View
218
Download
0
Category
Preview:
Citation preview
MINISTÉRIO DA EDUCAÇÃO E DESPORTOS
UNIVERSIDADE FEDERAL DE GOIÁS
INSTITUTO DE PATOLOGIA TROPICAL E
SAÚDE PÚBLICA
Luiz Fernando Nunes Rocha
Caracterização morfológica, molecular e biológica de fungos
patogênicos a invertebrados dos Cerrados de Goiás
Orientador: Dr. W. Christian Luz
Co-Orientador: Dr. André Kipnis
Tese de Doutorado
Goiânia-GO, 2010
Termo de Ciência e de Autorização para Disponibilizar as Teses e Dissertações Eletrônicas (TEDE) na Biblioteca Digital da UFG
Na qualidade de titular dos direitos de autor, autorizo a Universidade Federal de Goiás–UFG a disponibilizar gratuitamente através da Biblioteca Digital de Teses e Dissertações – BDTD/UFG, sem ressarcimento dos direitos autorais, de acordo com a Lei nº 9610/98, o documento conforme permissões assinaladas abaixo, para fins de leitura, impressão e/ou download, a título de divulgação da produção científica brasileira, a partir desta data.
1. Identificação do material bibliográfico: [ ] Dissertação [ X ] Tese
2. Identificação da Tese ou Dissertação Autor(a): Luiz Fernando Nunes Rocha CPF: 923.302.401-63 E-mail: luizfnr@hotmail.com Seu e-mail pode ser disponibilizado na página? [ X ]Sim [ ] Não
Vínculo Empregatício do autor Agência de fomento: Coordenação de Aperfeiçoamento de Pessoal de Nível Superior Sigla: Capes País: Brasil UF:GO CNPJ: Título: Caracterização morfológica, molecular e biológica de fungos patogênicos a invertebrados
isolados dos Cerrados de Goiás
Palavras-chave: Controle biológico, Hypocreales, triatomíneos, biologia molecular, morfologia Título em outra língua: Morphological, molecular and biological characterization of invertebrate
pathogenic fungi isolated from the Cerrado in Goiás
Palavras-chave em outra língua: Biological control, Hypocreales, triatomines, molecular biology, morphology
Área de concentração: Parasitologia Data defesa: (dd/mm/aaaa) 23/02/2010 Programa de Pós-Graduação: Medicina Tropical e Saúde Pública Orientador(a): Wolf Christian Luz CPF: 695.616.641-00 E-mail: wchrisluz@hotmail.com Co-orientador(a): André Kipnis CPF: 075.965.498-02 E-mail: akipnis@iptsp.ufg.br
3. Informações de acesso ao documento: Liberação para disponibilização?1 [ ] total [ X ] parcial Em caso de disponibilização parcial, assinale as permissões: [ X ] Capítulos. Especifique: Título, resumo, abstract, justificativa, introdução, conclusão, bibliografia da tese [ ] Outras restrições: artigo I - Occurrence of invertebrate-pathogenic fungi in a Cerrado
ecosystem inCentral Brazil - Manuscrito I (Morphology and Molecular Phylogeny of some Evlachovaea-like Fungi from the Central Brazilian Cerrado and their activity against Triatoma infestans) e Manuscrito II (Occurrence of Metarhizium spp. from Central Brazilian and their activity against Triatoma infestans)
Havendo concordância com a disponibilização eletrônica, torna-se imprescindível o envio do(s) arquivo(s) em formato digital PDF ou DOC da tese ou dissertação.O Sistema da Biblioteca Digital de Teses e Dissertações garante aos autores, que os arquivos contendo eletronicamente as teses e ou dissertações, antes de sua disponibilização, receberão procedimentos de segurança, criptografia (para não permitir cópia e extração de conteúdo, permitindo apenas impressão fraca) usando o padrão do Acrobat. ________________________________________ Data: 08 / 03 / 2010
Assinatura do(a) autor(a)
1 Em caso de restrição, esta poderá ser mantida por até um ano a partir da data de defesa. A extensão deste prazo suscita justificativa junto à coordenação do curso. Todo resumo e metadados ficarão sempre disponibilizados.
UNIVERSIDADE FEDERAL DE GOIÁS
INSTITUTO DE PATOLOGIA TROPICAL E
SAÚDE PÚBLICA
PROGRAMA DE PÓS-GRADUAÇÃO EM
MEDICINA TROPICAL E SAÚDE PÚBLICA
Luiz Fernando Nunes Rocha
Caracterização morfológica, molecular e biológica de fungos
patogênicos a invertebrados dos Cerrados de Goiás
Orientador: Dr. W. Christian Luz
Co-Orientador: Dr. André Kipnis
Tese apresentada ao programa de Pós
Graduação em Medicina Tropical do Instituto
de Patologia Tropical e Saúde Pública da
Universidade Federal de Goiás como requisito
parcial para obtenção do grau de Doutor em
Medicina Tropical − Área de Concentração:
Parasitologia.
GOIÂNIA-GO, 2010
Dados Internacionais de Catalogação na Publicação (CIP) GPT/BC/UFG
R672c
Rocha, Luiz Fernando Nunes.
Caracterização morfológica, molecular e biológica de fungos patogênicos a invertebrados dos Cerrados de Goiás [manuscrito] / Luiz Fernando Nunes Rocha. - 2010.
82 f. : figs, tabs. Orientador: Prof. Dr. W. Christian Luz; Co-Orientador: Prof. Dr.
André Kipnis. Tese (Doutorado) – Universidade Federal de Goiás,
Instituto de Patologia Tropical e Saúde Pública, 2010. Bibliografia: f. 70-81.
1. Controle biológico 2. Hypocreales 3. Triatomíneos 4. Biologia molecular – Morfologia – I.Título CDU: 582.28:592
Agradecimentos
Agradeço a todos que de alguma forma colaboraram para a realização deste trabalho,
em especial:
Ao Dr. Christian Luz, Professor do Departamento de Microbiologia, Imunologia,
Parasitologia e Patologia (DMIPP), Setor de Parasitologia do Instituto de Patologia Tropical
e Saúde Pública (IPTSP) da Universidade Federal de Goiás (UFG), pela orientação.
Ao Dr. André Kipnis, Professor do DMIPP, Setor de Microbiologia do IPTSP da UFG,
pela co-orientação.
Ao Dr. Richard A. Humber, pesquisador do Robert W. Holley Center for Agriculture
and Health, Ithaca, NY, USA, pelo caloroso recebimento em seu laboratório, envio e apoio na
identificação morfológica de fungos.
A Karen S. Hansen e Micheal M. Wheeler, do mesmo instituto, pelo apoio.
Ao Dr. Peter W. Inglis, pesquisador da Embrapa Recursos Genéticos e Biotecnologia,
Brasília, DF, pela importante ajuda na caracterização molecular de fungos.
Ao Dr. Marcos R. Faria, pesquisador da Embrapa Recursos Genéticos e Biotecnologia,
Brasília, DF, pelo envio de isolados de fungos.
Ao Dr. Ionizete G. Silva, Professor do DMIPP, Setor de Parasitologia do IPTSP da
UFG, pela disponibilização de insetos vetores.
A Regiane O. Silva, Genésio P. S. Neto e Martin Unterseher pelo auxílio nas coletas de
substratos e isolamento de fungos.
Ao IBAMA e ao Jeremias Lunardelli, proprietário da Fazenda Santa Branca, pela
permissão para coleta de substratos.
Ao IPTSP e ao Programa de Pós-Graduação em Medicina Tropical e Saúde Pública da
UFG, pela oportunidade.
À Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) pela bolsa
concedida.
Ao Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) pelo
auxílio financeiro.
Ao Setor de Parasitologia e aos colegas do Laboratório de Patologia de Invertebrados
em especial à Professora Dra. Adelair Helena dos Santos, pela ajuda.
À equipe do Laboratório de Bacteriologia Molecular pela receptividade e auxílio.
Aos meus pais e irmãos, pelo apoio e incentivo.
À minha esposa Wanessa, pela força, compreensão e apoio.
i
Sumário
Agradecimentos ............................................................................................................ i
Resumo ......................................................................................................................... iii
Abstract ........................................................................................................................ v
Justificativa................................................................................................................... 1
Introdução/Revisão bibliográfica ................................................................................. 3
1- Importância de invertebrados na saúde humana .......................................... 3
1.1- Artrópodes vetores ........................................................................ 3
1.1.1- Triatomíneos e a doença de Chagas ............................... 3
1.1.2- Culicídeos transmissores de doenças ............................. 4
1.1.3- Carrapatos de importância na saúde humana ................. 5
1.2- Moluscos hospedeiros intermediários de helmintos ..................... 6
2- Controle de invertebrados ........................................................................... 7
2.1- Controle clássico .......................................................................... 7
2.2- Controle microbiano ..................................................................... 8
2.2.1- Fungos ........................................................................... 9
3- Cerrado ........................................................................................................ 11
4- Isolamento de fungos .................................................................................. 11
5- Identificação e caracterização de fungos .................................................... 12
Objetivos ..................................................................................................................... 14
Artigo: Occurrence of invertebrate-pathogenic fungi in a Cerrado ecosystem in
Central Brazil ....................................................................................................... 15
Manuscrito 1: Morphology and Molecular Phylogeny of some Evlachovaea-like Fungi
from the Central Brazilian Cerrado and their activity against Triatoma infestans 22
Manuscrito 2: Occurrence of Metarhizium spp. from Central Brazil and their activity
against Triatoma infestans ................................................................................... 51
Conclusões .................................................................................................................. 64
Bibliografia ................................................................................................................. 65
Anexo do artigo I ........................................................................................................ 77
ii
Resumo
A grande biodiversidade de fungos patogênicos para invertebrados e o potencial desses
patógenos para controle de pragas até hoje pouco conhecido ressaltam a importância de se
procurar por novas espécies e linhagens eficazes. O Cerrado é considerado um dos “hotspots”
de biodiversidade e pouco se sabe sobre a ocorrência e a atividade de fungos patogênicos para
invertebrados encontrados neste bioma. No presente trabalho foi realizado levantamento de
fungos em diferentes áreas do Cerrado de Goiás. Foram coletadas amostras de substrato,
sedimento, água e insetos moribundos ou mortos para o isolamento de fungo. Vetores de
importância médica como triatomíneos (Triatoma infestans e Rhodnius neglectus), mosquitos
(Aedes aegypti e Culex quinquefasciatus), carrapato (Riphicephalus (Boophilus) microplus) e
caramujo (Biomphalaria glabrata), foram usados como isca para isolamento de fungos. Após o
isolamento de fungos eles foram identificados morfologicamente e incluídos na coleção do
Instituto de Patologia Tropical e Saúde Pública, Universidade Federal de Goiás. Para alguns
isolados de Evlachovaea e Metarhizium foram realizados uma caracterização molecular e teste
de atividade contra T. infestans. Um total de 561 amostras de solo (440), sedimento (106) e
água (15) foi coletado em diferentes áreas do Estado de Goiás. Das amostras coletadas na
Fazenda Santa Branca, foram obtidos 68 isolados de fungos patogênicos que foram
identificados como pertencentes aos gêneros Aspergillus, Beauveria, Cladosporium,
Evlachovaea, Fusarium, Gliocladium, Isaria, Lecanicillium, Metarhizium, Paecilomyces,
Pochonia e Trichoderma. Das outras áreas de coletas foram detectados 106 isolados de
Metarhizium spp. e 6 de Evlachovaea spp., sendo 65 isolados de Metarhizium e 1 de
Evlachovaea do Parque Nacional das Emas, 33 e 1 da região Nordeste do Estado de Goiás, e 8
e 4 da Floresta Nacional de Silvânia, respectivamente. A maioria dos fungos foi isolada de
solos utilizando triatomíneos como isca. Em insetos coletados mortos e com desenvolvimento
fúngico foram identificados fungos dos gêneros Aschersonia, Batkoa, Beauveria, Cordyceps,
Evlachovaea, Fusarium, Lecanicillium, Pandora e Torrubiella. Todos os isolados de
Metarhizium spp. e Evlachovaea spp. testados induziram alta mortalidade em T. infestans em
umidade relativa (UR) perto da saturação. O valor mais baixo de tempo letal de 90% foi de 6,6
d (6,3 – 7,1 (M. robertsii IP 34)) e 7,1 d (6,7 – 7,8 (Evlachovaea IP 141)), após tratamento de
T. infestans e exposição à UR > 98%. A concentração letal de 50% (CL50) do IP 34 foi de
2,8x103 (I.C. 4,4 x102-4,6x103) e o CL90 foi de 7,2x103 (I.C. 4,4x103-6,4x105) CFU/cm2 aos 10
d após inoculação. Em UR de 75% a mortalidade dos triatomíneos não ultrapassou 20%.
Estudos morfológicos e o seqüênciamento da região ITS e TEF dos isolados de Evlachovaea
mostraram que o gênero Evlachovaea deve ser sinonimizado com Isaria, sendo que o maior
grupo de isolados previamente identificados como Evlachovaea são I. cateniannulata e o
iii
menor grupo é provavelmente uma nova espécie de Isaria. O seqüênciamento das regiões TEF
e ITS mostrou que os isolados de Metarhizium são pertencentes às espécies de M. anisopliae,
M. robertsii, M. flavoviride var. pemphigi e o maior grupo de isolados podem ser uma nova
espécie Metarhizium ou uma variedade de M. anisopliae. Os resultados confirmaram que nos
Cerrados estão presentes uma alta diversidade de fungos e alguns deles, em especial M.
robertsii (IP 34) e Evlachovaea (IP 141), têm potencial para o controle biológico de T.
infestans.
iv
Abstract
The high biodiversity of fungi pathogenic to invertebrates and their potential to control
pests until today not well known emphasize the importance to look for new effective species
and strains. The Cerrado is considered one of the “hotspots” of biodiversity and little is known
about the occurrence and the potential of fungi pathogenic to invertebrates found in this biome.
In the present study a survey of fungi was carried out in different areas of the Cerrado of Goiás.
Samples of soil, slurry, water and moribund or dead insects were collected for isolation of
fungi. Vectors of medical importance such as triatomines (Triatoma infestans and Rhodnius
neglectus), mosquitoes (Aedes aegypti and Culex quinquefasciatus), ticks (Riphicephalus
(Boophilus) microplus) and snails (Biomphalaria glabrata) were used as baits for isolation of
fungi. After isolation fungi were morphologically identified and included in the collection of
Institute of Tropical Pathology and Public Health, Federal University of Goiás. Some isolates
of Evlachovaea and Metarhizium were molecularly characterized and activity tested against T.
infestans. A total of 561 samples of soil (440), slurry (106) and water (15) was collected in
different areas of Goiás State. Concerning samples collected at Fazenda Santa Branca, 68
isolates of pathogenic fungi were obtained and identified as belonging to the genera
Aspergillus, Beauveria, Cladosporium, Evlachovaea, Fusarium, Gliocladium, Isaria,
Lecanicillium, Metarhizium, Paecilomyces, Pochonia and Trichoderma. An total of 106
isolates of Metarhizium spp. and 6 of Evlachovaea spp. were sampled in other areas, being 65
isolates of Metarhizium and 1 of Evlachovaea from the Ema National Park, 33 and 1 from the
Northern portion of Goiás state, and 8 and 4 from the Silvânia National Forest, respectively.
Most fungi were isolated from soils using triatomines as baits. Fungi from genera Aschersonia,
Batkoa, Beauveria, Cordyceps, Evlachovaea, Fusarium, Lecanicillium, Pandora and
Torrubiella were isolated from mycosed cadavers. All tested isolates of Metarhizium spp. and
Evlachovaea spp. induced high mortality of T. infestans in relative humidity (RH) close to
saturation. The lowest values for lethal time of 90% were 6.6 d (6.3 – 7.1 d; M. robertsii IP 34)
and 7.1 d (6.7 – 7.8 d; Evlachovaea IP 141), after treatment of T. infestans and exposure to RH
> 98%. The lethal concentration to obtain 50% mortality (LC50) of IP 34 was 2.8x103 (C.I. 4.4
x102-4.6x103) and the LC90 was 7.2x103 (C.I. 4.4x103-6.4x105) CFU/cm2 at 10 d p.i. In RH
75% mortality of triatomines did not exceed 20%. Morphological studies and sequencing of the
ITS and TEF region of Evlachovaea isolates showed that genus Evlachovaea must be
synonymized with Isaria, and that the largest group of isolates previously identified as
Evlachovaea are I. cateniannulata, whereas the smaller group is probably a new species of
Isaria. The sequencing of the TEF and ITS regions showed that Metarhizium isolates belong to
species M. anisopliae, M. robertsii, M. flavoviride var. pemphigi, and the largest group of
v
Metarhizium isolates can be a new species of Metarhizium or a M. anisopliae variety. The
results confirmed that in the Cerrado a high diversity of fungi is present and some of them, in
special M. robertsii (IP 34) and Evlachovaea (IP 141) have potential for biological control of
T. infestans.
vi
Justificativa
As diferentes áreas tropicais dispõem de um grande número de microrganismos
patogênicos para invertebrados, cuja uma grande parte ainda é desconhecida do homem. Estes
organismos e seus metabólitos secundários, com atividade tóxica, têm grande utilidade para o
controle biológico de pragas encontradas no Brasil. A utilização de microrganismos
patogênicos, como fungos, bactérias e vírus, abriu novos caminhos para o controle de
invertebrados nocivos nas áreas agrária, médica e veterinária (Alves & Lopes 2008).
Uma das vantagens de fungos em relação aos outros microrganismos, é a invasão do
hospedeiro através da cutícula e não por via oral (Lacey & Goettel, 1995). Além disso, existem
fungos de largo espectro e capazes de colonizar diferentes estágios de desenvolvimento de
invertebrados (Alves & Lopes 2008). Mesmo diante do grande potencial de fungos para o
controle biológico, esses microrganismos ainda são pouco empregados quando comparados
com pesticidas químicos. Contudo, o interesse em estudar e utilizar fungos no controle
biológico no Brasil e em outros países aumentou consideravelmente nas últimas décadas
(Alves & Lopes 2008). Aproximadamente 130 micopesticidas comerciais estão sendo
produzidos e comercializados em mais de 25 países (Faria & Wraight 2007). Para o combate de
artrópodes, as principais espécies utilizadas são fungos cosmopolitas como Beauveria bassiana
e Metarhizium anisopliae. Na América Latina, o Brasil destaca-se na produção e utilização de
micoinseticidas para o combate de pragas agrícolas (Faria & Wraight 2007, Alves & Lopes
2008). Em 2006, o faturamento no Brasil com produtos à base de fungos atingiu
aproximadamente U$ 10 milhões (Alves & Lopes 2008). Porém, ainda pouco se sabe sobre a
utilidade desses ou de outros fungos para o combate de invertebrados vetores.
Algumas espécies de fungos dos gêneros Beauveria, Metarhizium, Isaria e Hirsutella,
dentre outros, já foram testadas em condições de laboratório contra importantes vetores como
triatomíneos, mosquitos e carrapatos (Luz et al. 1998 a, b, 2003 b, Scholte et al. 2004,
Fernandes & Bittencourt 2008). Porém, em condições de campo, poucos testes foram
realizados e os resultados obtidos não foram tão satisfatórios como em laboratório (Fernandes
& Bittencourt 2008).
O desenvolvimento de produtos à base de novos fungos com maior atividade e melhor
adaptação às condições ambientais onde esses produtos serão aplicados é de extrema
importância na consolidação de um controle de vetores à base de fungos. Para isso se fazem
necessários novos levantamentos de fungos em regiões onde se pretenda utilizá-los.
Fungos patogênicos são isolados diretamente de indivíduos infectados, vivos ou mortos,
ou indiretamente, de substratos contaminados utilizando invertebrados como isca ou meios
seletivos (Almeida & Filho 2001, Luz et al. 2007 a, Rocha & Luz 2009). A utilização de
invertebrados vetores como isca permite um isolamento mais específico enquanto meios
seletivos ou semi-seletivos são empregados para isolamento mais generalizado de fungos.
Poucos trabalhos sobre isolamento de novas espécies e linhagens de microrganismos foram
realizados nos diferentes biomas do Brasil (Shimazu et al. 1994, Luz et al. 2004 a, Monnerat et
al. 2005, Silva et al. 2004). O Cerrado é o segundo maior bioma brasileiro com
aproximadamente 2 milhões de km2 (Klink & Machado 2005) e considerado um dos “hotspots”
de biodiversidade em todo mundo (Myers et al. 2000). Novas prospecções de fungos em áreas
não antropisadas do Cerrado e testes sobre a atividade de novos isolados contra vetores irão
contribuir para um maior conhecimento sobre a ocorrência e o potencial de fungos patogênicos
para invertebrados encontrados no Cerrado.
A identificação rotineira e classificação de fungos são baseadas em características
morfológicas, nem sempre objetivas. Técnicas moleculares, em especial o seqüênciamento de
genes, têm proporcionado resultados mais seguros na identificação, taxonomia e filogenia de
fungos (Driver et al. 2000, Luangsa-ard et al. 2005, Rehner & Bucckley 2005, Bischoff et al.
2006, 2009). Várias novas sub-espécies, espécies e gêneros de fungos patogênicos para
invertebrados foram propostos desde então (Driver et al. 2000, Luangsa-ard et al. 2005,
Bischoff et al. 2006, 2009). Desta forma, para uma identificação mais precisa de fungos
encontrados no Cerrado faz-se necessário combinar estudos morfológicos com o
seqüênciamento de genes.
O vetor clássico da doença de Chagas no Cone Sul, T. infestans, após campanhas
intensas de combate é considerado erradicado em muitas regiões, inclusive no Centro-Oeste
brasileiro (Dias et al. 2002). Porém, já foram encontradas áreas re-infestadas por T. infestans e
casos de resistência deste vetor a inseticidas em regiões da Argentina e Bolívia (Audino et al.
2004, Picollo et al. 2005, Cécere et al. 2006, Orihuela et al. 2008). Para combates a esse vetor
faz-se necessário a utilização de novos produtos mais eficientes e, de preferência, menos
agressivos ao meio ambiente e ao homem. Nessa perspectiva, micoinseticidas destacam-se
como alternativa ao combate de triatomíneos. Isolados fúngicos altamente virulentos para
triatomíneos poderiam ser empregados no controle integrado deste vetor.
2
Introdução/Revisão Bibliográfica
1- Importância de invertebrados na saúde humana
Os invertebrados são um grupo do reino Animalia formado por espécies que não
possuem coluna vertebral. São seres pluricelulares, possuem tecidos especializados, vivem
como organismos heterotróficos e constituem mais de 90% das espécies de animais descritas.
Esses animais estabelecem uma grande diversidade de relações com outros animais, incluindo
o homem. Na área de saúde, alguns invertebrados como moluscos, carrapatos e especialmente
insetos têm grande importância por serem transmissores de patógenos ou parasitos para o
homem e outros vertebrados.
A classe Insecta constitui um dos grupos mais bem-sucedidos do reino Animalia e
indivíduos pertencente a essa classe podem ser encontrados em quase todos os ecossistemas do
planeta. Os insetos são caracterizados por possuírem cabeça, tórax e abdome distintos, três
pares de patas articuladas, peças bucais externas, por terem onze ou menos segmentos
abdominais e 2, 1 ou nenhum pares de asas. Esta classe contém vetores importantes, sobretudo
culicídeos, outros dípteros, triatomíneos, pulgas e piolhos.
1.1- Artrópodes vetores
1.1.1- Triatomíneos e a doença de Chagas
Triatomíneos são insetos hemimetabólicos que possuem três estágios de
desenvolvimento: ovo, ninfa e adulto. As ninfas se diferenciam dos adultos por não possuírem
asas e por não serem capazes de se reproduzir. A maioria destes insetos tem hábito noturno
exercendo a hematofagia desde eclosão das ninfas até adulto, tanto os machos como as fêmeas.
Já foram descritas mais de 130 espécies que são classificadas em 6 tribos e 19 gêneros. Com
exceção do gênero Linshcosteus e algumas espécies do gênero Triatoma, todos os outros
triatomíneos ocorrem exclusivamente no continente americano, desde a Argentina até os
Estados Unidos da América. Nas Américas são transmissores de Trypanosoma cruzi, agente
etiológico da doença de Chagas. Mais de 12 milhões de pessoas estão infectadas com o
protozoário e outras 28 milhões vivem em áreas de risco (Dias et al. 2008). Atualmente, a
doença de Chagas é endêmica em 28 países. A maioria dos triatomíneos é silvestre e associada
com uma ampla variedade de hospedeiros vertebrados, que servem como reservatório do
parasito. Algumas espécies adaptaram-se a ambientes peridomiciliares ou domiciliares e têm
papel importante como transmissores de T. cruzi para o homem e animais domésticos. No sul
da América Latina o vetor clássico intradomiciliar, Triatoma infestans, com vasta distribuição
e densidades elevadas, após campanhas intensas de combate é considerado erradicado em
3
muitas regiões do Cone Sul, inclusive no Centro-Oeste brasileiro (Dias et al. 2002). Porém, já
foram encontradas áreas re-infestadas por T. infestans e casos de resistência deste vetor a
inseticidas químicos em regiões da Argentina e Bolívia (Audino et al. 2004, Picollo et al. 2005,
Cécere et al. 2006, Orihuela et al. 2008). Além disso, espécies peridomiciliares e silvestres
estão invadindo e ocupando ambientes domiciliares e a transmissão vetorial dessa doença,
mesmo sendo baixa atualmente, não está banida. Espécies como Triatoma sordida, Triatoma
brasiliensis, Triatoma dimidiata, Triatoma pseudomaculata, Panstrongylus rufotuberculatus,
Rhodnius nasutus, Rhodnius negletus, Rhodnius stali, Eratyrus mucronatus e outras já foram
encontradas no interior de casas (Noireau et al. 1995; Dujardin et al. 1998, 2000; Schofield et
al. 1999; Matias et al. 2003). No estado de Goiás, R. neglectus, T. sordida, Triatoma williami e
Triatoma costalimai são espécies com alta adaptação domiciliar comprovada (Silveira et al.
1984; Silva et al. 1992).
1.1.2- Culicídeos transmissores de doenças
Os culicídeos são insetos holometabólicos que possuem quatro estágios distintos: ovo,
larva, pupa e adulto. Dependendo da espécie, ocorrem em ambientes silvestres, rurais ou
urbanos. Somente as fêmeas são hematófagas e responsáveis pela transmissão de diversos
agentes como vírus, protozoários e helmintos. Os três gêneros de maior importância são
Anopheles, Aedes e Culex.
Aedes aegypti é uma espécie de origem africana que atualmente está presente em quase
todos países das regiões tropicais e subtropicais. As fêmeas são sinantrópicas, adaptadas a
ambientes urbanos, e apresentam hábitos alimentares diurnos. Os criadouros localizam-se em
ambientes intra e peridomiciliares em pequenas coleções de água pobres em matéria orgânica e
sais. A. aegypti é o principal vetor dos vírus da dengue e da febre amarela urbana (FAU) no
mundo. Nas últimas décadas os casos de dengue aumentaram devido à alta dispersão
geográfica tanto do vírus como do mosquito (Gubler 2005). Atualmente a dengue é endêmica
em pelo menos 100 países e cerca de 2,5 bilhões de pessoas vivem em áreas de risco (WHO
2007). Estima-se que a cada ano 50 milhões de pessoas contraiam a dengue em todo mundo.
Dessas, cerca de 400 mil desenvolvem para dengue hemorrágica e o número de mortos é de
aproximadamente 24 mil pessoas (WHO 2002, 2007). A dengue é uma das arboviroses mais
importantes por estar associada a aglomerações urbanas e apresentar peculiaridades que
dificultam o desenvolvimento de vacinas e medicamentos (Yasui 1993, Khin et al. 1994). No
Brasil, Ae. aegypti tem grande importância devido a sua vasta distribuição, elevada densidade,
pela alta transmissão da dengue e pelo risco da transmissão e reurbanização da febre amarela.
Apesar da existência de vacina contra o vírus amarílico, a cada ano são relatados casos de febre
4
amarela na América do Sul e África. A febre amarela é endêmica em 33 países da África e 11
da América do Sul (WHO 2005, Barrett & Higgs 2007).
Culex quinquefasciatus é encontrado em regiões tropicais e sub-tropicais. Essa espécie
é o maior perturbador do repouso noturno humano. Além disso, transmite a Wuchereria
bancrofti, agente etiológico da filariose linfática humana. A espécie é altamente sinatrópica e
associada a aglomerados urbanos e rurais. Procria principalmente em água com matéria
orgânica em decomposição. Nas Américas, as fêmeas alimentam-se nas horas mais avançadas
da noite, coincidindo com a presença de microfilárias de W. bancrofti no sangue periférico. No
Brasil, focos endêmicos existem até hoje principalmente no litoral norte e nordeste. A
prevalência da filariose linfática aumentou em países de clima tropical e subtropical úmido,
principalmente pela expansão não planejada da urbanização em áreas endêmicas. Estima-se em
cerca de 120 milhões o número de pessoas parasitadas em todo mundo. No Brasil, esse número
é de aproximadamente, 49 mil pessoas e mais de 3 milhões moram em áreas de risco com focos
endêmicos nas regiões norte e nordeste (Medeiros et al. 2004).
Os mosquitos do gênero Anopheles são encontrados em todo mundo exceto em regiões
polares. Têm hábitos essencialmente silvestres, porém existem espécies adaptadas a ambientes
peridomiciliares e domiciliares. Seus criadouros são pequenos e médios cursos de água e em
imbricamento de folhas. A maioria das fêmeas realiza a hematofagia durante o dia
apresentando diferenças nos picos de atividade em função da espécie. Os anofelinos são os
vetores de maior importância na área de saúde por transmitirem Plasmodium spp., agentes
etiológicos da malária. A malária é a doença parasitária que acomete o maior número de
pessoas em todo o mundo. Só em 2006 foi estimado que 247 milhões de pessoas contraíram
essa parasitose. Destes, 212 milhões foram provenientes da África. A mortalidade foi de
aproximadamente um milhão de pessoas, sendo a maioria crianças com menos de 5 anos
(WHO 2008). Segundo relatório da Organização Mundial da Saúde (OMS), 109 países foram
considerados endêmicos para malária com 45 pertencendo ao continente africano. Atualmente,
cerca de 3,3 bilhões de pessoas moram em áreas de risco (WHO 2008). Das 40 espécies de
anofelineos, a principal espécie vetora é A. Gambiae, responsável pela maioria dos casos de
transmissão na África. No Brasil, a principal espécie é o A. darlingi, mosquito altamente
suscetível aos Plasmodium spp. Esta espécie apresenta acentuada sinantropia, sendo que as
fêmeas podem atacar o homem em áreas peridomiciliares, mas preferem fazê-lo dentro das
casas, principalmente ao crepúsculo vespertino e matutino.
1.1.3- Carrapatos de importância na saúde humana
5
Os carrapatos são artrópodes incluídos na ordem Acari, classe Arachnida, pertencentes
principalmente às famílias Ixodidae e Argasidae. São artrópodes com fases larval, ninfal e
adulta que possuem o corpo fundido, achatado dorsoventralmente, dividido em falsa cabeça ou
gnatossoma e idiossoma. As larvas são hexápodas, enquanto as ninfas e adultos possuem oitos
patas. Ambos machos e fêmeas são ectoparasitas hematófagos, responsáveis pela transmissão
de vírus, bactérias e protozoários para o homem e outros animais. Depois dos mosquitos, os
carrapatos são os principais artrópodes vetores de doenças (Dennis & Piesman 2005). Dentre as
doenças humanas transmitidas por carrapatos destacam-se a febre maculosa, doença de Lyme,
tifo exantemático americano, tularemia, ehrlichiose, borreliose, babesiose, entre outras
(Vranjac 2002, Charrel et al. 2004, Rodgers & Mather 2007, Ahantarig et al 2008). As espécies
de carrapatos Amblyomma cajennense, Rhipicephalus sanguineus, R. (Boophilus) microplus e
Dermatocentor nitens são as mais encontradas no Brasil e responsáveis por grandes prejuízos,
tanto no meio veterinário quanto na área médica humana (Lemos et al. 2002, Martins et al.
2004, Neves 2005). No Brasil, a principal doença transmitida ao homem por carrapato é a febre
maculosa brasileira, na qual o agente etiológico é a bactéria Rickettsia rickettsii do grupo da
febre maculosa. Os homens são hospedeiros acidentais, não são considerados reservatórios da
doença e não colaboram com a propagação do agente. Os primeiros casos no Brasil datam de
1929 no Estado de São Paulo; a partir desse ano, ocorreram casos em outros estados,
principalmente do suldeste brasileiro (Vranjac 2002).
1.2- Moluscos hospedeiros intermediários de helmintos
O filo Mollusca é o segundo maior filo do reino Animalia, com mais de 80 mil
espécies. Os moluscos têm o corpo mole circundado por uma formação carnosa denominada de
manto. Tipicamente apresentam uma cabeça anterior, boca com rádula e pé ventral. A classe
Gastropoda é a mais importante na área de saúde humana. A maioria dos trematódeos
digenéticos exige gastrópodes como hospedeiros intermediários durante a fase larval. Oito
trematódeos são causadores de importantes doenças para o homem em todo o mundo:
Schistosoma mansoni, S. haematobium, S. japonicum, Clonorchis sinensis, Fasciolopsis buski,
Paragonimus westermani, Opistorchis tenuicollis e Heterophyes heterophyes.
No Brasil, os caramujos com importância na transmissão de doenças são do gênero
Biomphalaria e Lymnaea. Já foram identificadas dez espécies de Biomphalaria no país. Porém,
apenas B. glabrata, B. tenagophila, B. straminea foram encontradas eliminando cercárias de S.
mansoni no meio ambiente. A esquistossomose é uma doença parasitária que afeta
aproximadamente 200 milhões de pessoas em países tropicais e subtropicais e mais de 600
milhões de pessoas vivem em áreas de risco (WHO 2006). A cada ano, mais de 100 mil casos
6
de esquistossomose são identificados no Brasil, sendo a região nordeste seguido da sudeste as
áreas com mais casos desta doença (Ministério da Saúde, site). Lymnaea columela e L. viatrix
são os principais hospedeiros intermediários de Fasciola hepatica. A importância da fasciolose
humana aumentou nas últimas décadas, com um crescente número de casos (Mas-Coma et al.
1999). No Brasil, os casos desta doença são restritos a algumas regiões nos Estados do Sul
sendo que a fasciolose animal está em expansão e com isso aumenta a chance da transmissão
para o homem (Guimarães 2005).
2- Controle de invertebrados
2.1- Controle clássico
Há décadas, produtos sintéticos são a principal forma de combate a invertebrados
vetores. Primeiros inseticidas utilizados para o combate de mosquitos e triatomíneos foram o
DDT, hexaclorocicloexano (BHC), dieldrin e outros organoclorados, a partir de 1945
(Hemingway & Ranson 2000, Aché & Matos 2001). Em 1955, a OMS recomendou o uso do
DDT para a erradicação global da malária através da borrifação em domicílios. Entretanto,
logo após a euforia inicial foram registrados os primeiros casos de resistência de anofelinos ao
DDT. Logo depois, outros mosquitos também foram encontrados resistentes aos inseticidas
(Hemingway & Ranson 2000). Muitos organoclorados foram então retirados do mercado por
afetar a saúde do homem e de animais, e por serem altamente agressivos ao meio ambiente
(D’Amato et al. 2002). Novas classes de inseticidas sintéticos constituídas por
organofosforados, carbamatos e piretróides foram desenvolvidas para obter produtos mais
seguros e eficazes. Porém, a utilização indiscriminada desses sintéticos agravou o desequilíbrio
ambiental e o número de casos de resistência não deixou de crescer em mosquitos (Karunaratne
& Hemingway 2001, Alexander & Maroli 2003, Somboon et al. 2003) e triatomíneos (Zerba
1999, Vassena et al. 2000, Audino et al. 2004).
A resistência de artrópodes a inseticidas químicos ocorre por mecanismos
comportamentais e fisiológicos (Roberts & André 1994, Brogdon & McAllister 1998). No
primeiro caso, um artrópode muda de comportamento e evita assim um contato com o produto.
A resistência fisiológica aparece com a síntese de enzimas específicas como esterases,
glutathione s- transferase ou monooxygenases pelos insetos que desativam o inseticida
(Hemingway et al. 2004). Essas enzimas têm sido relatadas atuando em organoclorados,
organofosforados, piretróides e carbamatos (Hemingway & Ranson 2000). A resistência foi
encontrada também após substituição de aminoácidos chaves no sítio de ligação do inseticida
por outros impedindo a ligação específica e atuação do inseticida (Brengues et al. 2003).
Atualmente, a maioria dos estudos sobre o controle de carrapatos está ligado a espécies
7
que têm importância na pecuária. O controle destes e de outros carrapatos está relacionado ao
uso de acaricidas sintéticos de contato, pour on e sistêmicos. Vários produtos acaricidas à base
de organofosforados, carbamatos, amidinas, piretróides, fenil pirazol, avermectinas,
benzofeniluréias, dentre outros, são aplicados para o combate desses artrópodes e, em todo
mundo, já foram encontradas populações de carrapatos resistentes aos diferentes acaricidas
(Martins et al 2001, George et al. 2004, Graf et al. 2004, Saueressig TM 2006, Mendes et al.
2007).
Moluscicidas têm sido usados para o controle de caramujos vetores desde a década de
1950. Um dos primeiros produtos bastante utilizado no combate de Biomphalaria spp. foi
niclosamida, produzido com o nome comercial de Bayluscide, que também foi empregado para
o controle de Lymnaea spp. Este moluscicida sintético é efetivo contra todos os estágios de
desenvolvimento de Biomphalaria (Lowe et al. 2005). Porém, este produto causou efeito
nocivo contra plantas e animais não-alvo (Andrews et al. 1983) além de ser genotóxico e
cancerígeno (Vega et al. 1988). O alto custo, a possibilidade de recolonização dos caramujos e
a toxicidade deste produto são fatores limitantes para o seu uso em programas oficiais de
controle de moluscos de importância na saúde (Pierre 1995, Sarquis et al. 1997, 1998, Mello-
Silva et al. 2006). Outros produtos têm sido estudados e utilizados para o controle de
caramujos vetores (Singh & Agarwal 1991, Xiaonong et al. 2002, Tantawy 2006).
2.2- Controle microbiano
Devido à preocupação sobre casos de resistência de invertebrados a produtos sintéticos
e conscientização crescente sobre o risco destes químicos para o homem e o meio ambiente,
microrganismos patogênicos, estão sendo estudados no combate a invertebrados. Estes
patógenos são geralmente mais específicos do que produtos sintéticos e apresentam baixa ou
nenhuma toxidez para vertebrados e plantas (Whiteley & Schnepf 1986). Resultados sobre
atividade de bactérias contra insetos vetores, especialmente larvas de culicídeos, confirmaram a
utilidade destes microrganismos no controle biológico. As bactérias mais estudadas e utilizadas
são Bacillus thuringiensis israelensis (B.t.i.) e B. sphaericus (B.s.). Ambas bactérias tiveram
ação seletiva e rápida contra larvas de culidídeos e outros dípteros de importância em saúde
pública (Federici et al. 2003, Monnerat et al. 2005). A ação patogênica destas bactérias se deve
à produção de diferentes toxinas, como as toxinas de cristal, a MTX, entre outras (Charles et al.
1996, Polanczyk et al. 2003). A atuação conjunta e complexa destas toxinas reduz a
probabilidade de induzir resistência nas larvas (Regis et al. 2001). Tanto B.t.i. quanto B.s. já
são usados em programas de controle de mosquitos no Brasil (Regis et al. 2000, Lima et al.
8
2005). Porém, estudos recentes têm mostrado o surgimento de populações de larvas de
culicídeos mais resistentes à toxina de B.s. (Amorin et al. 2007, Chalegre et al 2009).
Outros microrganismos como os Baculovirus spp. estão sendo utilizados com sucesso
para combate de pragas agrícolas como Anticarsia gemmatalis que acomete plantações de soja
(Moscardi & Souza 2002). Porém, existem poucos estudos sobre atividade de vírus em vetores
como mosquitos e triatomíneos (Barreau et al. 1996, Muscio et al. 1997, 2000, Rozas-Dennis et
al. 2002). Esses insetos também são acometidos por vírus como Aedes albopictus Parvovirus e
Triatoma vírus, mas não se conhece isolados com alta virulência.
O principal mecanismo de infecção de invertebrados por vírus e bactérias patogênicos
para invertebrados é por via oral. Larvas de dípteros ou sifonápteros ingerem formas
infectantes com o alimento. Contudo, para combate de invertebrados hematófagos como
fêmeas adultas de dípteros, triatomíneos, ou carrapatos, esses microrganismos não são
indicados pois dificilmente seriam ingeridos por hematófagos. Outros patógenos como fungos
que invadem seus hospedeiros principalmente pela cutícula têm potencial para o combate
integrado desses vetores (Lacey & Goettel 1995).
2.2.1- Fungos
Os fungos constituem o segundo maior grupo de organismos eucariontes do planeta,
atrás apenas dos insetos (Rossman et al. 1998). Estima-se que existam 1,5 milhões de espécies
das quais mais de 700 são patogênicas para invertebrados e agrupados em 90 gêneros,
causando cerca de 80% das doenças de insetos e outros artrópodes (Glare & Milner 1991,
Hawksworth 1991, Destéfano et al. 2004). Praticamente nada se sabe sobre atividade
patogênica de fungos para moluscos com importância para saúde humana. Acredita-se que
menos de 5% dos fungos patogênicos para invertebrados foram descritos e caracterizados
(Hawksworth 1991). A grande biodiversidade de espécies e linhagens, com seus metabolitos
secundários tóxicos apresenta um potencial pouco conhecido para controle de vetores e outras
pragas (Butt & Goettel 2000; Inglis et al. 2001).
A invasão do hospedeiro pelo fungo inicia com a adesão de formas infectantes,
geralmente conídios, à cutícula. Durante a germinação de conídios muitos fungos formam,
além do tubo germinativo, um apressório na extremidade, que serve como apoio durante a
penetração da cutícula. Quando não há a formação de apressório , uma massa mucilaginosa ao
redor do tubo germinativo auxilia a manutenção do fungo sobre a cutícula e libera enzimas. A
penetração ocorre através de processos mecânicos e fisiológicos, como ação de enzimas. Após
a penetração, o fungo forma corpos hifais e dissemina-se na hemolinfa do hospedeiro.
Dependendo da virulência do fungo e da suscetibilidade do inseto a infecção pode levá-lo à
9
morte. Após a morte e em umidade favorável, novo micélio aparece sobre o cadáver e o fungo
produz conídios ou esporos que são disseminados pelo ambiente e contaminam novos
hospedeiros.
Fungos foram um dos primeiros patógenos de insetos utilizados para combate de pragas
agrícolas (Metchnikoff 1879). Nas últimas décadas o interesse pelo controle biológico de
invertebrados com fungos tem aumentado bastante. Contudo, a grande maioria dos estudos e
aplicações é relacionada ao controle de pragas agrícolas e existem poucos trabalhos sobre
fungos atuando em vetores de doenças humanas em condições de campo. Os três gêneros de
maior interesse para combate de estágios aquáticos de mosquitos são, Lagenidium,
Culicinomyces e Coelomomyces. Porém, até hoje foi desenvolvido um único produto à base de
L. giganteum, para combate de larvas de culicídeos (Scholte et al. 2004). Infelizmente, esse
produto (LaginexTM) foi comercializado por pouco tempo nos EUA é desde anos não está mais
disponível no mercado. A principal vantagem de L. giganteum para combate é sua alta
resistência em condições de campo. Conforme Federici (1995) é necessária apenas uma
aplicação por estação. Contudo, esta espécie como outros oomycetos não são mais
considerados pertencentes ao reino Fungi e estão agrupados no reino Straminipila (=
Chromista) (Alexopoulos et al. 1996, Hibbet et al. 2007). Recentes trabalhos mostraram que
outros fungos, que normalmente não ocorrem em habitats aquáticos, também têm atividade em
larvas e ovos de culicídeos (Scholte et al. 2004, Silva et al. 2004, 2005, Luz et al. 2007 b, 2008,
Albernaz et al. 2009, Santos et al. 2009).
Os primeiros testes sobre atividade de fungos em triatomíneos foram feitos na década
de 1960 (Dias & Leão 1967). Desde então, foram feitos vários estudos sobre o impacto de
fatores abióticos como umidade relativa e temperatura e de fatores bióticos como virulência
dos fungos, suscetibilidade ligada a espécie, estádio e interfase sobre a eficácia de fungos,
especialmente de Beauveria bassiana e M. anisopliae (Romaña & Fargues 1992, Luz et al.
1994, 1998 b, c, 1999, 2003 a, 2004 a, c, Lecuona 2001). Estes fungos já foram encontrados
em habitats peridomiciliares de triatomíneos (Luz et al. 2004 a). Existem também relatos sobre
ocorrência natural de B. bassiana em triatomíneos encontrados mortos em áreas rurais aa Índia
e Argentina (Parameswaran & Sankaran 1977, Marti et al. 2005) e de outra espécie patogênica
ainda não descritas do gênero Evlachovaea, encontrada sobre uma ninfa morta de T. sordida no
estado de Goiás (Luz et al. 2003 b). Estas observações confirmaram que fungos podem atuar
como inimigos naturais de triatomíneos. Em testes de campo, na proximidade de São Luís de
Montes Belos, no estado de Goiás, o número de T. sordida em áreas peridomiciliares diminuiu
claramente durante pelo menos 6 meses após aplicação de conídios formulados em óleo-água
10
de B. bassiana (Luz et al. 2004 b). Também foram encontrados indivíduos mortos com hifas e
conídios de B. bassiana na superfície da cutícula.
Fungos são relatados como os principais patógenos de carrapatos e atuam como
controladores de populações destes hospedeiros em condições de campo (Samish & Rehacek
1999). Fungos do gênero Aspergillus, Beauveria, Fusarium, Metarhizium, Paecilomyces e
Lecanicillium já foram isolados de carrapatos coletados no meio ambiente (Samish and
Rehacek 1999, Costa et al. 2002). Os fungos mais estudados para o controle de carrapatos são
dos gêneros Metarhizium e Beauveria. Várias espécies de carrapatos, em diferentes estágios de
desenvolvimento, já foram tratadas com esses patógenos obtendo resultados promissores
(Samish & Rehacek 1999, Fernandes & Bittencourt 2008). Porém, poucos testes de campo
foram realizados para comprovar a eficiência de fungos no combate destes vetores (Fernandes
& Bittencourt 2008).
3- Cerrado
O Cerrado é a maior savana da América do Sul com aproximadamente 2 milhões de
km2 sendo o segundo maior bioma do Brasil abrangendo 13 estados e o Distrito Federal (Klink
& Machado 2005). Apresenta duas estações bem marcadas: inverno seco e verão chuvoso. A
precipitação média anual é de 1.500 mm e as temperaturas são geralmente amenas ao longo do
ano, entre 22ºC e 27ºC em média (Klink & Machado 2005). A vegetação, em sua maior parte, é
formada por gramíneas, arbustos e árvores esparsas. As árvores têm caules retorcidos e raízes
longas, que permitem a absorção da água disponível nos solos abaixo de 2 m de profundidade.
Exibe uma das floras mais ricas dentre os ambientes savânicos no mundo e a presença de três
das maiores bacias hidrográficas da América do Sul: Rio Tocantins, Rio São Francisco e Rio
da Prata.
Este bioma é considerado um dos hotspots de biodiversidade em todo mundo (Myers et
al. 2000). Contudo, o Cerrado está seriamente ameaçado pela crescente expansão agrícola,
criação de gado, queimadas e outras atividades humanas. A contínua destruição do Cerrado
tem causado grandes danos ambientais como degradação de ecossistemas, extinção de espécies
endógenas, invasão de espécies exóticas, erosão dos solos, poluição de aqüíferos, desequilíbrio
do ciclo de carbono e modificações climáticas (Klink & Machado 2005). Cerca de 20% do
Cerrado permanecem sem interferência direta humana e menos de 3% destas áreas têm sido
protegidas por lei (Mittermeier et al. 2005).
A acentuada destruição da biodiversidade implica na redução de possíveis
microrganismos úteis, com perdas irreversíveis. Existem poucas informações sobre a
ocorrência e a utilidade de fungos ou outros microrganismos benéficos, presentes no Cerrado,
11
para o controle biológico de invertebrados (Shimazu et al. 1994, Luz et al. 2004 b, Monnerat et
al. 2005, Silva et al. 2004). Intensos esforços de preservar ecossistemas e realizar estudos e
coletas de fungos são necessários para assegurar uma apropriada preservação in situ de fungos
patogênicos para invertebrados e a sua utilização no controle integrado de pragas.
4- Isolamento de fungos
Fungos são isolados diretamente de invertebrados infectados, encontrados vivos ou
mortos, ou indiretamente de substratos utilizando invertebrados como iscas (Almeida & Filho
2001). Larvas de coleópteros como Tenebrio molitor, Tribolium castaneum e Acanthocinus
aedilis, de lepidópteros como Galleria mellonella, e ninfas de hemípteros como triatomíneos já
foram utilizadas como insetos-isca para isolamento de fungos de substratos (Vänninen 1995,
Luz et al. 2004 a). Além de técnicas de isolamento in vivo, meios semi-seletivos ou seletivos
são empregados para isolamento in vitro de fungos. Fungicidas acrescidos no meio atrasam ou
inibem especificamente o crescimento de fungos indesejados e favorecem o desenvolvimento
do(s) fungo(s) alvo(s). Existem fungos contaminantes, que, na ausência de fungicida, crescem
com alta velocidade e inibem o crescimento de fungos procurados e comprometem assim sua
detecção e isolamento. O conhecimento sobre fungicidas e sua utilidade para isolamento de
fungos patogênicos de invertebrados estão restritos a poucos fungicidas e fungos (Veen &
Ferron 1966; Chase et al. 1986; Yaginuma & Takagi 1986, Mitchell et al. 1987, Sneh 1991,
Liu et al. 1993, Panter & Frances 2003). Além disso, existem poucas informações sobre o
efeito específico de fungicidas para outros fungos com patogenicidade em insetos e demais
invertebrados, e contaminantes ocorrendo nos mesmos habitats. Recentemente, Luz et al. (2007
a) e Rocha & Luz (2009) mostraram que os fungicidas Dodine, Benomyl e especialmente
Thiabendazole foram promissores para o isolamento de 17 espécies de fungos patogênicos para
invertebrados, e na inibição de 10 espécies de fungos sapróbios em condição de laboratório.
5- Identificação e caracterização de fungos
Durante as últimas décadas, o reino Fungi sofreu mudanças substanciais na classificação,
especialmente a partir da introdução de técnicas moleculares. Métodos de identificação e
classificação tradicionais de fungos entomopatogênicos são baseados, sobretudo em
características morfológicas, às vezes subjetivas e ambíguas. Condições de cultivo, o tipo de
meio, e simples mutações podem levar a diferenças morfológicas de um mesmo isolado.
Dentre os caracteres estudados estão a morfologia macroscópica de colônias sobre meios de
cultivo, estruturas microscópicas reprodutivas, a especificidade para hospedeiros e perfis de
metabólitos secundários (Thrane 1990).
12
A partir dos anos 80, importantes técnicas moleculares foram desenvolvidas e passaram a
ser amplamente utilizadas na identificação, diferenciação e classificação de fungos. Técnicas
moleculares combinadas com métodos morfológicos são muito úteis para identificar gêneros e
espécies (Oliveira & Costa 2002). Com o advento da PCR (reação em cadeia de polimerase),
criada em 1983 por Hary Mullis, foi possível amplificar regiões do DNA e comparar o
tamanho dos fragmentos amplificados entre diferentes linhagens e espécies de fungos. Dessa
forma, pode ser estabelecido um grau de proximidade ou distanciamento entre indivíduos
estudados.
A técnica molecular que utiliza a amplificação, ao acaso, de seqüências polimórficas do
DNA (RAPD), uma variação da PCR, tem sido amplamente utilizada por ser uma técnica
simples, barata quando comparada com outras técnicas moleculares e capaz de proporcionar
resultados rápidos e satisfatórios. Uma outra vantagem dessa técnica é a utilização de apenas
uma pequena seqüência arbitrária de nucleotídeos como iniciadores (primers). Esses primers
dirigem a reação de amplificação de locos anônimos no genoma, eliminando assim a
necessidade do conhecimento prévio da seqüência (Lacerda et al. 2002). Muitos trabalhos têm
sido realizados utilizando RAPD para diferenciação de espécies ou linhagens de fungos
patogênicos para invertebrados (Silveira et al. 1998, Driver et al. 2000, Freire et al. 2001,
Dalzoto et al. 2003).
Nos últimos anos, técnicas de caracterização moleculares mais modernas e precisas têm
sido desenvolvidas. O sequenciamento de genes de DNA ribossomal (rDNA) e ou DNA
mitocondrial (mDNA) tem gerado resultados mais seguros sobre aspectos taxonômicos e
filogenéticos de fungos patogênicos para invertebrados (Driver et al. 2000, Luangsa-ard et al.
2005, Rehner & Bucckley 2005, Bischoff et al. 2006). Esta técnica tem como finalidade
determinar a ordem das bases nitrogenadas do segmento amplificado. Regiões do DNA
ribossomal (rDNA) têm sido bastante estudadas para fungos patogênicos (Driver et al. 2000,
Oliveira & Costa 2002, Destéfano et al. 2004, Inglis & Tigano 2006, Torres et al. 2006). Genes
de rDNA incluem regiões que são bem conservadas ou outras com maior divergência. As
regiões 18S e 28S são mais conservadas e úteis na diferenciação entre gêneros e espécies,
enquanto as regiões ITS (internal transcribed spacer) e IGS (intergenic spacer), que apresentam
mais variabilidade, são estudadas na discriminação entre espécies e linhagens (Destéfano et al.
2004). O gene 5.8S, juntamente com as regiões ITS1 e ITS2, foram seqüenciados para estudos
filogenéticos de fungos dos gêneros Paecilomyces, Beauveria, Cordyceps e Metarhizium
(Driver et al. 2000, Fargues et al. 2002, Liu et al. 2002, Han et al. 2005, Luangsa-ard et al.
2005, Rehner & Buckley 2005, Inglis & Tigano 2006, Torres et al. 2006). Para estudos mais
seguros e aprofundados de filogenia estão sendo estudados múltipos genes e regiões como
13
LSU, SSU, 5.8S, ITS, β-tubulina, α-tubulina, RPB1, RPB2 e EF1-α (Sung & Spatafora 2004,
Luangsa-ard et al. 2005, Rehner & Buckley 2005, Bischoff et al. 2006, James et al. 2006).
Várias novas espécies e gêneros de fungos entomopatogênicos foram propostos deste então
(Driver et al. 2000, Sung & Spatafora 2004, Han et al. 2005, Luangsa-ard et al. 2005, Bischoff
et al. 2006, Torres et al. 2006).
Objetivos gerais
- Contribuir para o desenvolvimento de controle biológico de vetores e de outras pragas
- Estudar a ocorrência de fungos patogênicos para invertebrados no bioma Cerrado
Objetivos específicos
- Isolar e identificar morfologica e molecularmente fungos patogênicos coletados do Cerrado
- Avaliar a atividade de fungos em triatomíneos
14
Morphology and Molecular Phylogeny of some Evlachovaea-like Fungi from the Central
Brazilian Cerrado and their Activity against Triatoma infestans
Luiz Fernando Nunes Rocha · Peter Ward Inglis · Richard Humber · André Kipnis ·
Christian Luz
L.F.N. Rocha · A. Kipnis · C. Luz
Instituto de Patologia Tropical e Saúde Pública (IPTSP), Universidade Federal de Goiás,
Goiânia, GO, Brazil
P.W. Inglis
Embrapa Recursos Genéticos e Biotecnologia, Brasília, DF, Brazil
R. Humber
Robert W. Holley Center for Agriculture and Health, Ithaca, NY, USA
Address for correspondence: C. Luz, DMIPP, IPTSP, UFG, CP 131, 74001-970 Goiânia, GO,
Brazil; Tel: (55) 62 3209 6154; Fax: (55) 62 3209 6363; E-mail: wolf@iptsp.ufg.br
22
Abstract
Six Evlachovaea-like isolates were obtained from soils collected in Central Brazil using
Triatoma infestans a vector of Chagas disease in Latin America as bait. The isolates fell into
two groups according to morphology, rDNA-ITS and translation elongation factor 1-α (TEF)
sequences. Group I isolates had elongated-cylindrical conidia, 3.6 x 2.6 µm, and produced
distinct purple to pink pigments on SDAY medium. Group II isolates had ovoid to short-
cylindrical conidia, 2.7 x 2.1 µm, and produced no visible pigment. Phylogenetic analysis of
the ITS and TEF sequences showed that group I isolates (IP 126 and IP 148) were > 98.8%
similar to Evlachovaea sp. (IP 304 and ARSEF 1576), and clustered with Cordyceps pruinosa
(AB044635, HMIGD 20930 and ARSEF 5413). Group II isolates (IP 67, IP 141, IP 142, IP
154) were identical to Evlachovaea sp. (IP 218) and clustered with Isaria cateniannulata
strains and Cordyceps spegazzinii (ARSEF 7850). Isolates of both groups differed in ITS and
TEF sequences from E. kintrischica (ARSEF 7218 and ARSEF 8058), the type and only
described species of Evlachovaea. The ITS sequence of E. kintrischica was, in turn, very
similar or identical to those of Isaria amoenerosea and Isaria cateniobliqua strains. Our results
suggest that the generic name Evlachovaea should be synonymized with Isaria. All six
Evlachovaea-like isolates and E. kintrischica were active against T. infestans at 25ºC and
relative humidities > 98%. The most virulent isolate IP 141 with lowest lethal time and
concentration (LT50: 5.6 days; LC50: 6.4 x 103 colony forming units/cm2) has potential for
integrated control of triatomine vectors.
Keywords Evlachovaea · Isaria · Cordyceps · Sequencing · Morphology · Triatominae
23
Introduction
In 1991, Borisov and Tarasov isolated an entomopathogenic fungus from a chrysomelid beetle
in southwestern Georgia. This fungus was shown to have a distinct mode of producing conidia
in zipper-like, flat chains in which the conidia arose at alternating angles to the tip of the
conidiogenous cell which these investigators described as a new (and monotypic) genus with
the species Evlachovaea kintrischica [1]. Since then other isolates with similar modes of
conidiogenesis but varying morphologies that might represent different species–and activity
against insects including triatomines vectors of Chagas disease in Latin America–have been
reported throughout the world [2-6]. Fungi with the Evlachovaea type of conidiogenesis are
much more common and widespread than has been suspected so far, but the taxonomic status
and probable relationships of these various fungi are not clear. There are several interpretations
of the mode of conidiogenesis that is the key diagnostic character of Evlachovaea: The
anamorph of Cordyceps cardinalis [7] is clearly of the Evlachovaea type although the authors
of this taxon (who apparently were not aware of the description of Evlachovaea) characterized
this anamorph as Clonostachys- or Mariannaea-like. Other fungi with Evlachovaea-like
conidiogenesis include Isaria cateniannulata and I. cateniobliqua [8], Paecilomyces
loushanensis [9] and the anamorph of Cordyceps spegazzinii [6]. Further, continued re-
examinations of conidial fungi in the ARSEF culture collection have revealed several isolates
with Evlachovaea-like conidiogenesis incorrectly identified as species of Beauveria or
Paecilomyces species, and that ARSEF includes Evlachovaea-like isolates from Russia,
Turkey, Germany, South Africa, the United States, Mexico, Colombia, and Brazil (R.A.
Humber, personal communication, 2008).
That fungi with Evlachovaea-like conidiogenesis have been identified previously as
belonging to genera such as Isaria, Paecilomyces, Lecanicillium or other segregates of
Verticillium, should not be a surprise. Most identifications of conidial fungi are made from
slide preparations in which conidial chains are disrupted, and the relative orientations of
conidia to their conidiogenous cells (as well as to each other) are often unapparent. Among all
isolates now known to display Evlachovaea-type conidiogenesis, the morphology and
arrangements of conidiogenous cells are indistinguishable from either the solitary or clustered
flask-like phialides of Isaria or Paecilomyces species or else from the tapering, awl-like
phialides typical of Lecanicillium or related slime-spored genera. The conidia of Mariannaea
species and the Lecanicillium anamorph of Cordyceps militaris form initially in imbricate
chains of obliquely oriented conidia in parallel (side-by-side) that soon slime down into
globose conidial heads; the conidial chains of Evlachovaea species with conidia oriented in
alternating, chevron- or zipper-like angles to the apex of the conidiogenous cells and remain
24
dry and catenate. Using the low magnification of a dissecting microscope, the irregular
appearances of the conidial chains and the shapes and arrangement of conidiogenous cells of
Evlachovaea species–and in slides observed at higher magnifications even the sizes and shapes
of the conidia–can strongly resemble the solitary or weakly clustered conidiogenous cells of
Beauveria with their extended, denticulate raches bearing multiple conidia (that are the key
diagnostic character of Beauveria species).
Molecular techniques became important tools in taxonomic and phylogenetic investigations
of entomopathogenic fungi [10-15]. Sequencing of the ITS1-5.8S-ITS2 rDNA and translation
elongation factor 1-α (TEF) regions has contributed to better understanding of the intra- and
intergeneric relationships of fungi of the genera Beauveria, Cordyceps, Isaria, Metarhizium
and Paecilomyces and their associations with other fungi [6, 13-21], and this technique would
be helpful to reveal the phylogenetic positions of fungi that could be treated as species of
Evlachovaea.
Chagas disease is a serious parasitosis in Latin America. Transmission by Triatoma
infestans (Hemiptera: Reduviidae), in Southern Latin America, is regaining importance in
regions where populations of this species with low pyrethroid resistance threaten to reinvade
domestic areas [22-25]. This and other vector species are highly susceptible to infection with
entomopathogenic fungi, especially Beauveria bassiana and Metarhizium anisopliae [26-28]
and their application in peridomestic areas could reduce the risk of domestic reinfestation [29].
An Evlachovaea sp. isolate detected on a dead T. sordida in Central Brazil has been reported to
be also active against T. infestans and other triatomines [3, 4]. However, the promising activity
of this and other fungi at relative humidities close to saturation was often reduced at lower
humidities [3, 4, 30, 31]. Suboptimal moisture in natural habitats of many triatomine species
may limit their potential for triatomine control. Fungi baited with triatomines and isolated from
a region with a marked dry season may exhibit a better specificity to the target vector and
adaptation to suboptimal humidity and maintain high activity even in lower moisture. The
Cerrado in Central Brazil is characterized by extensive savanna and forest formations and has a
hot, semi-humid climate with a dry winter season from May through September or October
[32]. An accurate identification and characterization of entomopathogenic fungi is crucial
when assessing their potential for vector control. We report on the isolation of Evlachovaea-
like fungi from soils in the Cerrado, their morphological characteristics, ITS and TEF-based
taxonomy, and their activity against T. infestans.
Materials and methods
25
Detection of Fungi
A total of four hundred soil samples were collected during 2001 in different Cerrado areas with
low human impact in the Ema National Park (150 samples), in a forest close to Silvânia (50
samples) and other localities (200 samples) in the Central Brazilian state of Goiás. For each
sample, about 25 g soil were scraped from the soil surface at randomly selected locations to a
depth to 2-3 cm, transferred to a plastic bag and stored at 20°C.
In the laboratory, soils were homogenized, and about 3 g of each sample were transferred
to a Petri dish (90 x 15 mm). Ten laboratory-reared [33], newly emerged and unfed third instar
nymphs (N3) of T. infestans were exposed to the soil for 20 days at 25°C in containers (33 x 37
x 22 cm) at relative humidities (RH) > 98%. Humidity in the containers was maintained by a
saturated aqueous solution of K2SO4 at the bottom of the containers [34]; mortality was
monitored daily. Dead insects were dipped in 93% alcohol, surface-sterilized in 2.5% sodium
hypochlorite for 3 min, and then washed three times for 1 min in sterile water. Cadavers were
then incubated inside Petri dishes on dampened filter paper for 15 days at 25°C and > 98% RH.
Fungal development on the cadavers was evaluated daily, and emergent fungi inoculated onto
complete medium (CM: 0.001 g FeSO4, 0.5 g KCl, 1.5 g KH2PO4, 0.5 g MgSO4 ⋅ 7 H2O, 6.0 g
NaNO3, 0.001 g ZnSO4, 1.5 g hydrolysed caseine, 0.5 g yeast extract, 10 g glucose, 2 g
peptone, 20 g agar and 1000 mL distilled water) to which chloramphenicol (1 g/1000 mL) was
added.
Morphological Identification
Isolates were inoculated onto the border of a minimal drop (100 µl) of Sabouraud dextrose agar
amended with yeast extract (SDAY: 10 g peptone, 40 g glucose, 2 g yeast extract, 20 g agar
and 1000 mL distilled water) applied on a glass slide (76 x 26 mm) and covered with a
coverslip (18 x 18 mm). Cultures were then incubated up to 7 days at 25°C, > 98% RH and a
12 h photophase before examining conidial chains microscopically [35]. Coverslips were
mounted with lactic acid-cotton blue on new slides, and the dimensions of conidiogenous cells
and conidia were determined based on measurements of 25 conidiogenous cells and 30 conidia
for each isolate. Fungal structures were analyzed by microscope (Olympus BX51) and
documented with a ProgRes® CFscan digital camera (Jenoptik, Jena, Germany) and augmented
with Helicon Focus Pro (Helicon Soft Co., Kharkov, Ukraine) montaging software to integrate
images from multiple focal planes.
E. kintrischica (ARSEF 8058), isolate IP 218, previously identified as Evlachovaea sp. by
Luz et al. [3], Evlachovaea sp. (ARSEF 1576), which has recently been reclassified from
Isaria fumosorosea, and other fungi with similar morphology to Evlachovaea-like fungi such
26
as Isaria cateniobliqua (ARSEF 6244, ARSEF 6283); I. cateniannulata (ARSEF 6240,
ARSEF 6241, ARSEF 6242, ARSEF 6243); Cordyceps spegazzinii (ARSEF 7850) and C.
cardinalis (ARSEF 7193), were mounted and measured as mentioned.
Molecular Characterization
Genomic DNA was extracted from mycelium previously grown for 48 h in 100 mL CM using
the CTAB (cetyltrimethylammonium bromide) extraction method of Rogers and Bendich [36].
The internal transcribed spacer (ITS) regions ITS1 and ITS2 as well as the central 5.8S rDNA
were amplified by PCR using primers which annealed to the 3' end of the small sub-unit rDNA
(ITS1; 5' TCCGTAGGTGAACCTGCGG) and to the 5' end of the large sub-unit rDNA (ITS4;
5' TCCTCCGCTTATTGATATGC), respectively [37]. A portion of the translation elongation
factor 1-α (TEF) gene was amplified from selected strains in two overlapping fragments, using
the primers: TEF intron region: 728F (5´- CATCGAGAAGTTCGAGAAGG) and EFjR (5´-
TGYTCNCGRGTYTGNCCRTCYTT); TEF exon region: 983F (5´-
GCYCCYGGHCAYCGTGAYTTYAT) and 2218R (5´-
ATGACACCRACRGCRACRGTYTG) [19, 38].
The PCR products were checked using agarose gel electrophoresis and purified using the
GeneClean II kit (Bio 101). Sequencing of both strands of the PCR products was accomplished
with the Applied Biosystems Big Dye v.3.1 kit, using the amplification primers and an ABI
3700 automatic sequencer.
Assembled sequences were aligned using MUSCLE [39] with minimal requirement for
local manual refinement for both ITS and TEF. Selected ITS and TEF sequences available
from the GenBank database were also included in the analysis (Table 1) from fungi with
morphological or taxonomic similarity to Evlachovaea-like isolates.
A cladistic analysis was conducted under the maximum parsimony (MP) criterion for ITS
and TEF data using PAUP* version 4.0b10 [40]. Heuristic searches comprised five cycles of
random taxon addition, holding one tree per cycle, which was repeated 1000 times. Alignment
gaps were treated as missing data and character-state optimization was by accelerated
transformation (ACCTRAN). Branch swapping was by tree bisection reconnection (TBR) and
the best trees from the first phase of the search were subjected to a further round of TBR
branch swapping to widen tree space. To reduce the effects of homoplasy in the data matrices,
five cycles of progressive character reweighting, as implemented in PAUP*, were applied,
optimizing for the maximum fit to the rescaled consistency index (RC), and including TBR
branch swapping after each reweighting. Branch support was assessed using 1000 bootstrap
pseudoreplicates [41]. Congruence between ITS and TEF phylogenies was evaluated,
27
following character reweighting, (see above) using the Incongruence Length Difference Test
(ILD) [42] as implemented in PAUP* (Partition homogeneity test), with 1000 replicates.
A taxonomic hypothesis based on the ITS and TEF data was also obtained using the
Bayesian Monte Carlo Markov Chain (MCMC) method of phylogenetic inference as
implemented in MrBayes 3.1.2 [43, 44]. The Bayesian analysis utilized the general time
reversible + gamma model settings, which were found to be optimal using jModelTest 0.1 [45,
46]. For the ITS analysis, one cold and three heated MCMC chains were run for 1,000,000
generations, sampling every 100th generation and discarding the first 25% of the trees (the
burn-in). For TEF, 100,000 generations was found to be sufficient run-time the chains to have
reached equilibrium. The MCMC runs were repeated twice to confirm the topology of the 50%
majority rule tree obtained after each run.
In vivo characterization
Isolates were cultured on CM for 15 days at 25°C and 12 h photophase. E. kintrischica
(ARSEF 7218) which did not produce conidia on CM was grown in liquid potato dextrose
medium (PD: 170 g potato, 40 g maltose, 15 g yeast extract and 1000 mL dist. H2O). Ten T.
infestans N3 were sprayed directly with 5 mL of aqueous suspensions of conidia or hyphal
bodies at a final concentration of 2x105 CFU/cm2 using a Potter spray tower (Burkard,
Hertfordshire, UK) [3]. Viability of conidia and hyphal bodies was checked routinely as
reported by Silva et al. [47]. Control nymphs were treated with water only. Insects were dried
for one hour at ambient temperature and humidity and then incubated for 20 days at 75 ± 5% or
> 98% RH in containers (33 x 37 x 22 cm). A relative humidity of ca. 75% was maintained by
a saturated aqueous solution of NaCl [34]. Mortality was recorded daily for 20 days.
Development of fungi on dead insects was examined as mentioned. The most virulent
Evlachovaea-like isolate found in the Cerrado was tested at > 98% RH and conidial
concentrations of 2x103, 6x103, 2x104, 6x104 and 2x105 CFU/cm2 treated area. Generally in
each test four repetitions, independent in time and space with 10 N3 in each repetition, were
run.
Mortality data were arcsine-square root transformed and then analyzed with analysis of
variance (ANOVA) or t-test and the Student-Newman-Keuls (SNK) multiple range test for
comparison of means. Means were considered significantly different at P < 0.05. Lethal
Concentrations (LC) and Lethal Times (LT) to kill 50% and 90% of nymphs were calculated
by probit analysis of dependent and independent values, respectively [48, 49].
Results
28
Fungal Isolation
Six strains whose mode of conidial development matches that characteristic for the genus
Evlachovaea as described by Borisov and Tarasov [1] were isolated from sites in the Central
Brazilian Cerrado. One isolate, IP 67, was found in open savannah, at Ema National Park, and
all others in gallery forests: IP 126 from close to Pirenópolis, and IP 141, IP 142, IP 148 and IP
154 from the vicinity of Silvânia.
Growth Characteristics and Morphology
The morphological characteristics of phialides and conidia permitted a separation of these
Brazilian isolates into two groups. Flask-like phialides of group I (IP 126 and IP 148), with
11.6 ± 4 µm length and 2 ± 0.3 µm width (mean ± standard deviation) (Table 2), were borne
singly or in pairs or small clusters with slightly swollen bases and gradually narrowed to a
distinct neck. Conidia were also formed on short to long peg-like phialides with unswollen
lateral branches frequently observed for IP 126, 14.9 ± 8.8 x 1.9 ± 0.4 µm, whereas IP 148
produced few, short peg-like phialides 3.1 ± 0.2 x 1 µm in length.
Conidia of isolates of group I routinely alternated in oblique angle, sometimes lying
broadside in “V” shape, and chains often became irregularly curved. Conidia were elongate-
cylindrical and averaged 3.6 ± 0.4 µm length and 2.6 ± 0.4 µm width. The length/width ratio
was 1.4 ± 0.3 (Fig. 1; Table 2). Combined length and width data did not differ from data found
for C. cardinalis ARSEF 7193, E. kintrischica ARSEF 8058, I. cateniobliqua ARSEF 6244
and ARSEF 6283, and Evlachovaea sp. ARSEF 1576 (Fig. 2a-d; Tables 2 and 3). Conidial
chains of C. cardinalis were more regular compared to all other isolates, with conidia partially
superimposed that produced long chains (Fig. 2a).
Isolates IP 126, IP 148 and Evlachovaea sp. ARSEF 1576 formed whitish or purple to pink
coloured colonies, that excreted purple to pink pigments into the medium. C. cardinalis was
found with only whitish colonies that excreted purple to pink pigments; no coloured colonies
or pigments were observed for any other fungi tested.
Conidiogenous cells of group II isolates (IP 67, IP 141, IP 142 and IP 154) were mostly
borne singly, in pairs or in small clusters of flask-shaped (or, less commonly, evenly tapering,
awl-like) phialides. These were smaller than the phialides of group I with 7.9 ± 2.6 µm length
and 2.3 ± 0.5 µm width (Table 2). Conidiogenous cells also originated directly on hyphae or
short peg-like lateral branches, 5 ± 2 x 1 ± 0.2 µm. Ovoid to short-cylindrical, white, hyaline
conidia were borne routinely in alternately oblique angles to the apex of the phialide with
average dimensions of 2.7 ± 0.3 µm length x 2.1 ± 0.2 µm width and a length/width ratio of 1.3
29
± 0.2 (Fig. 3; Table 2). Conidial chains often became irregularly curved. Conidia of group II
isolates were morphologically similar to Evlachovaea sp. IP 218, all isolates of I.
cateniannulata and the anamorph of C. spegazzinii ARSEF 7850 (Fig. 2e-f; Table 3).
In both groups and regardless of the isolate, some conidial chains occasionally failed to
show the typical alternating angles of insertion of conidia at their bases of their chains, thus
indicating that conidial formation began with the Evlachovaea-type alternatingly oblique
orientations of conidia, but could revert more to axial orientations of conidial formation more
characteristic of Isaria species.
DNA Sequences
The size of the ITS1-5.8S-ITS2 rDNA amplified from all isolates was about 540 bp and for
TEF, about 1390 bp. The six Evlachovaea-like Cerrado isolates formed two ITS groups with
the same clustering of isolates found in the morphological examination; within each group
ITS1-5.8S-ITS2 sequences were identical but the sequences of each group differed markedly.
The same division of the Cerrado isolates was observed in the analysis of TEF sequences,
although some small polymorphism was observed in the smaller of the two groups. The MP
and Bayesian phylogenetic analysis showed that group I Evlachovaea-like isolates were close
(> 98.8% identity) in ITS and TEF sequence to IP 304, previously morphologically identified
as Evlachovaea sp. [50], and Evlachovaea sp. ARSEF 1576. The ITS sequence of these strains
subsequently clustered with two C. pruinosa sequences (AB044635 and HMIGD 20930), and
the TEF sequences with C. pruinosa ARSEF 5413 (Figs. 4-7). ITS sequences from isolates of
group II were identical to that of Evlachovaea sp. IP 218, and nearly identical to two I.
cateniannulata isolates (BCMU IF05 and CBS 152.83). This group also clustered closely with
three more I. cateniannulata isolates (RCEF 209, ARSEF 6240 and ARSEF 6242), and
subsequently with C. spegazzinii ARSEF 7850 (Figs. 4 and 5). These relationships were
confirmed by the analysis of TEF sequences in selected strains (Figs. 6 and 7), although branch
length between the Evlachovaea-like isolates and the included I. cateniannulata isolates was
significantly greater than in the ITS analysis. Both Cerrado groups differed from E.
kintrischica ARSEF 7218 and ARSEF 8058, which were found to be identical in ITS sequence
to several I. amoenerosea isolates (ARSEF 744, CG 162 and CG 639) and were very similar (≥
99.1% identity) to Isaria cateniobliqua isolates (ARSEF 6283, CBS 153.83 and RCEF 189)
and, with 98.5% identity, very close to I. cateniobliqua CBS 107.73. Subsequently, group II
formed a clade with three out of six Isaria fumosorosea isolates (Figs. 4 and 5); which as a
species, was polyphyletic in our analysis. The similarity of E. kintrischica to I. cateniobliqua
was also observed in the TEF analysis (Figs. 6 and 7). Despite some strong morphological
30
similarities, C. cardinalis did not cluster with any Evlachovaea isolate studied (Figs. 4 and 5).
All six Evlachovaea-like isolates from the Cerrado and E. kintrischica ARSEF 7218 and
ARSEF 8058 showed stronger affinities with Isaria isolates and other members of the family
Cordycipitaceae than with other clavicipitoid fungi such as Metarhizium robertsii, P. carneus
or P. marquandii, now in the family Clavicipitaceae sensu stricto, or P. lilacinus, now in the
family Ophiocordycipitaceae according to the revised taxonomy of Sung et al. [51, 52]. There
was generally good agreement between the MP and Bayesian analyses of both DNA loci,
where bootstrap or clade credibility values were good for the majority of clades in the
phylogenetic trees. A notable exception was in the support for the branch separating group I
Evlachovaea-like isolates and C. pruinosa from the other Isaria isolates, where the MP and
Bayesian topologies also differed. The ILD test initially suggested that the TEF and ITS
phylogenies were significantly incongruent (P < 0.01). However, this was found to be caused
by a difference in position of the clade containing the two Beauveria species common to both
datasets. When these species were removed, the ILD test showed that the TEF and ITS
phylogenies were otherwise highly congruent (P = 0.998).
Activity against T. infestans
First dead nymphs were found 4-6 days post-inoculation (p.i.) at both humidities tested. At 20
days p.i. there was a highly significant effect of humidity on cumulative mortalities (t38 = 4.4;
P < 0.001) and of the isolate on mortality at humidities close to saturation (F5, 18 = 17.6; P <
0.001), but not at 75% (Table 4). At this time and > 98% RH, cumulative mortalities varied
between 65% (IP 67) and 100% (IP 141, IP 142 and IP 154). The shortest LT50 and LT90 data
were found for IP 141 at > 98% RH with 5.6 days and 7.1 days, respectively (Table 4). LT50
values of other isolates varied between 9.9 days (IP 142) and 17.5 days (IP 148), and LT90
values between 13 days (IP 154) and 31 days (IP 148; Table 4). At 75% RH, IP 141 killed 30%
(± 4.1) of N3 at 20 days p.i. while for the other isolates > 90% of the nymphs survived.
A high mortality (≥ 90%) was observed 10 days p.i. testing IP 141 at > 98% RH, regardless
of the concentrations tested (Fig. 8). Value of LC50 of this isolate, 7 days p.i., was 6.4x103
CFU/cm2 (CI: 2.5x103 − 1.2x104) and the LC90 was 4.3x105 CFU/cm2 (1.5x105 − 3.8x106).
A total of 52.5% (± 4.8) of N3 treated with hyphal bodies of E. kintrischica ARSEF 7218
were killed at 20 days p.i. at > 98% RH; LT50 and LT90 data were of 18.2 days (10.5 – 41.3)
and 32.7 days (22.7 – 110.5), respectively. At 75% RH dead nymphs were not observed.
Control mortality never exceeded 10% at 20 days p.i., regardless of the humidity and the
isolated tested. Development of inoculated fungi was observed on all cadavers, except on dead
control nymphs.
31
Discussion
The detection of six Evlachovaea-like isolates in soil samples confirmed other reports about
the occurrence of these fungi in the Brazilian Cerrado [2, 3]. Their isolation in different regions
of this biome and the low total incidence in comparison to other fungi detected in the same
samples such as Beauveria spp. and Metarhizium spp. [50, LFN Rocha, RA Humber and C
Luz, personal communication, 2008] lead us to believe that Evlachovaea-like fungi are
widespread but not frequent in soils of the Cerrado. However, the low number may also be
related to the technique of isolation, since T. infestans is an effective insect bait for both
Beauveria spp. and Metarhizium spp. [50, 53] but is probably less susceptible to Evlachovaea-
like fungi.
There are two groups of Evlachovaea-like fungi that differ from each other and also from
E. kintrischica. The long-spored isolates of group I (IP 126 and IP 148), Evlachovaea sp. IP
304 and ARSEF 1576, and other Evlachovaea-like isolates originating from different localities
in Brazil characterized by Humber et al. [2] had phialides and conidial shapes resembling those
of C. cardinalis ARSEF 7193. However, C. cardinalis (BCMU CC01), unlike the
Evlachovaea-like isolates, produced long, divergent, sympodially imbricate chains [7] and the
ITS sequence of this isolate was distinctly different from all Brazilian Evlachovaea-like
isolates. Our findings that C. cardinalis belongs in the family Cordycipitaceae agree with those
of Sung et al. [51, 52] although their studies also placed C. cardinalis outside the main group
of Cordyceps species in that family and might require its later transfer to a different
teleomorphic genus. ARSEF 1576, from an Italian collection isolated from Monophadnus
elongatulus (Hymenoptera: Tenthredinidae), was originally identified as Isaria fumosorosea on
the basis of the size and shape of its conidia but the zipper-like arrangement of its conidial
chains and genomic characteristics found here clearly place this isolate among the group I
isolates of Evlachovaea-like fungi. This clade had clear affinities with Isaria and a curious
similarity with C. pruinosa strains. Conidiogenesis of the anamorph of this species,
Mariannaea pruinosa, was described with arrangement of conidia in parallel and oblique to the
apex of the conidiogenous cell rather than of the alternating Evlachovaea type [2]. We do not
have morphological evidence of a C. pruinosa anamorph with zippered conidial chains or
chains that do not slime down as M. pruinosa. Moreover, other sequences of C. pruinosa or M.
pruinosa deposited in GenBank did not show a high similarity with isolates of group I. The
results obtained here do not support a correlation between C. pruinosa and group I. Isolates IP
126, IP 148, IP 304 and ARSEF 1576 are identical and may represent a new and still
undescribed species of Isaria. Evlachovaea-like isolates IP 67, IP141, IP142, IP 154 (group II)
32
and Evlachovaea sp. IP 218, represent a single fungal species. Their high morphological and
molecular resemblance with all tested I. cateniannulata and C. spegazzinii suggests that these
isolates should be synonymized with I. cateniannulata and considered as the anamorph of C.
spegazzinii. This interpretation is supported by results found recently in Turkey where some
fungi morphologically identified as Evlachovaea sp. were also molecularly similar to I.
cateniannulata [54].
The morphological characteristics and ITS and TEF sequences of E. kintrischica resembled
those of the I. cateniobliqua isolates tested here and also the ITS sequences of several I.
amoenerosea isolates. Probably all these isolates are a single species, but their taxonomic
situation is actually not clear and should be re-evaluated. In fact, our results suggest that the
genus Evlachovaea is not valid and should be treated as a synonym of the genus Isaria.
At humidity close to saturation most Evlachovaea-like isolates, especially isolate IP 141
(group II), were highly active against T. infestans nymphs, without a difference between group
I and II. At drier 75% RH, no isolate induced significant mortality (> 70%). It became clear
that activity of Evlachovaea-like fungi against T. infestans, even isolated in a region with
distinct and extended dry season and with triatomine baits, is limited by dry conditions of
humidity. These and other fungi, especially Beauveria bassiana and Metarhizium anisopliae,
act probably as natural enemies of triatomine vectors when rain is abundant and elevated
humidities can be expected in the habitats [3, 4, 30, 31, 53]. The most virulent Evlachovaea-
like fungus found in the Central Brazilian Cerrado, IP 141, has potential for integrated control
of triatomine vectors, especially during the rainy season.
Acknowledgements
The authors thank Regiane O Silva and Martin Unterseher (IPTSP/UFG) for assistance during
collecting activities, Marcos R Faria and Ana Y Ciampi (Embrapa) for providing fungi and
sequencing facilities, respectively, Karen Hansen and Micheal Wheeler (Robert W Holley
Center for Agriculture and Health) for technical assistance during morphological identification,
Ionizete G Silva (IPTSP) for providing triatomines, Lorena C Santos (IPTSP) for assistance
during sequencing activities, the National Council of Scientific and Technological
Development (CNPq) and Coordination for the Improvement of High Education Personnel
(CAPES) for financial support.
33
References
1. Borisov BA, Tarasov KL. Notes on biodiversity of causal agents of invertebrate mycoses in
Adjaria (southwestern Georgia). I. Evlachovaea kintrischica gen. et sp. nov.
(Hyphomycetes) from Kintrishi Reservation. Micol Fitopatol. 1999;33:248–56.
2. Humber RA, Tanzini MR, Alves SB. Evlachovaea: First reports of an unusual and little
known entomopathogenic fungal genus from the New World. Ann Meet Soc Invertebr Pathol
35th, 2002. Abstr. 74–5.
3. Luz C, Rocha LFN, Humber RA. Record of Evlachovaea sp. (Hyphomycetes) on Triatoma
sordida in the State of Goiás, Brazil and its activity against Triatoma infestans
(Reduviidae, Triatominae). J Med Entomol. 2003;40:451–4. doi: 10.1603/0022-
2585(2003)040[0451:ROESHO]2.0.CO;2.
4. Luz C, Rocha LFN, Silva IG. Pathogenicity of Evlachovaea sp. (Hyphomycetes), a new
species isolated from Triatoma sordida, in Chagas disease vectors under laboratory
conditions. Rev Soc Bras Med Trop. 2004;37:189–91. doi: 10.1590/S0037-
86822004000200017.
5. Held DW, Helhaus JK. Damage in centipede sod associated with crane fly and march fly
larvae (Diptera: Tipulidae, Bibionidae) in Mississippi. Florida Entomologist. 2006;89:89–
90. doi: 10.1653/0015-4040(2006)89[89:DICSAW]2.0.CO;2.
6. Torres MS, White JF, Bischoff JF. Cordyceps spegazzinii sp. nov., a new species of the C.
militaris group. Mycotaxon. 2006;94:253–63. http://www.mycotaxon
.com/vol/abstracts/94/94-253.html.
7. Sung GH, Spatafora JW. Cordyceps cardinalis sp. nov., a new species of Cordyceps with
an east Asian-eastern North American distribution. Mycologia. 2004;96:658–66.
http://www.658mycologia.org/cgi/content/full/96/3/658.
8. Liang Z. Two new species of Paecilomyces from insects. Acta Microbiol Sinica.
1981;21:31–4.
9. Liang ZQ, Liu AY, Huang JZ, Jiao YC. The genus Cordyceps and its allies from
Kuankuoshui Preserve in Guizhou II. Mycosystema. 1997;16:61–7.
10. Pace NR, Olsen GJ, Woese CR. Ribosomal RNA phylogeny and the primary lines of
evolutionary descent. Cell. 1986;45:325–6.
11. Bowman BH, Taylor JW, Brownlee AG, Lee J, Lu SD, White TJ. Molecular evolution of
the fungi: relationships of the Basidiomycetes, Ascomycetes and Chytridiomycetes. Mol
Biol Evol. 1992;9:285–96.
http://www.mbe.oxfordjournals.org/cgi/content/abstract/9/2/285.
34
12. Hibbett DS. Ribosomal RNA and fungal systematics. Trans Mycol Soc Japan.
1992;33:533–56.
13. Driver F, Milner RJ, Trueman JWH. A taxonomic revision of Metarhizium based on a
phylogenetic analysis of rDNA sequence data. Mycol Res. 2000;104:143–50. doi:
10.1017/S0953756299001756.
14. Luangsa-ard JJ, Hywel-Jones NL, Manoch L, Samson RA. On the relationships of
Paecilomyces sect. Isarioidea species. Mycol Res. 2005;109:581–9. doi:
10.1017/S0953756205002741.
15. Bischoff JF, Rehner SA, Humber RA. Metarhizium frigidum sp. nov.: a cryptic species of
M. anisopliae and a member of the M. flavoviride complex. Mycologia. 2006;98:737–45.
doi: 10.3852/mycologia.98.5.737.
16. Fargues J, Bon MC, Manguin S, Couteaudier Y. Genetic variability among Paecilomyces
fumosoroseus isolates from various geographical and host insect origins based on the
rDNA-ITS regions. Mycol Res. 2002;106:1066–74. doi: 10.1017/S0953756202006408.
17. Liu ZY, Liang ZQ, Liu AY, Yao YJ, Hyde KD, Yu ZN. Molecular evidence for
teleomorph-anamorph connections in Cordyceps based on ITS-5.8S rDNA sequences.
Mycol Res. 2002;106:1100–8. doi: 10.1017/S0953756202006378.
18. Han Y, Liang Z, Chu H, Kang J. Paecilomyces parvosporus, a new species with its
relatives from Yunnan Province, China. Mycotaxon. 2005;94:357–63.
http://www.mycotaxon.com/vol/abstracts/94/94-357.html.
19. Rehner SA, Buckley E. A Beauveria phylogeny inferred from nuclear ITS and EF1-αy
sequences: evidence for cryptic diversification and links to Cordyceps teleomorphs.
Mycologia. 2005;97:84–98. doi: 10.3852/mycologia.97.1.84.
20. Inglis PW, Tigano MS. Identification and taxonomy of some entomopathogenic
Paecilomyces spp. (Ascomycota) isolates using rDNA-ITS sequences. Genet Mol Biol.
2006;29:132–6. doi: 10.1590/S1415-47572006000100025.
21. Bischoff JF, Rehner SA, Humber RA. A multilocus phylogeny of the Metarhizium
anisopliae lineage. Mycologia. 2009;101:508–28. doi: 10.3852/07-202.
22. Audino PG, Vassena C, Barrios S, Zerba E, Picollo MI. Role of enhanced detoxication in a
deltamethrin-resistant population of Triatoma infestans (Hemiptera, Reduviidae) from
Argentina. Mem Inst Oswaldo Cruz. 2004;99:335–9. doi: 10.1590/S0074-
02762004000300018.
23. Cecere MC, Vazquez-Prokopec GM, Gurtler RE, Kitron U. Spatio-temporal analysis of
reinfestation by Triatoma infestans (Hemiptera: Reduviidae) following insecticide spraying
35
in a rural community in Northwestern Argentina. Am J Trop Med Hyg. 2004;71:803–10.
http://www.ajtmh.org/cgi/content/full/71/6/803.
24. Cecere MC, Vazquez-Prokopec GM, Gurtler RE, Kitron U. Reinfestation sources for
Chagas disease vector, Triatoma infestans, Argentina. Emerg Infec Dis. 2006;12:1096–
102. http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1853288.
25. Picollo MI, Vassena C, Santo OP, Barrios S, Zaidenberg M, Zerba E. High resistance to
pyrethroid insecticides associated with ineffective field treatments in Triatoma infestans
(Hemiptera: Reduviidae) from Northern Argentina. J Med Entomol. 2005;42:637–42. doi:
10.1603/0022-2585(2005)042[0637:HRTPIA]2.0.CO;2.
26. Luz C, Tigano M, Silva IG, Cordeiro CMT, Aljanabi SM. Selection of Beauveria bassiana
and Metarhizium anisopliae isolates to control Triatoma infestans. Mem Inst Oswaldo Cruz
1998;93:839–846. doi: 10.1590/S0074-02761998000600026.
27. Luz C, Silva IG, Magalhães BP, Cordeiro CMT, Tigano M. Control of Triatoma infestans
(Klug) (Reduviidae: Triatominae) with Beauveria bassiana (Bals.) Vuill. preliminary
assays on formulation and application in the field. An Soc Entomol Bras. 1999;28: 101–
110. doi: 10.1590/S0301-80591999000100011.
28. Lecuona RE, Edelstein MFB, Rossa FR, Arcas JA. Evaluation of Beauveria bassiana
(Hyphomycetes) strains as potential agents for control of Triatoma infestans (Hemiptera:
Reduviidae). J Med Entomol. 2001;38:172–179. doi: 10.1603/0022-2585-38.2.172.
29. Luz C, Rocha LFN, Nery GV, Magalhães BP, Tigano MS. Activity of oil-formulated
Beauveria bassiana against Triatoma sordida in peridomestic areas in Central Brazil. Mem
Inst Oswaldo Cruz. 2004;99:211–218. doi: 10.1590/S0074-02762004000200017.
30. Luz C, Fargues J. Dependence of the entomopathogenic fungus Beauveria bassiana on
high humidity for infection of Rhodnius prolixus. Mycopathologia. 1999;146:33–41.doi:
10.1023/A:1007019402490
31. Lazzarini GMJ, Rocha LFN, Luz C. Impact of moisture on in vitro germination of
Metarhizium anisopliae and Beauveria bassiana and their activity in Triatoma infestans.
Mycol Res. 2006;110:485–92. doi:10.1016/j.mycres.2005.12.001.
32. Klink CA, Machado RB. Conservation of the Brazilian Cerrado. Conserv Biol.
2005;19:707–713.
33. Silva IG. Influência da temperatura na biologia de triatomíneos. I. Triatoma rubrovaria
(Blanchard, 1834) (Hemiptera, Reduviidae). Rev Goiana Med. 1985;34:29–34.
34. Winston PW, Bates DH. Saturated solutions for the control of humidity in biological
research. Ecology. 1960;41:232–7.
36
35. Humber RA. Fungi: Identification. In: Lacey LA, editor. Manual of Techniques in Insect
Pathology. San Diego, CA: Academic Press. 1997. pp. 153-85.
36. Rogers SO, Bendich AJ. Extraction of DNA from plant tissues. In: Gelvin SB,
Schilperpoort RA, Verma DPS, editors. Plant Molecular Biology Manual Vol. A6.
Dordrecht: Kluwer Acadademic Publishers; 1988. pp. 1–10.
37. White TJ, Bruns TD, Lee SB, Taylor JW. Amplification and direct sequencing of fungal
ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ,
editors. PCR protocols: a guide to methods and applications. San Diego: Academic Press;
1990. pp. 315–22.
38. Carbone I, Kohn LM. A method for designing primer sets for speciation studies in
filamentous ascomycetes. Mycologia 1999;91:553–6.
39. Edgar RC. MUSCLE: multiple sequence alignment with high accuracy and high
throughput. Nucleic Acids Res. 2004;32:1792–1797. doi: 10.1093/nar/gkh340.
40. Swofford DL. PAUP*: Phylogenetic analysis using parsimony and other methods. Version
4. Sinauer Associates, Sunderland, Massachusetts. 1998.
41. Felsenstein J. Confidence limits on phylogenies: an approach using the bootstrap.
Evolution. 1985;39:783–91.
42. Farris JS, Kallersjo M, Kluge AG, Bult C. Constructing a significance test for
incongruence. Syst Biol. 1995;44:570–2.
43. Huelsenbeck JP, Ronquist F, Nielsen R, Bollback JP. Bayesian inference of phylogeny and
its impact on evolutionary biology. Science. 2001;294:2310–4. doi: 10.1590/S1415-
47572006000100025.
44. Ronquist F, Huelsenbeck JP. MRBAYES 3: Bayesian phylogenetic inference under mixed
models. Bioinformatics. 2003;19:1572–4. doi: 10.1093/bioinformatics/btg180.
45. Posada D. jModelTest: Phylogenetic model averaging. Mol. Biol. Evol. 2008;25:1253–6.
doi:10.1093/molbev/msn083.
46. Guindon S, Gascuel O. A simple, fast, and accurate algorithm to estimate large phylogenies
by maximum likelihood. Syst Biol. 2003;52:696–704. doi: 10.1080/10635150390235520.
47. Silva RO, Silva HHG, Ulhoa CJ, Luz C. Is there a relationship between N-acetyl-β-D-
glucosaminidase activity of Metarhizium anisopliae (Metschn.) Sorokin (Hyphomycetes)
isolates from peridomestic areas in Central Brazil and larvicidal effect on Aedes aegypti
(L.) (Diptera, Culicidae)? J Appl Entomol. 2005;129:158–64. doi: 10.1111/j.1439-
0418.2005.00933.x.
48. Throne JE, Weaver DK, Baker JE. Probit analysis: Assessing goodness-of-fit based on
back transformation and residuals. J Econ Entomol. 1995;88:1513–6.
37
49. Throne JE, Weaker DK, Chew V, Baker JE. Probit analysis of correlated data: Multiple
observations over time at one concentration. J Econ Entomol. 1995;88:1510–2.
50. Rocha LFN, Tai MHH, Santos AH, Albernaz DAS, Humber RA & Luz C. Occurrence of
invertebrate-pathogenic fungi in a Cerrado ecosystem in Central Brazil. Biocont Sci
Technol. 2009;19: 547–53. doi: 10.1080/09583150902789337.
51. Sung GH, Hywel-Jones NL, Sung JM, Luangsa-ard JJ, Shrestha B, Spatafora JW.
Phylogenetic classification of Cordyceps and the clavicipitaceous fungi. Stud Mycol.
2007;57:5–59. doi: 10.3114/sim.2007.57.01.
52. Sung GH, Sung JM, Hywel-Jones NL, Spatafora JW. A multi-gene phylogeny of
Clavicipitaceae (Ascomycota, Fungi): Identification of localized incongruence using a
combinational bootstrap approach. Mol Phylogenet Evol. 2007;44:1204–23. doi:
10.1016/j.ympev.2007.03.011.
53. Luz C, Rocha LFN, Nery GV. Detection of entomopathogenic fungi in peridomestic
triatomine-infested areas in Central Brazil and fungal activity against Triatoma infestans
(Klug) (Hemiptera: Reduviidae). Neotrop Entomol 2004;33:783–91. doi: 10.1590/S1519-
566X2004000600017.
54. Sevim A, Demir I, Höfte M, Humber RA, Demirbag Z. Isolation and characterization of
entomopathogenic fungi from hazelnut-growing region of Turkey. BioControl. 2009; first
online: doi: 10.1007/s10526-009-9235-8.
38
Figure legends
Fig. 1 Morphological features of phialides with conidial chains of Evlachovaea-like isolates of
group I.
Fig. 2 Morphological features of conidial chains of fungi related to the genus Evlachovaea; a-
Cordyceps cardinalis ARSEF 7193, b- E. kintrischica ARSEF 8058, c- Isaria cateniobliqua
ARSEF 6244, d- Evlachovaea sp. ARSEF 1576, e- C. spegazzinii ARSEF 7850, f- I.
cateniannulata ARSEF 6243.
Fig. 3 Morphological features of phialides with conidial chains of Evlachovaea-like isolates of
group II.
Fig. 4 Strict consensus of 2000 MP trees (MAXTREES limit hit) of ITS data of Evlachovaea-
like (group I: IP 126 and 148; group II: IP 67, IP 141, IP 142, IP 154) and other fungi,
following progressive character reweighting of 616 (aligned) characters, where 367 characters
are constant, 85 variable characters are parsimony-uninformative and 164 characters are
parsimony-informative. Tree length = 298.75, CI = 0.8454, RI = 0.9204, RC = 0.7781
(unweighted tree length = 468). Numbers above branches are results of 1000 bootstrap
pseudoreplicates (%).
Fig. 5 Bayesian 50% majority rule consensus phylogenetic tree of ITS data of Evlachovaea-
like (group I: IP 126 and 148; group II: IP 67, IP 141, IP 142, IP 154) and other fungi. The tree
was rooted using the Metarhizium robertsii sequence and clade credibility values (posterior
probabilities) are indicated at the nodes.
Fig. 6 Single most parsimonious tree of TEF data of Evlachovaea-like (group I: IP 126 and IP
148; group II: IP 67, IP 141, IP 142, IP 154) and other fungi following progressive character
reweighting of 1683 total (aligned) characters, where 1195 characters are constant, 131
variable characters are parsimony-uninformative, number of parsimony-informative characters
= 357. Tree length = 566.93; CI = 0.8839, RI = 0.9259, RC = 0.8183 (unweighted tree length =
860). Numbers above branches are results of 1000 bootstrap pseudoreplicates (%).
Fig. 7 Bayesian 50% majority rule consensus phylogenetic tree of TEF data of Evlachovaea-
like (group I: IP 126 and IP 148; group II: IP 67, IP 141, IP 142, IP 154) and other fungi. The
39
tree was rooted using the Metarhizium robertsii sequence and clade credibility values
(posterior probabilities) are indicated at the nodes.
Fig. 8 Cumulative mortality (%) of third instar nymphs of Triatoma infestans after spraying
water-suspended Evlachovaea-like IP 141 conidia at 5 concentrations (colony forming units
cm-2). Nymphs were incubated at relative humidities > 98% and 25°C for 10 days.
40
Table 1 Reference strains and their respective collection and GenBank codes
Fungus
Strain a
GenBank Code
ITS
TEF
Beauveria bassiana b
ARSEF 1564
d
-
Beauveria bassiana ARSEF 730 AY532043 AY531952 Beauveria brongniartii ARSEF 1431 AY531980 AY531889 Beauveria brongniartii CBS 223.53 Z54103 - Cordyceps bassiana ATCC 26854 EF026006 - C. cardinalis BCMU CC01 AB237660 - C. pruinosa c AB044635 - C. pruinosa HMIGD 20930 DQ342253 - C. pruinosa ARSEF 5413 - DQ522351 C. spegazzinii b ARSEF 7850 DQ196435 GU734752 Evlachovaea kintrischica b ARSEF 7218 EU553278 GU734751 Evlachovaea kintrischica ARSEF 8058 GU734764 GU734750 Evlachovaea-like IP 67 EU553275 GU734753 Evlachovaea-like IP 126 EU553279 GU734747 Evlachovaea-like IP 141 EU553276 GU734755 Evlachovaea-like IP 142 EU553273 GU734754 Evlachovaea-like IP 148 EU553280 GU734748 Evlachovaea-like IP 154 EU553274 GU734756 Evlachovaea sp IP 218 EU553277 GU734757 Evlachovaea sp IP 304 GU734765 GU734745 Evlachovaea sp ARSEF 1576 EU553296 GU734746 Isaria amoenerosea CBS 107.73 AY624168 - I. amoenerosea CG 639 EU553287 - I. amoenerosea CG 162 EU553315 - I. amoenerosea ARSEF 744 EU553281 - I. cateniannulata BCMU IF05 AB263742 - I. cateniannulata b CBS 152.83 AY624172 - I. cateniannulata RCEF209 AF368802 - I. cateniannulata ARSEF 6240 GU734761 GU734758 I. cateniannulata ARSEF 6242 GU734760 GU734759 I. cateniobliqua b CBS 153.83 AY624173 - I. cateniobliqua ARSEF 6283 GU734763 GU734749 I. cateniobliqua RCEF189 AF368799 - I. cicadea BCMU CS03 AB085888 - I. farinosa CBS 111113 AY624181 -
I. fumosorosea ARSEF 4700 AY755506 - I. fumosorosea b CBS 107.10 AY624184 - I. fumosorosea CBS 244.31 AY624182 - I. fumosorosea CBS 337.52 EF411219 - I. fumosorosea CG 499 EU553301 - I. fumosorosea CG 325 EU553307 - I. japonica BCC 2787 AY624200 - I. tenuipes FI 1304 EU553323 - I. tenuipes OSC 111007 - DQ522349 P. carneus b CBS 239.32 AY624171 - P. lilacinus b CBS 284.36 AY624189 - P. lilacinus CBS 431.87 AY624188 EF468791 P. marquandii CBS 182.27 AY624193 EF468793 Metarhizium robertsii ARSEF 727
AF516302 DQ463994 a Isolate accession numbers from their appropriate culture collection are denoted by the following prefixes: ARSEF, Agricultural Research Service Entomopathogenic Fungus Collection, USDA, NY, USA; ATCC,
41
American Type Culture Collection, Manassas, USA; BCC, National Center for Genetic Engineering and Biotechnology, BIOTEC, Bangkok, Thailand; CBS, Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands; CG, Embrapa Collection, Brasília, Brazil; FI, CSIRO Collection, Canberra, Australia; HMIGD, Department of Medicinal Fungi, Guangdong Institute of Microbiology, Guangdong, China; IP, Institute of Tropical Pathology and Public Health, Federal University of Goiás, Goiás, Brazil; RCEF, Research Center on Entomogenous Fungi, Anhui Agricultural University, Anhui, China; OSC, Oregon State University Herbarium, Oregon, USA. Isolates with identical ITS1-5.8S-ITS2 or TEF gene sequences were assigned to an appropriate isogenic group and are represented in Figs. 4 - 7 by this group designation b Known ex-type listed cultures c Collection source information not available from GenBank d Strains without GenBank code
42
Table 2 Morphological characteristics of conidia and conidiogenous cells of Evlachovaea-like isolates from the Brazilian Cerrado and Evlachovaea kintrischica Fungus
Conidia
Conidiogenous cells
Length (µm) Width (µm)
L/W
Length (µm)
Width (µm)
L/W
Group I
IP 126 3.7 ± 0.5 (2.9 – 4.7)
2.7 ± 0.9 (2.2 – 2.9)
1.4 ± 0.3 (1.0 – 2.2)
13.0 ± 3.9 (7.0 – 25.0)
1.9 ± 0.4 (1.0 – 3.0)
7.1 ± 2.9 (2.8 – 16.7)
IP 148 3.5 ± 0.4 (2.9 – 4.3)
2.5 ± 0.4 (2.2 – 3.6)
1.5 ± 0.2 (1.0 – 1.8)
10.3 ± 3.7 (6.0 – 18.0)
2.1 ± 0.2 (2.0 – 2.5)
5.0 ± 1.9 (2.8 – 9.0)
Combined data
3.6 ± 0.4 (2.9 – 4.7)
2.6 ± 0.4 (2.2 – 3.6)
1.4 ± 0.3 (1.0 – 2.2)
11.6 ± 4.0 (6.0 – 25.0)
2.0 ± 0.3 (1.0 – 3.0)
6.1 ± 2.6 (2.8 – 16.7)
Group II
IP 67 2.6 ± 0.3 (2.2 – 2.9)
2.0 ± 0.2 (1.8 – 2.2)
1.3 ± 0.2 (1.0 – 1.6)
9.2 ± 2.7 (6.0 – 15.0)
2.1 ± 0.4 (1.0 – 3.0)
4.9 ± 2.6 (2.0 – 15.0)
IP 141 2.7 ± 0.3 (2.2 – 3.2)
2.2 ± 0.1 (2.1 – 2.5)
1.2 ± 0.1 (1.0 – 1.5)
6.9 ± 1.9 (4.5 – 12.0)
2.6 ± 0.6 (2.0 – 4.0)
2.8 ± 1.2 (1.5 – 6.0)
IP 142 2.7 ± 0.3 (2.2 – 2.9)
2.2 ± 0.1 (2.2 – 2.5)
1.2 ± 0.1 (1.0 – 1.3)
7.1 ± 1.8 (5.0 – 12.0)
2.2 ± 0.4 (1.5 – 2.5)
3.4 ± 1.0 (2.0 – 6.0)
IP 154 2.7 ± 0.4 (2.2 – 3.6)
2.3 ± 0.2 (1.9 – 2.9)
1.2 ± 0.1 (1.0 – 1.5)
8.6 ± 3.5 (4.0 – 20.0)
2.2 ± 0.5 (1.5 – 3.0)
4.4 ± 2.2 (1.3 – 10.0)
Combined data
2.7 ± 0.3 (2.2 – 3.6)
2.1 ± 0.2 (1.4 – 2.9)
1.3 ± 0.2 (1.0 – 2.0)
7.9 ± 2.6 (4.0 – 20.0)
2.3 ± 0.5 (1.0 – 4.0)
3.8 ± 1. 9 (1.3 – 15.0)
Evlachovaea sp. IP 218
2.6 ± 0.4 (2.2 – 3.6)
1.8 ± 0.2 (1.4 – 2.2)
1.5 ± 0.3 (1.0 – 2.0)
7.6 ± 2.0 (4.5 – 12.0)
2.2 ± 0.4 (2.0 – 3.0)
3.5 ± 1.2 (1.5 – 6.0)
Evlachovaea sp. ARSEF 1576
3.4 ± 0.3 (2.9 – 4.3)
2.2 ± 0.1 (2.1 – 2.5)
1.6 ± 0.2 (1.3 – 2.0)
9.1 ± 2.3 (5.0 – 14.0)
2.1 ± 0.2 (2.0 – 2.5)
4.4 ± 1.1 (2.5 – 7.0)
E. kintrischica ARSEF 8058
3.6 ± 0.5 (2.9 – 5.0)
2.1 ± 0.3 (1.4 – 2.5)
1.8 ± 0.3 (1.3 – 2.5)
9.1 ± 2.5 (5.0 – 15.0)
2.4 ± 0.5 (1.5 – 3.0)
3.9 ± 1.6 (2.0 – 7.0)
Means (± standard deviation) followed by minimum and maximum size of morphological structures. A total of 30 conidia and 25 flask-like conidiogenous cells of each isolate were measured. Fungi were grown for up to 7 days at 25°C and in a humid chamber on a drop of Sabouraud dextrose agar amended with yeast extract, arranged on glass slides and covered with a coverslip Fungi of group I and II were isolated from soils, Evlachovaea sp. IP 218 from Triatoma sordida, all in Brazil and E. kintrischica from a chrysomelid beetle in Georgia
43
Table 3 Morphological characteristics of conidia and conidiogenous cells of fungi morphologically referable to the genus Evlachovaea
Fungus
Code
Number
Conidia
Conidiogenous cells
Length (µm) Width (µm)
L/W
Length (µm)
Width (µm)
L/W
Cordyceps cardinalis
ARSEF 7193
4.3 ± 0.4 (3.1 – 5.0)
2.2 ± 0.1 (1.8 – 2.5)
2.0 ± 0.2 (1.7 – 2.3)
12.5 ± 2.9 (8.0 – 20.0)
2.0 ± 0.5 (1.5 – 3.5)
6.1 ± 1.8 (3.1 – 12.0)
Cordyceps spegazzinii
ARSEF 7850
2.9 ± 0.3 (2.5 – 3.6)
2.2 ± 0.1 (1.8 – 2.5)
1.3 ± 0.2 (1.0 – 1.7)
9.4 ± 5.1 (4.0 – 23.0)
2.0 ± 0.2 (1.5 – 2.5)
4.7 ± 2.7 (2.0 – 11.5)
Isaria cateniannulata
ARSEF 6240
2.9 ± 0.4 (2.2 – 4.3)
2.2 ± 0.1 (1.8 – 2.5)
1.3 ± 0.2 (1.2 – 2.0)
6.9 ± 1.4 (5.0 – 10.0)
2.0 ± 0.1 (2.0 – 2.5)
3.3 ± 0.7 (2.0 – 5.0)
ARSEF 6241
2.5 ± 0.3 (1.8 – 2.9)
2.0 ± 0.2 (1.4 – 2.2)
1.2 ± 0.2 (1.0 – 1.6)
5.5 ± 1.3 (4.0 – 8.5)
2.4 ± 0.3 (2.0 – 3.0)
2.3 ± 0.7 (1.3 – 4.0)
ARSEF 6242
2.8 ± 0.4 (2.2 – 3.6)
2.2 ± 0.2 (1.8 – 2.9)
1.3 ± 0.2 (0.8 – 1.7)
5.3 ± 1.1 (4.0 – 7.0)
2.0 ± 0.2 (2.0 – 3.0)
2.6 ± 0.6 (2.0 – 3.5)
ARSEF 6243
2.7 ± 0.3 (2.2 – 3.2)
2.2 ± 0.1 (1.8 – 2.5)
1.2 ± 0.1 (1.0 – 1.5)
6.1 ± 2.0 (3.5 – 13.0)
2.3 ± 0.4 (1.5 – 3.0)
2.7 ± 1.5 (1.2 – 8.7)
Combined data
2.7 ± 0.4 (1.8 – 4.3)
2.1 ± 0.2 (1.4 – 2.9)
1.3 ± 0.2 (0.8 – 2.0)
5.9 ± 1.6 (3.5 – 13.0)
2.2 ± 0.3 (1.5 – 3.0)
2.8 ± 1.0 (1.2 – 8.7)
Isaria cateniobliqua
ARSEF 6244
4.1 ± 0.6 (3.2 – 5.0)
2.2 ± 0.2 (1.8 – 2.5)
1.9 ± 0.3 (1.5 – 2.3)
5.9 ± 1.8 (4.0 – 11.0)
2.4 ± 0.4 (2.0 – 3.0)
2.5 ± 0.9 (1.6 – 5.5)
ARSEF 6283
4.0 ± 0.6 (3.6 – 5.8)
2.2 ± 0.2 (1.8 – 2.5)
1.9 ± 0.3 (1.4 – 2.4)
6.9 ± 1.6 (5.0 – 12.0)
2.8 ± 0.3 (2.5 – 3.0)
2.5 ± 0.5 (2.0 – 4.0)
Combined data
4.0 ± 0.6 (3.2 – 5.8)
2.2 ± 0.2 (1.8 – 2.5)
1.9 ± 0.3 (1.4 – 2.4)
6.4 ± 1.7 (4.0 – 12.0)
2.6 ± 0.4 (2.0 – 3.0)
2.5 ± 0.8 (1.6 – 5.5)
Means (± standard deviation) followed by minimum and maximum size of morphological structures. A total of 30 conidia and 25 flask-like conidiogenous cells of each isolate were measured. Fungi were grown for up to 7 days at 25°C and in a humid chamber on a drop of Sabouraud dextrose agar amended with yeast extract, arranged on glass slides and covered with a cover slip
44
Table 4 Lethal times (days) to kill 50 or 90% (LT50/90) with their respective confidence intervals and cumulative mortalities (%; ± standard error of the mean) of Triatoma infestans third instar nymphs (N3), treated topically with water-suspended conidia of Evlachovaea-like isolates (group I and II) and incubated at relative humidities > 98%, 12 h photophase and 25ºC for 20 days
Group
Isolate
LT50
LT90
Cumulative Mortality
IP 126 13.5 (10.4 – 16.6) bc 20.7 (17.4 – 27.2) c 90.0 ± 4.1 b
I IP 148 17.5 (11.2 – 27.3) c 31.0 (23.1 – 59.7) c 70.0 ± 7.1 c
IP 67 17.4 (14.6 – 20.7) c 27.9 (23.8 – 35.3) c 65.0 ± 10.4 c
IP 141 5.6 (5.2 – 6.0) a 7.1 (6.7 – 7.8) a 100 a
II IP 142 9.9 (9.0 – 10.8) b 13.4 (12.4 – 14.9) b 100 a
IP 154 10.1 (9.3 – 10.8) b 13.0 (12.1 – 14.3) b 100 a
Ten N3 each repetition and isolate were treated topically with a Potter spray tower at a final concentration of 2x105 colony forming units cm-2 treated surface. Four independent repetitions for each isolate were done. Values within the same column, followed by different letters (a - c) were significantly different among each other
45
Occurrence of Metarhizium spp from Central Brazil and their activity against Triatoma
infestans
Luiz Fernando Nunes ROCHAa, Peter Ward INGLISb, Richard HUMBERc, André KIPNISa,
Christian LUZa,*
a DMIPP, Instituto de Patologia Tropical e Saúde Pública, Universidade Federal de Goiás, Goiânia,
GO, Brazil
b Embrapa Recursos Genéticos e Biotecnologia, Brasília, DF, Brazil
c Robert W. Holley Center for Agriculture and Health, Ithaca, NY, USA
* Corresponding author. C. Luz, DMIPP, IPTSP, UFG, CP 131, 74001-970 Goiânia, GO,
Brazil; Tel: (55) 62 3209 6113; Fax: (55) 62 3521 1839; E-mail: wolf@iptsp.ufg.br
ABSTRACT
A hundred and six Metarhizium spp. isolates were obtained from soils or slurries collected
in Central Brazil with Triatoma infestans as bait or modified Chase medium. Maximum
parsimony phylogenetic analysis showed that isolates belong to at least three species: M.
anisopliae, M. robertsii and M. flavoviride var. pemphigi. A large number of isolates similar to
M. anisopliae was however, sufficiently different and could be a new species or variety of M.
anisopliae. All 106 isolates proved to be pathogenic to T. infestans. There was a highly
significant effect of the isolate on cumulative mortality of nymphs 8 d after inoculation (p.i.) of
conidia (F9, 30 = 11.2; P < 0.001). Values of lethal time to obtain 90% mortality varied from 6.6
d (M. robertsii IP 34) to 9.7 d (M. f. var. pemphigi IP 143). IP 34 differed significantly from
other tested isolates. The lethal concentration to obtain 90% mortality for IP 34 was 7.2 x 103
(C.I. 4.4 x 103-6.4 x 105 CFU/cm2) at 10 d p.i. This is the first report of activity of M. robertsii
against T. infestans and results obtained with IP 34 emphasize the potential of this isolate for
the biological control of triatomine vectors.
52
Introduction
Members of the genus Metarhizium are soil-borne anamorphs of clavicipitacean fungi that
affect arthropods. Especially Metarhizium anisopliae play an important role in agriculture pest
control (Faria & Wraight 2007). Since the description of the genus Metarhizium in 1883
complex inter and intraspecific relationship and their distribution around the world were
investigated (Tulloch 1976, Driver et al. 2000, Bischoff et al. 2006, 2009, Meyling & Eilenberg
2007, Humber et al. 2009). Molecular techniques, particularly gene sequencencing, together
with morphological studies provide nowadays more reliable results on taxonomy and
phylogeny. In a more recent revision based on sequencing of the nuclear ribosomal internal
transcribed spacer (ITS), three species were recognized: M. album, M. flavoviride with four
varieties and an undetermined M. flavoviride “Type E”, and M. anisopliae with another four
varieties (Driver et al. 2000). However, ITS sequencing alone data did not provide a sufficient
resolution to determine the relationship among some strains studied and they were therefore
classified as varieties. In the most recent studies on the genus Metarhizium based on multigene
sequencing Bischoff et al. (2006, 2009) described three new species (M. frigidum, M. globosum
and M. robertsii), resurrected M. brunneum, promoted three varieties to species level (M.
acridum, M. lepidiotae and M. majus) and synonymized M. guizhouense with M. taii.
Moreover, authors recognized the following species and varieties: M. anisopliae, M.
pingshaense, M. flavoviride var. flavoviride, M. flavoviride var. minus and M. flavoviride var.
pemphigi.
Whereas M. anisopliae was frequently isolated around the world (Meyling & Eilenberg
2007), M. frigidum or M. globosum were found only in Australia or India, respectively
(Bischoff et al. 2006, 2009). In Brazil there is still little information about the occurrence of
Metarhizium spp. in different biomes. M. anisopliae, M. acridum, M. majus, M. flavoviride, M.
pingshaense and M. robertsii were already isolated from insects or soils (Tigano et al. 2002,
Luz et al. 2004, Humber et al. 2009, Rocha et al. 2009). Identification to the species level
based only on morphological characteristics used in these and other studies bears a risk of
misidentification (Inglis et al. 1999, Yanaka-Schäfer et al. 2008).
The Cerrado is one of the world’s top biodiversity hotspots and the second largest Brazilian
biome with nearly 2 million km2 located mainly in Central Brazil. A better knowledge on the
occurrence and potential for biological control of Metarhizium spp. in this biome will
contribute to understand better the diversity and distribution of species and utility as control
agents against pest insects in this region.
53
Despite advances in agriculture pest control, there is still little information on the potential
of Metarhizium spp. for vector control. In Latin America more than 12 million people are
infected with Trypanosoma cruzi and another 28 million live in areas at risk of Chagas disease
(Dias et al. 2008). After years of intense combat the classic vector of Chagas disease in the
Southern Cone, T. infestans, is considered eradicated in many areas (Dias et al. 2002).
However, there are areas where this species was detected after eradication, and vector
populations resistant to pyrethroids have been reported in Argentina and Bolivia (Audino et al.
2004, Picollo et al. 2005, Cecere et al. 2006, Orihuela et al. 2008). New, more efficient
products, that are less harmful to the environment and humans, are required for an effective
control of this and other triatomine vectors. Fungi are promising candidates for integrated
control of these vectors. Within the genus Metarhizium only M. anisopliae has been tested
against triatomines and showed to be highly active under laboratory conditions (Luz et al.
1998, 2004). This species was detected in peridomestic habitats of triatomines in Central Brazil
and probably act as an antagonist of these vectors (Luz et al 2004). Powerful mycoinsecticides
could be developed with virulent species and strains of this genus.
We report on the detection of Metarhizium spp. in soils from the Cerrado in Central Brazil,
their TEF based identification, and activity against Triatoma infestans.
Material and Methods
Sampling of substrates - A total of about five hundred soil and slurry samples were
collected during the rainy season, from October 2000 until March 2001 in different areas of the
Central Brazilian Cerrado: Ema National Park (150 soils and 45 slurries), Silvânia National
Forest (45 soils and 5 slurries) and Northern State of Goiás (200 soils and 41 slurries). For each
sample, about 25 g soil were scraped from the soil surface to a depth of 2-3 cm or slurry
without water taken from areas with stagnant water at a maximal 30 cm deepness at randomly
selected locations, transferred to a plastic bag and stored at 20°C.
In vivo detection of fungi. In the laboratory, fungi were baited from substrates using T.
infestans nymphs. For this, soils and slurries were homogenized, and about 3 g of each sample
were transferred to a Petri dish (90 x 15 mm). Ten laboratory-reared, newly emerged and unfed
third instar nymphs (N3) of T. infestans were permanently exposed onto each substrate for 20 d
in containers (33 x 37 x 22 cm) at 25°C and > 98% relative humidity (RH). Nymphs were not
fed during the assays. Humidity in the containers was maintained by a saturated aqueous
solution of K2SO4 at the bottom of the containers (Winston & Bates 1960). Mortality was
monitored daily. Dead insects were dipped in 93% alcohol, surface-sterilized in 2.5% sodium
54
hypochlorite for 3 min, and then washed three times for 1 min in sterile water. Cadavers were
then incubated in Petri dishes on filter paper for 15 d at 25°C and RH > 98%. Fungal
development on cadavers was evaluated daily, and emerging fungi transferred onto complete
medium amended with chloramphenicol (CMC: 0.001 g FeSO4, 0.5 g KCl, 1.5 g KH2PO4, 0.5
g MgSO4 ⋅ 7 H2O, 6.0 g NaNO3, 0.001 g ZnSO4, 1.5 g hydrolysed caseine, 0.5 g yeast extract,
10 g glucose, 2 g peptone, 20 g agar, 1 g chloramphenicol and 1000 mL distilled water).
In vitro detection. Fungi were also isolated from both soils and slurries using modified
Chase medium (MCM: oatmeal infusion (2%), 20 g agar, 0.3 g dodine (N-dodecylguanidine
monoacetate, Cyprex 65 WP), 5 mg chlortetracycline, 0.4 g penicillin, 1 g streptomycin, 10 mg
crystal violet and 1000 ml distilled water (Chase et al. 1986)). For each sample, 1 g substrate
was suspended in 10 ml sterile 0.1% Tween 80, vortexed for 3 min and filtered through sterile
gauze. Each suspension was then diluted (10-2) in distilled sterile water, spread onto MCM, and
incubated for 20 days at 25 ± 0.5°C and 12h photophase. Developing colony forming units
(CFU) were examined daily, and fungi inoculated separately on CMC.
Fungi were identified by observing of macroscopic appearance and microscopic
examination of the form, color and size of conidiogenous cell, conidia chain and conidia. All
isolates were stored in the fungal culture collection of the Institute of Tropical Pathology and
Public Health, Federal University of Goiás, Goiânia, Brazil.
Molecular Characterization - Genomic DNA was extracted from mycelium previously
grown in 125 mL complete medium, with shaking at 150 rpm, 25°C for 7 d, using the CTAB
(cetyltrimethylammonium bromide) extraction method of Rogers and Bendich (1988). Partial
sequences of three nuclear genes were amplified and sequenced for this study. Partial
sequences of the 5' intron-rich region of the translation elongation factor 1-alpha (TEF intron
region) were amplified by PCR using primers 5' TEF intron region: EF1T (5'-
ATGGGTAAGGARGACAAGAC) and EF2T (5'-GGAAGTACCAGTGATCATGTT)
(Rehner & Buckley 2005, Bischoff et al. 2006). In order to confirm the results obtained by
sequencing the TEF region, the internal transcribed spacer (ITS) regions ITS1 and ITS2 as well
as the central 5.8S rDNA of the IP 30, IP 46, IP 60, IP 101, IP 119 and IP 120 were sequenced
using primers which annealed to the 3' end of the small sub-unit rDNA (18D; 5'
CACACCGCCCGTCGCTCCTACCGA) and to the 5' end of the large sub-unit rDNA (28CC;
5' ACTCGCCGTTACTAGGGGAA), respectively (Hillis & Dixon 1991). The PCR products
were checked using agarose gel electrophoresis, and bands then purified using the E.N.Z.A. TM
55
Cycle Pure Kit (Omega bio-tek). Sequencing of both strands of the PCR products was
accomplished with the BigDye Terminator v.3.1 kit (Applied Biosystems), and an ABI 3130
automatic sequencer. Selected TEF sequences of different species of Metarhizium available
from the GenBank database and sequences of the isolates IP 332, IP 338 and IP 348 originating
from another Cerrado locality (Santa Branca farm, Rocha et al. 2009) were used in the analysis
(Table 1).
Assembled sequences were aligned using MUSCLE (Edgar, 2004). A cladistic analysis was
conducted under the maximum parsimony (MP) criterion, for all molecular loci individually
and in combination, using PAUP* (version 4.0b10, Swofford 1998). Heuristic searches
comprised five cycles of random taxon addition, holding one tree per cycle, which was
repeated 1000 times. Alignment gaps were treated as missing data and character-state
optimization was by accelerated transformation (ACCTRAN). Branch swapping was by tree
bisection reconnection (TBR) and the best trees from the first phase of the search were
subjected to a further round of TBR branch swapping to widen tree space. Branch support for
trees was assessed using 1000 bootstrap pseudoreplicates (Felsenstein, 1985), utilizing the
same heuristic search strategy as above. To reduce the effects of homoplasy in the data
matrices, five cycles of progressive character reweighting, as implemented in PAUP*, were
applied, optimizing for the maximum fit to the rescaled consistency index (RC), and including
TBR branch swapping after each reweighting. Branch support for trees based on the
reweighted matrices was again evaluated using 1000 bootstrap pseudoreplicates.
In vivo tests – The pathogenicity of all Metarhizium sp. was tested. For this, 1 ml of
suspended conidia in water was applied using a semi-automatic pipette upon filter paper with 9
cm of diameter in a Petri dish, at a final concentration of 5x105 CFU (colony forming
unit)/cm2. After drying for 1 h, ten T. infestans N3 were transferred onto the treated filter paper
and incubated for 15 d at 25 ± 1 °C, 12 h photophase and RH > 98%. Dead insects were
transferred to a humid chamber. Fungal development on cadavers was examined for 15 d and
their morphology compared with previously inoculated fungi.
Five ml of suspended conidia of ten promising isolates of different Metarhizium species,
were applied directly on N3 spraying with a Potter spray tower (Burkard, Hertfordshire) in a
final concentration of 1×108, conidia/ml corresponding to 2.3×105 CFU/cm2 treated surface
(Lazzarini et al. 2006). Control nymphs were treated with 0.1 % Tween 80 only. After drying
for 1 h at ambient temperature and humidity nymphs were placed on filter paper in plastic Petri
dishes (90×15 mm) and held in containers at humidity close to saturation (Winston & Bates
1960). The mortality was examined by 10 d. IP 34 was also tested by applying five different
56
concentrations of conidia corresponding to 2.3x103, 7x103, 2.3x104, 7x104 and 2.3x105
CFU/cm2, as mentioned before (Lazzarini et al. 2006).
Analysis - Mortality data were arcsine-square root transformed and then analyzed with
analysis of variance (ANOVA) and the Student-Newman-Keuls (SNK) multiple range test for
comparison of means. Means were considered significantly different at P < 0.05. Lethal time
(LT) to kill 50% and 90% of nymphs were calculated using the method of Throne et al. 1995a,
1995b. Lethal concentrations (LC) to kill 50% and 90% were calculated by Probit analysis.
Results
A total of 106 Metarhizium sp. was isolated from 101 soil and 5 in slurry samples (Table
2). Of all substrates investigated, 25.6% and 5.5% of soil and slurry samples were positive for
Metarhizium, respectively. The highest number of isolates was detected in the Ema National
Park (61.3%), followed by the Northern State of Goiás (31.1%) and Silvânia National Forest
(7.6%) (Table 2). Only 12 isolates (IP 1, IP 5, IP 72, IP 105, IP 107, IP 108, IP 118, IP 119, IP
120, IP 123, IP 125, IP 134) were obtained using MCM, and all other 94 isolates with T.
infestans as insect bait.
DNA Sequence
A total of 63 Metarhizium isolates from Cerrado were sequenced. The size of the TEF
intron region amplified from all isolates was 675 base pairs with 705 aligned characters that
included 162 parsimony-informative characters, 509 constant characters and 34 variable
characters that were parsimony-uninformative. The MP phylogenetic analysis showed that
Metarhizium isolates from the Cerrado tested belong in fact to at least three species (Figure 1).
The largest number of 53 isolates were close to M. anisopliae, however, with marked
difference. The second largest group, composed of IP 34, IP 123, IP 125, IP 145, IP 146, IP
332, IP 338 and IP 348, clustered with M. robertsii ARSEF 6472 and ARSEF 727, and the
isolates were identified as M. robertsii (Figure 1). The strain IP 119 was highly similar to M.
anisopliae ARSEF 7487 and clustered with other M. anisopliae, ARSEF 6472 and E6. Strain
IP 143 showed to be a M. flavoviride var. pemphigi, due to its strong similarity to ARSEF 7491
and this grouping was supported by a bootstrap of 100% (Figure 1). The sequencing of ITS1-
5.8S-ITS2 rDNA resulted in the amplification of about 655 base pairs. The MP phylogenetic
analysis showed that 5 isolates belonging to the largest group of Metarhizium based in MP
analysis of TEF sequence (IP 30, IP 46, IP 60, IP 101 and IP 120) formed a group supported by
a bootstrap of 82% and did not clustered with any M. anisopliae standard (Figure 2). IP 119
57
clustered again with M. anisopliae isolates as ARSEF 7487, FI-1027, E6 and M. anisopliae
var. anisopliae LCR 148 (Figure 2).
Activity against T. infestans
All 106 isolates proved to be pathogenic to T. infestans. First dead nymphs were found 4 d
post-inoculation (p.i.). At 10 d p.i. 75.5% of isolates had killed ≥ 90% of the nymphs. Only
4.7% of the isolates induced mortality < 50% at the same moment. Five days later no nymphs
had survived with the exception of IP 103 with 30% of surviving N3. The development of
inoculated fungi was observed on all cadavers 15 d after incubation in RH > 98%.
When testing activity of selected strains (Table 3), first dead nymphs were found 3 d p.i.
and exposure to RH > 98%. At 8 d p.i. there was a highly significant effect of the isolate on
cumulative mortality (F9, 30 = 11.2; P < 0.001). At this moment, isolates molecularly similar to
M. anisopliae (IP 1, IP 41, IP 46, IP 60, IP 119), except IP 101 and M. robertsii IP 34 induced
mortality ≥ 90% of nymphs whereas only 30% of dead insects were found with M. f. var.
pemphigi IP 143 (Table 3). Values of LT50 varied from 5.7 d (IP 34) and 8 d (IP 143) and
values of LT90 from 6.6 d (IP 34) and 9.7 d (IP 143). IP 34 differed significantly from others
tested isolates (Table 3). The lethal concentration (LC50) to obtain 50% mortality of this isolate
was 2.8x103 (C.I. 4.4 x102-4.6x103) and the LC90 was 7.2x103 (C.I. 4.4x103-6.4x105 CFU/cm2)
at 10 d p.i.
Discussion
The relative high number of isolates made clear that fungi of the genus Metarhizium are
widespread in unaltered soils of the Brazilian Cerrado and can be found to a lesser extent in
aquatic habitats. The results underlining the utility of T. infestans and other triatomines for
baiting of entomopathogenic fungi such as Metarhizium spp., Beauveria spp.,
Isaria/Paecilomyces spp. and Pochonia chlamydosporia (Luz et al. 2004, Rocha et al. 2009,
Rocha, Inglis, Humber, Kipnis, Luz unpublished data). M. flavoviride var. pemphigi is reported
for the first time in Brazil and the unique isolate indicated a low incidence in soils of the tested
region.
TEF and ITS sequencing showed that largest group of Metarhizium isolates from the
Cerrado was sufficiently different from M. anisopliae and these isolates belong probably to a
new variety of M. anisopliae not yet described. It is important to note that the ITS sequence has
been considered to have a limited power resolution in the differentiation among species and
varieties (Rehner & Buckley 2005, Bischoff et al. 2006, 2009). Nevertheless it was possible to
distinguish clearly the isolates of the largest group of Metarhizium from all standard M.
58
anisopliae used. M. robertsii has been described recently (Bischoff et al. 2009) and was found
mostly in coleopteran, lepidopteran, orthopteran and hemipteran insects mainly from the
Americas. This species has also already been isolated in the Cerrado (Humber et al. 2009). It is
remarkable that only a single isolate of M. anisopliae, IP 119, has been confirmed within the
tested isolates. This species has been reported with frequency in soils of the Cerrado and other
regions of Brazil (Luz et al. 2004, Rocha et al. 2009, Humber et al. 2009). These fungi,
morphologically identified as M. anisopliae, could be in fact related to other species of the
genus Metarhizium or varieties of M. anisopliae. Morphological and molecular studies would
be necessary to understand better the distribution of M. anisopliae and other species occurring
in Brazilian biomes.
This is the first report on the activity of M. flavoviride var. pemphigi and M. robertsii
against T. infestans. At humidities close to saturation most of isolates were highly active
against T. infestans nymphs. Whereas M. flavoviride var. pemphigi IP 143 induced the lowest
mortality among nymphs and has probably no interest for triatomine vector control, M.
robertsii IP 34 is actually with other Metarhizium one of the most promising candidates within
the genus Metarhizium found in Central Brazil (Luz et al. 2004, Lazzarini et al. 2006). More
investigations about the activity of this strain are necessary in order to confirm its potential for
the biological control of triatomine vectors.
59
References
Audino PG, Vassena C, Barrios S, Zerba E, Picollo MI, 2004. Role of enhanced detoxication in
a deltamethrin-resistant population of Triatoma infestans (Hemiptera, Reduviidae) from
Argentina. Memmórias do Instituto Oswaldo Cruz 99: 335–339.
Bischoff JF, Rehner AS, Humber RA, 2006. Metarhizium frigidum sp. nov.: a cryptic species
of M. anisopliae and a member of the M. flavoviride. Mycologia 98: 737–745.
Bischoff JF, Rehner SA, Humber RA, 2009. A multilocus phylogeny of the Metarhizium
anisopliae lineage. Mycologia 101: 508–528.
Cecere MC, Vazquez-Prokopec GM, Gürtler RE, Kitron U, 2006. Reinfestation Sources for
Chagas Disease Vector, Triatoma infestans, Argentina. Emerging Infection Disease 12:
1096–1102.
Chase AR, Osborne LS, Ferguson VM, 1986. Selective isolation of the entomopathogenic
fungi Beauveria bassiana and Metarhizium anisopliae from an artificial potting medium.
Florida Entomologist 69: 285–92.
Dias JCP, Prata A, Correia D, 2008. Problems and perspectives for Chagas disease control: in
search of a realistic analysis. Revista da Sociedade Brasileira de Medicina Tropical
41:193–196.
Dias JCP, Silveira AC, Schofield CJ, 2002. The impact of Chagas disease control in Latin
America. A Review. Memórias do Instituto Oswaldo Cruz 97: 603–612.
Driver F, Milner RJ, Trueman JWH, 2000. A taxonomic of Metarhizium based on a
phylogenetic analysis of rDNA sequence data. Mycological Research 104: 134–150.
Edgar RC, 2004. MUSCLE: multiple sequence alignment with high accuracy and high
throughput. Nucleic Acids Research 32: 1792–1797.
Faria MR, Wraight SP, 2007. Mycoinsecticides and mycoacaricides: a comprehensive list with
worldwide coverage and international classification of formulation types. Biological
Control 43: 237–256.
Felsenstein J, 1985. Confidence limits on phylogenies: an approach using the bootstrap.
Evolution 39: 783–791.
Hillis DM, Dixon MT, 1991. Ribosomal DNA: Molecular evolution and phylogenetic
inference. The Quarterly Review of Biology 66: 411–453.
Humber RA, Hansen KS, Wheeler MM, 2009. Metarhizium and Metarhiziopsis. ARSEF
catalog, USDA-ARS collection of entomopathogenic fungal cultures; http://arsef
http://arsef.fpsnl.cornell.edu.
60
Inglis PW, Magalhães BP, M. Valadares-Inglis C, 1999. Genetic variability in Metarhizium
flavoviride revealed by telomeric fingerprinting. FEMS Microbiological Letter 179: 49–52.
Lazzarini GMJ, Rocha LFN, Luz C, 2006. Impact of moisture on in vitro germination of
Metarhizium anisopliae and Beauveria bassiana and their activity in Triatoma infestans.
Mycological Research 110: 458 –492.
Luz C, Rocha LFN, Nery GV, 2004. Detection of entomopathogenic fungi in peridomestic
triatomine-infested areas in Central Brazil and fungal activity against Triatoma infestans
(Klug) (Hemiptera: Reduviidae). Neotropical Entomology 33: 783–791.
Luz C, MS Tigano, IG Silva, CMT Cordeiro, SM Aljanabi, 1998. Selection of Beauveria
bassiana and Metarhizium anisopliae to control Triatoma infestans. Memórias do Instituto
Oswaldo Cruz 93: 839–846.
Meyling NV, Eilenberg J, 2007. Ecology of the entomopathogenic fungi Beauveria bassiana
and Metarhizium anisopliae in temperate agroecosystems: Potential for conservation
biological control. Biological Control 43: 145–155.
Orihuela PLS, Vassena CV, Zerba EM, Picollo MI, 2008. Relative contribution of
monooxygenase and esterase to pyrethroid resistance in Triatoma infestans (Hemiptera:
Reduviidae) from Argentina and Bolivia. Journal of Medical Entomology 45: 298–306.
Picollo MI, Vassena C, Orihuela PS, Barrios S, Zaidemberg M, Zerba E, 2005. High
resistance to pyrethroid insecticides associated with ineffective field treatments in Triatoma
infestans (Hemiptera: Reduviidae) from Northern Argentina. Journal of Medical
Entomology 42: 637–642.
Rehner AS, Buckley E, 2005. A Beauveria phylogeny inferred from nuclear ITS and EF1-α
sequences: evidence for cryptic diversification and links to Cordyceps teleomorphs.
Mycologia 97: 84–98.
Rocha LFN, Tai MHH, Santos AH, Albernaz DAS, Humber RA, Luz C, 2009. Occurrence of
invertebrate-pathogenic fungi in a Cerrado ecosystem in Central. Biocontrol Science and
Technology 19: 547–553.
Rogers SO, Bendich AJ, 1988. Extraction of DNA from plant tissues. In: Gelvin, S. B &
Schilperpoort, R. A., Verma DPS (Eds), Plant molecular biology manual, Vol. A6.
Dordrecht: Kluwer Academic Publishers, 1–10.
Swofford DL, 1998. PAUP*: Phylogenetic analysis using parsimony and other methods.
Version 4. Sinauer Associates, Sunderland, Massachusetts.
Throne JE, Weaver DK, Baker JE, 1995a. Probit analysis assessing goodness-of-fit based on
back transformation and residuals. Journal of Economic Entomology 88:1513–1516.
61
Throne JE, Weaver DK, Chew V, Baker JE, 1995b. Probit analysis of correlated data: multiple
observations over time at one concentration. Journal of Economic Entomology 88: 1510–
1512.
Tigano MS, Faria MR, Martins I, 2002. Catálogo da coleção de fungos entomopatogênicos. 2°
ed. Brasília, Embrapa-Cenargen, 104 p.
Tulloch M, 1976. The genus Metarhizium. Transactions of the British Mycological Society 66:
407–411.
Winston PW, Bates DH, 1960. Saturated salt solutions for the control of humidity in biological
research. Ecology 41: 232-237.
Yanaka-Schäfer1 FY, Onder LPD, Panichi MC, Mendes RG, Fagundes NJR, Bandinelli JB &
Bogo MR 2008. Sequence analysis of the rDNA intergenic spacer of Metarhizium strains
isolated in Brazil. Genetics and Molecular Biology 31: 116–121.
Fig 1– Maximum parsimony strict consensus tree of aligned translation elongation factor 1
alpha (TEF) gene (partial) sequence data. Trees were rooted using the sequence from M.
flavoviride var. flavoviride ARSEF 4730. Support for branches is given as a percentage of 1000
bootstrap pseudoreplicates.
Fig 2– Maximum parsimony strict consensus tree of aligned internal transcribed spacer
(ITS) gene (partial) sequence data. Trees were rooted using the sequence from M. flavoviride
var. flavoviride ARSEF 2024, M. flavoviride var. pemphigi F658 and FI-72, M. flavoviride var.
minus ARSEF 2037. Support for branches is given as a percentage of 1000 bootstrap
pseudoreplicates.
62
Conclusões
A grande quantidade de isolados e espécies de fungos patogênicos encontrados nas
diferentes áreas do Cerrado no estado de Goiás estudadas sugere que neste bioma existe uma
alta diversidade de fungos com potencial para ser usado no controle biológico de
invertebrados-praga. Fungos, especialmente do gênero Metarhizium, são freqüentes em solos
do Cerrado enquanto Evlachovaea-like ocorrem com menor incidência.
O isolamento de fungos foi diretamente ligado aos invertebrados iscas utilizados neste
estudo. Os triatomíneos estudados mostraram ter alta suscetibilidade à infecção com fungos e
assim têm grande utilidade como isca para o isolamento destes microrganismos.
Os resultados dos estudos morfológicos e moleculares com os isolados de Evlachovaea
deixaram claro que o gênero Evlachovaea deve ser sinonimizado com o gênero Isaria. O maior
grupo de isolados de Evlachovaea, grupo II, são I. cateniannulata enquanto os Evlachovaea do
grupo I são provavelmente uma nova espécie de Isaria ainda não descrita.
Os isolados formando o maior grupo de Metarhizium obtidos de amostras coletadas no
Cerrado pertencem provavelmente a uma nova espécie ou variedade de M. anisopliae.
Dentre os isolados testados, M. robertsii IP 34 e I. cateniannulata IP 141 coletados no
Parque Nacional das Emas e na Floresta Nacional de Silvânia, respectivamente, têm maior
potencial para combate de T. infestans.
69
Bibliografia
Aché A, Matos AJ 2001. Interrupting Chagas disease transmission in Venezuela. Rev Inst Med
Trop S Paulo 43: 37-43.
Ahantarig A, Trinachartvanit W & Milne JR (2008) Tick-borne pathogens and diseases of
animals and humans in Thailand. Southeast Asian J Trop Med Public Health 39: 1015-
1032.
Albernaz DAS, Tai MHH, Luz C 2009. Enhanced ovicidal activity of an oil formulation of the
fungus Metarhizium anisopliae on the mosquito Aedes aegypti. Med Vet Entomol on line.
Alexander B & Maroli M 2003: Control of phlebotomine sandflies. Med Vet Entomol 17: 1-18.
Alexopoulos CJ, Mims CW & Blackwell M 1996. Introductory Mycology. New York, John
Wiley & Sons, Inc. x+869p. 4th Edition.
Almeida JEM, Batista-Filho A 2001. Banco de microrganismos entomopatogênicos. Rev
Biotec Cienc Des 20: 77-86.
Alves SB, Lopes RB 2008. Controle Microbiano de Pragas na América Latina. 1° ed.
Piracicaba: Fundação de Estudos Agrários Luiz de Queiroz-FEALQ: pp 414.
Amorim LB, Oliveira CMF, Rios EM, Regis L & Silva-Filha MHNL 2007. Development of
Culex quinquefasciatus resistance to Bacillus sphaericus strain IAB59 needs long term
selection pressure. Biolog Contr 42: 155-160.
Andrews P, Thyssen J, Lorke D 1983. The biology and toxicology of the molluscicide,
Bayluscide. Pharmacol Ther 19: 245-295.
Audino PG, Vassena C, Barrios S, Zerba E, Picollo MI 2004. Role of enhanced detoxication in
a deltamethrin-resistant population of Triatoma infestans (Hemiptera, Reduviidae) from
Argentina. Mem Inst Oswaldo Cruz 99: 335-339.
Barreau C, Jousset FX, Bergoin M 1996. Pathogenicity of the Aedes albopictus Parvovirus
(AaPV), a denso-like virus, for Aedes aegypti mosquitoes. J Invertebr Pathol 68: 299-
309.
Barrett ADT & Higgs S 2007. Yellow Fever: A Disease that Has Yet to be Conquered. Annu.
Rev. Entomol. 52: 209-229.
Bischoff JF, Rehner SA, Humber RA 2009. A multilocus phylogeny of the Metarhizium
anisopliae lineage. Mycologia. 101: 508–528.
Bischoff JF, Rehner SA, Humber RA 2006. Metarhizium frigidum sp. nov.: a cryptic species of
M. anisopliae and a member of the M. flavoviride complex. Mycologia. 98: 737–745.
Brengues C, Hawkes NJ, Chandre F, McCarroll L, Duchon S, Guillet P, Manguin S, Morgan
JC, Hemingway J 2003. Pyrethroid and DDT cross-resistance in Aedes aegypti is
70
correlated with novel mutations in the voltage-gated sodium channel gene. Med Vet
Entomol 17: 87-94.
Brogdon WH, McAllister JC 1998. Insecticide resistance and vector control. Emerg Inf Dis 4:
605-613.
Butt TM & Goettel MS 2000. Bioassays of entomogenous fungi. Bioassays of
entomopathogenic microbes and nematodes. Ed. CAB International. 141-195.
Cecere MC, Vazquez-Prokopec GM, Gürtler RE & Kitron U 2006. Reinfestation Sources for
Chagas Disease Vector, Triatoma infestans, Argentina. Emerg Infect Dis 12: 1096-1102.
Charles JF, Nielsen-Leroux C & Delécluse A 1996. Bacillus sphaericus toxins: molecular
biology and mode of action. Annu Rev Entomol 4: 451-472.
Chalegre KDM, Romão TP, Amorim LB, Anastacio DB, Barros RA, Oliveira CMF, Regis L,
Melo-Neto OP, and Silva-Filha MHNL 2009. Detection of an allele conferring resistance
to Bacillus sphaericus binary toxin in Culex quinquefasciatus populations by molecular
screening. Appl Environ Microbiol 75: 1044-1049.
Charrel RN, Attoui H, Butenko AM, Clegg JC, Deubel V, Frolova TV, Gould EA, Gritsun T S,
Heinz FX, Labuda M, Lashkevich VA, Loktev V, Lundkvist A, Lvov DV, Mandl CW,
Niedrig M, Papa A, Petrov VS, Plyusnin A, Randolph S, Süss J, Zlobin VI &
Lamballerie X (2004). Tick-borne virus diseases of human interest in Europe. Clin
Microbiol Infect 10, 1040-1055.
Chase AR, Osborne LS, Ferguson VM 1986. Selective isolation of the entomopathogenic fungi
Beauveria bassiana and Metarhizium anisopliae from an artificial potting medium.
Florida Entomol 69: 285-291.
Costa GL, Sarquis MI, Moraes AML 2002. Isolation of Beauveria bassiana and Metarhizium
anisopliae var. anisopliae from Boophilus microplus tick (Canestrini, 1887), in Rio de
Janeiro State, Brazil. Mycopathologia 154:207–209.
D`Amato C, Torres JPM, Malm O 2002. DDT (dicloro difenil tricloroetano): toxicidade e
contaminação ambiental - uma revisão. Quim Nova 25: 1002-2002.
Dalzoto PR, Glienke-Blanco C, Kava-Cordeiro V, Araújo WL & Azevedo JL 2003. RAPD
analyses of recombination processes in the entomopathogenic fungus Beauveria. Mycol
Res 107: 1069-1074.
Dennis DT, Piesman JF 2005. Overview of tick-borne infections of humans. In: Goodman JL,
Dennis DT, Sonenshine DE, eds. Tick-borne diseases of humans. Washington, DC:
American Society for Microbiology Press, 3-11.
71
Destéfano RHR, Destéfano SAL, Messias CL 2004. Detection of Metarhizium anisopliae var.
anisopliae within infected sugarcane borer Diatraea saccharalis (Lepidoptera, Pyralidae)
using specific primers. Gen Mol Biol 27: 245-252.
Dias JCP, Leão AEA 1967. Parasitismo de fungos (Beauveria bassiana) sobre triatomíneos
brasileiros criados em laboratório. Atas SocBiol 2: 85-87.
Dias JCP, Silveira AC, Schofield CJ 2002. The impact of Chagas disease control in Latin
America. A Review. Mem Inst Oswaldo Cruz 97: 603-612.
Dias JCP, Prata A & Correia D 2008. Problems and perspectives for Chagas disease control: in
search of a realistic analysis. Rev Soc Bras Med Trop 41:193-196
Driver F, Milner RJ, Trueman JWH. A taxonomic revision of Metarhizium based on a
phylogenetic analysis of rDNA sequence data. Mycol Res. 2000;104:143–150.
Dujardin JP, Schofield CJ, Panzera F 2000. Les vecteurs de la maladie de Chagas. recherches
taxonomiques, biologiques et génétiques, Ac Roy Sci Outre-Mer, Classe Sci Nat Méd,
Paris, 162 pp.
Dujardin JP, Schofield CJ, Tibayrenc M 1998. Population structure of Andean Triatoma
infestans: allozyme frequencies and their epidemiological relevance. Med Vet Entomol
12: 20-29.
Fargues J, Bon MC, Manguin S & Couteaudier Y 2002. Genetic variability among
Paecilomyces fumosoroseus isolates from various geographical and host insect origins
based on the rDNA-ITS regions. Mycol Res 106: 1066-1074.
Faria MR, Wraight SP 2007. Mycoinsecticides and mycoacaricides: a comprehensive list with
worldwide coverage and international classification of formulation types. Biol Control 43:
237-256.
Federici BA 1995. The future of microbial insecticides as vector control agents. J Am Mosq
Control Assoc 11: 260-268.
Federici BA, Park HW, Bideshi DK, Wirth MC, Johnson JJ 2003. Recombinant bacteria for
mosquito control. J Exp Biol 206: 3877-3885.
Fernandes EKK, Bittencourt VREP 2008. Entomopathogenic fungi against South American
tick species. Exp Appl Acarol 46: 71-93.
Freire LLC, Costa ABL, Góes LB, Oliveira NT 2001. DNA polymorphism and total protein in
mutants of Metarhizium anisopliae var. anisopliae (Metsch) Sorokin strain E9. Brazilian
J Microbiol 32: 93-97.
George JE, Pound JM & Davey RB 2004. Chemical control of ticks on cattle and the resistance
of these parasites to acaricides. Parasitology 129, S353–S366.
72
Glare TR, Milner RJ 1991. Ecology of entomopathogenic fungi. Handbook of Applied
Mycology (humans, animals e insects). Vol. 2, Ed. Arora, L. Ajello, and K. G. Mukerji.
547–612.
Graf JF, Gogolewski R, Leach-Bing N, Sabatini GA, Molento MB, Bordin EL & Arantes GJ
2004. Tick control: an industry point of view. Parasitology 129, S427–S442.
Gubler DJ 2005. The emergence of epidemic dengue fever and dengue hemorrhagic fever in
the Americas: a case of failed public health policy. Pan Am J Pub Health (PAHO) 17:
22-24.
Guimarães, MP 2005. Fasciola hepatica. In: Neves DP, Melo AL, Linardi PM, Vitor RWA,
Parasitologia Humana. 11º ed. São Paulo: Atheneu; 2005. p. 223–226.
Halstead SB 1993. Global epidemiology of dengue: health systems in disarray. Trop Med 35:
37-146.
Han Y, Liang Z, Chu H & Kang J 2005. Paecilomyces parvosporus, a new species with its
relativesfrom Yunnan Province, China. Mycotaxon 94: 357-363.
Hawksworth DL 1991. The fungal dimension of biodiversity: magnitude, significance, and
conservation. Mycol Res 95: 641-655.
Hemingway J, Hawkes NJ, McCarroll L, Ranson H 2004. The molecular basis of insecticide
resistance in mosquitoes. Insect Biocherm Mol Biol 34: 653-665.
Hemingway J, Ranson H 2000. Insecticide resistance in vectors of human disease. Annu Rev
Entomol 45: 371-391.
Hibbett DS, Binder M, Bischoff JF, Blackwell M, Cannon PF, Eriksson OE, Huhndorf S,
James T, Kirk PM, Lücking R, Lumbsch HT, Lutzoni F, Matheny PB, McLaughlin DJ,
Powell MJ, Redhead S, Schoch CL, Spatafora JW, Stalpers JA, Vilgalys R, Aime MC,
Aptroot A, Bauer R, Begerow D, Benny GL, Castlebury LA, Crous PW, Dai Y-C, Gams
W, Geiser DM, Griffith GW, Gueidan C, Hawksworth DL, Hestmark G, Hosaka K,
Humber RA, Hyde KD, Ironside JE, Kõljalg U, Kurtzman CP, Larsson K-H, Lichtwardt
R, Longcore J, Miadlikowska J, Miller A, Moncalvo J-M, Mozley-Standridge S,
Oberwinkler F, Parmasto E, Reeb V, Rogers JD, Roux C, Ryvarden L, Sampaio JP,
Schüßler A, Sugiyama J, Thorn RG, Tibell L, Untereiner WA, Walker C, Wang Z, Weir
A, Weiss M, White MM, Winka K, Yao Y-J & Zhang N 2007. A higher-level
phylogenetic classification of the Fungi. Mycol Res 111: 509-547.
Inglis GD, Goettel MS, Butt TM, Strasser H 2001. Use of hyphomycetous fungi for managing
insect pests. Fungi as Biocontrol Agents. Ed. CAB International. 23-67.
73
Inglis PW, Tigano MS 2006. Identification and taxonomy of some entomopathogenic
Paecilomyces spp. (Ascomycota) isolates using rDNA-ITS sequences. Genet Mol Biol
29: 132-136.
James TY, Kauff F, Schoch CL, Matheny PB, Hofstetter V, Cox C, Celio G, Gueidan C,
Fraker E, Mia˛ dlikowska J, Lumbsch HT, Rauhut A, Reeb V, Arnold EA, Amtoft A,
Stajich JE, Hosaka K, Sung G-H, Johnson D, O’Rourke B, Crockett M, Binder M, Curtis
JM, Slot JC, Wang Z, Wilson AW, Schüßler A, Longcore JE, O’Donnell K, Mozley-
Standridge S, Porter D, Letcher PM, Powell MJ, Taylor JW, White MM, Griffith GW,
Davies DR, Humber RA, Morton J, Sugiyama J, Rossman AY, Rogers JD, Pfister DH,
Hewitt D, Hansen K, Hambleton S, Shoemaker RA, Kohlmeyer J, Volkmann-Kohlmeyer
B, Spotts RA, Serdani M, Crous PW, Hughes KW, Matsuura K, Langer E, Langer G,
Untereiner WA, Lücking R, Büdel B, Geiser DM, Aptroot A, Diederich P, Schmitt I,
Schultz M, Yahr R, Hibbett DS, Lutzoni F, McLaughlin D, Spatafora J, Vilgalys R,
2006. Reconstructing the early evolution of the fungi using a six gene phylogeny. Nature
443: 818–822.
Karunaratne SHPP, Hemingway J 2001. Malathion resistance and prevalence of the malathion
carboxylesterase mechanism in populations of mosquito vectors of disease in Sri Lanka.
Bull World Health Organization 79: 1060-1064.
Khin MN, Jirakanjanakit N, Yoksan S, Bhamarapravati N 1994. Infection, dissemination,
transmission and biological attributes of dengue-2 PDK53 candidate vaccine virus oral
infection in Aedes aegypti. Am J Trop Med Hyg 51: 864-869.
Klink CA & Machado RB 2005. Conservation of the Brazilian Cerrado. Conserv Biol 19:
707−713.
Lacerda DR, Acedo MDP, Lemos Filho JP & Lovato MB 2002. A técnica de RAPD: uma
ferramenta molecular em estudos de conservação de plantas. Lundiana 3: 87-92.
Lacey L, Goettel MS 1995. Current developments in microbial control of insects.
Entomophaga 40: 202-211.
Lecuona RE, Edelstein MFB, Rossa FR & Arcas JA 2001. Evaluation of Beauveria bassiana
(Hyphomycetes) strains as potential agents for control of Triatoma infestans (Hemiptera:
Reduviidae). J Med Entomol 38: 172-179.
Lemos ERS, Rozental T, Villela LC 2002. Brazilian spotted fever: description of a fatal clinical
case in the State of Rio de Janeiro. Rev Soc Bras Med Trop 35: 523-525.
Lima JBP, Mello NV, Valle D 2005. Residual effect of two Bacillus thuringiensis var.
israelensis products assayed against Aedes aegypti (Diptera: Culicidae) in laboratory and
outdoors at Rio de Janeiro, Brazil. Rev Inst Med Trop S Paulo 47: 125-130.
74
Liu ZY, Milner RJ, McRae CF, Lutton GG 1993. The use of dodine in selective media for the
isolation of Metarhizium spp. from soil. J Invertebr Pathol 62: 248-251.
Liu ZY, Liang ZQ, Liu AY, Yao YJ, Hyde KD & Yu ZN 2002. Molecular evidence for
teleomorph-anamorph connections in Cordyceps based on ITS-5.8S r DNA sequences.
Mycol Res 106: 1100-1108.
Lowe D, Xi J, Meng X, Wu Z, Qiu D, Spear R 2005. Transport of Schistosoma japonicum
cercariae and the feasibility of niclosamine for cercariae control. Parasitol Int 54: 83-89.
Luangsa-ard JJ, Hywel-Jones NL, Manoch L & Samson RA 2005. On the relationships of
Paecilomyces sect. Isarioidea species. Mycological Research 109: 581-589.
Luz C, Fargues J, Romaña CA, Moreno J, Goujet R, Rougier M & Grunewald J 1994. Potential
of entomopathogenic Hyphomycetes for the control of the triatomine vectors of Chagas’
disease. Proc. 6. Int. Coll. Invertebr. Path Microbiol Control 1: 272-276.
Luz C, Fargues J, Grunewald J 1998 a. The effect of fluctuating temperature and humidity on
the longevity of starved Rhodnius prolixus. J Appl Entomol 122: 219-222.
Luz C, Tigano M, Silva IG, Cordeiro CMT, Aljanabi SM 1998 b. Selection of Beauveria
bassiana and Metarhizium anisopliae isolates to control Triatoma infestans. Mem Inst
Oswaldo Cruz 93: 839-846.
Luz C, Silva IG, Cordeiro CMT, Tigano M 1998 c. Beauveria bassiana (Hyphomycetes) as a
possible agent for biological control of Chagas disease vectors. J Med Entomol 35: 977-
979.
Luz C, Silva IG, Magalhães BP, Cordeiro CMT, Tigano M 1999. Control of Triatoma infestans
(Klug) (Reduviidae: Triatominae) with Beauveria bassiana (Bals.) Vuill. preliminary
assays on formulation and application in the field. An Soc Entomol Brasil 28: 101-110.
Luz C, Fargues J, Romaña CA 2003 a. Influence of starvation and blood meal-induced moult
on the susceptibility of nymphs of Rhodnius prolixus Stål (Hem., Triatominae) to
Beauveria bassiana (Bals.) Vuill. infection. J Appl Entomol 127: 153-156.
Luz C, Rocha LFN, Humber RA 2003 b. Record of Evlachovaea sp. (Hyphomycetes) on
Triatoma sordida in the State of Goiás, Brazil, and its activity against Triatoma infestans
(Reduviidae, Triatominae). J Med Entomol 40: 451-454.
Luz C, Rocha LFN, Nery G. 2004 a. Detection of entomopathogenic fungi in peridomestic
triatomine-infested areas in Central Brazil and fungal activity against Triatoma infestans
(Klug) (Hemiptera: Reduviidae). Neotropical Entomol 33: 783-791.
Luz C, Rocha LFN, Nery GV, Magalhães BP, Tigano MS 2004 b. Activity of oil-formulated
Beauveria bassiana against Triatoma sordida in peridomestic areas in Central Brazil.
Mem Inst Oswaldo Cruz 99: 211-218.
75
Luz C, Rocha LFN, Silva IG 2004 c. Pathogenicity of Evlachovaea sp. (Hyphomycetes), a new
species isolated from Triatoma sordida, in Chagas disease vectors under laboratory
conditions. Rev Soc Bras Med Trop 37: 189-191.
Luz C, Tai MHH, Santos AH, Rocha LFN, Albernaz DAS, Silva HHG 2007a. Ovicidal activity
of entomopathogenic hyphomycetes on Aedes aegypti (L.) (Diptera: Culicidae) under
laboratory conditions. J Med Entomol 44, 799-804.
Luz C, Netto MCB, Rocha LFN 2007b. In vitro susceptibility to fungicides by invertebrate-
pathogenic and saprobic fungi. Mycopathol 164: 39-47.
Luz C, Tai MHH, Santos AH, Silva HHG 2008. Impact of moisture on survival of Aedes
aegypti eggs and ovicidal activity of Metarhizium anisopliae under laboratory conditions.
Mem Inst Oswaldo Cruz 103: 214-215.
Marti GA, Scorsetti AC, Siri A, López Lastra CC 2005. Isolation of Beauveria bassiana (Bals.)
Vuill. (Deuteromycotina: Hyphomycetes) from the Chagas disease vector, Triatoma
infestans (Hemiptera: Reduviidae) in Argentina. Mycopathol 159: 389–391.
Martins JR, Furlong J 2001. Avermectina resistance of the cattle tick Boophilus microplus in
Brazil. Vet Record 149: 64.
Martins JR, Medri IM, Oliveira CM, Guglielmone A 2004. Ocorrência de carrapatos em
tamanduá-bandeira (Myrmecophaga tridactyla) e tamanduá-mirim (Tamandua
tetradactyla) na região do Pantanal Sul Mato-Grossense, Brasil Cienc Rural 34: 293 295.
Mas-Coma MS, Esteban JG & Bargues MD 1999. Epidemiology of human fascioliasis: a
review and proposed new classification. Bulletin of the World Health Organization 77, p
340-346.
Matias A, Riva J, Martinez E, Torrez M, Dujardin JP 2003. Domiciliation process of Rhodnius
stali (Hemiptera: Reduviidae) in Alto Beni, La Paz, Bolivia. Trop Med Int Health 8: 264-
268.
Medeiros Z, Oliveira C, Quaresma J, Barbosa E, Aguiar-Santos A M, Bonfim C, Almeida J,
Lessa F 2004. A filariose bancroftiana no município de Moreno – Pernambuco, Brasil.
Rev Bras Epidemiol 7: 73-79.
Mello-Silva CC, Vasconcellos MC, Pinheiro J, Rodrigues MLA 2006. Physiological changes
in Biomphalaria glabrata Say, 1818 (Pulmonata: Planorbidae) caused by sub-lethal
concentrations of the latex of Euphorbia splendens var. hislopii N.E.B (Euphorbiaceae.
Mem Inst Oswaldo Cruz 101: 3-8.
Mendes MC, Pereira JR, Prado AP 2007. Sensitivity of Boophilus microplus (Acari: Ixodidae)
to pyrethroids and organophosphate in farms in the Vale do Paraíba region, São Paulo,
Brazil. Arq Inst Biol 74: 81-85.
76
Metchnikoff E 1879. Diseases of the larvae of the grain weevil. Insects harmful to agriculture
[series]. Issue III.
Mitchell DJ, Kannwischer-Mitchell ME. & Dickson DW 1987. A semi-selective medium for
the isolation of Paecilomyces lilacinus. J Nematol 19: 255-256.
Mittermeier RA, Gil PR, Hoffman M, Pilgrim J, Brooks T, Mittermeier CG, Lamoreux J &
Fonseca GAB 2005. Hotspots Revisited: Earth's Biologically Richest and Most
Endangered Terrestrial Ecoregions. Conservation International, Washington, D.C. 392
pp.
Monnerat RG, Dias DGS, Silva SF, Martins ES, Berry C, Falcão R, Gomes ACMM, Praça LB,
Soares CMS 2005. Screening of Bacillus thuringiensis strains effective against
mosquitoes. Pesq Agropec Bras 40: 103-106.
Moscardi F, Souza ML 2002. Baculovírus para o controle de pragas: panacéia ou realidade?
Biotecno Ciênc Desenvolv 24: 22-29.
Muscio OA, Bonder MA, La Torre JL, Scodeller EA 2000. Horizontal transmission of triatoma
virus through the fecal-oral route in Triatoma infestans (Hemiptera: Triatominae). J Med
Entomol 37: 271-275.
Muscio OA, Torre JL, Bonder MA & Scodeller EA 1997. Triatoma vírus pathogenicity in
laboratory colonies of Triatoma infestans (Hemiptera: Reduviidae). J Med Entomol 34:
253-256.
Myers N, Mittermeier RA, Mittermeier CG, Fonseca GAB & Kent J 2000. Biodiversity
hotspots for conservation priorities. Nature 403: 853-858.
Neves DP 2005. Classe Arachnida. In: Costa JO, Botelho JR. Parasitologia Humana, 11. ed.
São Paulo: Editora Atheneu. p. 413-421
Noireau F, Bosseno MF, Carrasco R, Telleria J, Vargas F, Camacho C, Yaksic N, Brenière F
1995. Sylvatic triatomines (Hemiptera: Reduviidae) in Bolivia: trends toward domesticity
and possible infection with Trypanosoma cruzi (Kinetoplastida: Trypanoso-matidae). J
Med Entomol 32: 594-598.
Oliveira VC & Costa JLS 2002. Análise de restrição de DNA ribossomal amplificado
(ARDRA) pode diferenciar Fusarium solani f. sp. phaseoli de F. solani f. sp. glycines.
Fitopatol Brasil 27: 632-634.
Orihuela PLS, Vassena CV, Zerba EM & Picollo MI 2008. Relative contribution of
monooxygenase and esterase to pyrethroid resistance in Triatoma infestans (Hemiptera:
Reduviidae) from Argentina and Bolivia. J Med Entomol 45: 298-306.
Panter C, Frances SP 2003. A more selective medium for Culicinimyces clavisporus. J
Invertebr Pathol 82: 198-200.
77
Parameswaran G, Sankaran T 1977. Record of Beauveria bassiana (Bals.) Vuill. on
Linshcosteus sp. (Hemiptera: Reduviidae: Triatominae) in India. J Entomol Res 1: 113-
114.
Picollo MI, Vassena C, Orihuela PS, Barrios S, Zaidemberg M & Zerba E 2005. High
resistance to pyrethroid insecticides associated with ineffective field treatments in
Triatoma infestans (Hemiptera: Reduviidae) from Northern Argentina. J Med Entomol
42: 637-642.
Pieri OS 1995. Perspectivas no controle ambiental dos moluscos vetores da esquistossomose.
In FS Barbosa, Tópicos em Malacologia Médica, Fiocruz, Rio de Janeiro, p. 239-252.
Polanczyk RA, Garcia MO, Alves SB 2003. Potencial de Bacillus thuringiensis israelensis
Berliner no controle de Aedes aegypti. Rev Saúde Púb 37: 813-816.
Regis L, Silva SB, Melo-Santos MA 2000. The use of bacterial larvicides in mosquito and
black fly control programmes in Brazil. Mem Inst Oswaldo Cruz 95: 207-210.
Regis L, Silva-Filha MH, Nielsen-LeRoux C, Charles JF 2001. Bacteriological larvicides of
dipteran disease vectors. Trends Parasitol 17: 377-380.
Rehner SA, Buckley E. A Beauveria phylogeny inferred from nuclear ITS and EF1-αy
sequences: evidence for cryptic diversification and links to Cordyceps teleomorphs.
Mycologia. 2005;97:84–98.
Roberts DR, Andre RG 1994. Insecticide resistance issues in vector-borne disease control. Am
J Trop Med Hyg 50: 21-34.
Rocha LFN, Luz C 2009. Utility of six fungicides for selective isolation of Evlachovaea sp and
Tolypocladium cylindrosporum. Mycopathol. 167: 341-350
Rodgers SE & Mather TN (2007). Human Babesia microti incidence and Ixodes scapularis
distribution, Rhode Island, 1998–2004. Emerg Infect Dis 13: 633-635.
Romaña CA, Fargues J 1992. Relative susceptibility of different stages of Rhodnius prolixus to
the entomopathogenic hyphomycete Beauveria bassiana. Mem Inst Oswaldo Cruz 87:
363-368.
Rossman AY, Tulloss RE, Dell TEO, Thorn RG 1998. Introduction and overview. All taxa
biodiversity inventory of fungi in a Costa Rican conservation area. Ed. Parkway
Publishers, Inc. 1-12.
Rozas-Dennis GS, Cazzaniga NJ, Gúerin DMA 2002. Triatoma patagonica (Hemiptera,
Reduviidae), a new host for Triatoma virus. Mem Inst Oswaldo Cruz 97: 427-429.
Saueressig TM 2006. Produção de proteína animal de qualidade com sustentabilidade: controle
racional das parasitoses dos bovinos. Embrapa Documentos 157, p 46.
78
Samish M, Rehacek J (1999) Pathogens and predators of ticks and their potential in biological
control. Annu Rev Entomol 44: 159–182.
Santos AH, Tai MHH, Rocha LFN, Silva HHG, Luz C 2009. Dependence of Metarhizium
anisopliae on high humidity for ovicidal activity on Aedes aegypti. Biol Cont, on line.
Sarquis O, Pieri OS, Santos SAA 1997. Effects of Bayluscide WP70® on the survival and
water-leaving behaviour of Biomphalaria straminea, snail host of schistosomiasis in
northeast Brazil. Mem Inst Oswaldo Cruz 92: 619-623.
Sarquis O, Pieri OS, Cunha RA, Jurberg P 1998. Effects of Bayluscide WP70® on the kinetic
behaviour of Biomphalaria straminea in laboratory conditions. Mem Inst Oswaldo Cruz
93: 239-241.
Schofield CJ, Diotaiuti L & Dujardin J 1999. The process of domestication in Triatominae.
Mem Inst Oswaldo Cruz 94: 375-378.
Scholte E, Knols BGJ, Samson RA, Takken W 2004. Entomopathogenic fungi for mosquito
control: A review. J Insect Science 4: (19) 1-24.
Shimazu M, Teixera AR, Kishino KI 1994. Investigations on entomogenous fungi in the
Cerrado region and their utilization for microbial control of pests. Relatório técnico do
Centro de Pesquisa Agropecuária dos Cerrados, Planaltina, DF, Brasil: 202-214.
Silva RO, Silva HHG, Luz C 2004. Effect of Metarhizium anisopliae isolated from soil
samples of the central Brazilian cerrado against Aedes aegypti larvae under laboratory
conditions. Rev Pat Trop 33: 207-216.
Silva RO, Silva HHG, Ulhoa CJ, Luz C 2005. Is there a relationship between N-acetyl-β-D-
glucosaminidase activity of Metarhizium anisopliae (Metschn.) Sorokin (Hyphomycetes)
isolates from peridomestic areas in Central Brazil and larvicidal effect on Aedes aegypti
(L.) (Diptera, Culicidae)? J Appl Entomol 129: 158-164.
Silva IG, Silva JL, Silva HHG, Camargo M, Moura AF, Elias M, Santos AH 1992.
Distribuição dos vetores da tripossomíase americana capturados no ambiente domiciliar
no estado de Goiás no período de 1984/88. An Soc Entomol 21: 139-154.
Silveira AC, Feitosa VR, Borges R 1984. Distribuição de triatomíneos capturados no ambiente
domiciliar, no período de 1975/1983, Brazil. Rev Bras Malariol Doenças Trop 36: 15-
312.
Silveira EB, Al-Janabi SM, Magalhães BP, Carvalho LJCB & Tigano MS 1998. Polymorphism
of the Grasshopper Schistocerca pallens (Thunberg) (Orthoptera: Acrididae) and its
Natural Pathogen Metarhizium flavoviride Gams & Rozsypal (Hyphomycetes),
Revealed by RAPD Analysis. An Soc Entomol Brasil 27: 91-99.
79
Singh DK & Agarwal RA1991. Action sites of cypermethrin, a synthetic pyrethroid in the snail
Lymnaea acuminata. Acta Hydrochemt Hydrobiol 19: 425-430.
Sneh B 1991. Isolation of Metarhizium anisopliae from insects on an improved selective
medium based on wheat germ. J Invertebr Pathol 58: 269-273.
Somboon P, Prapanthadara L, Suwonkerd W 2003. Insecticide susceptibility tests of Anopheles
minimus s.l., Aedes aegypti, Aedes albopictus, and Culex quinquefasciatus in northern
Thailand. Southeast Asian J Trop Medicine Public Health 34: 87-90.
Sung GH & Spatafora JW 2004. Cordyceps cardinalis sp. nov., a new species of Cordyceps
with an east Asian-eastern North Americam can distribuiton. Mycologia 96:658-666.
Tantawy AA 2006. Molluscicidal effect of fenitrothion and anilofos on Lymnaea natalensis
and Biomphalaria alexandrina snails and on the free larval stages of Schistosoma
mansoni. J Egypt Soc Parasitol. 2006 Aug;36(2):629-42.
Thrane U 1990. Grouping Fusarium section discolor isolates by statistical analysis of
quantitative high performance liquid chromatographic data on secondary metabolite
production. J Microbiol Methods 12: 23-39.
Torres M, White JF, Bischoff 2006. Cordyceps spegazzinii sp. nov., a new species of the C.
militaris group. Mycotaxon 94: 253-264.
Vänninen I 1995. Distribution and occurrence of four entomopathogenic fungi in Finland:
effect of geographical location, habitat type and soil type. Mycol Res 100: 9-101.
Vassena CV, Picollo MI, Zerba EN 2000. Insecticide resistance in Brazilian Triatoma infestans
and Venezuelan Rhodnius prolixus. Med Vet Entomol 14: 51-55.
Veen KH & Ferron P 1966. A selective medium for isolation of Beauveria tenella and
Metarhizium anisopliae. J Invertebr Pathol 8: 268–26.
Vega SG, Guzman P, Garcia L, Espinosa J, Cortina-de-Nava C 1988. Sperm shape abnormality
and urine mutagenicity in mice treated with niclosamide. Mut Res 204: 269-276.
Vranjac A 2002. Informe Técnico Febre Maculosa Brasileira. Centro de Vigilância
Epidemiológica, Secretaria de Estado da Saúde de São Paulo.
ftp://ftp.cve.saude.sp.gov.br/doc_tec/ZOO/INF_MACULOSA.pdf
Whiteley HR, Schnepf HE 1986. The molecular biology of parasporal crystal body formation
in Bacillus thuringiensis. Ann Rev Microbiol 40: 549-576.
WHO 2002. Dengue and Dengue Haemorrhagic Fever. Fact sheet Nº 117. World Health
Organization, Geneva.
WHO 2005. Weekly epidemiological record, Nº 6, 49-60.
WHO 2006. Preventive chemotherapy in human helminthiasis. 63.
80
WHO 2007. WHO alarmed about the spread of dengue.
http://www.wpro.who.int/media_centre/press_releases/pr_23072007.htm. Acessado 11
de março de 2009.
WHO 2008. World Malaria Report 2008, pp 190.
http://www.who.int/malaria/wmr2008/malaria2008.pdf
Xiaonong Z, Minggang C, McManus D & Bergquist R 2002. Schistosomiasis control in the
21st century: Proceedings of the International Symposium on Schistosomiasis, Shanghai,
July 4–6, 2001. Acta Trop 82, 95-114.
Yaginuma K & Takagi K 1986. Improvement of a selective medium for isolation of
Metarhizium anisopliae (Metschnikoff) Sorokin. Japan J Appl Entomol Zool 30: 300-
301.
Yasui K 1993. Strategies of dengue vaccine development by WHO. Using new biotechnology.
Trop Med 35: 233-241.
Zerba EN 1999. Susceptibility and resistance to insecticides of Chagas disease vectors. Med
Buenos Aires 59: 41-46.
http://portal.saude.gov.br/portal/saude/visualizar_texto.cfm?idtxt=27670.
81
Anexo do artigo: Occurrence of invertebrate-pathogenic fungi in a Cerrado ecosystem in
Central Brazil
Figura 1. Invertebrados coletados na fazenda Santa Branca com micose durante a estação chuvosa de 2006 e 2007, e algumas estruturas destes fungos.
Figura 2. Desenvolvimento de fungos entomopatogênicos em Rhodnius neglectus. a – Metarhizium sp, b – Isaria cateniannulata, c – Paecilomyces lilacinus, d – Pochonia
chlamydosporia, e – Lecanicillium psalliotae.
82
Recommended