The first PCR cycle: The sequence between the two primers will be amplified

Preview:

DESCRIPTION

PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers is amplified. The first PCR cycle: The sequence between the two primers will be amplified. Four cycles of PCR. - PowerPoint PPT Presentation

Citation preview

PCR is another in vitro DNA synthesis reactionThe twist in this case is that the reaction is repeated 25-30 times so that the DNA between

the primers is amplified

The first PCR cycle:The sequence between the two primers will be

amplified

Four cycles of PCR

Copy number of the sequence between the primers increases exponentially

SEQUENCIAMENTO DE DNA

Profa. Dra. Maria Aparecida Fernandez

Depto de Biologia Celular e Genética

Universidade Estadual de Maringá

Structure of dideoxynucleotide triphosphates

Dideoxy DNA sequencing is an in vitro DNA synthesis reaction with a twist

DNAP requires a template and a primer

The [ddNTP] determines the distribution of chain lengths produced.

The primer is labeled so the DNA fragments synthesized can be detected by autoradiography.

TGGCTCGGCCTCAAGTCGAGGTTATCAGATCTGCAACTCAA

Alto peso molecular

Baixo peso molecular

Filme de raio X

Auto-radiograma

Leitura manual

Automated DNA Sequencing

Reação de seqüênciamentoReação de seqüênciamento

Fragmentos amplificados na reação de seqüênciamentoFragmentos amplificados na reação de seqüênciamento

Typical output of an automated sequencer

Eletroforese no seqüênciamentoEletroforese no seqüênciamento

Captura do fluorescente e processamento da informaçãoCaptura do fluorescente e processamento da informação

Seqüenciador automáticoSeqüenciador automático

Conjunto

de

16 capilares

Panorama no momento da corrida

Análise preliminar pós corrida

ELETROFEROGRAMAS

Recommended