Aquaculture 310 (2011) 305–311

Contents lists available at ScienceDirect

Aquaculture

j ourna l homepage: www.e lsev ie r.com/ locate /aqua-on l ine

A parentage study using microsatellite loci in a pilot project for aquaculture of theEuropean anchovy Engraulis encrasicolus L.

Yaisel J. Borrell a, Jorge Alvarez a, Gloria Blanco a, Amalia Mártinez de Murguía b, Deborah Lee b,Carlos Fernández c, Concha Martínez c, Unai Cotano d, Paula Álvarez d, José Antonio Sanchez Prado a,⁎a Laboratorio de Genética Acuícola, Departamento de Biología Funcional, Universidad de Oviedo, 33071 Oviedo, Spainb Aquarium de San Sebastián, Plaza de Carlos Blasco de Imaz, 1 20003 San Sebastián, Spainc I.E.O. Planta de Experimentación en Acuicultura “El Bocal”, Apdo. 240, 39080 Santander, Spaind AZTI, Tecnalia/Investigación Marina, Herrera Kaia portualdea z/g, 20110 Gipuzkoa, Spain

⁎ Corresponding author. Tel.: +34 985 103889; fax:E-mail address: jafsp@uniovi.es (J.A.S. Prado).

0044-8486/$ – see front matter © 2010 Elsevier B.V. Aldoi:10.1016/j.aquaculture.2010.10.025

a b s t r a c t

a r t i c l e i n f o

Article history:Received 22 June 2010Received in revised form 7 October 2010Accepted 16 October 2010

Keywords:Microsatellite markersMultiplex PCRParentageInbreedingEngraulis encrasicolus L.Anchovy

The European anchovy Engraulis encrasicolus L. is in high demand as a fish species, but most fishery stocks arecurrently at risk of collapsing. A pilot project for anchovy aquaculture was carried out in Spain to explore thepotential of satisfying demand for fresh and canned fish and to establish a supportive breeding program thatcould enhance native populations. We have studied the spawning dynamics in this novel culture usingmicrosatellite loci. Our main aims were to assess the effective breeding number (Ne) and the inbreedingcoefficient that would result in use of these fish for an E. encrasicolus closed-cycle culture. A total of 183 wildbreeders from the Bay of Biscay were adapted to culture and induced to spawn from November 2009 to January2010. Twohundred and eighty-eight eggswere collected at fourdifferent times. Breeders and eggswere analyzedwith twomultiplexPCRs that included sevenmicrosatellite loci. Breeders showedextremelyhigh levels of geneticvariation (mean number of alleles by locus=35), but there was a significant reduction in genetic variation inprogeny. Breeders were also found to be genetically different from all progeny. Parentage was successfullyassigned at a rate of 93%. A total of 105 breeders (55 females and 50males) took part in reproduction; however,there was significant unequal breeder contribution to progeny. Taking this into account, we found inbreedingcoefficients and effective breeder numbers as follows: initial November ΔF=6.5%, Ne=8; mid-NovemberΔF=2.9%,Ne=17; DecemberΔF=3.2%,Ne=16; JanuaryΔF=3.5%,Ne=14 and overallΔF=1.8%,Ne=27.Wehave concluded that the partial dominance of some breeders and the high family variance found in this studyshould be taken into accountwhen establishing closed-cycle cultures of the European anchovy to help guaranteeits sustainability. If one of the main goals is establishment of a supportive breeding program to enhance wildstocks, the inbreeding levels found here, which imply significant genetic differentiation between breeders andprogeny, should also be taken into account to avoid genetic damage to wild populations over time.

+34 985 103534.

l rights reserved.

© 2010 Elsevier B.V. All rights reserved.

1. Introduction

The sharp deterioration of fisheries in recent years has motivatedgovernment and the private sector to find a solution to this problem. Ifnothing is done, it is clear that a substantial gap between supply anddemand will soon result in higher fish prices. Aquaculture may be asolution to the problem. It is one of the fastest growing food productionsystems in theworld and is currently being used in developing countriesto supply food and fuel the economy. This has led several countries tofund aquaculture projects using other species, particularly small-scalepilot projects with the intent of developing large-scale commercialoperations. Spain is oneof these countries and isdoingsowith anchovies.

The engraulids are coastal schooling planktivores that spawn inbatches and grow to 10–20 cm. The European anchovy Engraulis

encrasicolus L. is found along the Eastern Atlantic coastline fromNorwayto Angola and in the Mediterranean, Black, and Azov seas, where it is aprincipal target species for commercial fisheries. This fish species is inhigh demand in the Bay of Biscay. In this region this fish is a multiplespawner with asyncronous development of oocytes: “De novo”vitellogenesis occurs continuously during the reproductive seasonwith all oocyte stages present simultaneously in the ovary. Close to100% of the anchovy population reaches maturity during the reproduc-tive season, although the smallest of the one-year-old anchoviesmatureslightly later (Motos, 1996). The spawning season of the Bay of Biscayanchovy population extends from March to August, although mostreproduction occurs duringMay and June. Spawning is triggered by thewarming of surface waters and coincides with the sharpest rise intemperature and the onset of stratification (Motos et al., 1996).

Most fisheries stocks of the European anchovy are currently overfished to the point not only of commercial collapse but also to the pointof biological extinction of populations. In the past few decades, anchovy

Table 1Microsatellite loci used for the M3XB and M4XA multiplex systems in E. engrasicolus.*Alleles sizes using preliminary data in our lab and data from the Zarraonaindia et al.(2009) report.

MultiplexPCR

Locus Source Annealingtemp.

Dye Primers pairconcentrations

Allelessizes*

M3XB EJ2 Chiu et al.2002

58 °C 6-FAM

0.5 μM 151–253

EJ9 Chiu et al.2002

58 °C VIC 0.2 μM 165–275

EJ35 Chiu et al.2002

58 °C PET 0.2 μM 177–227

M4XA EJ27.1 Chiu et al.2002

58 °C 6-FAM

0.5 μM 164–268

EeOV04 This work 54 °C VIC 0.2 μM 275–400

Ee10 Landi et al.2005

56 °C NED 0.2 μM 203–273

EJ41.1 Chiu et al.2002

55 °C PET 0.5 μM 135–261

306 Y.J. Borrell et al. / Aquaculture 310 (2011) 305–311

fishery populations in the Bay of Biscay have dropped to historicalminima (Borja et al., 1998; Uriarte et al., 2008) and experienced a seriesof consecutive low recruitments since 2001, leading to the eventualcollapse of commercial fishing and closure of the fishery (ICES, 2007;Sanz et al., 2008). Similar situations have been previously reported forthe Black, theAdriatic, theAzeas and theAlboranSeas anchovyfisheries,which have collapsed multiple times due to fishing pressures and/orintroduction of alien species (Pertierra and Lleonart, 1996). Aquaculturecould be a potential remediation strategy for the current anchovysituation. It could help satisfy the commercial demand for anchovies andserve as a source for reintroduction into wild populations.

One problem with aquaculture is inbreeding when closed-cyclecultures are used. Fish are highly fecund, thus it is possible to obtainhigh numbers of eggs and spermwith only a few breeders. High levelsof inbreeding could cause growth rate or other production pheno-types to decrease significantly and seriously affect aquaculturesustainability (Kincaid, 1983; Gjerde et al., 1983; Sbordoni et al.,1986; Su et al., 1996; Tave, 1999). If the goal of the fish culture isreintroduction into wild populations (supportive breeding), inbreed-ing is also a serious problem. Supportive breeding using culturedstocks can be a serious threat to natural populations. It usually reduceseffective populations' sizes because of reductions in allelic andgenotypic diversity due to artificial propagation of a small proportionof a population to enhance the entire population (e.g. the “Ryman-Laikre effect”) (Ne) (reviewed by Utter and Epifanio, 2002). Thisobviously depends on genetic management of the hatchery popula-tion. Release of cultured fish could also produce outbreedingdepression, genetic extinction, ecological interferences, mixed-stocksand altered selection regimes (Utter and Epifanio, 2002).

A pilot project for anchovy aquaculture was recently funded inSpain, whose main goal was to reach a stable culture of anchovieswith the intent of improving both the anchovymarket and the currentstate of wild anchovy populations. After adaptation to culture, thesefish were induced to spawn from November 2009 to January 2010(Martinez de Murguia et al., unpublished). We studied the spawningdynamics in these culture conditions using microsatellite markers asthe basis for parentage studies. Microsatellites have been used to infereffective breeding numbers (Ne) for successful parentage assignmentsin several fish species, for example the Atlantic salmon Salmo salar(Norris et al., 2000), the turbot fish Scophthalmus maximus (Borrell etal., 2004), the cod Gadus morhua (Herlin et al., 2007 and Herlin et al.,2008), the common dentex Dentex dentex (Borrell et al., 2008), thegilthead seabream Sparus aurata (Navarro et al., 2008 and Navarro etal., 2009) and the seabass Dicentrarchus labrax (Bardon et al., 2009).

Our main goal was to assess effective breeding numbers (Ne) andinbreeding coefficients that would result in use of these fish for an E.encrasicolus closed-cycle culture.

2. Materials and methods

2.1. Samples

Approximately 2000 E. encrasicolus juveniles captured in the Bay ofBiscay (44.20°N; −2.54°W) in September 2008 were reared at theAquarium of San Sebastian (Basque Country, Spain). Around 200 ofthem were kept in a tank and allowed to adapt to culture conditions.After one year, mass spawning of a total of 183 breeders was inducedusing photoperiod and temperature changes. As with many otherclupeoids (Blaxter and Hunter, 1982), anchovies show diel spawningcycles with maximum intensity at dusk or night (Motos, 1996).Spawning started in August 2009 and continued until January 2010with the maximum peak in November 2009. Egg collections wereperformed early in the morning in the lateral overflow of the tankswith the help of a 250-μm sieve. The collection covered the entirespawning period (two days of egg collection each time) and eggs werepreserved in 100% ethanol for DNA extraction.

At the end of the spawning season, the breeders were sacrificedand frozen. Sex was determined later by gonad dissection. Gonadsretract once the spawning season is over. This and the small size ofindividual animals made it difficult to find gonads and identify sex.Forty-one individuals were identified as males, 20 as females, and theremaining 122 individuals were undetermined. A sample of 288fertilized eggs from four different times during the spawning periodwere selected for genetic analyses in the University of Oviedo lab asfollows: 48 eggs in early November (EGNOVI), 96 eggs in mid-November (EGNOVM), 96 eggs in mid-December (EGDEC) and 48 eggsin January (EGJAN). Eggs with a minimum development stage of II(late-E) were selected based on methods of Moser and Ahlstrom(1985). Preliminary results indicated that after this stage successfulPCR amplification could be attained.

2.2. Microsatellite amplification and scoring

Genomic DNA from the breeders was purified from a small piece ofmuscular tissue using the Zymobead™ Genomic DNA Kit from ZYMOResearch (USA). For eggs we used 100 μL of Chelex-100 (Walsh et al.,1991) following the DNA extraction procedures reported in Borrell etal. (2008) for common dentex eggs.

Seven loci were used for genetic screening (EJ2, EJ9, EJ35, EJ27.1,EJ41.1 (Chiu et al., 2002), Ee10 (Landi et al., 2005) and EeOV04(unpublished; forward primer: cccaggaagtgtattgggtggctt; reverseprimer: tgtgtgtcccaaacacagtgcgga) (GeneBank accession number:AJ609586.1). Loci were arranged in two multiplex PCRs (M3XB andM4XA) designed with the use of Multiplex Manager 1.0 software(Holleley and Geerts, 2009). We used previously obtained anchovymicrosatellite data; allele size, annealing temperature, etc. fromZarraonaindia et al. (2009) and preliminary tests in our lab using 20individuals (Table 1). The QIAGEN multiplex PCR kit methodology(58 °C as annealing temperature) was used to obtain 15 μl of the twomultiplex systems. Parental and offspring genotypeswere scored afteranalysis of the amplification products on the ABI 3130XL GeneticAnalyzer and use of Genemapper 4.0 software.

2.3. Genetic diversity analysis

The number of alleles at each microsatellite locus (NA), thepercentages of polymorphic loci (P0,95), the proportion of individualsamples that were heterozygous (direct count heterozygosity,Ho) andthe unbiased estimate of heterozygosity (He) for each group wereassessed using Cervus 3.0 (Marshall et al., 1998) software. The FSTATstatistical package (2.93 version) (Goudet, 1995 and Goudet, 2001)was used to estimate the total variation in gene frequencies (FIT)partitioned into components of variation occurring within (FIS) and

307Y.J. Borrell et al. / Aquaculture 310 (2011) 305–311

among (FST) samples for each locus as inWeir and Cockerham (1984).Significance levels of FIS were assessed through randomization ofalleles (1000 times) within samples (FSTAT). Pairwise FST valuesbetween samples and p-values were calculated using FSTAT. Todetermine significance levels of FST, multi-locus genotypes wererandomized between pairs of samples (1000 permutations), thensignificance after Bonferroni correction calculated (Rice, 1989;Goudet, 2001). The unbiased genetic distance (D) among samples(Nei, 1978) and the Neighbor-Joining clustering method included inthe PHYLIP 3.5p package (Felsenstein, 1993) were used to generatetrees that were visualized using the TreeView program (Page, 1996).

2.4. Parentage assignments

Weused Cervus 3.0 software (Marshall et al., 1998; Kalinowski et al.,2007) to perform parentage assignments. This program calculates the apriori polymorphic information content (PIC) for every locus from eachbroodstock and total exclusionary power (E). In addition, the programcreates simulations for parental assignments. Total exclusionary poweris defined as the probability of excluding an arbitrary unrelatedcandidate parent. As soon as multiple candidate parents remain non-excluded, the exclusionary approach is inadequate (Cervus 3.0;Marshall et al., 1998). The parentage assignment simulations werecarried out taking into account the number of breeders per broodstock.Ten thousand cycles of simulated assignations were carried out using95% confidence intervals. Finally, all offspring (after genotyping) wereassigned to the most likely candidate parent pair with sexes unknown.

Fig. 1. The M3XB and M4XA multiplex systems for genotyping Engraulis encrasicolus individuthe Multiplex Manager Software (Holleley and Geerts, 2009). The base pair spaces betweenABI3130XL Genetic Analyzer and the Genemapper 4.0 software.

In the assignment procedures, we allowed for typing errors (0.05), sincethis dramatically reduces the impact of two other possible causes ofmismatches in parent–offspring relationships, mutations and nullalleles (Marshall et al., 1998).

2.5. Estimation of effective breeding numbers (Ne)

The average inbreeding values in groups (ΔF) and the effectivepopulation size (Ne) are related by ΔF=1/2 Ne (Falconer, 1989). Wefirst used the classical formula for estimating Ne (Ne=4 (Nm×Nf)/(Nm+Nf) (Falconer, 1989)), then an approach previously assessed byBrown et al. (2005) and reassessed by Woolliams (personalcommunication). This approach takes into account the proportion ofdescendants left by “presumed” unrelated parents to the nextgeneration and is based on Woolliams and Bijma (2000). Woolliamsproposed that ΔF=∑ci (m)

2 /8+1/(32 m)+∑ci (f)2 /8+1/(32f)

with ci being the fractional contribution of males and females tooffspring and m and f the number of males and females, respectively(Woolliams, personal communication; Borrell et al., 2008).

3. Results

3.1. Genetic description of samples

Almost all individuals (273 of 288 offspring and the 183 breeders)were successfully genotyped for seven microsatellites using the M3XBand M4XA multiplex systems (Fig. 1). The systems were reliable with

als with 7 microsatellites. 1A: Diagram showing the design of the multiplex PCRs usingmarkers are indicated by numbers. 1B: Electrophoretograms of one breeder using the

Table 2Genetic variation data for breeders and progenies of E. encrasicolus.

Bay of Biscay

Breeders Locus n k HObs HExp PIC FIS

EJ2 182 38 0.934 0.94 0.934 +0.007EJ9 183 48 0.923 0.968 0.964 +0.046EJ35 182 21 0.846 0.898 0.887 +0.058EeOV04 182 41 0.703 0.925 0.919 +0.240⁎

Ee10 182 29 0.769 0.797 0.779 +0.035EJ27.1 180 40 0.939 0.955 0.95 +0.177⁎

EJ41.1 182 31 0.654 0.794 0.766 +0.017Means 183 35.43 0.824 0.897 0.886 +0.081*

ProgeniesEJ2 259 32 0.884 0.910 0.901 +0.028EJ9 256 41 0.773 0.939 0.933 +0.176⁎

EJ35 266 20 0.835 0.887 0.875 +0.059EeOV04 267 31 0.685 0.878 0.867 +0.220⁎

Ee10 267 24 0.708 0.786 0.766 +0.100⁎

EJ27.1 271 35 0.771 0.859 0.850 +0.371⁎

EJ41.1 261 31 0.521 0.827 0.808 +0.102⁎

Means 273 30.57 0.740 0.869 0.857 +0.149⁎

n: Number of samples. K: number of alleles. HObs.: Observed heterozygosity. HExp.:Expected heterozygosity in Hardy–Weinberg equilibrium. FIS : heterozygotes deficitsinside samples. PIC: Polymorphic Information Content.⁎ Pb0.05.

Fig. 2. Genetic distances (Nei, 1978) among E.encrasicolus samples. *Samples from theMediterranean (MEDIT) (n=44, coordinates: 43.036688/+16.130991), France(FRANCE) (n=20, 47.0/−2.50), and Santander (SANT) (n=75, 43.476289/−4.022778) have been added from Borrell, Y.J. (unpublished), Breeders as (BISCAY)(n=183, 44.204444/−2.54083), Eggs as: Initial November (EGNOVI), mediumNovember (EGNOVM), medium December (EGDEC) and January (EGJAN).

308 Y.J. Borrell et al. / Aquaculture 310 (2011) 305–311

DNA extracted using either method (Chelex or the Zymo Kit), but someegg DNA samples showed no amplification for some loci assayed(Table 2). The genetic characteristics of breeders and progeny analyzedin this work are presented in Table 2. Breeders showed extremely highlevels of genetic variation (mean number of alleles by locus N35 andmean observed heterozygosity levels N0.800). We also found disagree-ment with Hardy–Weinberg expectations for populations underequilibrium (significant FIS values) for some loci assayed (EJ27.1 andEeOV04) (Table 2). There was a reduction in genetic variation inprogeny. Mean number of alleles fell to 30 (a total of 34 alleles werelost), while observed heterozygosity levels fell to 0.740 (Table 2).

Breeders were genetically different from all progeny (FST=0.0127,Pb0.05). Samples representing each of the spawning periods (earlyNovember (EGNOVI), mid-November (EGNOVM), mid-December(EGDEC) and January (EGJAN)) were genetically different from eachother and from the breeders (Table 3). The same information could beobtained after Nei's distances analyses (D) (Nei, 1978) amongsamples (0.1275≤D≤0.4699) and dendogram representationsusing a Neighbor-Joining clustering method (Table 3, Fig. 2). Apreliminary analysis including other microsatellite data from wildpopulations (using the same markers) revealed that genetic distancesamong other wild samples (Santander, France, the Mediterraneanarea) and the Bay of Biscay (the breeders in this work) were shorterthan between progeny samples and wild populations or amongprogeny samples themselves (Fig. 2) (Borrell YJ., unpublished).

Table 3The FST values among E. encrasicolus samples and p-values (parenthesis) (abovediagonal) and Nei genetic distances (Nei, 1978) among samples (below diagonal).*Pb0.05 after 2000 randomisations not assuming Hardy–Weinberg equilibrium andBonferroni corrections (Rice, 1989).

Bay of Biscay EGNOVI EGNOVM EGDEC EGENE

0.0239 0.0131 0.0376 0.0522Bay of Biscay – (0.0050*) (0.0050*) (0.0050*) (0.0050*)

0.0440 0.0173 0.0667EGNOVI 0.2265 – (0.0050*) (0.0050*) (0.0050*)

0.0479 0.0471EGNOVM 0.1275 0.3850 – (0.0050*) (0.0050*)

0.0742EGDEC 0.2663 0.1398 0.3393 – (0.0050*)EGENE 0.3773 0.4699 0.3158 0.4684 –

3.2. Parentage assignments and effective breeding number (Ne)estimation

Our parentage assignments revealed that the true parent pair(with unknown sexes) would be expected (by simulation) to be found99.6% of the time using two multiplex PCRs that included sevenmicrosatellites. Almost all progeny (254/273=93%) were assigned toa parental couple without uncertainty. Nineteen individuals werediscarded as follows: seven assigned to two couples with the sameprobability, twelve because the unique LOD positive couple foundwasnot in accordance with sex data previously recorded, eleven assignedto male×male parental couples and one assigned to a female×femaleparental couple. A total of 168 (1%) of the 16,653 possible couples(with 183 breeders of unknown sex) were detected. We founddescendants for 17 out of 20 females (85%), 30 out of 41 males (73%)and 58 out of the 122 individuals (48%) with unknown sex. Fifty-eightbreeders of unknown sex formed couples with individuals of knownsex after the parentage assignment and so sex could be assigned. Wedetermined that 105 breeders (55 females and 50 males) took part inreproduction (Table 4).

The effective breeding numbers, taking into account only thenumber of males and females from whom descendants wereidentified, were Ne EGNOVI=23, Ne EGNOVM=60, Ne EGDEC=58 andNe EGJAN=31, with a total effective breeding number of Ne Total=105(sexes were in almost equal proportion) (Table 4). Unequalreproductive success affects Ne estimates. We observed a globallysignificant unequal contribution of breeders to progeny (Fig. 3). The‘global’ effective breeding numbers calculated using the Woolliams'approach revealed significantly lower Ne values than expected with

Table 4Breeders participation and effective breeding numbers (Nê) estimates in the spawningseason of E. encrasicolus.

Breeders* EGNOVI EGNOVM EGDEC EGENE Total

Females 11 28 25 17 55Males 12 32 35 14 50Total 23/183 60/183 60/183 31/183 105/183Nê (1) 22.95 59.73 58.33 30.70 104.76ΔF 0.0650 0.0290 0.0317 0.0351 0.0185Nê (2) 7.69 17.23 15.77 14.24 26.99

Breeders*: breeders that left progenies following parental assignments assessmentsafter genotyping with seven microsatellite loci. Nê(1): Effective population sizes using4×(Nm×Nf)/(Nm+Nf) (Falconer, 1989). Nê(2): Effective population sizes usingΔF=∑ci (m)

2 /8+1/(32 m)−∑ci (f)2 /8+1/(32f) (Woolliams and Bijma, 2000; Brownet al., 2005, Woolliams, J., Pers. Comm.) and then ΔF=1/2 Nê (Falconer, 1989).

309Y.J. Borrell et al. / Aquaculture 310 (2011) 305–311

equal contributions; thus we found Ne EGNOVI=8, Ne EGNOVM=17,Ne EGDEC=16 and Ne EGJAN=14with a total effective breeding numberof Ne Total=27 (a reduction of around 75% fewer “effective breeders”for the entire experiment) (Table 4).

4. Discussion

The European anchovy has great commercial value for fishermenand the fishing industry in Spain. This species has experienced a seriesof consecutive low recruitment leading the stock to historical

Fig. 3. Breeders contributions to offsprings in

minimum biomass levels (Uriarte et al., 2008). This pilot projectinvolving European anchovy aquaculture indicates a possible solution.In this study we examined the spawning season of this species withthe goal of determining the rate of inbreeding occurrences and thebest strategy for a future closed-cycle culture to help satisfy thedemand for both food fish and a supportive breeding program toenhance the native population.

Because of their high variation levels, microsatellites are a usefultool for determining parentage assignments and rates of inbreeding inaquaculture even in large commercial mass spawning tanks (Herlin et

the spawning season of E. encrasicolus.

310 Y.J. Borrell et al. / Aquaculture 310 (2011) 305–311

al., 2007). Microsatellites in E. engrasicolus have a mean of around 30alleles per locus making the species ideal for this kind of analysis,although its use for population analysis is complex due to excessivepolymorphisms (Pakaki et al., 2009; Zarraonaindia et al., 2009). Theproblem could come from the possibility of null alleles as has beenreported in several family studies in fish (Borrell et al., 2004; Castro etal., 2008). Only two of the seven loci used here were in Hardy–Weinberg disequilibrium in the breeder sample (EJ27.1 and EeOV04).These loci showed significant heterozygote deficits (positive FISvalues), which could implying the possibility of the presence of anull allele, although a similar signal can be obtained when there areheterozygote disadvantages, assortative matings, Wahlund effectsand/or unrecognized sex linkage. In fact, it has been reported thatwildpopulations of the European anchovy show an unusually complexgenetic structure (Magoulas et al., 1996 and Magoulas et al., 2006;Sanz et al., 2008; Zarraonaindia et al., 2009). Only a sequencingprotocol using known families could confirm or dispute the possibilityof a null allele for these two loci. Another sign of the presence of a nullallele would be the lack of PCR amplification in some eggs. Despitethis, parentage assignments using Cervus have been improved to takepossible genotyping errors into account and to minimize errors(Marshall et al., 1998; Kalinowski et al., 2007). Multiplex PCRs are lesscostly in time and money than scoring each marker in independentPCRs and electrophoresis runs. Unfortunately not much can be donewhen arranging the anchovy microsatellites in multiplex PCRs sincetheir expected amplifications products are in similar size ranges. Thiscould be solved by usingmoremarkers in the design of multiplex PCR,e.g. another 11microsatellite markers reported by Pakaki et al. (2009)for this species. By using two multiplexes we have been able to inferinbreeding levels in this pilot anchovy culture experiment.

Hatchery managers usually use eggs collected in one day (orsometimes a few days) for upcoming rearing cycles. This commonpractice can be very dangerous for the sustainability of a closed-cycleculture. Tave (1999) has suggested that farmers and hatcherymanagers should try to prevent inbreeding from exceeding 5%,although this would imply more management efforts. In our case, ifdescendants from the entire spawning season were used forformation of the subsequent broodstock, there would be around1.8% inbreeding resulting. However, this value would be significantlyhigher if eggs used came exclusively from any one of the four timesassessed here (estimated inbreeding levels of 3–6%). The effect of theunequal reproductive success on the effective breeder numberestimates (those taking part in reproduction) should be noted.While 105 of 183 (57%) breeders left descendants in this work(which may be considered good for an initial culture experiment),only 27 of 183 breeders (15%) are effectively taking part inreproduction (responsible for around 85% of the descendants). Thiscould have consequences in the upcoming breeding cycle and shouldbe taken into account.

Inbreeding in culture stocks also has serious consequences whenused for supportive breeding programs. Utter and Epifanio (2002)reviewed this subject recently. Using a small fraction of the wildparental fish for hatchery production may favor the reproductive rateof one segment of the overall population, thus increasing the totalvariance of family size. While such a program may immediatelyincrease the absolute abundance of wild populations, it may threatengenetic diversity through reduction of effective population sizes(Ryman and Laikre, 1991; Ryman et al., 1995) and ultimately reducepopulation size in the long term (Frankham, 1996; Tessier et al.,1997). Our work shows that progeny are genetically different (anddistant) from the breeders. It is therefore necessary to make periodicgenetic evaluations of the source population (the Bay of Biscayanchovy population) and the established broodstock and theirprogeny (potentially useful for repopulations) to ensure that theyare genetically similar. Incidentally, the genetic state (levels of geneticstructure, existence of isolated management units, stocks, etc.) in the

native population of the Bay of Biscay is not yet well established. Sanzet al. (2008) after having studied both sides of the Cap Breton in theBay of Biscay concluded that there is only one genetic unit (stock);however Zarraonaindia et al. (2009) suggested the existence of morethan one genetic unit within this area. This makes it necessary toidentify anchovy population dynamics (e.g., spatio-temporal limits) inthe Bay of Biscay, not only for implementing sustainable fishingpolicies (the main aim of fishery stakeholders), but also forimplementing a proper supportive breeding program to enhancethe population.

These initial results, despite problems with breeder sex determi-nation and the small number of eggs analyzed, indicate inbreeding asa major problem that should be correctly managed in fish hatcheries.The partial dominance of some of the breeders and the high familyvariances found in this study should be taken into account whenestablishing closed-cycle cultures of the European anchovy, thushelping guarantee its sustainability. If one of the main aims is also asupportive breeding program to enhance wild stocks, the inbreedinglevels found here (that imply significant genetic differentiationbetween breeders and progeny) and the lack of knowledge aboutthe current state of anchovy populations in the Bay of Biscay should betaken into account to avoid genetic damage to wild populations in thenear and distant future.

Acknowledgements

This work was financed by the Spanish Ministry of Science andInnovation (MICINN-08-CIT-600000-2008-16). Thanks to A. Estonbawho helped with anchovy microsatellite data and multiplex design(information about allele sizes, etc.) before publication of Zarrao-naindia et al. (2009). Thanks to the three anonymous referees thathelped with valuable suggestions to the review of our manuscript.

References

Bardon, A., Vandeputte, M., Dupont-Nive, M., Chavanne, H., Haffray, P., Vergnet, A.,Chatain, B., 2009. What is the heritable component of spinal deformities in theEuropean sea bass (Dicentrarchus labrax)? Aquaculture 294 (3–4), 194–201.

Blaxter, J.H.S., Hunter, J.R., 1982. The biology of clupeoid fishes. Advances in MarineBiology. Academic Press. 20: 1223.

Borja, A., Uriarte, A., Egañaa, J., Motos, L., Valencia, V., 1998. Relationships betweenanchovy (Engraulis encrasicolus) recruitment and environment in the Bay of Biscay(1967–1996). Fish. Oceanogr. 7, 375–380.

Borrell, Y.J., Álvarez, J., Vázquez, E., Fernández, C., Mártinez, C., Sánchez, J.A., Blanco, G.,2004. Applying microsatellites to the management of turbot stocks (Scophthalmusmaximus L.) in hatcheries. Aquaculture 241, 133–150.

Borrell, Y.J., Blanco, G., Vázquez, E., Piñera, J.A., Giménez, G., Estévez, A., Sánchez, J.A.,2008. Assessing the spawning season in common dentex (Dentex dentex) usingmicrosatellites. Aquac. Res. 39 (12), 1258–1267.

Brown, R.C., Woolliams, J.A., McAndrew, B.J., 2005. Factors influencing effectivepopulation size in commercial populations of gilthead seabream, Sparus aurata.Aquaculture 247, 219–225.

Castro, J., Pino-Querido, A., Hermida, M., Chavarrias, D., Romero, R., Garcia-Cortes, L.A.,Toro, M., Martinez, P., 2008. Heritability of skeleton abnormalities (lordosis, lack ofoperculum) in gilthead seabream (Sparus aurata) supported by microsatellitefamily data. Aquaculture 279, 18–22.

Chiu, T.-S., Lee, Y.-J., Huang, S.-W., Yu, H.-T., 2002. Polymorphic microsatellite markersfor stock identification in Japanese anchovy (Engraulis japonica). Mol. Ecol. Notes 2(1), 49–50.

Falconer, D.S., 1989. Introduction to Quantitative Genetics3rd edn. Longman, New York.Felsenstein, J., 1993. PHYLIP (phylogeny inference package). Dept. Genetics, University

of Washington, Seattle.Frankham, R., 1996. Relationship of genetic variation to population size in wildlife.

Conserv. Biol. 10, 1500–1508.Gjerde, B., Gunnes, K., Gjedrem, T., 1983. Effect of inbreeding on survival and growth in

rainbow trout. Aquaculture 34, 327–332.Goudet, J., 1995. FSTAT (vers. 1.2): a computer program to calculate F-statistics. J.

Hered. 86, 485–486.Goudet, J., 2001. FSTAT, a program to estimate and test gene diversities and fixation

indices (version 2.9.3). Available from http://www.unil.ch/izea/softwares/fstat.html.

Herlin, M., Taggart, J.B., McAndrew, B.J., Penman, D.J., 2007. Parentage allocation in acomplex situation: a large commercial Atlantic cod (Gadus morhua) mass spawningtank. Aquaculture 272S1, S195–S203.

Herlin, M., Delghandi, M., Wesmajervi, M., Taggart, J.B., McAndrew, B.J., Penman, D.J.,2008. Analysis of the parental contribution to a group of fry from a single day of

311Y.J. Borrell et al. / Aquaculture 310 (2011) 305–311

spawning from a commercial Atlantic cod (Gadus morhua) breeding tank.Aquaculture 274, 218–224.

Holleley, C.E., Geerts, P.G., 2009. Multiplex Manager 1.0: a crossplatform computerprogram that plans and optimizes multiplex PCR. Biotechnics 46 (7), 511–517.

ICES, 2007. Report of the Working Group on the Assessment of Mackerel, Horse,Mackerel, Sardine and Anchovy (WGMHSA). 4–13 September 2007, Copenhagen:ICES Headquarters. ICES CM 2007/ACFM:31.

Kalinowski, S.T., Taper, M.L., Marshall, T.C., 2007. Revising how the computer programCERVUS accommodates genotyping error increases success in paternity assign-ment. Mol. Ecol. 16, 1006–1099.

Kincaid, H.L., 1983. Inbreeding in fish populations used for aquaculture. Aquaculture 33,215–227.

Landi,M., Garoia, F., Piccinetti, C., Tinti, F., 2005. Isolation of polymorphicmicrosatellite locifrom the European anchovy, Engraulis encrasicolus. Mol. Ecol. Notes 5 (2), 266–268.

Magoulas, A., Tsimenides, N., Zouros, E., 1996. Mitochondrial DNA phylogeny and thereconstruction of the population history of a species: the case of the Europeananchovy (Engraulis encrasicolus). Mol. Biol. Evol. 13 (1), 178–190.

Magoulas, A., Castilho, R., Caetano, S., Marcato, S., Patarnello, T., 2006. Mitochondrial DNAreveals amosaic pattern of phylogeographical structure inAtlantic andMediterraneanpopulations of anchovy (Engraulis encrasicolus). Mol. Phyl. Evol. 39 (3), 734–746.

Marshall, T.C., Slate, J., Kruuk, L.E.B., Pemberton, J.M., 1998. Statistical confidence forlikelihood-based paternity inference in natural populations. Mol. Ecol. 7, 639–655.

Moser, H.G., Ahlstrom, E.H., 1985. Staging anchovy eggs. In: Lasker, R. (Ed.), An EggProduction Method for Estimating Spawning Biomass of Pelagic Fish: Application totheNorthernAnchovy, Engraulis mordax. NOAA Technical Report NMFS 36, pp. 37–41.

Motos, L., 1996. Reproductive biology and fecundity of the Bay of Biscay anchovypopulation (Engraulis encrasicolus L.). Scient. Mar. 60 (Sup. 2), 195–207.

Motos, L., Uriarte, A., Valencia, V., 1996. The spawning environment of the Bay of Biscayanchovy (Engraulis encrasicolus L.). Scient. Mar. 60 (Sup. 2), 117–140.

Navarro, A., Badilla, R., Zamorano, M.J., Pasamontes, V., Hildebrandt, S., Sánchez, J.J.,Afonso, J.M., 2008. Development of two newmicrosatellite multiplex PCRs for threesparid species: Gilthead seabream (Sparus auratus L.), red porgy (Pagrus pagrus L.)and redbanded seabream (P. auriga, Valenciennes, 1843) and their application topaternity studies. Aquaculture 285, 30–37.

Navarro, A., Zamorano, M.J., Hildebrandt, S., Ginés, R., Aguilera, C., Afonso, J.M., 2009.Estimates of heritabilities and genetic correlations for growth and carcass traits ingilthead seabream (Sparus auratus L.), under industrial conditions. Aquaculture289, 225–230.

Nei, M., 1978. Estimation of average heterozygosity and genetic distance from a smallnumber of individuals. Genetics 89, 583–590.

Norris, A.T., Bradley, D.G., Cunningham, E.P., 2000. Parentage and relatednessdetermination in farmed Atlantic salmon (Salmo salar) using microsatellitemarkers. Aquaculture 182, 73–83.

Page, R.D.M., 1996. TREEVIEW: an application to display phylogenetic trees on personalcomputers. Comput. Appl. Biosci. 12, 357–358.

Pakaki, V., Magoulas, A., Kasapidis, P., 2009. New polymorphic microsatellite loci forpopulation studies in the European anchovy, Engraulis encrasicolus (L.). Mol. Ecol.Resour. 9 (5), 1406–1409.

Pertierra, J.P., Lleonart, J., 1996. NW Mediterranean anchovy fisheries. In: Palomera, I.,Rubiés, P. (Eds.), The European Anchovy and its Environment. Scient. Mar. 60 (2),pp. 257–267.

Rice, W.R., 1989. Analysing tables of statistical tests. Evolution 43, 223–225.Ryman, N., Laikre, L., 1991. Effects of supportive breeding on the genetically effective

population size. Conserv. Biol. 5, 325–329.Ryman, N., Utter, F., Laikre, L., 1995. Protection of intraspecific biodiversity of exploited

fishes. Rev. Fish Biol. Fish. 5, 417–446.Sanz, N., García-Marín, J.L., Viñas, J., Roldan, M., Pla, C., 2008. Spawning groups of

European anchovy: population structure and management implications. ICES J.Mar. Sci. 65 (10), 1635–1644.

Sbordoni, V., De Matthaeis, M., Cobolli Sbordoni, M., La Rosa, G., Mattoccia, M., 1986.Bottleneck effects and the depression of genetic variability in hatchery stocks ofPenaeus japonicus (Crustacea, Decapoda). Aquaculture 57, 239–251.

Su, G.S., Liljedabl, L.E., Gall, G.A.E., 1996. Effects of inbreeding on growth andreproductive traits in rainbow trout (Oncorhynchus mykiss). Aquaculture 142,139–148.

Tave, D., 1999. Inbreeding and brood stock management. Fisheries Technical Paper. No.392. Rome, FAO. . 122p.

Tessier, N., Bernatchez, L., Wright, J.M., 1997. Population structure and impact ofsupportive breeding inferred from mitochondrial and microsatellite DNA analysesin land-locked Atlantic salmon Salmo salar L. Mol. Ecol. 6, 735–750.

Uriarte, A., Prellezo, R., Punzón, A., Aranda, M., Villamor, B., 2008. The Spanish fishery onanchovy in the Bay of Biscay: Analysis of the relationship between fishing Capacity,Effort and mortality. ICES CM 2008/I:18. 20pp.

Utter, F., Epifanio, J., 2002. Marine aquaculture: genetic potentialities and pitfalls. Rev.Fish Biol. Fish. 12, 59–77.

Walsh, P.S., Metzger, D.A., Higuchi, R., 1991. Chelex® 100 as a médium for simpleextraction of DNA for PCR-based typing form forensic material. Biotechnics 10,506–510.

Weir, B.S., Cockerham, C.C., 1984. Estimating F-statistics for the analysis of populationstructure. Evolution 38, 1358–1370.

Woolliams, J.A., Bijma, P., 2000. Predicting rates of inbreeding in populationsundergoing selection. Genetics 154, 1851–1864.

Zarraonaindia, I., Pardo, M.A., Iriondo, M., Manzano, C., Estonba, A., 2009. Microsatellitevariability in European anchovy (Engraulis encrasicolus) calls for further investi-gation of its genetic structure and biogeography. ICES J. Mar. Sci. 66 (10),2176–2182.