View
5
Download
0
Category
Preview:
Citation preview
Studies on Agrobacterium-mediatedTransformation in Oat (Avena sativa L.)
THESIS
Submitted to the
Jawaharlal Nehru Krishi Vishwa Vidyalaya, Jabalpur
In partial fulfilment of the requirement forthe degree of
MASTER OF SCIENCE
In
AGRICULTURE(MOLECULAR BIOLOGY AND BIOTECHNOLOGY)
By
NAGESH RAOSAHEB DATTGONDE
Biotechnology centreJawaharlal Nehru Krishi Vishwa Vidyalaya, Jabalpur (MP)
2013
CERTIFICATE- I
This is to certify that the thesis entitled, “Studies on Agrobacterium-mediated Transformation in Oat (Avena sativa L.)” submitted in partial
fulfillment of the requirement for the degree of MASTER OF SCIENCE INAGRICULTURE (Molecular Biology and Biotechnology) of Jawaharlal
Nehru Krishi Vishwa Vidyalaya, Jabalpur is a record of the bonafide research
work carried out by Mr. NAGESH RAOSAHEB DATTGONDE under my
guidance and supervision. The subject of the thesis has been approved by the
Student’s Advisory Committee and the Director of Instruction.
No part of the thesis has been submitted for any other degree or
diploma (Certificate awarded etc.) or has been published / published part has
been fully acknowledged. All the assistance and help received during the
course of the investigation has been acknowledged by him.
(Dr. S. Tiwari)Chairman of Advisory Committee
THESIS APPROVED BY THE STUDENT’S ADVISORY COMMITTEE
Chairman: (Dr. S. Tiwari) ……………………………………………..
Member: (Dr. L.P.S. Rajput) ……………………………………………..
Member: (Dr. A. K. Naidu) ……………………………………………..
CERTIFICATE-II
This is to certify that the thesis entitled, “Studies on Agrobacterium-mediated Transformation in Oat (Avena sativa L.)” submitted by Mr.NAGESH RAOSAHEB DATTGONDE to the Jawaharlal Nehru Krishi Vishwa
Vidyalaya, Jabalpur, in partial fulfillment of the requirement for the degree of
MASTER OF SCIENCE in AGRICULTURE (Molecular Biology andBiotechnology), JNKVV, Jabalpur, after evaluation has been approved by the
Student’s Advisory Committee and the External Examiner and by the student’s
Advisory Committee after an oral examination on the same.
Place : Jabalpur (Dr. S. Tiwari)Date: ………… Chairman of Advisory Committee
MEMBER OF THE STUDENT’S ADVISORY COMMITTEE
Chairman : Dr. S. Tiwari ……………………
Member :
Member :
Dr. L.P.S. Rajput
Dr. A. K. Naidu
……………………
……………………
Director, Biotechnology centre : Dr. S. Tiwari .……………………
Director of Instructions : Dr. P.K. Mishra ..……………………
ACKNOWLEDGEMENT
Firstly I would express my sincere gratititude to almighty God, who gave me this
opportunity to giving my heartfelt thank to all the dedicated people who gave me support
and kind co-operation, encouragement during my studies and research work.
In presenting this text, I feel highly privileged to the chairman of my advisory
committee Dr. S. Tiwari, Director of Biotechnology Centre, JNKVV, Jabalpur for his
invaluable counsel, keen interest and constant encouragement during the course of the
study and preparation of thesis work.
I am deeply obliged to all the members of my advisory committee Dr. L.P.S.
Rajput, Principal Scientist, Biotechnology Centre and Dr. A. K. Naidu for their valuable
guidance and timely suggestions during the course of investigation. I am deeply obliged
and express my sincere gratitude to Mrs. Keerti Tantwai, Biotechnology Centre, whose
constant encouragement and valuable suggestions is unforgettable.
I would like to mention and express my special thanks to Dr. Iti Gontia-Mishra,
Mr. Niraj Tripathi and Mr. Sunil Kumar for helping me with tissue culture and molecular
work.
I also owe an everlasting debt of gratititudes to all the members of Biotechnology
Centre Ms. Shaly Sasidharan, Ms. Ritu Sharma and Mr. Sandip Rangdale for their advice
and help during the tenure.
If I forget to mention here about, my senior, Mr. Swapnil Sapre, Ms. Sapana
Varandani and Mr. Vijay Prakash Bansal; they always stands behind me like a pillar. I
would express my gratititude and heart full feeling to them and no words to giving them
thank.
I express my sincere thanks to my friends Yogesh Patil, Kachare Satish, Rupesh
Kulkarni, Roshani Sawalakhe, Shrikant Karale, Vaibhav Gaikwad, Chetan Bondre, Amol
Ganore, Kunal Bhalerao, Krishna Ambhure, Shantanu Zayale, Jagdeep Bilolikar and
Husain Basha for their support, best wishes and encouragement.
At this inexplicable moment of joy, I deem it a proud privilege to recall all the
cooperation and the contribution of my dear juniors Pankaj, Deva, Yogesh, Vishwajeet,
Vishwavijay and Sumit.
I would like to express my heartfelt gratitude to my grandfather Shri Ramrao L.
Delmade and grandmother Late Chandrabhagabai R. Delmade who always gave me a
helping hand, in any condition stand behind me and gave constant encouragement with a
smile of love and affection.
I would like to express my heartfelt gratitude to my parents Shri Raosaheb N.
Dattgonde and Smt. Laxmibai R. Dattgonde who always gave me a helping hand, in any
condition stand behind me and gave constant encouragement with a smile of love and
affection.
I have no words to thank my brothers Ambadas R. Dattgonde and sister Utkarsha
whose love and cheerful presence, joy and energy filled in my life with the joy of success
and prosperity.
Finally, I would like to thanks all those who directly and indirectly support me in
my life.
Place : Jabalpur
Date : July 2013 (Nagesh Raosaheb Dattgonde)
LIST OF CONTENTS
SI. Title Page
1 Introduction 1-4
2 Review of Literature 5-12
3 Materials and Methods 13-35
4 Results 36-48
5 Discussion 49-56
6Summery, Conclusions and Suggestions for further
work57-59
References 60-64
Appendices I-III
Vita
LIST OF TABLES
Number Title Page
3.1 List of oat genotypes used in the present studyalong with their pedigree
13
3.2 General composition and stock solutions of MS(Murashige and Skoog) basal medium
15
3.3 General composition and stock solutions of B5 basal(Gamborg) medium
16
3.4 Preparation and storage of growth regulator stocksolutions
18
3.5 Preparation of MS medium from stock solutions 19
3.6 Concentrations of plant growth regulators fortifiedwith MS culture media for preliminary experiments
21
3.7 Composition of Co-cultivation (CCM) 26
3.8 Shoot Elongation (SEM) and Rooting Medium (RM) 28
3.9 Composition of GUS staining solution 29
3.10 Composition of DNA Extraction buffer 30
3.11 PCR programme for different primers used in thestudy
32
3.12 List of primers and their features 34
3.13 The time course of the transformation procedure 35
4.1 Observation on in vitro regeneration of Oat cultivarJO-1
37
Number Title Page
4.2 Percent survival and regeneration in oat explants in
the presence of different concentrations of
antibiotics in regeneration (MS02B0.1N) medium
40
4.3 Effect of different treatment on transformation
efficiency (TE %) of embryo explants based on
survival on hygromycin containing media
42
4.4 Effect of different treatment on transformation
efficiency (TE %) of embryo explants based on
criteria of GUS assay
42
4.5 Effect of different treatment on transformation
efficiency (TE %) of embryo explants based on
criteria of PCR
43
4.6 Effect of different treatment on transformation
efficiency (TE %) of leaf base explants based on
hygromycin survival
44
4.7 Effect of different treatment on transformation
efficiency (TE %) of leaf base explants based on
criteria GUS assay
44
4.8 Effect of different treatment on transformation
efficiency (TE %) of leaf base explants based on
criteria PCR putative transgenic explants
45
4.9 Overall effects of co-cultivation period and different
treatments on transformation efficiency (TE %)46
List of Figures
SI. Titles Page
1Flow diagram of Agrobacterium-mediated transformation in
oat using different explants56
LIST OF PLATES
Number TitlePage
(In between)
1. A. Oat spiklets 36-37
B. Oat spiklets with immature seed 36-37
C. Oat plants with immature seeds spiklets 36-37
D. Oat mature seeds 36-37
E-F. Germination of oat seeds on MS media without
growth regulators (E: 2 days and F: 5 days after
culture)
36-37
2. 2. Culture of isolated oat embryos 37-38
A-B. Freshly isolated embryos 37-38
C-D. Callus initiation 37-38
E-F. Direct shoot and root proliferation from isolated
oat embryos
37-38
3. 3. Different stages of cultured leaf base of oat 38-39
A-B. Freshly cultured leaf base 38-39
C-D. Callus initiation 38-39
E-F. Direct shoot and root proliferation from cultured
leaf base of oat
38-39
4. 4. In vitro morphogenesis in oat 39-40
A-C. In vitro regeneration from cultured embryos 39-40
D-F. In vitro morphogenesis in cultured oat leaf base 39-40
Number TitlePage
(in between)
5. 5. Explants of oat showing GUS expression 46-47
A. Non transformed callus 46-47
B. Transformed callus 46-47
C. Shoot with root 46-47
D. Leaf 46-47
E. Morphogenic calli 46-47
F. Callus 46-47
G-H. Shoot with root 46-47
I. Leaf venation showing GUS expression 46-47
6. A. Diagrammatic representation of the binary vector
pCAMBIA 1305.1 containing 35S CaMV
promoter from Cauliflower mosaic virus and poly
A terminator, hptII Hygromycin phospho
transferse II gene, (NOS) Nopaline synthase
terminator, Kanamycin resistance gene for
bacterial selection
47-48
B. Culture of Agrobacterium tumefaciens strain
GV3101 harboring binary vector pCAMBIA
1305.1 carrying reporter gene uidA (β-
glucuronidase, GUS) and plant selectable
marker gene hptII under the CaMV 35S
promoter
47-48
C. Plasmid DNA of Agrobacterium tumefaciens
strain GV3101 harboring binary vector pCAMBIA
1305.1
47-48
Number TitlePage
(in between)
7. 7. Molecular analysis of PCR putative transgenic plant 47-48
A. PCR amplification of hptII gene from control plant and
putative transformants, Lane M-1kb DNA ladder,
Lane P-Positive control, Lane N-Nontransformed
control plant, Lane 1,2,3 and 5 putative transformants
47-48
B. PCR amplification of virD2 gene for Agrobacterium
DNA contamination free transgenic selection. M-
Marker, P-Positive control as a Agrobacterium DNA
amplified on 338bp, N-Negative control and 1,5
Positive, 2-4 Negative transgenic
47-48
C. PCR amplification of CaMV 35S promoter gene from
control plant and putative transformants, Lane M-1kb
DNA ladder, Lane P-Positive control, Lane N-
Nontransormed control plant, Lane 1-2 and 3-5
putative transformants
47-48
8. A-C. Plants regeneration with root formation 48-49
D. Regenerated plants ready for hardening 48-49
List of Abbreviations
Sl. Abbreviations Stands for
1 MS Murashige and Skoog’s medium
2 B5 Gamborg’s medium
3 BAP or BA Benzyl amino purine or 6-Benzyladenine
4 IBA Indole-3-butyric acid
5 IAA Indole-3-acetic acid
6 2,4-D 2,4-Dichlorophenoxyacetic acid
7 GA3 Gibberalic Acid
8 NAA Naphthalene acetic acid
9 bp Base pair
10 CTAB Cetyl Tri methyl Ammonium Bromide
11 EDTA Ethylene Diamine Tetra Acetate
12 mg Milli Gram
13 g Gram
14 µg Micro gram
15 ng Nano gram
16 L Liter
17 ml Milli Liter
18 µl Micro Liter
19 mm Milli Meter
20 M Molar
21 mM Milli Molar
22 µM Micro Molar
23 % Percentage
24 PCR Polymerase Chain Reaction
25 O.D. Optical density
26 rpm Revolutions per minute
27 TAE Tris base Acetic acid Glacial EDTA
28oC Degree centigrade
29 cv Cultivar
30 RH Relative humidity
31 h Hour
32 min Minute
33 DNA Deoxy-ribose Nucleic Acid
34 SDS Sodium Dodacile sulphate
35 LB Luria Bertaini
36 VAAT Vacuum Assisted Agrobacterium-mediated
transformation
37 VIAAT Vacuum Infiltration Assisted Agrobacterium-mediated
transformation
38 SAAT Sonication Assisted Agrobacterium-mediated
transformation
39 SVIAAT Sonication and Vacuum infiltration Assisted
Agrobacterium-mediated transformation
40 Vol. Volume
1
INTRODUCTION
Cultivated oat (Avena sativa L.) is an important agronomic cereal crop.
The oat crop is primarily produced for animal feed and human food, but recent
research has elevated its potential dietary value for human consumption. Oat
ranks sixth in world cereal production following wheat, maize, rice, barley and
sorghum (Choubey et al., 1996). It is important winter forage in many parts of the
world and is grown as a multipurpose crop for grain, forage or as a rotation crop.
It has excellent growth habit, quick recovery after cutting and good quality fodder.
It is a palatable, succulent and nutritious fodder crop with excellent protein
quality. Oat requires a long, cool season for its growth; therefore, it is
successfully grown in the plains and hilly areas of the country. Currently, oat
remains an important grain and forage crop in many parts of the world and grown
on 13.2 million hectares with a grain production of 26.2 million metric tons in
2003. The Russian federation is the largest producer followed by Canada and the
USA. Land area devoted to oat has fallen substantially in the past several
decades with oat being placed by higher value crops, such as soybean in USA.
In India, this crop occupies maximum area in Uttar Pradesh (34%) followed by
Punjab (20%), Bihar (16%), Haryana (9%) and Madhya Pradesh (6%) (Choubey
et al., 1996).
In India, oat productivity is quite low as compared to other cereal crops. It
suffers heavy yield losses due to several biotic and abiotic stresses. Biotic
stresses including diseases such as crown rust (caused by Puccinia coronata
f.sp. avenae), stem rust (caused by Puccinia graminis f.sp. avenae), powdery
mildew, septoria leaf blight, victoria blight, bacterial blights, soil-borne viruses
and nematodes etc. have been the primary disease problems in the major oat-
producing areas around the world. Abiotic stresses comprises extreme
temperatures, drought, high salinity, cold and water logging which often result in
significant losses to the yield of oat crop.
Crop and plant improvement is a major area of commercial interest. A
great deal of efforts has been made towards the development of new cultivars of
2
oat with improved disease, pest and herbicide tolerance. Genetic improvement of
commercially important oat cultivars through classical breeding is laborious and
time-consuming, expensive and sometimes even unsuccessful.
The pre-requisite for any genetic engineering process is the availability of
an efficient in vitro regeneration system from cell and callus cultures. The
transformation system is requires, efficient system for embryogenic callus
induction and shoot regeneration have been considered to be the basic step in
production of stable transgenic plants. Various tissue culture techniques are
being applied for varietal development of cereal crops including oat in different
countries (Kim et al., 2004). Among these techniques, anther culture, protoplast
fusion, leaf culture, root culture and dehusked seed culture are important in oat
an ancillary techniques for the formation of novel oat varieties.
The new gears of biotechnology such as genetic transformation has
enabled us to insert any gene for any quality character such as delayed
flowering, early maturity and increment in girth etc. as well as against biotic and
abiotic stresses. A remarkable progress has been made in the development of
gene transfer technology (Somers et al., 1992), which ultimately has resulted in
the production of large number of transgenic plants both in dicots and monocots.
Genetic modification is an important experimental tool that can be used to
analyze and understand the mechanisms responsible for the expression of
transgenes or endogenous genes and to create plants with the desired
characteristics. For genetic transformation, two basic methods are available i.e.
biolistic and Agrobacterium-mediated transformation (Gasparis et al., 2008).
Potential benefits from these transgenic plants include higher yield and enhanced
nutritional value reduction in pesticide and fertilizer use.
Transgenic oat plants have been obtained using particle bombardment
methods for gene transfer (Pawlowski and Somers, 1998). DNA integration
patterns in transformed plant tissue obtained via particle bombardment tend to be
highly variable and multiple or fragment copies of introduced DNAs are common,
especially when older cultures are targeted. Cho et al., (2003) studied the
3
expression of green fluorescent protein (gfp) and its inheritance in transgenic oat
plants transformed with a synthetic green fluorescent protein gene driven by a
rice actin promoter where proliferating SMCs were bombarded with a mixture of
plasmids containing the sgfp (S65T) gene and one of three selectable marker
genes, phosphinothricin acetyltransferase (bar), hygromycin phosphotransferase
(hpt) and neomycin phosphotransferase (nptII).
Till date there is only a single report available on Agrobacterium mediated
transformation of oat by Gasparis et al. (2008). Two different types of explants:
immature embryos and leaf base segments were used for transformation.
Immature embryos are composed of highly totipotent, meristematic cells,
whereas leaf base segment consist of differentiated cells, which have to undergo
dedifferentiation before somatic embryo development and plant regeneration and
these difference in these explants were employed to test cell-competence to
Agrobacterium-mediated transformation and transgene expression.
A new and potentially more efficient method, Sonication Assisted
Agrobacterium-mediated Transformation (SAAT) (Trick and Finer, 1997) was
developed for delivery of Agrobacterium to plant target tissues. SAAT is a very
easy, low cost method to substantially enhance the efficiency of Agrobacterium-
mediated transformation of low or non-susceptible plant species. The strength of
this method is that the cavitation caused by sonication results in thousands of
micro-wounds on and below the surface of the plant tissue. This wounding
pattern permits Agrobacterium to travel deeper and more efficiently throughout
the tissue than conventional microscopic wounding, increasing the probability of
infecting plant cells. In some another studies the Vacuum Assisted
Agrobacterium-mediated Transformation (VAAT) (Lin et al., 2009), and some
with application of both the methods (SAAT and VAAT) (Amoah et al., 2001)
used to increase the transformation efficiency by increasing the infiltration of
Agrobacterium in the plant cell through these wounds.
Since there are few reports of Agrobacterium-mediated transformation
studies in oat, this was taken as the basis to take up the present investigation to
4
generate an efficient protocol for Agrobacterium-mediated transformation of oat
using various explants. Also check the transformation efficiency by using
Sonication and Vacuum Agrobacterium-mediated assisted transformation
separately and by combining both the methods.
In the light of above facts, the present experiments were envisaged to
fulfill following objectives:
1. To study the response of different explants of oat to Agrobacterium -
mediated transformation.
2. To standardize an efficient protocol for Agrobacterium - mediated
transformation in oat.
3. To validate the genetically transformed plants.
5
REVIEW OF LITERATURE
Oat is an important cereal crop produced mainly for animal feed and
human food. Presently, it has also being known for its potential dietary value for
human consumption. There are several coordinated public breeding programs
focusing on the genetic enhancement of oat. Despite these efforts, a yield and
quality losses due to stress, pathogens and insects continue to occur. The
continued development of biotechnological approaches based on genetic study
can manipulate oat which would aid in oat quality enhancement efforts (Carlson
et al., 2007).
2.1 In vitro plant regenerationThe establishment of in vitro regeneration systems plays a significant role
in the biotechnological improvement of cereals. While in the major cereals like
maize, rice, wheat and barley, impressive progress has been achieved towards
developing efficient plant regeneration systems from different tissues and organs,
but in oats only a few work have been reported. However, since the first
publication on successful plant regeneration from oat callus (Lorz et al., 1976),
plant tissue culture methods have advanced considerably.
Plant tissue culture technology is playing a vital role in basic and applied
studies, including crop improvement. In modern agriculture, about 150 plant
species are extensively cultivated. Many of these are reaching the limits of their
improvement by traditional methods. The application of tissue culture technology,
as a central tool or as an adjunct to other methods, including recombinant DNA
techniques, is an initial step towards plant modification and improvement for
agriculture, horticulture and forestry. The initial development in the field of plant
tissue culture i.e. the ability to recover plants, not only from micropropagated
meristematic tissues, but from in vitro cultures of protoplasts, cells,
undifferentiated plant tissues (callus), pollen, ovules, embryos, cotyledons and
other explants tissues, take quite a long time for its development hence, for any
tissue culture system sterilization and maintaining aseptic condition is the pre-
6
requisite step. The most tedious parts of in vitro techniques are sterilizing plant
materials and media and maintaining aseptic conditions. Obtaining sterile plant
material is difficult and despite precautions taken, 95% of cultures will end up
contaminated if the explants are not disinfected in a proper manner. Because
living materials cannot be exposed to extreme heat and retain their biological
capabilities, plant organs and tissues are sterilized by treatment with a
disinfecting solution.
According to the protocol by Chen et al. (1995) the seeds were surface
sterilized with 70% ethanol for two minutes, followed by two washes with sterile
distilled water, and then treating with 5% sodium hypochlorite solution for 10 min
followed by five washes with sterile distilled water. The sterilized seeds were
germinated on solid MS medium in tissue culture jars (70 x 75mm) at 27°C in the
dark for one day. The germinated seeds were grown in the dark at 25°C in
incubator or in a growth cabinet at 25°C with 16h day illumination.
The best callus induction in oats was achieved when immature embryos
were used as explants. However, Chen et al. (1995) reported that immature
embryos are not a convenient source of material for transformation studies
because they require mature plants for their production, require specialized
growth environments and may be restricted to a short season. Therefore, it is an
urgent need for development a reliable alternative regeneration system in oats.
Although mature embryos produce lower callus yields, their availability
throughout the year makes them an excellent explants source (Birsin et al.,
2001).
An efficient in vitro regeneration system for oat using leaf bases as
explants has been developed by Chen et al. (1995). Leaf segments isolated from
seedlings grown for 2 to 5 days in the dark which were subjected to an initial
screening for callus formation. Callus was induced from cultured leaf base
segments on MS medium containing 2mg l-1 2,4-D. The frequency of callus
formation in leaf explants was strongly dependent on the position of the segment
taken from seedling and age of the seedling. The callus was induced only from
7
the basal segments of leaves and the frequency of callus induction of the first
segment from the leaf base was higher than that of the subsequent segments
from the leaf base. Callus tissue first became visible on the leaf explants within a
week on callus medium. Some compact and opaque callus developed within soft
callus masses one week later. The four to five week old calli were transferred to
a shooting medium. Shoots of 3mm long were excised from the callus and
transferred to fresh shooting medium. Seven days later, when most of the shoots
had grown 15 to 20mm long, they were transferred to a rooting medium. Roots
developed within 5 days. The plants with shoots and well developed roots were
transplanted to pots containing soil. Whole plants were able to grow in soil to
normal mature plants within ten weeks.
Chen et al. (1995) developed an efficient short term regeneration system
using seedling derived from oat (Avena sativa). Callus derived from the leaf base
showed a higher response of plant regeneration than callus initiated from
mesocotyls and more mature parts of the leaves. A correlation between the
nuclear DNA content of the donor material, was analyzed with flow cytometry and
its ability to form callus was observed. Somatic embryogenesis was developed
from callus derived from tissue close to the apical meristern. Plant regeneration
media with various concentrations of auxins were examined. Callus from three
different cultivars showed a similar regeneration potential with an optimal
regeneration frequency of 60%. About 2 months after inoculation, regenerated
plantlets were obtained which were further transferred to green house for
cultivation.
Gless et al. (1997) developed a reliable and efficient protocol for the
regeneration of fertile plants derived from leaf base segments of young in-vitro-
grown oat seedlings. Callus induction and shoot regeneration were achieved
when the basal region of young seedlings was cultured on auxin-containing
medium. Callus induction efficiencies as well as regeneration frequencies were
correlated with the developmental stages and the genotype of the explants.
8
Nuutila et al. (2002) developed a protocol for regeneration where the
nitrogen composition, sugar and auxin concentrations of callus induction medium
were optimized in order to improve the regeneration of green plants from two
elite oat cultivars, Aslak and Veli. For both the cultivars, the production of
plantlets was doubled by optimization. The results obtained also clearly
demonstrated that cultivars of the same species may differ drastically in their
requirements for essential media components. Veli required higher total amounts
of nitrogen (67.8mM) than Aslak (44.9mM) but less maltose and 2,4-
dichlorophenoxyacetic acid (28g l-1 and 0.6mg l-1) than Aslak (38g l-1 and 2mg l-
1).
Kim et al. (2002) reported that mature embryos of five oat genotypes were
cultured to develop an efficient method of callus induction and plant regeneration.
Murashige and Skoog (MS) and N6 media supplemented with 2,4-
dichlorophenoxyacetic acid (2,4-D) and kinetin was used for callus induction.
Significant callus induction was observed among the combinations of various
plant growth regulators. Callus induction showed highest efficiency in medium
containing 3mg l-1 of 2,4-D. The highest frequency of callus induction was
obtained in Gwiri37. For plant regeneration calli induced from mature embryos
were transferred onto MS and N6 media supplemented with combinations of 6-
benzyladenine (BA) and napthaleneacetic acid (NAA) for 5 weeks. Highest
percentage of plant regeneration showed in MS medium containing 0.2mg l-1 of
NAA and 1mg l-1 of BA. The callus initiation medium affected the subsequent
plant regeneration. Treatment with 3mg l-1 of 2,4-D and 3mg l-1 of kinetin in callus
induction media showed high frequency for plant regeneration. Regenerated
shoots were treated with indole 3-butyric acid induced root formation.
Kim et al. (2004) reported plant regeneration of Korean oat using mature
embryo and leaf base segment as explant. MS media supplemented with 2,4-
dichlorophenoxyacetic acid, kinetin and picloram was used for callus initiation
from mature embryos and leaf base segments. 3mg l-1of 2,4-D and 3mg l-1 of
picloram when used in callus induction medium showed highest frequency for
plant regeneration from mature embryos. Leaf base segments were transferred
9
to callus induction medium and incubated at 25°C in 16/8 hour light/ dark cycle
for 3 weeks. Callus induction from leaf base segments of Malgwiri variety showed
highest efficiency in medium containing 3mg l-1 of 2,4-D and 1mg l-1 of kinetin
(91.8%). In case of Samhangwiri, the combinations of phytohormones did not
show significant difference. Regeneration from leaf base segments showed
highest frequency in shoot medium containing 1mg l-1 of antiauxin, tri-
iodobenzoic acid (TIBA) and 1mg l-1 of 6-benzyladenine (BA). Calli induced from
leaf base segments of Samhangwiri and Malgwiri in media containing 3mg l-1 of
2,4-D and 3mg l-1 of picloram showed better regeneration. Thus callus induction
medium is an important factor for plant regeneration.
Hao et al. (2006) developed an efficient protocol where enhanced somatic
embryogenesis and plant regeneration was obtained using young leaf bases of
naked oat (Avena nuda) as explants by including salicylic acid (SA) and carrot
embryogenic callus extracts (CECE) in media. Five and four-fold improvement
was achieved in somatic embryogenesis and plant regeneration, on the
corresponding media supplemented with 0.5mM SA and CECE as compared to
control, respectively. Some physiological and biochemical changes were
assayed in both embryogenic callus (EC) and non-embryogenic callus (NEC) and
results indicated that superoxide dismutase activity was stimulated and catalases
and ascorbate peroxidase activities were inhibited, while the O2 (superoxide
anion) content was reduced and the hydrogen peroxide level was promoted in
EC compared with NEC. Reduced malondialdehyde content and relative
electrolyte leakage were also detected in EC.
2.2 Agrobacterium-mediated transformationGene transfer is the introduction of genetic information from any living
organism into a new host that can help provide a solution to certain constraints
that limit crop production or quality. Such crops are genetically modified (GM) or
transgenic. Transgenic crops that have been commercialized include maize,
soya, cotton and canola. Two popular strategies for gene transfer to plants are
the Agrobacterium method and direct DNA introduction by micro-particle
bombardment. The efficient production of transgenic plants requires stringent
10
selection procedures supported by a selectable marker gene that confers
resistance to agents such as antibiotics or herbicides. Several such selection
systems have recently been described for grain legumes, based on the marker
genes neomycin phosphotransferase II (nptII), hygromycin phosphotransferase
(hph, aph IV or hyg) ( Popelka et al., 2004).
Kuai et al. (2001) produced fertile transgenic plants of oat (Avena sativa
L.var. Melys) followed by microprojectile bombardment of primary embryogenic
calli from immature embryos with two plasmids containing the bar gene or the β-
glucuronidase (uidA) gene, after selection with glufosinate ammonium. Eleven
plants were regenerated from phosphinothricin resistant callus, with three of the
eleven plants containing either intact or rearranged copies. No plants co-
transformed with the non-selected uidA gene were detected. Stable transmission
and expression of the bar gene in the T1 inbred progenies occurred in a
Mendelian manner in one line, which contained an intact bar gene, and in all six
T2 lines tested from this transformant.
Cho et al. (1999) developed a highly efficient and reproducible
transformation system for oat (Avena sativa L. cv. GAF/Park-1) using
microprojectile bombardment of highly regenerative tissues derived from mature
seeds. Callus was induced under dim light conditions on medium containing 2,4-
D, BAP and high cupric sulfate. Highly regenerative tissues, generated from
embryogenic callus, were used as a transformation target. From 327 individual
explants bombarded with the β-glucuronidase gene and a hygromycin
phosphotransferase gene, 84 independent transgenic events were obtained after
an 8-12 weeks selection period on hygromycin. All events were regenerative,
giving an effective transformation frequency of 26%; co-expression of GUS
activity occurred in 70% of the independent events. Presence of the foreign
genes in DNA from leaf samples of T0 and T1 plants was confirmed by PCR
amplification and/or DNA blot hybridization. Fertility of the plants from the
transgenic lines was 63% (24/38) and the transgene(s) was stably transmitted to
T1 and T2 progeny.
11
Gasparis et al. (2008) reports on the successful Agrobaterium-mediated
transformation of oat. Three cultivars, two types of explants and three
combinations of strain/vectors, were successfully used for transformation of other
cereals. Transgenic plants were obtained from the immature embryos of cv.
Bajka, Slawko and Akt and leaf base explants from Bajka after transformation
with A. tumefaciens strain LBA4404(pTOK233). The highest transformation rate
(12.3%) was obtained for immature embryos of cv. Bajka.
2.2.1 Sonication assisted Agrobacterium-mediated transformationTrick and Finer (1997) described a new and efficient Agrobacterium-based
transformation technology that overcomes the barriers and enhances DNA
transfer in such diverse plant groups as dicots, monocots and gymnosperms.
They used sonication-assisted Agrobacterium-mediated transformation (SAAT),
involves subjecting the plant tissue to brief periods of ultrasound in the presence
of Agrobacterium. It was observed that SAAT increases transient transformation
efficiency in several different plant tissues including leaf tissue, immature
cotyledons, somatic and zygotic embryos, roots, stems, shoot apices,
embryogenic suspension cells and whole seedlings. A 100 to 1400-fold increase
in transient β-glucuronidase expression has been demonstrated in various
tissues of soybean, Ohio buckeye, cowpea, white spruce, wheat and maize.
Stable transformation of both soybean and Ohio buckeye has been obtained
using SAAT of embryogenic suspension culture tissues.
SAAT is an easy, low cost method to substantially enhance the efficiency
of Agrobacterium-mediated transformation of low or non-susceptible plant
species. These method was also used in different crops, as like cowpeas (Pathak
and Hamzah, 2008), flax (Beranova et al., 2008), lily (Kim et al., 2007), soybean
(Santarém et al., Trick and Finer, 1998), (Meurer et al., 1998), sunflower (Weber
et al., 2003). The strength of this method is that the cavitation caused by
sonication results in thousands of micro-wounds on and below the surface of the
plant tissue. This wounding pattern permits Agrobacterium to travel deeper and
more completely throughout the tissue than conventional microscopic wounding,
increasing the probability of infecting plant cells.
12
2.2.2 Vacuum assisted Agrobacterium-mediated transformationLin et al. (2009) used the mature embryos of soaked seeds were pierced
by a needle and soaked in the Agrobacterium inoculum under vacuum infiltration.
They worked on herbicide or antibiotic analysis and molecular analysis were
conducted on T0 plants. The results showed that although the efficiency of
transformation was about 6.0%, it was easier to transform indica rice using this
method and the transformation process was significantly shortened. The success
of transformation was further confirmed by the genetic and molecular analyses of
T1 transformants. This method was also used in different crops like Arabidopsis
(Ye et al., 1999), soybean (Mariashibu et al., 2013), pakchoi (Xu et al., 2008),
alfalfa, radish, pakchoi and petunia (Grabowska and Filipecki, 2004).
2.2.3 Sonication and Vacuum assisted Agrobacterium-mediatedtransformation
Amoah et al. (2001) reported an efficient transformation of inflorescence
tissue from ‘Baldus’ which is a commercial wheat variety, using the
agrobacterium strain AGLI harbouring the binary vector pAL 156. The effect of
different factors used for transformation as like duration of preculture, vacuum
infiltration, sonication treatment and Agrobacterium cell density was studies for
the expression of uidA gene.
The reports for use of sonication and vacuum assisted Agrobacterium-
mediated transformation are known for kidney bean (Liu et al., 2005) and radish
(Park et al., 2005) citrus (Oliveira et al., 2009), and banana (Subramanyam et al.,
2011), which showed tremendous increase in transformation efficiency.
13
MATERIALS AND METHODS
In the present investigation, experiments related to “Studies on
Agrobacterium-mediated transformation in oat (Avena sativa L.)” were carried
out in the Plant Tissue Culture and Transgenic Laboratory, Biotechnology
Centre, Jawaharlal Nehru Krishi Vishwavidyalaya, Jabalpur. Details of the
protocols are given below. List of oat genotypes used in the present study
along with their pedigreeare given in Table 3.1.
3.1 Experimental material3.1.1 Explants material
The commercial cultivar of Oat ‘JO-1’ was selected for the “Studies on
Agrobacterium-mediated transformation in Oat (Avena sativa L.)” on the basis
of good regeneration capacity ‘JO-1’ variety was selected for study
(Varandani, 2011) among other five selected genotype. Seeds of oat varieties
JO-1, JHO-822, JHO-851, OS-6 and Kent were obtained from the ‘All India
Coordinated Forage Research Project (ICAR), Department of Agronomy,
JNKVV, Jabalpur’. Various explants viz. leaf base, mature embryo of oat were
obtained from in vitro germinated seeds (Plate 1). Oat genotypes used in the
present study along with their pedigree are shown in Table 3.1.
Table 3.1 List of oat genotypes used in the present study along withtheir pedigree.
Sl. Genotype Pedigree
1. JO-1 Cross Kent × UPO 50
2. OS-6 Cross Hfo-10 × Hfo 55-P2-2
3. Kent Introduction from USA
4. JHO-822 Cross 4268 × Indio
5. JHO-851 Selection from Japanese introduced materialHIUGAKAIRYOKURO)
14
3.1.2 Agrobacterium cultureFor genetic transformation studies, Agrobacterium tumefaciens strain
GV 3101 containing binary plasmid vector pCAMBIA 1305.1 (11846bp) was
obtained from National Research Centre on Plant Biotechnology (NRCPB),
IARI, New Delhi. This vector comprise of gus (β-glucuronidase) gene with
catalytic intron under control of CaMV35S promoter and nos terminator,
and hptII (Hygromycin phosphotransferase II) gene as plant selectable
marker under the control of CaMV35S promoter and poly A terminator
(Plate 6A).
3.1.3 Glasswares, plasticwares, Chemicals and reagentsAll the glassware’s and plastic wares used in the study were procured
from Borosil and Tarsons respectively. All the chemicals used in the present
investigation were of plant tissue culture and molecular biology grade
procured from reputed companies and suppliers.
3.2 Methods3.2.1 In vitro plant regeneration
For the development of transgenic oat, efficient and reproducible plant
regeneration system from explants cultures is a prerequisite.
3.2.1.1 ExplantsThe explants viz. mature embryos were excised from mature seeds
(Plate 2), while leaf bases were excised from 6 days old seedlings (Plate
3) respectively and cultured to initiate in vitro cultures and transformation
via Agrobacterium tumefecians.
3.2.1.2 Culture MediaMurashige and Skoog (MS) medium (Murashige and Skoog, 1962)
and Gamborg’s B5 medium (Gamborg et al., 1968) fortified with different
combination of auxins and cytokinin were used for plant tissue culture. A
general composition of basal MS and B5media are given in the Table 3.2
and 3.3.
15
Table 3.2 General composition and stock solutions of MS (Murashigeand Skoog) basal medium.
ConstituentsAmount (mg l-1)
present inoriginalmedium
Amount to betaken for stocksolutions (g l-1)
Inorganic compounds
a. Macronutrients (1X) (40X)
KNO3 (Potassium nitrate) 1900 76
NH4NO3 (Ammonium nitrate) 1650 66
CaCl2 .2H2O (Calcium chloride) 440 17.6
MgSO4.7H2O (Magnesium sulphate) 370 14.8
KH2PO4 (Potassium phosphate) 170 6.8
b. Micronutrients (200X)
MnSO4.4H2O (Manganese sulphate) 22.3 4.46
ZnSO4.7H2O (Zinc sulphate) 8.6 1.72
H3BO3 (Boric acid) 6.2 1.24
KI (Potassium iodide) 0.83 0.17
Na2MoO4.H2O (Molybdic acid) 0.25 0.05
CoCl2 (Cobalt chloride) 0.025 0.005
CuSO4.2H2O (Copper sulphate) 0.025 0.005
c. Iron stock (200X)
Disodium EDTA (Na2- EDTA) 37.25 7.45
Ferrous sulphate (FeSO4) 27.85 5.57
Organic compounds
d. Vitamins (1000X)
Nicotinic acid 0.50 0.5
Pyridoxine HCl 0.50 0.5
Thiamine HCl 0.10 0.1
e. Amino acid (1000X)
Glycine 2 2
16
Table 3.3 General composition and stock solutions of B5 basal(Gamborg) medium.
ConstituentsAmount (mg l-1)
present inoriginal medium
Amount to betaken for stocksolutions (g l-1)
a. Macronutrients (1X) (40X)KNO3 (Potassium nitrate) 2500 100.00
CaCl2.H2O (Calcium chloride) 150 6.00
MgSO4.7H2O (Magnesium
sulphate) 250 10.00
(NH4)2SO4 (Ammonium sulphate) 134 5.36
NaH2PO4.H2O (Sodium
phosphate) 150 6.00
b. Micronutrients (200X)H3BO3 (Boric acid) 300 60.0
MnSO4.H2O (Manganese
sulphate) 1000 200.0
ZnSO4.7H2O (Zinc sulphate) 200 40.0
KI (Potassium iodide) 75 15.0
Na2MoO4.2H2O (Molybdic acid) 25 5.0
CuSO4 (Cupric sulphate) 2.5 0.5
CoCl2.6H2O (Cobalt chloride) 2.5 0.5
c. Iron stock (200X)Disodium EDTA (Na- EDTA) 37.25 7.45
Ferrous sulphate (FeSO4) 27.85 5.57
d. Vitamins (100X)Myo-inositol 100 10.0
Nicotinic acid 1 0.1
Pyridoxine-HCl 1 0.1
Thiamine-HCl 10 1.0
3.2.1.3 Preparation of stock solutions3.2.1.3.1 Stock solution of macronutrients
To prepare 1L of macronutrients stock solution, the salts mentioned
in Tables 3.2 and 3.3 were dissolved one after another in 600ml of double
17
distilled water and then the volume was made to 1L after filtering, this
solution was stored in refrigerator at 4°C.
3.2.1.3.2 Stock solution of micronutrientsTo make 1L of this stock solution, the salts were dissolved
sequentially as shown in Table 3.2 and 3.3, in 800ml of distilled water and
final volume was adjusted to 1L.
3.2.1.3.3 Stock solution of ironNa2-EDTA (7.45g) was dissolved in boiling water. Thereafter, 5.57g
of FeSO4 was added gradually. The solution was stirred for at least 1h in
hot condition until the colour of the solution changes to golden yellow.
Finally the volume was made up to 1L and stored in refrigerator, in an
amber coloured bottle.
3.2.1.3.4 Stock solution of vitaminsTo make 50ml of vitamin stock solution, 25mg of nicotinic acid was
first dissolved in 25ml of boiling distilled water and after cooling, other two
vitamins pyridoxine-HCl (25mg) and thiamine-HCl (5mg) were added. The
final volume was made to 50ml. This solution was stored in refrigerator at
0°C for a maximum period of 10 days.
3.2.1.3.5 Stock solution of amino acidGlycine (100mg) was dissolved in 50ml of distilled water and stored
at 0°C for a maximum period of 15 days.
3.2.1.3.6 Stock solution of growth regulatorsGrowth regulators were not directly dissolved in water. Firstly it was
dissolved in water-miscible solvents and finally water was added to make
up to the desired volume. Auxins, NAA and IBA (100mg) were initially
dissolved into 3 to 5ml of absolute ethanol and then volume was made up
to 100ml by adding ultra pure water. Cytokinin, BAP (100mg) was first
dissolved in to 3 to 5ml of 1N NaOH and then, final volume was made up
to 100ml by adding ultrapure water.
18
Table 3.4 Preparation and storage of growth regulator stocksolutions.
Growth regulators
Solution preparation
Solvent DiluentsPowderstorage
Liquidstorage
Sterilization
2,4-Dichlorophenoxy-
acetic acidEthanol Water RT 2-8°C CA
Indole-3-acetic acid
Free acid (IAA)1N NaOH Water 0°C 0°C CA/F
Indole-3-acetic acid
Sodium salt1N NaOH Water 2-8°C 0°C CA/F
α-Naphthalene acetic
acid Free acid (NAA)1N NaOH Water RT 2-8°C CA
6-Benzylaminopurine
(BAP)1N NaOH Water RT 2-8°C CA/F
Kinetin 1N NaOH Water -0°C -0°C CA/F
CA=Co-autoclavable, F=Filter sterilization.
To obtain the final working concentration of 1mgl-1 of plant growth
regulator in culture medium, 1ml of the stock solution was added to 1L
medium. It was calculated by using following formula to meet the
requirement as given in the Table 3.4.
Vol. of stock solution=Desired growth regulators concentration × Medium Vol.
Stock solution concentration
3.2.1.4 Preparation of culture mediaFor in vitro regeneration of oat, MS basal medium was prepared
from stock solutions as per Table 3.5.
19
Table 3.5 Preparation of MS medium from stock solutions.
Components MS Medium (1l)
Macronutrients (ml l-1) 25
Micronutrients (ml l-1) 5
Iron stock (ml l-1) 5
Vitamin stock (ml l-1) 1
Amino acids (ml l-1) 1
Growth regulators (ml l-1) as required
Myo-inositol (mg l-1) 100
Sucrose (g l-1) 30
Agar (g l-1) 8
Desired concentration of auxin and cytokinin were added from stock
solutions according to the culture media combinations used (Table 3.4).
Unless specified otherwise, all fortified MS media supplemented with micro
and macro nutrients, vitamins, 30g l-1 sucrose and 8g l-1 agar and the pH of
the medium was adjusted to 5.8 with addition of 1N NaOH or 1N HCl and
final volume was made to 1L (Table 3.2). Culture media were sterilized in
one litre aliquots by autoclaving at 121oC and 15 psi stream pressure for 20
min before pouring into pre-sterilized 100x17mm glass Petri dishes (30-
35ml/Petri dish) under aseptic condition on laminar air flow cabinet.
3.2.2 Sterilization and germination of seedsInitially oat seeds were washed thoroughly with tap water in order to
remove dust and other particles followed by washing with distilled water with
2-3 drops of tween-20 for 20 min. The seeds were rinsed with distilled water
8-9 times. Further sterilization was carried out inside the laminar air flow
chamber. Seeds were treated with 70% ethanol for 2 min followed by 0.5%
HgCl2 solution for 5 min. Sterilized seeds were washed thoroughly with
autoclaved distilled water for 4-5 times to overcome the poisonous effect of
20
HgCl2. Finally, seeds were soaked in sterile water for 1-2 min prior to
inoculation in to MS medium without any growth regulator.
3.2.3 Mature embryo as explantsSeeds were sterilized as described in section 3.2.2. The mature
embryos were removed from the imbibed seeds and placed, scutellum-up, on
MS medium with different combinations of growth regulators as mentioned in
Table 3.6 (Plate 2). Plates were incubated at 25°C for 15 days in dark. For the
regeneration, embryogenic part of the callus was cut into small pieces
approximately 2-3mm in size and inoculated on MS regeneration media
(MS2B.1N) and incubated for 5 weeks at 25°C in a 16h light and 8h dark
photoperiod. Small shoots (2-3cm) were sub-cultured on growth regulator-free
root regeneration medium. Plants were hardened under laboratory conditions
before they were transferred to the greenhouse.
3.2.4 Leaf base as explantsSeeds were sterilized as described in section 3.2.2. They were
germinated under light conditions on MS medium. Leaf-base segments were
taken from 4-6 day-old seedlings. The leaves were separated from coleoptiles
and sequentially cut into 1mm transverse sections, starting from the original
leaf base with a scalpel in a sterile petri- dish, a sheet of millimetre paper was
placed underneath to allow accurate sizing during dissection. Segments 1-6
starting from base (1mm each) were compared for their embryogenic callus
induction efficiency (Plate 3). Only those calli, containing distinct embryogenic
development visualized under the stereomicroscope were considered to be
embryogenic. Other types of calli (e.g. watery, translucent callus) were
discarded. On the basis of this comparison, only segments of 1-3mm were
further used for callus development. After about 4-5 weeks, calli were
transferred to shoot induction medium (for regeneration) with different
combinations of growth regulators (Table 3.6) and cultured in light at 25°C.
Shoots were sub-cultured on growth regulator-free root regeneration medium.
Plants were kept under laboratory conditions for 10-15 days before they were
transferred to the greenhouse for hardening.
21
Table 3.6 Concentrations of plant growth regulators fortified with MSculture media for preliminary experiments.
Sl. MediaGrowth regulators (mg l-1)
2,4-D IAA NAA BA IBA
1 MS2D 2.0 - - - -
2 MS6D 6.0 - - - -
3 MS10D 10.0 - - - -
4 MS50D 50.0 - - - -
5 MS2B.1N - - 0.1 2.0 -
6 MS5B.1N - - 0.1 5.0 -
7 MS1B1N - - 1.0 1.0 -
8 MS2IBA - - - - 2.0
9 MS3IBA - - - - 3.0
10 MS3IAA - 3.0 - - -
3.3 Culture conditionsPetri dishes were incubated at 25 ± 2°C under dark condition for one
week. Later they were subjected to a photoperiod regime of 12h at 1200 lux
luminance provided by photosynthetically active radiation (PAR) lamps.
3.4 Regeneration of plantsAfter 45 days, observations were recorded for all explants cultures and
calli were transferred to MS medium without growth regulators for maturation.
For the plant regeneration, the calli were subsequently transferred into the
regeneration medium consisting of MS basal medium supplemented with
different concentrations of plant growth regulators in varying combinations
(Table 3.6), 30g l-1 sucrose and 8g l-1 agar powder. Where root formation was
not obtained on regeneration medium, plantlets were subsequently sub
cultured to rooting medium, (MS basal medium supplemented with 1.1mg l-1
BAP, 0.1mg l-1 NAA, 15g l-1 sucrose and 8g l-1 agar).
22
3.5 Hardening of regenerated plantsThe roots of plantlets were rinsed with sterile lukewarm water to wash-
off the adhering agar (Plate 8). The plantlets were transferred to root trainers
filled with sterilized mixture of sand, soil and FYM in 1:1:1 ratio. Transplanted
root trainers were transferred to a glass house under 30 ± 2oC and 60 ± 5%
RH for 2-3 weeks for acclimatization.
3.6 Experimental designThe factorial completely randomized design (CRD) was used to study
the effect of culture medium and genotypes and their interactions on callus
induction, formation of morphogenic and embryogenic calli, organogenesis
and plant regeneration of oat from cultured explants. 90 explants each were
cultured for each separate treatment for both explants and each treatment
was performed in two replications and computation of the effect of all factors
was carried out separately.
3.7 Observations recordedFor all explants cultures, observations were recorded at 3 stages;
Stage 1-after 35 days of initial culturing; after 28 days from reculturing of calli
on regeneration media; Stage 3-when the complete plants were obtained. All
observations were based on initial culture media, irrespective of regeneration
medium or rooting medium.
3.7.1 Number of callus forming explants per 90 explants platedCultured explants on different media were recorded for callus formation
after 30 days.
3.7.2 Number of embryogenic calli per 90 explants platedProliferated calli from cultured explants were classified into live and
dead calli. A count was made for live calli identified by their phenotypic
appearance. Such calli were semitransparent, glossy or swelled structures,
partially shooting or rooting on white friable callus observed and sometimes
green calli with shoots were observed (Plate 4).
3.7.3 Number of organogenic calli per 90 explants platedProliferated calli from cultured explants were classified into live and
dead calli during observations. A count was made for calli identified by their
23
phenotypic appearance. Such calli were white to yellowish green in colour
with dense and glossy appearance and regenerating shootlets and/or roots as
well as shoots with roots. Calli regenerated from cultured explants, showing
shoot formation were referred as shoot forming calli (Plate 4).
3.7.4 Number of plants regenerated per 90 explantsComplete plantlets (shoots + roots) regenerated were recorded as
regenerated plantlets.
3.8 Statistical analysis of dataThe data were analyzed in factorial completely randomized design
(CRD) to find out the significance of different culture media combination,
genotypic effects and their interactions with two replications. The analysis of
data was carried out as per the method suggested by Snedecor and Cochran
(1989) to study the single as well as interactive effects.
3.9 Genetic transformation of Oat3.9.1 Maintenance of Agrobacterium cultures
A. tumefaciens GV3101 was cultured on Luria Bertanni agar plates
(LA). The bacterial culture was subcultured within two to three weeks for
maintenance. To prepare 1 litre of LB medium; Tryptone (10g), Yeast
extract (5g) and NaCl (5g) were dissolved together in 900 ml ultra pure
water; pH was adjusted to 7.5; volume was made up to 1L, added with
agar (15g) followed by autoclaving at 121ºC and 15 psi for 20 min. LB
broth was prepared without agar. The medium was supplemented with
antibiotics viz. kanamycin (50μgml-1) and rifampicin (50μgml-1) (Plate 6B).
3.9.2 Plasmid isolation (Miniprep method)1. From all the 10 cultures, 1ml culture each was taken in Eppendorf tube
and centrifuged at 5500 rpm for 10 min.
2. The supernatant was discarded and 100µl freshly prepared sol. I was
added to the tube, vortexed vigorously till the pellet gets dissolved.
3. 200µl of sol. II was added in the tube and mixed gently by inverting 5-7
times and incubated at room temperature for 5 min.
4. 150µl of chilled sol. III was added to each tube and mixed by inverting
15-17 times and incubated on ice for 15 min.
24
5. Tubes were centrifuged at 12000 rpm for 20 min. After centrifugation,
supernatant was taken out in a fresh Eppendorf tube and equal volume
of chilled isopropanol was added to each tube and mixed by inversion.
6. Centrifuged at 12000 rpm for 20 min. Supernatant was discarded and
700µl of 70% ethanol was added in each tube and mixed well by tubes
horizontally.
7. Centrifuged at 12000 rpm for 10 min, discarded ethanol by pouring and
dried pellet properly in vacuum drier.
8. 20-25µl of sterilized double distilled water was added in each tube and
pellet was dissolved properly by tapping the tubes.
3.9.3 Plasmid PCRPCR was carried out using plasmid samples as template in individual
reaction. (Working concentration)
10X PCR buffer 2µl 1X
25mM MgCl2 2µl 2.5mM
Plasmid DNA 2µl 50ng
dNTPs mix 0.5µl 200µM
Forward primer 0.5µl 20pM
Reverse primer 0.5µl 20pM
Taq polymerase (Fermentas) 0.5µl 1 Unit
Nuclease free water 12µl For volume making
Total 20µl
Reaction conditions included one cycle of initial denaturation at 94ºC
for 5 min followed by 35 cycles each of denaturation at 94 ºC for 1 min,
annealing at 48ºC for 1 min and DNA replication at 72ºC for 2 min with a final
extension step at 72ºC for 10 min. Finally hold at 4ºC.
25
3.9.4 Colony PCR of positive Agrobacterium culture harbouringpCAMBIA constructs
Agrobacterium culture grown on LA plate containing rifampicin
(50µgml-1) and kanamycin (50µgml-1) was confirmed for the presence of the
construct through colony PCR. A single bacterial colony was picked up and
dissolved in 2µl nuclease free water which was further used as template. The
PCR reaction and thermal conditions were same as that of above mentioned
plasmid PCR except an initial denaturation step for 10 min at 94ºC.
3.9.5 Screening of explants for antibiotic sensitivityThe explants were inoculated on MS media with different
concentrations of hygromycin for the assessment of antibiotic sensitivity.
Hygromycin was used in concentrations of 5mg l-1, 10mg l-1, 25mg l-1 and
50mg l-1 with MS basal medium as control.
3.9.6 Pre-culture of explantsIn order to determine the influence of pre-culture of explants on
transformation efficiency, callus developed from mature embryos and leaf
base were inoculated in shoot induction medium and incubated at 25 ± 2°C
with 12h photoperiod at a light intensity of 1200 lux for 12, 18, 24, and 48h. A
control was maintained in similar way without pre-culturing the explants. Each
experiment comprised of 100 immature explants in replicates of three.
3.9.7 Co-cultivation of Oat explants with AgrobacteriumA. tumefaciens was inoculated in LB containing antibiotics rifampicin
(50mgl-1) and kanamycin (50mg l-1). The Agrobacterium colony was picked
from LA plate with the help of sterile inoculation loop and inoculated in LB.
The culture was incubated in dark at 28°C for 16h with shaking at 200rpm.
Agrobacterium cultures in LB were centrifuged at 5,000 rpm for 5 min
at 28°C. Supernatant was discarded and pellet was dissolved in 20 ml of
liquid co-cultivation medium [(containing B5 Major & Minor Salts, Ferrous-
NaEDTA, Sucrose, 2-[N-morpholino] ethanesulfonic acid (MES), B5 Vitamins,
Acetosyringone (3', 5'- Dimethoxy-4-hydroxyacetophenone), GA3 (Gibberellic
acid), BAP, L-Cysteine, Na-thiosulphate and DTT); (Table 3.7)].
26
Acetosyringone was dissolved in ddH2O first and then added to the mixture
for further sterilization.
Table 3.7 Composition of Co-cultivation (CCM).
Components Co-cultivation medium (1l)
B5 Major Salts (40X) 2.5ml
B5 Minor Salts (200X) 0.5ml
Ferrous-NaEDTA (200X) 0.5ml
Sucrose (3%) 30g
2-[N-morpholino]ethanesulfonic acid (MES) 3.9g
Agar (plate only) 8g
B5 Vitamins (100X) 10ml
Acetosyringone (100mM) 1ml
GA3 (Gibberellic acid) mgml-1 1ml
BAP (6-benzyl-aminopurine) (1.67mg ml-1) -
L-cysteine (3.3 mM) 400mg
Na-thiosulphate(1.0mM) 248mg
Dithiothreitol (DTT, 1mM) 154mg
3.9.8 Sonication assisted Agrobacterium-mediated transformation(SAAT)
For SAAT, plant tissue was sonicated in a bath sonicator (HF-
frequency: 35 KHz) in the presence of Agrobacterium culture. The explants
were kept in liquid co-cultivation medium and subjected to sonication in 20ml
Agrobacterium suspension (in co-cultivation medium) for 0-30s followed by
soaking on sterile Whatman filter paper to remove excess co-cultivation
medium. Ten treated calli developed from embryo and leaf base were placed
on top of solid co-cultivation medium. Plates were then sealed with ParafilmTM
and incubated at 25±2ºC for 3-4 days in dark.
27
3.9.9 Vacuum Infiltration assisted Agrobacterium-mediatedtransformation (VIAAT)
During co-cultivation, explants submerged in co-cultivation medium
with bacteria, were subjected to various time periods of vacuum infiltration viz.
10 and 15min at different vacuum pressure ranging from 15 to 30 inch of Hg.
3.9.10 Sonication and vacuum infiltration assisted Agrobacterium-mediated transformation (SVIAAT)The conditions optimized in the methods SAAT and VIAAT were
applied in combination to achieve maximum transformation efficiency. This
method was referred to as Sonication and vacuum infiltration assisted
Agrobacterium-mediated transformation (SVAAT) of oat.
3.9.11 Selection and plant regenerationCalli were washed with cefotaxime (250mg l-1) containing MS Liquid
medium to remove the excess Agrobacterium culture. Calli were kept in
cefotaxime solution for fifteen minutes and blot dried on sterile filter paper and
cultivated on MS medium supplemented with hygromycin 20mg l-1 and
cefotaxime 500mg l-1. Only calli which were able to regenerate on MS medium
supplemented with hygromycin 20mg l-1 were considered as putative
transformed plants.
After 8 days of culturing transformed plants survived and regenerated
on hygromycin containing medium and appeared greenish in colour and the
non-transformed plants does not showed any growth and were light yellowish
to brown necrosis. Hence they were removed and only green and healthy
plants were allowed to regeneration.
3.9.12 Statistical analysisA range of parameters influencing transformation was evaluated using
fifty explants for each experiment. Each experiment was repeated at least
three times. All the parameters were evaluated and optimized on the basis of
GUS activity in treated explants or the number of regenerating explants. The
data were analyzed using one-way analysis of variance (ANOVA) in a
completely randomized design (CRD). For each experiment, the treatment
means and least significant difference (LSD) were determined (α= 0.05). LSD
28
was used to separate the means for significant effect at significance level P<
0.05. All statistical analysis was performed using web based statistical
package WASP2 (http://icargoa.res.in).
Table 3.8 Shoot Elongation (SEM) and Rooting Medium (RM).
ComponentsShoot
ElongationMedium (1L)
RootingMedium (1l)
MS Major Salts (40X) 25ml 25ml
MS Minor Salts (200X) 5ml 5ml
MSIII Iron Stock (200X) 5ml 5ml
Sucrose (3%) 30g 30g
2-[N-morpholino] ethanesulfonic acid
(MES)
0.6g 0.6g
Purified Agar 8g 8g
B5 Vitamins (100X) 10ml 10ml
L-Aspartic acid 50mg 50mg
GA3, (1mg ml-1) 1ml 0.3ml
BAP (1mg ml-1) 2ml -
NAA (1mg ml-1) 0.1ml 0.0 or 0.1 ml
Cefotaxime, (250mg ml-1) 1ml 1ml
Carbenicillin, (100mg ml-1) 1ml 1ml
pH 5.6 5.6
3.9.13 GUS Histochemical assayTransient GUS expression in explants was histochemically assayed
after 3 to 5 days of co-cultivation with A. tumefaciens GV3101 containing
pCAMBIA 1305.1 vector by staining the explants in a buffer containing X-
GLUC (Table 3.9). Briefly, 10 explants with shoots were incubated in X-GLUC
29
overnight at room temperature in dark and washed with ethanol for removing
chlorophyll content. Experiment was performed in triplicate. The developing
callus, shoots and the putative transgenic plantlets regenerated through
transformation experiments were also analyzed through histochemical assay.
GUS histochemical assay was performed according to the method described
by Jefferson (1987). Histochemical localization of GUS activity was examined
under a Nikon DXM 1200F stereomicroscope (Plate 5).
Table 3.9 Composition of GUS staining solution.
SI. ConstituentsConcentration
For 1ml final volumeStock required
1 Distilled water - - 830μl
2 Sodium phosphate pH 7.0 1M 0.1M 100μl
3 EDTA 0.5M 10mM 20μl
4 Triton 100X 10% 0.1% 10μl
5 Potassium ferri-cyanide 50mM 1mM 20μl
6 X- Gluc 0.1M 2mM 20μl
3.9.14 Molecular analysis through Polymerase Chain Reaction (PCR):
3.9.14.1 DNA Isolation
The technique of DNA isolation rely upon the fact that nucleic acid (NA)
would form suitable complex with detergent cetyltrimethylammonium bromide
(CTAB) under high salt concentration and when the concentration reaches
0.4M NaCl the CTAB-NA complex would precipitate. Genomic DNA was
isolated using method adopted by Saghai-Maroof et al. (1984) with suitable
minor modifications. DNA Extraction buffer [100mM Tris-HCl (pH 8.0),
20mM EDTA (pH 8.0), 1.4M NaCl, 2% CTAB and 0.2% β-
mercaptoethanol] was made without β-mercaptoethanol on a magnetic stirrer
to avoid foaming. β-mercaptoethanol was added to the cooled solution at
room temperature.
30
Table 3.10 Composition of DNA Extraction buffer.
Reagents Concentration
Tris-HCl (pH 8.0) 100mM
EDTA (pH 8.0) 20mM
NaCl 1.4M
CTAB 2%
β-mercaptoethanol 0.2%
Sample (2g) was homogenized in liquid nitrogen using a pre-chilled
pestle and mortar. The fine powder was transferred to a 50ml Oakridge
tube and 10ml of DNA extraction buffer (preheated to 65ºC) was added
and mixed thoroughly. The samples were incubated in a water bath at
65ºC for 1h with intermittent mixing every 10min to ensure complete and
even extraction. The samples were then removed from water bath and
cooled to room temperature. Samples were then centrifuged for 15min at
10,000rpm at room temperature. Supernatant was transferred to a fresh
tube. Then an equal (to supernatant) volume of chloroform: isoamyl
alcohol (24:1) v/v was added and mixed thoroughly but gently for about
5min. The mixture was then centrifuged for 15min at 10,000rpm at room
temperature. Supernatant was transferred to a fresh tube and equal (to
supernatant) volume of chilled isopropanol was added and mixed gently
by inverting tubes and kept for 10min undisturbed. The DNA precipitate
was then spooled out using 1ml cut tips and transferred to a 1.5ml
microcentrifuge tube. DNA was again centrifuged at 10,000rpm for 10min.
The supernatant was discarded and pellet was washed with 70% ethanol.
The pellet was dried at room temperature and dissolved in 200µl of TE
buffer for further use.
3.9.14.2 DNA purificationThe purification of DNA was carried out in order to remove the
impurities like RNA, proteins and polysaccharides. These are considered as
inhibitors in DNA amplification during PCR.
31
5µl of RNaseA (5mg ml-1) was added to DNA, mixed well and
incubated at 37ºC for 30min. This was followed by the addition of equal
volumes of chloroform: isoamyl alcohol (24:1) v/v and mixed vigorously.
The above mixture was centrifuged at 14,000 rpm for 10min. Supernatant
was transferred to a fresh microcentrifuge tube and 1/10 volume of 3M
sodium acetate (pH 5.4) was added followed by further addition of two
volumes of pre-chilled ethanol and mixed gently for DNA precipitation. The
precipitated DNA was centrifuged at 12,000rpm for 5min to obtain pellet.
The pellet was dried at room temperature to completely remove ethanol
and then dissolved in 100µl of TE buffer and stored at -20ºC for further
use.
3.9.14.3 Quantification of DNAIsolated DNA was quantified by measuring the absorbance at 260nm
and 280nm on a UV-spectrophotometer. 50µgml-1 concentration of double
stranded DNA shows an absorbance of 1 at 260nm. Concentration of DNA
samples was calculated using formula: (O.D.260nm x 50µg DNA/ml x
Dilution factor)/1000.
3.9.14.4 Dilution of DNAThe quantified DNA was diluted according to the DNA quantity needed
in each sample for PCR amplification using sterile nuclease free water.
Dilutions were carried out according to the following formula:
Dilution =Required concentration of DNA (ng/µl) x Total volume required (µl)
Available concentration of DNA (ng/µl)
3.9.14.5 PCR amplification with gene specific primersPCR reaction was prepared with following concentrations: 10X Taq
buffer with MgCl2, 100µM dNTPs, 10pmol primers (forward and reverse),
1UTaq DNA polymerase and 25-100ng of template DNA.
3.9.14.6 PCR conditionsPCR conditions were standardized considering different parameters
viz. initial denaturation, denaturation, annealing, extension and final extension
using Thermo Hybrid (Px2) PCR Machine. PCR thermal and reaction profiles
32
(Table 3.12) were optimized for amplification purpose by using specific
primers.
3.9.14.7 Gel electrophoresis of PCR productDNA molecules obtained throughout the study were visualized on
agarose gel. Agarose gel electrophoresis was carried out according to
Maniatis et al. (1989). According to the purpose, different concentrations (0.8-
1%) of gel solutions were prepared in 0.5X TBE buffer. For 0.8% agarose gel,
0.8g of agarose was melted completely in 100ml of 0.5X TBE buffer by
heating. Then the solution was left to cool around 50°C and 50µl of ethidium
bromide (10mg ml-1) added to the gel solution. The gel was poured into the
electrophoresis tray having a comb, which will form the wells for the sample
loading. The gel was left at room temperature until it was solidified and
electrophoresis tank was filled with 0.5X TBE buffer. The samples were
prepared by mixing the samples with 6X loading buffer to the final
concentration of 1X and loaded into the wells, along with DNA size markers
(λ-phage DNA digested with PstI), in a separate well. Then the tank was
connected to a power supply and run under constant voltage of 50-60V in
agarose gel electrophoresis apparatus (BioRad, USA). The gel was visualized
under UV transilluminator and photographed.
Table 3.11 PCR programme for different primers used in the study
No. ofcycles Steps
Temperatures (ºC) and durations
hptII caMV 35S virD2
1 Initialdenaturation
94 ºC for 5min
94 ºC for 5min
94 ºC for 10min
35
Denaturation 94 ºC for 1min
94 ºC for 1min
94 ºC for 1min
Annealing 52 ºC for 1min
52 ºC for 1min
50 ºC for 1min
Primerextension
72 ºC for 2min
72 ºC for 2min
72 ºC for 2min
1 Final extension 72 ºC for 10min
72 ºC for 10min
72 ºC for 10min
33
3.10 Time course of transformation
A general time course of the transformation procedure followed in the
present investigation has been presented in Table 3.13.
34
Table 3.12 List of primers and their features.
S.N.PrimerCode
Sequence
(5’-3’)
No. ofNucleotides
GCContent
(%)
Tm(°C)
AnnealingTemp. (°C)
Expectedfragment size
(bp)
1Hpt F TCGTCCATCACAGTTTGCC 19 52.6 55.4
52 499Hpt R AAAAGCCTGAACTCACCGC 19 52.6 56.0
2CamVF GCTCCTACAAATGCCATCA 19 47.3 52.6
52 522CamVR GATAGTGGGATTGTGCGTCA 20 50.0 54.8
3Vir D2A ATGCCCGATCGAGCTCAAGT 20 55.0 58.9
50 338Vir D2E CTGACCCAAACATCTCGGCTGCCCA 25 60.0 65.1
35
Table 3.13 The time course of the transformation procedure.
Steps Description Materials Time period
1. Explant preparation (100 explants) Oat mature Embryos calli and Leaf base 30 to 45 Days
2. Agrobacterium inoculation Liquid co-cultivation medium, overnight bacterial culture (12-16 hr),sonicator for sonication, vacuum pump with desiccator for vacuuminfiltration
~ 20 min
3. Co-cultivation Co-cultivation medium in petri dishes (No antibiotics) 3 Days
4. Washing of explants Sterile water added with 400 mg l-1cefotaxime 1 min each
5. Shoot regeneration Regeneration medium supplemented with hygromycin in petri dishes 5-6 weeks
6. Rooting of shoots Rooting medium supplemented with hygromycin in bottle jars 2-3 weeks
7. Gus analysis (between steps 3-4) X-Gluc, assay buffer, vacuum pump with desiccators for vacuuminfiltration, 70 % ethanol
2 days
8. PCR analysis Primers, Taq polymerase and PCR buffer, Agarose powder, TBEbuffer
1 day
9. Hardening of regenerated plants Pots covered with a plastic bag with sterile Soil:Sand:Vermiculite(1:1:1)
2-3 weeks
Total time to obtain fully hardened transgenic plants 12-16 weeks
11. Green house growth Pots with potting mix, irrigation-100 ml/pot/day Up to maturity
36
RESULTS
The present investigation was carried out with an objective to achieve
Agrobacterium-mediated transformation in oat. For transformation of oat, mature
seeds were sterilized, germinated and used for explants generation. For
transformation, Agrobacterium tumefaciens GV3101 carrying the binary vector
pCAMBIA 1305.1 was used, which contain a reporter gene (gus) and after
transformation, further experiments were carried out for confirmation of
transformation. The putative transformants were selected on media
supplemented with antibiotics and these were further validated through molecular
analysis. The results obtained are presented below.
4.1 In vitro morphogenesis studiesFor the in vitro morphogenesis studies in oat two separate experiments
were conducted with mature embryo and leaf base explants. Explants of five
genotypes viz. JO-1, OS-6, KENT, JHO-822 and JHO-851 were cultured on
different combination of MS media. The media were selected on the basis of
preliminary experiments conducted to screen suitable plant growth regulators
and their combinations for in vitro response. The basal MS medium was fortified
with different combinations of BAP, NAA, IAA, IBA and 2,4-D in varying
concentrations. During present investigation, observations were recorded for
callus induction, embryogenic callus and organogenic callus formation and plant
regeneration abilities.
4.1.1 Morphogenesis in cultured explantsTwo explants, mature embryo and leaf base were cultured on MS medium
fortified with different concentrations and combinations of plant growth regulators.
Leaf base explants were obtained by germination of oat seeds on MS basal
medium for 6 days (Plate 1). The first response of cultured explants was
visualized after one week and mostly independent of culture media combinations
and accessions. During the second week, explants became swollen and no
callus proliferation was evident. The callus initiation started from the upper
37
portion of explants usually not in contact with the culture medium. After 28-35
days of culture, callus initiating explants were counted.
After callus induction from the explants, callus tissue developed distinct
characteristics such as dense, rough, soft and sometimes glossy. These
distinctness reflected diversity in in vitro developmental potentials with the
different culture medium regimes.
In vitro morphogenesis, the way in which a callus forms a new plant in
vitro, was variable. During the present investigation plant regeneration from the
explants cultures appeared to be direct as well as via callus phase. Culture
media played an important role in the formation of morphogenic callus (Table
4.1).
Table 4.1 Observation on in vitro regeneration of Oat cultivar JO-1.
Explants tobe taken
No. of callusformation/ 90
explants
No. explantshaving shoot
formation
No. of explantshaving rootformation
Embryo 62 48 43
Leaf base 75 53 39
4.1.2 Mature embryo culture
Mature embryos were cultured on different combinations of MS medium.
After, callus induction, embryogenic calli and organogenic calli formation were
observed on different combination of MS medium.
4.1.2.1 Callus inductionThe callus induction from mature embryo cultures varied from 90-97%.
Maximum callus induction was evident from JO-1 (97.0%) followed by OS-6
(90.0%). In terms of the culture media response to in vitro culture, the
performance of culture media MS6D with 6mg l-1 2,4-D (97.0%) was found to be
the best in terms of callus initiation (Plate 2).
38
4.1.2.2 Embryogenic callus initiationThe mean embryogenic callus formation from mature embryo cultures
varied from 86.5-96%. Among five accessions, maximum embryogenic calli
formation was observed for JO-1 (96.0%). In terms of the culture media response
to in vitro culture, the performance of culture media MS6D (96.0%) followed by
MS10D (86.5%) was found to be most responding for embryogenic callus
initiation (Plate 4).
4.1.2.3 Organogenic callus formationThe mean organogenic callus formation from mature embryo cultures
varied from 2.45-13.3%. Maximum organogenic calli formation was observed for
cv. JO-1 (17%). (Plate 2)
4.1.3 Leaf base cultureLeaf base explants were cultured on three different combinations of MS
medium. Callus induction, embryogenic calli and organogenic calli formation
were observed from all the accessions and on all combinations of MS medium;
however their frequency varied among the different media combinations and
accessions. Leaf bases were observed to swell 5-10 days after plating. Callus
formation was observed after 20-25 days of plating. Callus proliferation started
from the cut edges of the leaf. After callus induction, initiated callus tissue
developed distinct phenotypes viz. wet, rough, hard dense and glossy, reflecting
different developmental potentials. After 40-45 days of inoculation, calli could be
distinguished on the basis of their phenotypic appearances. Compact, light green
coloured calli with few or many dark green bead like structures and sometimes
partially covered with thin layer of white loose callus were recognized as
embryogenic calli.
4.1.3.1 Callus inductionThe mean callus induction frequencies from leaf base cultures varied from
1.5%-89.0%. Maximum callus induction was evident from JO-1 (89.0%) and
minimum by OS-6 (1.5%). Among different culture media, MS6D (98.0%), was
found the best (Plate 3).
39
4.1.3.2 Embryogenic callus initiationThe overall formation of embryogenic calli varied from 2.27% to 88.1%.
Most embryogenic callus were generated from JO-1 (95.5%) followed by OS-6
(Plate 3).
4.1.3.3 Organogenic callus formationThe mean organogenic callus formation from leaf base cultures varied
from 2.67% to 12.82%. Higher organogenic calli formation was observed from
JO-1 (12.82%), and least by OS-6 (2.67%). (Plate 4)
4.2 Agrobacterium-mediated transformation of OatExplants each of oat mature embryo calli and leaf base calli were infected
with Agrobacterium suspended in co-cultivation liquid medium and then the calli
were transferred on to the co-cultivation solid medium and kept in dark for 1-3
days to observe transformation efficiency.
It was observed that the co-cultivated calli which were kept for incubation
for two days showed best transformation efficiency than one day and three day
incubation periods.
4.2.1 Assessment of antibiotic sensitivity of explantsThe sensitivity of explants to the antibiotic hygromycin was established
prior to actual transformation experiments in order to determine the effective
concentration for selection of transformants. The explants were cultured on MS
medium containing 2mgl-1 BAP, 0.1mgl-1 IAA and supplemented with either of five
different concentrations of hygromycin (10, 15, 20, 25 and 30mg l-1) to test
hygromycin sensitivity with a control in each and observed for growth up to at
least 6 weeks. In the absence of antibiotics, the explants regenerated normally
and produced calli and shoots. The regeneration capacity of explants was
restricted even at 25mg l-1 concentrations hygromycin respectively, resulting into
very slow growth and a maximum of 2 per cent of explants showed regeneration
of adventitious shoots after three weeks of culture. While, explants cultured on
medium with 30mg l-1 Hygromycin caused total inhibition of shoot regeneration
within 2 weeks and finally resulting into bleaching of explants (Table 4.2).
40
However, explants cultured on higher concentrations of antibiotic (hygromycin,
30-40mg l-1) became necrotic and dried up within one week. Hence, antibiotic
concentrations on and above of 20mg l-1 of hygromycin were used for selection of
transformants in subsequent transformation experiments.
Table 4.2: Percent survival and regeneration in oat explants in the presenceof different concentrations of antibiotics in regeneration(MS02B0.1N) medium.
Cultivars Explants Hygromycin concentration (mg l-1)
Control 10 15 20 25
JO-1Embryos calli 68 14 6 0 0
Leaf base calli 82 17 9 0 0
4.2.2 Culture of co-cultivated explantsExplants after co-cultivation with Agrobacterium strains, were placed on
regeneration medium with antibiotics cefotaxime (250mg l-1) and hygromycin
(20mg l-1). The regenerated explants were subsequently subcultured on
regeneration medium. This culture strategy greatly stimulated the in vitro
regeneration of transformed callus with embryogenic and organogenic calli.
It was observed that embryogenic and organogenic transformed calli
showed maximum regeneration on MS medium fortified with 2mg l-1 BAP and
0.1mg l-1 NAA.
4.2.3 Optimization of plant transformation conditions4.2.3.1 Bacterial inoculum density and inoculation duration
Exposure of embryo calli and leaf base calli explants to an undiluted
culture (OD600 = 0.5) of Agrobacterium tumefaciens GV3101 resulted in severe
necrosis of the explants. Diluted culture (1:2 dilutions) reduced necrosis to a
great extent. The GUS response varied significantly among the treatments. The
maximum GUS response was obtained with 1: 2 dilution for 20 min. Therefore,
41
subsequent experiments were carried out for 20 min inoculation using 1:2 dilution
of Agrobacterium culture (OD600 = 0.5).
4.2.3.2 Effect of co-cultivation duration on transformationFollowing transformation, explants were co-cultivated on semisolid co-
cultivation medium at 25±2ºC for different durations to test its effect on
transformation frequency in oat explants. Co-cultivation durations up to 2-4 days
showed better results in oat transformation (Table 4.9). Experiment failed
completely when duration of co-cultivation was increased to 5 days giving lowest
transformation (4%) with high mortality of explants. A 3-day co-cultivation period
was the best option over 2 or 4 days resulting into highest transient
transformation efficiency of 40%.
4.2.3.3 Effect of different treatment on transformation of embryo explantsThe embryo explants tested for transformation in oat. For transformation
of embryo different treatments as like sonication, vacuum infiltration was used.
On the basis of hygromycin survival, T5 (73.33) was found to be statistically
superior over all other treatments and minimum survival was found in T9 (47.78)
with 2.32 at 5% CD (Table 4.3). In addition, the T5 (52.96) was also found to be
statistically superior over all other treatments for transformation efficiency with
GUS assay in embryo explants (Table 4.4) however, leaf base explants exhibited
less transformation efficiency. The minimum transformation efficiency with GUS
assay was observed in T3 (32.59). During transgenic selection based on PCR, T5
(40.74) proved to be superior over all other treatment used for transformation
(Table 4.5) and minimum value was observed in T3 (26.67). Finally, in case of
embryo highest transformation efficiency with hygromycin survival, GUS assay
and PCR were 73.33%, 52.96% and 40.74% respectively.
42
Table 4.3 Effect of different treatment on transformation efficiency (TE %)of embryo explants based on survival on hygromycin containingmedia.
Embryos Transformationtreatment
Co-cultivationperiod (Hours) Treatment Transformation
efficiency (%)
Sonication48 T1 52.5972 T2 55.1996 T3 51.11
Vacuum Infiltration48 T4 65.9372 T5 73.3396 T6 60.37
Sonication+
Vacuum Infiltration
48 T7 52.2272 T8 57.4196 T9 47.78
Control - T10 4.44SEM ± 0.78, CD 1% 3.17, CD 5% 2.32
Table 4.4 Effect of different treatment on transformation efficiency (TE %)of embryo explants based on criteria of GUS assay.
EmbryosTransformation
treatmentCo-cultivationperiod (Hours) Treatment Transformation
efficiency (%)
Sonication48 T1 35.5672 T2 37.7896 T3 32.59
Vacuum Infiltration48 T4 50.0072 T5 52.9696 T6 46.67
Sonication+
Vacuum Infiltration
48 T7 46.3072 T8 46.6796 T9 42.22
Control - T10 0.0SEM ± 0.74, CD 1% 3.11, CD 5% 2.28
43
Table 4.5 Effect of different treatment on transformation efficiency (TE %)of embryo explants based on criteria of PCR.
Embryos Transformationtreatment
Co-cultivationperiod (Hours) Treatment Transformation
efficiency (%)
Sonication48 T1 27.7872 T2 29.2696 T3 26.67
Vacuum Infiltration48 T4 38.1572 T5 40.7496 T6 37.78
Sonication+
Vacuum Infiltration
48 T7 31.8572 T8 36.3096 T9 33.70
Control - T10 0.0SEM ± 0.81, CD 1% 3.28,CD 5% 2.40
4.2.3.4 Effect of different treatment on transformation of Leaf base explantsThe leaf base explants also tested for transformation in oat. For
transformation of leaf base also the different treatments as like sonication,
vacuum infiltration were used. On the basis of hygromycin survival, T5 (70.0) was
found to be statistically superior over all other treatments and minimum survival
was found in T9 (46.3) with 2.5 at 5 % CD (Table 4.6). In addition, the T5 (51.85)
was also found to be statistically superior over all other treatments for
transformation efficiency with GUS assay in leaf-base explants (Table 4.7)
however, embryo explants exhibited more transformation efficiency. The
minimum transformation efficiency with GUS assay was observed in T3 (33.33).
During transgenic selection based on PCR, T5 (37.04) proved to be superior over
all other treatment used for transformation (Table 4.8) and minimum value was
observed in T3 (28.89). With leaf base, highest transformation efficiency with
hygromycin survival, GUS assay and PCR were 70.0%, 51.85% and 37.04%
respectively.
44
Table 4.6 Effect of different treatment on transformation efficiency (TE %)of leaf base explants based on hygromycin survival.
Leaf base Transformationtreatment
Co-cultivationperiod (Hours) Treatment Transformation
efficiency (%)
Sonication48 T1 50.0072 T2 52.2296 T3 48.89
Vacuum Infiltration48 T4 64.4472 T5 70.0096 T6 58.89
Sonication+
Vacuum Infiltration
48 T7 50.0072 T8 54.4496 T9 46.30
Control - T10 3.70SEM ± 0.85, CD 1% 3.41, CD 5% 2.50
Table 4.7 Effect of different treatment on transformation efficiency (TE %)of leaf base explants based on criteria GUS assay.
Leaf base Transformationtreatment
Co-cultivationperiod (Hours) Treatment Transformation
efficiency (%)
Sonication48 T1 34.8172 T2 37.7896 T3 33.33
Vacuum Infiltration48 T4 48.8972 T5 51.8596 T6 45.56
Sonication+
Vacuum Infiltration
48 T7 41.1172 T8 43.7096 T9 41.11
Control - T10 0.0SEM ± 0.82, CD 1% 3.31, CD 5% 2.42
45
Table 4.8 Effect of different treatment on transformation efficiency (TE %)of leaf base explants based on criteria PCR putative transgenicexplants.
Leaf baseTransformation
treatmentCo-cultivationperiod (Hours) Treatment Transformation
efficiency (%)
Sonication48 T1 31.1172 T2 30.0096 T3 28.89
Vacuum Infiltration48 T4 36.6772 T5 37.0496 T6 33.33
Sonication+
Vacuum Infiltration
48 T7 33.3372 T8 34.4496 T9 32.22
Control - T10 0.0SEM ± 0.919, CD 1% 3.692, CD 5% 2.719
4.2.3.5 Overall effects of different treatment on both oat explantstransformation
When observed transformation data of both explants combinedly analysed
on basis of hygromycin survival, T9 (73.33) was found to be statistically superior
over all other treatments and minimum survival was found in T18 (46.30) with 2.34
at 5% CD. In addition, the T9 was also found to be statistically superior over all
other treatments for with 52.96% transformation efficiency in GUS assay of leaf-
base explants. The minimum transformation efficiency with GUS assay was
observed in T5 (32.59). During transgenic selection based on PCR, T9 proved to
be superior over all other treatment used for transformation with transformation
efficiency of 40.74% (Table 4.9).
4.3 GUS assay in transformed calli and shootsAfter selection on media containing hygromycin, the putative transformed
calli and shoots were assayed for transient GUS expression. Blue stained leaf
46
Table 4.9 Overall effects of co-cultivation period and different treatments on transformation efficiency (TE %).
Transformationtreatment
Co-cultivationperiod (Hours)
Explants tobe taken Treatment
Transformation efficiency (%) based on
Hygromycin resistanttransgenic explants
GUS putativetransgenic explants
PCR putativetransgenic explants
Sonication
48Embryo T1 52.59 35.56 27.78
Leaf base T2 50.00 34.81 31.11
72Embryo T3 55.19 37.78 29.26
Leaf base T4 52.22 37.78 30.00
96Embryo T5 51.11 32.59 26.67
Leaf base T6 48.89 33.33 28.89
VacuumInfiltration
48Embryo T7 65.93 50.00 38.15
Leaf base T8 64.44 48.89 36.67
72Embryo T9 73.33 52.96 40.74
Leaf base T10 70.00 51.85 37.04
96Embryo T11 60.37 46.67 37.78
Leaf base T12 58.89 45.56 33.33
Sonication +Vacuum
Infiltration
48Embryo T13 52.22 46.30 31.85
Leaf base T14 50.00 41.11 33.33
72Embryo T15 57.41 46.67 36.30
Leaf base T16 54.44 43.70 34.44
96Embryo T17 47.78 42.22 33.70
Leaf base T18 46.30 41.11 32.22
Control -Embryo T19 4.44 0.0 0.00
Leaf base T20 3.70 0.0 0.00SEM ± 0.820CD 1% 3.132CD 5% 2.343
SEM ± 0.799CD 1% 3.055CD 5% 2.285
SEM ± 0.869CD 1% 3.329CD 5% 2.483
47
venation and spots could be clearly visualized on transformed calli and shoots
while untransformed calli and shoots were completely bleached and were devoid
of any stained spots/area (Plate 5).
4.4 Molecular analysis of putative transformants of oat
After selection on antibiotic containing media, the putative transformants
plantlets were analyzed at molecular level for confirmation of transformation.
4.4.1 Colony PCR using Agrobacterium colony as template for positivecontrolAgrobacterium tumefaciens strain GV 3101 containing binary plasmid
vector pCAMBIA 1305.1 were grown in LB medium (Plate 6A, 6B). Single colony
of the Agrobacterium strains was used in colony PCR to test the product sizes as
well as for its further use as a positive control. Plasmid DNA was isolated from
Agrobacterium colonies and further used as positive control (Plate 6C). When
Agrobacterium strain GV3101 harbouring pCAMBIA 1305.1 vector was used as
template, while hptII primers led to a product size of 499bp as amplified upon gel
electrophoresis of colony PCR product (Plate 7A).
4.4.2 Absence of Agrobacterium contamination in transformed plantsGenomic DNA from putatively transformed plants was subjected to PCR
using virD2 gene specific forward and reverse primers which led to the
amplification of 338bp fragment specific to the Agrobacterium chromosomal
DNA. Based on the results of the analysis thirteen plants were found with an
amplified fragment of 338bp i.e. virD2 gene specific fragment, indicating that the
plants were contaminated with Agrobacterium (Plate 7B), rest of the putative
transgenic plants were devoid of any such contamination.
4.4.3 Analysis of plants transformed by pCAMBIA 1305.1 vector.The genomic DNA from different samples of putative transformants were
analyzed for amplification of fragment of hptII gene using gene specific primer.
Negative control (non-transformed plants) and the positive control (plasmid
isolated form Agrobacterium strain pCAMBIA 1305) were also used for
48
amplification of this gene. Some putative transformants gave positive results with
a product size of approximately 499bp with gene specific primer of hptII gene and
products of 522bp size in case of CaMV35S promoter specific primers (Plate
7C).
Molecular analysis employing polymerase chain reaction clearly indicated
the integration of the transgenes from the T-DNA region of Agrobacterium to the
oat host genome. Finally the transformation efficiency observed approximately
40% in used explants of oat.
4.5 RootingThe transformed explants further separated and subculture on rooting
medium (1B0.1I) (Plate 8). After sufficient rooting the transgenic plantlets should
be hardened under green house condition. Finally they were transfer to soil.
4.5 HardeningAfter successful transfer to soil, the hygromycin resistant putative
transgenic plants were subjected to molecular analysis to validate the genetic
transformation. The genomic DNA was used as template for PCR analysis with
gene specific primer sets. Among all the hygromycin resistant plants, some were
found with Agrobacterial contamination based on the amplification of virD2 gene
specific amplicons of 338bp. Remaining plants were tested by PCR using hptII
gene specific primer set. Remaining putative transformants gave positive results
with a product size of approximately 499bp with gene specific primers of hptII
gene. Same amplification products were also visualized in positive control using
A. tumefaciens GV3101 single colony as a template while, they were absent in
negative control. DNA from the non-transformed plantlets did not show any
amplified product.
49
DISCUSSION
Totipotency and genetic engineering of somatic cells is the basis for
transformation and in vitro propagation which is being extensively used for
obtaining a large number of genetically identical transformed plantlets. These
plantlets would serve as an excellent source for tolerance to various biotic and
abiotic stresses. The abiotic stresses and biotic stresses are the major
constraints in oat production. So for the development of transgenic plants; callus
induction, genetic transformation and plant regeneration is a critical step.
Despite many years of research, tissue culture of oat is still not easy and
varies in each and every genotype. Selecting a suitable subculture medium to
improve the quality of calli might be a key step for the success of transformation.
Production of embryogenic calli with high regeneration ability is prerequisite for
highly efficient transformation of oat (Somers et al., 1992; Torbert et al., 1995).
During present investigation plant regeneration appeared to be a stepwise
process, starting from callus induction, callus proliferation, morphogenesis i.e.
embryogenesis and/or organogenesis followed by plantlet regeneration (Plate 2,
3, 4). Plants from explant cultures followed one of the two pathways: direct
organogenesis and somatic embryogenesis. Organogenesis was accomplished
by the de novo organization of gamogenesis (only shoot) or rhizogenesis (only
root). Direct somatic embryogenesis or formation of embryoids in callus cultures
was obtained without complete plantlet regeneration after transformation.
Multiple shoots proliferation was obtained from callus after three to five weeks of
co-cultivation culture of mature embryo and leaf base.
The transformed explants were selected on the basis of antibiotic provided
in the media (hygromycin 20mg l-1) and then individual shoots were aseptically
excised and GUS stained for validating transformation (Plate 5). Major factors,
which produced considerable variation in the pattern of development in culture,
were cultivars and media combinations. Genotypic differences are usually related
to variation in endogenous growth regulator levels (Seraj et al., 1997). Different
50
explants of single genotype do not responded identically in cultures, most likely
due to varying gradients of endogenous growth regulators. Single explants
collected from same source behaved differently in culture depending upon size
and location on donor plant. Response of explants from well-nourished plants
was different from those of nutrient deficient plants. Even in our single
experiment, with similar explants and media, culture responses varied
considerably.
During present investigation, three types of media were used for callus
culture establishment. A basal MS medium supplemented with auxins, a growth
regulator free basal MS medium for germination of oat seeds and, the third MS
medium supplemented with low auxin and higher cytokinin for regeneration of
plantlets from embryogenic calli. The use of in vitro grown seedling as starting
materials for tissue culture experiments has several advantages. Sterile plant
material of constant quality can be easily provided within a short time and
specialized and usually extensive growth conditions are not necessary. Results
exhibit that the embryogenic callus induction largely depends upon the nature of
initial culture medium i.e. the first medium, where as other two media supported
the germination of seeds and for regeneration of plantlets, respectively.
The presence of auxin in the medium is generally essential for callus
induction. Tissue or callus maintained continuously in an auxin containing
medium. The callus initiated and multiplied on a medium rich in auxin that
induced differentiation of localized group of meristematic cells called
embryogenic clumps. Developed embryogenic calli were transferred to media
devoid of auxin, or with the reduced levels of auxin and high level of cytokinin.
When transferred to a medium with low auxin and higher cytokinin, the
embryogenic callus showed shoot proliferation.
For mature embryo and leaf base culture, during course of preliminary
investigations three auxins (2,4-D, IAA and IBA) and a cytokinin (BAP) in
different concentration and combinations were used for culture establishment.
Results clearly indicated varying response of growth regulators. Some
51
combinations led to organogenesis, some followed the process of
embryogenesis from cultured explants (Plate 4).
In the present study, mature embryos were placed on ten different
modifications of MS medium (Table 3.6) to evaluate callus initiation. Medium
MS6D induced maximum number of calli (97%) from mature embryo and from
leaf base calli too. In the same cultural conditions medium MS1B1N have shown
less callus initiation (0.75%). It was also observed that incubating in dark,
increased the percentage of calli initiation in genotype JO-1 even up to 50% as
compared to light incubation. Calli obtained in this condition were generally
cream in colour and turned green after transferring to light. Calli turned brown if,
they were not subcultured within three weeks. Almost similar results were
recorded in case of both mature embryo and leaf base explants. Callus induction
from mature embryo of JO-1 (97%) showed high efficiency in medium containing
6mg l-1 of 2,4-D. However low level of 2,4-D i.e. 3mg l-1 in combination with 3mg l-
1 picloram gave similar results (Kim et al., 2004). This may be due to synergistic
action of picloram with auxin 2,4-D.
Plant regeneration efficiency was examined in MS medium containing
2mg l-1 BAP and 0.1mg l-1 NAA. Percentage of plant regeneration from mature
and immature embryos of JO-1 and OS-6 showed high in calli induced from
medium containing 6mg l-1 2,4-D. However, Kim and Lee (2002) reported that
treatment with 3mg l-1 of 2,4-D and 1mg-l-1 of kinetin in callus medium showed
high frequency for plant regeneration in oat cultivars. This result supports that
plant regeneration was influenced by the callus initiation medium (Kim and Lee,
2002). The regeneration efficiencies of JO-1 and OS-6 were 97% and 96% in
medium containing 6mg l-1 2,4-D increased the frequencies of callus induction.
While medium containing MS2B.1N showed high frequency of multiple shoot
proliferation.
During present investigation, growth regulator 6 mg l-1 2,4-D induced
callus in higher frequencies in mature embryo culture (91%) as compared to leaf
base culture (89.9%) among varying concentrations tested ranging from 2.0 to
52
50.0 mg l-1. Kim et al. (2002) have also shown that low level of 2,4-D i.e. 3mg l-1
in combination with 3mg l-1 picloram is quite effective for callus initiation. In
addition, combination of both auxin and cytokinin supplied in culture medium
gave rise to multiple shoot induction from meristematic zones.
From leaf base the embryogenic calli were initiated in medium MS2D
(95.5%), MS3I (65.0%), MS3IBA (62.0%) and MS2IBA (60.0%). Maximum
organogenesis was found on medium MS2B.1N (13.69 %) and minimum on
medium MS3IAA (1.5%) from leaf base culture. However, calli initiated on an
auxin alone failed to initiate embryogenic calli and this lacunae was overcome by
adding a cytokinin in the media.
Leaf base segments have been proved to be a very suitable target for the
production of transgenic oat plant due to their easy availability, the short culture
period and their high regeneration potential (Gless et al., 1998). During the
present investigation for the leaf-base culture, the leaf length was a vital
parameter for obtaining maximum in vitro response. Leaf-base isolated from 6
day old seedlings responded better as compared to younger or older seedlings.
In another experiment on oat by Chen et al. (1995) maximum calli could be
obtained from 3-day-old seedlings. The gradient of morphogenic competence of
leaf-base and apex has been reported for many other cereal species, viz. rice
(Werincke et al., 1981), wheat (Wernicke and Milkovits, 1984), rye (Linacero and
Vazquez, 1986), barley (Becher et al., 1992) and oat (Chen et al., 1995).
During present investigation in a preliminary experiment, among 5
cultivars tested for their in vitro potential, JO-1 showed best results for callus
induction, embryogenic calli formation and organogenic calli formation from
mature embryo and leaf base. In another study on oat, Kim et al. (2004) also
documented genotypic differences for callus induction and regeneration. The
efficiency of in vitro regeneration system being genotype dependent has also
been reported by other groups (Varandani, 2011; Birsin and ozgen, 2001; Chen
et al., 1995). Although strong genotypic effects are still general characteristics of
the in vitro response in cereal tissue culture, studies by Karp and Lazzeri (1992)
53
suggested that with improved techniques, some of these genotypic variations can
be overcome.
The results of present study demonstrated that under experimental
conditions, in vitro responses of explants i.e. mature embryo and leaf base
cultures were dependent on genotype and media combinations. It was also
noticed that mature embryo initiated callus comparatively earlier than the leaf
base. Presence of higher endogenous auxins in mature embryo explants as
compared to leaf base may be the possible reason for an early induction of
callus. One more possible reason for the occurrence of such phenomenon may
be that mature embryo contains meristemoids that are known for higher and
faster regeneration potential. For the regeneration from calli, medium containing
higher level of cytokinin and low level of auxin such as MS2B.1N showed the
best result for both the explants. For regeneration capabilities, both the explants
responded differently. During present investigation maximum plantlets
regeneration was observed from mature embryo followed by leaf base.
Due to the remarkable progress made in the development of gene
transfer technology (Somers et al., 1992), which ultimately resulted in the
production of large number of transgenic plants both in dicots and monocots.
Genetic modification is an important experimental tool that can be used to
analyze and understand the mechanisms responsible for the expression of
transgenes or endogenous genes, and to create plants with the desired
characteristics. The two basic methods of genetic transformation—biolistic and
Agrobacterium-mediated transformation are the methods available (Gasparis et
al., 2008). Potential benefits from these transgenic plants include higher yield,
enhanced nutritional value reduction in pesticide and fertilizer use. Transgenic
oat plants have been obtained using particle bombardment methods of gene
transfer (Pawlowski and Somers, 1998). DNA integration patterns in transformed
plant tissue obtained via particle bombardment tend to be highly variable and
multiple or fragment copies of introduced DNAs are common, especially when
older cultures are targeted. Cho et al. (2003) studied the expression of green
fluorescent protein (GFP) and its inheritance in transgenic oat plants transformed
54
with a synthetic green fluorescent protein gene driven by a rice actin promoter
where proliferating SMCs were bombarded with a mixture of plasmids containing
the sgfp (S65T) gene and one of three selectable marker genes, phosphinothricin
acetyltransferase (bar), hygromycin phosphotransferase (hpt) and neomycin
phosphotransferase (nptII). Cho et al. (1999) developed highly efficient and
reproducible transformation system for oat using microprojectile bombardment of
highly regenerative tissues derived from mature seeds. Highly regenerative
tissues were generated from embryogenic callus which were used as a
transformation target and transformation was achieved successfully with
transformation efficiency of 26%. Hence till now, not many reports were available
on transformation of oat via Agrobacterium-mediated transformation and only
one report was available developed by Gasparis et al. (2008), where they
developed procedures of oat regeneration from two different types of explants:
immature embryos and leaf base segments. Immature embryos are composed of
highly totipotent, meristematic cells, whereas leaf base segment consist of
differentiated cells, which have to undergo dedifferentiation before somatic
embryo development and plant regeneration and this difference encouraged to
test cell-competence to Agrobacterium-mediated transformation and transgene
expression.
The transformation efficiency may be dependent on the factor incubation
period, sonication, vacuum infiltration treatments and concentration of
acetosyringone. The transformation efficiency at four days incubation period
(96h) with vacuum infiltration of calli was higher, but growth of Agrobacterium
was higher. In order to decrease the excess growth of Agrobacterium, addition of
appropriate antibiotic is an essential requirement. Hence, 3 days (72h) incubated
calli culture was better preferred as they showed lesser growth of Agrobacterium,
but sufficient to cause infection as compared to four days (96h) incubated callus
(Table 4.9).
During the present investigation for primary antibiotic selection of
transformed explants we used MS media containing hygromycin (20mg l-1) and
fortified with 2mg l-1 BAP and 0.1mg l-1NAA. In embryos and leaf base explant,
55
transformation efficiency obtained was 73.33 and 70.00% respectively. Validation
of the transformed plant was done by the GUS histochemical assay. As per other
plant, transformed oat also showed blue coloured spots in multiple shoot
regenerated explants and calli. But especially in regenerated oat plant the GUS
expression was showed in leaf venation as blue colour. The callus that would be
transformed showed partial or complete transformation by expressing blue colour
which confirming transformation. The GUS reporter system utilizes a bacterial
gene from Escherichia coli (uidA) coding for a β-glucuronidase (GUS) and
consists in placing this gene in the Ti-plasmid, which is transferred to plant cells
following infection. When the plant tissue is assayed, transformation events were
indicated by blue spots, which is a result of the enzymatic cleaving of an artificial
substrate to give a blue product. In present investigation it was observed, in case
of embryo and leaf base transformations on basis of GUS assay the
transformation efficiency were 52.96% and 51.85% respectively (Plate 5). (Table
4.3 and 4.7)
In the molecular analysis of putative transformants amplified hptII specific
primer were further used for the amplification of hygromycin phosphotransferase
resistant gene. The PCR product showed the presence of amplified bands of the
hptII gene specific primers at 499bp and CaMV 35S promoter region specific
primer at 522bp. This confirmed the transformation however, absence of this
band/amplification at 499 bp possibility of transformation was rejected (Plate 7A).
In this manner putative transformants were validated with the PCR technique.
Presence of agobacterial contamination in transformants was checked by virD2
gene specific primer which amplified a 338bp fragment. Overall, highest
transformation efficiency (40.74%) in oat was observed with the treatment of
vacuum infiltration with 72h incubation in dark during co-cultivation of embryo
explants with Agrobacterium.
An overall protocol for efficient transformation of oat using Agrobacterium-
mediated transformation has been developed which is present in Fig 1.
56
Sterilization of oat seeds
Inoculation in callus induction (MS6D) medium
Infection with Agrobacterium along with vacuum treatment
Co-cultivation of explants for 72h under dark condition
Washing with Cefotaxime solution (250mg l-1)
Selection of putative transformants on regeneration media(MS2B0.1N+Hygromycin 20mg l-1+ Cefotaxime 250mg l-1) for 3 cycles of 10 days
Regeneration of explants
Selection of GUS putative transformants
Detection of transgene through gene specific PCR
Rooting of selected putative transformants on rooting medium (MS)
Hardening
Fig 1. Flow diagram of Agrobacterium-mediated transformation in oat usingdifferent explants
Embryo as explantsLeaf base as explants
Inoculation of seed on MSmedia for germination
Excise the Leaf base from 6days old seedlings aseptically
Soak the seeds overnight indistilled water
Excise the swollen embryounder microscope aseptically
57
SUMMARY, CONCLUSIONS AND SUGGESTIONS FORFURTHER WORK
6.1 Summary
Oat is one of the most important cereal crops worldwide. In spite of its
nutritional importance, its area of cultivation has been low, with virtually no
increase. Conventional breeding has resulted in several important improvements
in this crop and recent advances in biotechnology, such as plant tissue culture
and genetic transformation can significantly contribute to better sustainability of
this important food and fodder crop.
Currently, use of in vitro technology for improvement of oat is rapid,
reliable and sustainable option. However, so far this crop is very difficult to
manipulate in vitro due to its very sensitive response during culturing practices.
Therefore, very extensive and broader approach was applied in this study in
selection of explants, media and other physio-chemical parameters.
For the in vitro regeneration studies in oat from different explants, mature
embryo and leaf base were cultured on MS medium supplemented with different
concentrations and combinations of auxins and cytokinin. In vitro regeneration in
oat was studied by culturing explants on MS medium supplemented with BAP
(0.1-5.0mg l-1) in combination with NAA (1-2mg l-1), IAA (1-3mg l-1), IBA (2-3mg l-
1) and 2,4-D (2-50mg l-1). After 40-45 days of culture, the calli were transferred
into shooting medium. The pH of the entire medium was adjusted to 5.8 prior to
autoclaving. All cultures were incubated at 25±2°C under PAR light and a 12/12
hrs light/dark photoperiod regime.
Culture responses were accounted based on callus induction,
embryogenic calli formation and organogenesis. Among different explants, leaf
base demonstrated best response for regeneration. In mature embryo callus
induction was observed on MS medium supplemented with 2,4-D at 6.0mg l-1,
whereas in case of leaf base, callus induction was observed maximum on MS
medium supplemented with 2,4-D at 2.0mg l-1.
58
In case of embryogenic calli MS medium supplemented with 2,4-D (6mg l-
1) was found to be best and in organogenesis MS medium supplemented with
BAP (0.5-2mg l-1) and NAA (0.1-2mg l-1) was found to be better. Among different
genotypes JO-1 produced maximum number of induced calli, embryogenic calli
as well as organogenic calli.
Regeneration from callus cultures is a prerequisite for the application of
modern methods of in vitro culture for crop improvement. In this study, in vitro
regeneration in oat using mature embryo and leaf base as explants with different
treatments of Agrobacterium-mediated transformation have been described.
Experiments were conducted to examine callus induction from leaf base, mature
embryo and then transforming the calli with Agrobacterium by using different
treatments. The co-cultivation treatment were supplemented with sonication,
vacuum infiltration and both in combination used for transformation with different
incubation period at dark condition of 48h, 72h and 96h (Table 4.9). Among
different transformation treatments, it was found to be the vacuum treatment with
72h dark incubation period observed good results of transformation over other
treatments.
After explants selection on hygromycin containing media, transformed
explants and calli were again validation through GUS staining followed by the
molecular analysis employing polymerase chain reaction. These validations
clearly indicated the integration of the transgenes from the T-DNA region of
Agrobacterium to the oat host genome. However, the transformation efficiency
was less, as approximately only 24 per cent of the explants and calli of oat
exhibited transgenic presence. On the other hand, vacuum infiltration technique
during co-cultivation increased the transformation efficiency up to 40.74 per cent.
6.2 ConclusionOn the basis of results obtained from different explants, mature embryo
and leaf base was preferred over other explants. It can be concluded from the
experiments, that callus induction takes place when basal medium is
supplemented with higher levels of 2,4-D. Whereas shoot differentiation occurs
59
on basal medium supplemented with higher concentrations of BAP with low level
of NAA. Among genotypes, JO-1 was found to be most responsive for in vitro
regeneration hence, was used for further transformation related experiments.
Finally based on data obtained, it was concluded that the mature embryo
calli become infected with Agrobacterium tumefaciens and were transformed with
co-cultivation with vacuum treatments. Higher transformation efficiency at
different transgenic selection criteria was observed when transformed calli were
kept in incubation in dark for 72h followed by an antibiotic wash to remove
Agrobacterium contamination. Finally, based on PCR analysis putative
transgenic calli and/or plants were selected with a highest transformation
efficiency of 40.74 per cent.
6.3 Suggestion for further work
1. In vitro responsive genotypes may be used in inter-specific and
inter-generic hybridization programmes, where in vitro embryo
rescue technique will be required to obtain hybrids.
2. Embryogenic callus culture from mature embryos can be used to
obtain embryogenic cell suspension cultures and for totipotent
protoplast isolation. Suspension cultures can be used for in vitro
selection at cell level, and protoplast for somatic hybridization,
cybridization and genetic transformation purposes.
3. Regeneration protocol developed during this study from embryo/ leaf
bases should be used for development of transgenic lines with
different transgene transformed through this technique.
4. Transformation of the local cultivars of oat with transgenes like
phytase to increase its nutritive values for feed purposes.
5. Development of biotic and abiotic stress resistant varieties of oat
through transformation.
60
REFERENCES
Amoah, B.K., H. Wu, C. Sparks and H.D. Jones (2001). Factors influencing
Agrobacterium-mediated transient expression of uidA in wheat inflorescence
tissue. J. of Exp. Bot., 28 (358): 1135-1142.
Becher, T., G. Haberland and H. Koop (1992). Callus formation and plant regeneration in
standard and microexplants from seedlings of barley (Hordeum vulgare L.). Plant
Cell Rep., 11: 39-43.
Beranova, M., S. Rakousky, Z. Vavrova and T. Skalicky (2008). Sonication assisted
Agrobacterium-mediated transformation enhances the transformation efficiency
in flax (Linum usitatissimum L.). Plant Cell Tiss. Organ Cult., 94: 253-259.
Birsin, M.A., S. Onde and M. Ozgen (2001). Callus induction and plant regeneration from
mature embryos of Oat (Avena sativa). Turk Biol., 25: 427-434.
Carlson A. and H.F. Kaeppler (2007). Oat, Transgenic Crops IV In: E.C. Pua and M.R.
Davey (ed.) Biotechnology in Agriculture and Forestry. 59. pp 151-160.
Chen, H., G. Xu, D.C. Loschke, L. Tomaska and B.G. Rolfe (1995). Efficient callus
formation and plant regeneration from leaves of oats (Avena sativa L.). Plant Cell
Rep., 14: 393-397.
Chen, Z.H., Q.G. Zhuge and C. Sundqvist (1995). Oat leaf base tissue with an efficient
regeneration capacity. Plant Cell Rep., 14 (6): 354-358.
Cho, M.J., H.W. Choi, D. Okamoto, S. Zhang and P.G. Lemaux (2003). Expression of
green fluorescent protein and its inheritance in transgenic oat plants generated
from shoot meristematic cultures. Plant Cell Rep., 21: 467-474.
Cho, M.J., Wen Jiang, Peggy G. Lemaux (1999). High-frequency transformation of oat
via microprojectile bombardment of seed-derived highly regenerative cultures.
Plant Sci., 148: 9-17.
Choubey, R.N., S.N. Zadoo and A.K. Roy (1996). Analysis of forage yield and related
traits in back-cross derived progenies of interspecific matings (Avena sativa x A.
sterilis) of oats. Crop Improv., 23 (1): 155-157.
Gamborg, O.L., R.A. Miller and K. Ojima (1968). Nutrient requirements of suspension
cultures of soybean root cells. Exp. Cell Res., 50: 151–158.
Gasparis, S., C. Bregier, W. Orezyk and A.N. Orczyk (2008). Agrobacterium-mediated
transformation of oat (Avena sativa). Plant Cell Rep., 27: 1721–1729.
61
Gless, C., H. Lorz and A. Jahne-Gartner (1998). Establishment of a highly efficientregeneration system from leaf base segments of oat (Avena sativa L.). Plant CellRep., 17: 441-445.
Grabowska, A. and M. Filipecki (2004). Infiltration with Agrobacterium-the method forstable transformation avoiding tissue culture. Acta Physiol. Plant., 26 (4): 451-458.
Hao, L., L. Zhou, X. Xu, J. Cao and T. Xi (2006). The role of salicylic acid and carrotembryogenic callus extracts in somatic embryogenesis of naked oat (Avenanuda). Plant Cell, Tiss. and Org. Cult., 85: 109-113.
Jefferson, R.A., T.A. Kavanagh and N.W. Bevan (1987). GUS fusions: β-glucuronidaseas a sensitive and versatile gene fusion marker in higher plants. EMBO J., 6:3901-3907.
Karp, A. and P.A. Lazzeri (1992). Regeneration, stability and transformation of barley. In:Shewry PR (ed) Barley: genetics, biochemistry, molecular biology andbiotechnology. CAB International, Wallingford, pp 549–571.
Kim, S., D. Shin and H. Park (2007). Transient b-glucuronidase expression in lily (Liliumlongflorum L.) pollen via wounding-assisted Agrobacterium-mediatedtransformation. Biotechnol. Lett., 29: 965–969.
Kim, K.H. and B.M. Lee (2002). Callus induction and plant regeneration from matureembryo in oat. Korean J. Crop Sci., 47 (5): 352-355.
Kim, K.H., J.H. Moon and S.K. Lee (2004). Improvement of regeneration efficiency frommature embryo and leaf base segment in Korean oat Genotypes. Korean J. CropSci., 49: 349-353.
Kuai, B., S. Perret, S.M. Wan, S.J. Dalton, A.J.E. Bettany & P. Morris (2001).Transformation of oat and inheritance of bar gene expression. Plant Cell, Tiss.and Org. Cult., 66: 79–88.
Lin, J., B. Zhou, Y. Yang, J. Mei, X. Zhao, X. Guo, X. Huang, D. Tang and X. Liu (2009).Piercing and vacuum infiltration of the mature embryo: a simplified method forAgrobacterium-mediated transformation of indica rice. Plant Cell Rep., 28: 1065–1074.
Linacero, R. and A.M. Vazquez (1986). Somatic embryogenesis and plant regenerationfrom leaf tissue of Secale cereale L. Plant Sci., 44: 219–222.
Liu, Z., B. Park, A. Kanno and T. Kameya (2005). The novel use of a combination ofsonication and vacuum infiltration in Agrobacterium-mediated transformation ofkidney bean (Phaseolus vulgaris L.) with lea gene. Molecular Breeding, 16: 189–197.
62
Lorz, H., C.T. Harms and I. Potrykus (1976). Regeneration of plant from callus in Avena
sativa L. Z. Pflazenzuecht., 77: 257-259.
Mariashibu, T.S., K. Subramanyam, M. Arun, S. Mayavan, M. Rajesh, J. Theboral, M.
Manickavasagam and A. Ganapathi (2013). Vacuum infiltration enhances the
Agrobacterium-mediated genetic transformation in Indian soybean cultivars. Acta
Physiol. Plant., 35: 41–54.
Meurer, C.A., R.D. Dinkins and G.B. Collins (1998). Factors affecting soybean
cotyledonary node transformation. Plant Cell Rep., 18: 180-186.
Murashige, T. and F. Skoog (1962). A revised medium for rapid growth
and bioassays with tobacoo tissue cultures. Pl. Physiol., 15: 473-497.
Nuutila, A.M. and C. Villiger (2002). Embryogenesis and regeneration of green plantlets
from oat (Avena sativa L.) leaf-base segments: influence of nitrogen balance,
sugar and auxin. Plant Cell Rep., 20: 1156-1161.
Oliveira, M.L.P., V.J. Febres, M.G.C. Costa, G.A. Moore and W.C. Otoni (2009). High-
efficiency Agrobacterium-mediated transformation of citrus via sonication and
vacuum infiltration. Plant Cell Rep., 28 (3): 387-395.
Park, B.J., Z. Liu, A. Kanno and T. Kameya (2005). Transformation of radish (Raphanus
sativus L.) via sonication and vacuum infiltration of germinated seeds with
Agrobacterium harboring a group 3 LEA gene from B. napus. Plant Cell Rep., 24
(8): 494-500.
Pathak, M.R. and R.Y. Hamzah (2008). An effective method of sonication-assisted
Agrobacterium-mediated transformation of chickpeas. Plant Cell Tiss. Org. Cult.,
93: 65-71.
Pawlowski, W.P. and D.A. Somers (1998) Transgenic DNA integrated into the oat
genome is frequently interspersed by host DNA. Proc Natl. Acad. Sci. USA., 95:
12106-12110.
Popelka, C.A.J., B.N. Terryn and T.J.V. Higgins (2004). Gene technology for grain
legumes: can it contribute to the food challenge in developing countries? Plant
Sci., 167: 195–206.
Saghai-Maroof, M.A., K.M. Soliman, R.A. Jorgensen and R.W. Allard (1984). Ribosomal
DNA spacer-length polymorphisms in barley: Mendelian inheritance,
chromosomal location, and population dynamics. Proc. Natl. Acad. Sci. USA., 81:
8014-8018.
63
Santarem, E.R., H.N. Trick, J.S. Essig and J.J. Finer (1998). Sonication-assisted
Agrobacterium-mediated transformation of soybean immature cotyledons:
optimization of transient expression. Plant Cell Rep., 17: 752-759.
Seraj, Z.I., Z. Islam, M.O. Faruque, T. Devi and S. Ahmed (1997). Identification of the
regeneration potential of embryo derived callus from various Indica rice varieties.
Plant Cell Tiss. and Org. Cult., 48: 9-13.
Snedecor, G.W. and W.G. Cochran (1989). Statistical methods VI Ed. Oxford IBH, Delhi,
India.
Somers, D.A., H.W. Rines, W. Gu, H.F. Kaeppler and W.R. Bushnell (1992). Fertile
transgenic oat plants. Biotechnol., 10: 1589-1594.
Subramanyam, K., K. Subramanyam, K.V. Sailaja, M. Srinivasulu and K. Lakshmidevi
(2011). Highly efficient Agrobacterium-mediated transformation of banana cv.
Rasthali (AAB) via sonication and vacuum infiltration. Plant Cell Rep., 30: 425-
436.
Torbert, K.A., H.W. Rines and D.A. Somers (1995). Use of puromycin as a selective
agent for oat transformation. Plant Cell Rep., 14: 635–640.
Trick, H.N. and J.J. Finer (1997). SAAT: sonication-assisted Agrobacterium-mediated
transformation. Transgenic Res., 6: 329-337.
Trick, H.N. and J.J. Finer (1998). Sonication-assisted Agrobacterium-mediated
transformation of soybean [Glycine max (L.) Merrill.] embryogenic suspension
culture tissue. Plant Cell Rep., 17: 482-488.
Varandani, S.P. (2011). Studies on in vitro Regeneration of Oat (Avena sativa). M.Sc.
Thesis, Biotechnology centre, JNKVV, Jabalpur.
Weber, S., W. Friedt, N. Landes, J. Molinier, C. Himber, P. Rousselin, G. Hahne and R.
Horn (2003). Improved Agrobacterium-mediated transformation of sunflower
(Helianthus annuus L.): assessment of macerating enzymes and sonication.
Plant Cell Rep., 21: 475-482.
Wernicke, W. and L. Milkovits (1984). Developmental gradients in wheat leaves–
response of leaf segments in different genotypes cultured in vitro. J. Pl. Physiol.,
115: 49-58.
Wernicke, W., R. Brettell, T. Wakizuka and I. Potrykus (1981). Adventitious embryoid
and root formation from rice leaves. Z. Pflanzen. Physiol., 103: 361-365.
Xu, H.J., H. Zhao, X.F. Wang and F. Liu (2008). Exploration on the vacuum infiltration
transformation of pakchoi. Biol. Plantarum., 52 (4): 763-766.
64
Ye, G., D. Stone, S. Pang, W. Creely, K. Gonzalez and M. Hinchee (1999). Arabidopsis
ovule is the target for Agrobacterium in planta vacuum infltration transformation.
The Plant J. 19 (3): 249-257.
APPENDICES
ANOVA Table 4.3 Effect of different treatment on transformation efficiency(TE %) of embryo explants based on survival onhygromycin containing media.
Source ofvariation
Degrees offreedom
Sum ofsquares
Mean sum ofsquares F cal F prob
Treatments 9 7384.833 820.530 439.574 5.585
Error 20 37.333 1.866 - -
Total 29 - - - -
SEM ± 0.789, CD 1% 3.177, CD 5% 2.32
ANOVA Table 4.4 Effect of different treatment on transformation efficiency(TE %) of embryo explants based on criteria of GUS assay.
Source ofvariation
Degrees offreedom
Sum ofsquares
Mean sum ofsquares F cal F
probTreatments 9 4827.866 536.426 298.014 2.633
Error 20 36.000 1.800 - -
Total 29 - - - -
SEM ± 0.744, CD 1% 3.115, CD 5% 2.28
ANOVA Table 4.5 Effect of different treatment on transformation efficiency(TE %) of embryo explants based on criteria of PCR.
Source ofvariation
Degrees offreedom
Sum ofsquares
Mean sum ofsquares F cal F prob
Treatments 9 2952.800 328.088 164.044 9.536
Error 20 40.000 2.000 - -
Total 29 - - - -
SEM ± 0.816, CD 1% 3.281, CD 5% 2.40
ANOVA Table 4.6 Effect of different treatment on transformation efficiency(TE %) of leaf base explants based on hygromycinsurvival.
Source ofvariation
Degrees offreedom
Sum ofsquares
Mean sumof squares F cal F prob
Treatments 9 6975.366 775.047 357.711 4.317
Error 20 43.333 2.166 - -
Total 29 - - - -
SEM ± 0.850, CD 1% 3.412, CD 5% 2.50
ANOVA Table 4.7 Effect of different treatment on transformation efficiency(TE %) of leaf base explants based on criteria GUS assay.
Source ofvariation
Degrees offreedom
Sum ofsquares
Mean sum ofsquares F cal F prob
Treatments 9 4337.500 481.944 237.028 2.538
Error 20 40.666 2.033 - -
Total 29 - - - -
SEM ± 0.823, CD 1% 3.313, CD 5% 2.426
ANOVA Table 4.8 Effect of different treatment on transformation efficiency(TE %) of leaf base explants based on criteria PCRputative transgenic explants.
Source ofvariation
Degrees offreedom
Sum ofsquares
Mean sum ofsquares F cal F
probTreatments 9 2533.200 281.466 111.102 4.316
Error 20 50.666 2.533 - -
Total 29 - - - -
SEM ± 0.919, CD 1% 3.692, CD 5% 2.719
ANOVA Table 4.9 Over all effects of co-cultivation period and differenttreatments on transformation based on criteria ofhygromycin containing media.
Source ofvariation
Degrees offreedom
Sum ofsquares
Mean sumof squares
F cal F prob
Treatments 19 14416.266 758.758 376.241 4.358
Error 40 80.666 2.016 - -
Total 59 - - - -
SEM ± 0.820, CD 1% 3.132, CD 5%= 2.343
ANOVA Table 4.9 Over all effects of co-cultivation period and differenttreatments on transformation based on criteria GUSassay.
Source ofvariation
Degrees offreedom
Sum ofsquares
Mean sum ofsquares F cal F
probTreatments 19 9183.516 483.349 252.179 1.207
Error 40 76.666 1.916 - -
Total 59 - - - -
SEM ± 0.799, CD 1% 3.055, CD 5% 2.285
ANOVA Table 4.9 Over all effects of co-cultivation period and differenttreatments on transformation based on criteria PCR.
Source ofvariation
Degrees offreedom
Sum ofsquares
Mean sumof squares F cal F prob
Treatments 19 5489.266 288.907 127.457 8.116
Error 40 90.666 2.266 - -
Total 59 - - - -
SEM ± 0.869, CD 1% 3.329, CD 5% 2.483
VITA
The author of this thesis Mr. Nagesh Raosaheb Dattgonde
S/O Shri. Raosaheb Nagoji Dattgonde was born on 21 May 1988 at
Barepurwadi, Tahsil Vasamat, District Hingoli of Maharashtra.
He completed his primary school education in Malegaon, District
Nanded; S.S.C. and H.S.C. from Ahmadpur, District Latur (M.H.)
under Latur board, Latur.
He joined College of Agriculture, Naigaon (Bz.) affiliated to
MAU, Parbhani (M.H.) in the year 2005 and successfully
completed B.Sc. (Agriculture) degree in the year 2009 with an
O.G.P.A. of 7.85.
Subsequent to graduation, he joined M.Sc. in Agriculture
(Molecular biology and Biotechnology) at Biotechnology Centre,
J.N.K.V.V. Jabalpur (M.P.) in the year 2010. In partial fulfillment
of master degree he was allotted a research problem entitled
“Studies on Agrobacterium-mediated Transformation in Oat
(Avena sativa L.)”.
Nagesh Raosaheb Dattgonde
At BarepurwadiPost/Tahsil. VasamatDist. Hingoli (M.H.)Mobile No.: +918600683423
Email ID: nrd2010@gmail.com,nageshdattgonde1@gmail.com
Recommended