Journal of General Virology (1996), 77, 2089-2096. Printed in Great Britain

A porcine CD8 + T cell clone with heterotypic specificity for foot-and-mouth disease virus

Ana Rodr(guez,lt Victoria Ley, 1 Enrique Ortu6o, 1 Angel Ezquerra, ~ Armin Saalm£iller, 2 Francisco Sobrino ~,3 and Juan Carlos S&iz3t

i Centro de Investigaci6n en Sanidad Animal, INIA, Valdeolmos, 28130 Madrid, Spain

2 Federal Research Centre for Virus Diseases of Animals, 7400 TObingen, Germany

3 Centro de Biologia Molecular 'Severo Ochoa', Cantoblanco, 28049 Madrid, Spain

Foot-and-mouth disease virus (FMDV)-specific T cell lines and clones have been obtained from a swine lymphocyte antigen (SLA) inbred miniature pig vaccinated with chemically inactivated virus. One of the clones obtained, CE3, showed a specific and heterotypic proliferation against infectious but not inactivated FMDV in the presence of syngeneic peripheral blood mononuclear cells (PBMC). Ad- herent cells from PBMC were sufficient to support specific activation of the clone and the proliferation was abolished when the contact between CE3 and adherent cells was prevented. Phenotypic charac-

terization of CE3 cells revealed expression of CD2, CD25 (interleukin-2 receptor), SLA class I and SLA class II. Furthermore, the cells were highly CD8 positive but showed low expression of CD4. The expression of T cell receptor (TCR) = and p genes confirmed their T cell nature. Consistent with the CD8 phenotype, the proliferative response of CE3 was inhibited with MAbs to SLA class I and CD8. Altogether, these results indicate that CE3 is a porcine SLA class I-restricted CD8 ÷ T cell clone, that recognizes a heterotypic FMDV antigen.

In t roduct ion

Picomavirus infections represent good examples of antibody-mediated immunity to viruses. In recent years there has been increasing evidence of the relevance of the T cell- mediated immune response in protection and recovery from picornavirus infection (reviewed in Usherwood & Nash, 1995). The role of cellular immunity is particularly interesting for foot-and-mouth disease virus (FMDV), an antigenically diverse aphthovirus causing an economically important disease of farm animals, mainly cattle and swine (Bachrach, 1968; Domingo et al., 1990). Immunization with serotype-specific, chemically inactivated vaccines, is extensively used to control the disease in enzootic areas (reviewed in Barreling & Vreeswijk, 1991). A correlation has been established between high titres of

Author for correspondence: Francisco Sobrino.

Fax + 34 1 6202247. e-mail sobrino@samba.cnb.uam.es

1 Present address: Department of Cell Biology, Yale University School

of Medicine, New Haven, CT 06510, USA.

~: Present address: Liver Unit, Hospital Clinic, Department of

Medicine, Universitat de Barcelona, Spain.

circulating neutralizing antibodies and the capacity of vacci- nated animals to resist experimental FMDV challenge. How- ever, this correlation is not complete, and persistently infected animals usually show a good humoral antiviral response (McCullough et al., 1992; Collen, 1994).

Extensive information has been gained on the antigenic structure of B cell sites and their topology on the capsid surface (Acharya eta]., 1989; Lea et a]., 1994), and a continuous antigenic site located within the G-H loop of capsid protein VP1 (site A) (Strohmaier eta]., 1982; Bittle eta]., 1982; Pfaff et aL, 1982) has been used as the basis for the development of recombinant and peptide vaccines (DiMarchi eta/ . , 1986). However, these vaccines are poor immunogens and the protection they confer is lower than that induced by whole- virus inactivated vaccines (reviewed in Brown, 1992). This limitation could be due, at least in part, to the absence in their formulation of virus-specific T cell epitopes that can be efficiently recognized by host immune systems (Clarke et al., 1987; Glass & Millar, 1995). Only partial information is available to date on the characterization and functional role of the virus-specific T cells in the immune response of natural hosts to FMDV. There is evidence of a requirement for specific B cell-T cell interactions to elicit protective levels of anti-

~_08 c 0001-3886 © 1996 SGM

iiiiiiiiiiiiiiiiiiiii.iiii i ii.@i( ii iiii ii. i iii.iii.i.ii.iij FMDV antibodies in natural host species (reviewed in Collen, 1994) and for the involvement of antigen-presenting cells (APC) during in v ivo protection (reviewed in McCullough et al., 1992). Induction of FMDV antibodies in mice is T cell dependent (Collen et al., 1989), and recent studies have characterized the lymphoproliferative response induced by the virus in cattle and swine (Collen & Doel, 1990; S~iiz et al., I992). These studies have identified several T helper epitopes on capsid proteins recognized by individuals of these species (Glass & Millar, 1994; Collen el al., I 9 9 I ; Rodriguez et al., 1994; Van Lierop et al., 1994). Cytotoxic T lymphocytes (CTL) appear to play an important role in the host immune response to most viral infections, including those of picornaviruses (Lindsley ef al., 1991; Kutubudin et al., 1992, reviewed in Usherwood & Nash, I995), by limiting replication and accelerating clearance of virus and by releasing cytokines with antiviral activity such as interferon-7 (Doherty et al., 1992). However, the role of CTL in FMDV infection remains largely unexplored.

T cell lines and clones are valuable tools for the analysis of the principles of the antiviral immune response in different species, FMDV-specific bovine CD4 + lymphocyte clones have been used to study the antigenic specificity of T cell recognition (Collen et al,, 1991; Glass & Millar, 1994; van Lierop et al., 1992). The establishment of long-term T cell cultures from swine has presented various difficulties and it is only recently that a few stable lines have been described (Grimm et al., 1993 ; Dillender & Lunney, 1993). To study the lymphocyte popula- tions involved in the porcine immune response to FMDV, and their possible role in the resolution of viral infection, we established a virus-specific T cell line derived from peripheral blood mononuclear cells (PBMC) of a vaccinated pig. The cells were expanded by in vitro restimulation with infectious virus and several stable clones were obtained by limiting dilution. A T ceil clone derived from this cell line was further characterized and found to be CD8 + and SLA-restricted. It expressed T cell receptor (TCR) c¢fl genes and was specific for infectious FMDV.

Methods • Viruses. A type C1 FMDV (C-$8) (Villanueva et al., 1983), either purified on a CsCI gradient or sedimented through a sucrose cushion (S~iiz et a]., 1989), was used for pig immunization and for the establishment of T cell lines and clones, respectively. To study the antigenic specificity of T cell activation, FMDV stocks of serotypes C (C-$8 and C10berbayem), A (AS Westerwald) and O (O1 Kaufbeuren) were used to stimulate T cell cultures. Viruses were grown in BHK-21 cells and supematants of infected cells were clarified and stored at - 70 °C. Titres of the virus stocks were determined by plaque assay on BHK-21 cells (Domingo el al., 1980), and are expressed as p.f.u./ml. When necessary, FMDV was inactivated with binary ethylenimine (BEI) as described by Bahnemann (1974).

• Animal immunization. A 5-month-old, SLA inbred miniature pig (Sachs et al., 1976~ of the SLA ~/a (c/d) phenotype was immunized intradermally with about 5 ~tg of BEt-inactivated, purified C-$8 FMDV

(corresponding to 5 x I07 p.f.u.) in Freund's complete adjuvant. The animal was boosted 4 weeks later by a second equivalent dose in Freund's incomplete adjuvant and PBMC obtained 26 weeks later were used to establish FMDV-specific cell lines.

• Preparation of conditioned medium. PMBC from the same animal were cultured for 48 h in RPM] medium supplemented with 10 % heat-inactivated fetal calf serum, 2 mM-glutamine, 50 I~M-2-mercapto- ethanol, 100 pg/ml streptomycin, 100 U/ml penicillin, in the presence of 2'5 i~g/ml concanavalin A (Con_&) and 10 i~g/ml phytohaemagglutinin (PHA). Supematant was collected, concentrated five times through an Amicon filter (0'2 I~m pore size) and stored in aliquots at - 70 °C.

• Establishment of cell lines and cloning. Isolation of PBMC from peripheral blood was performed as described previously (S~iz et al., 1992). T cell lines were obtained following a modification of the procedure described by Taylor et aI. (1987). Briefly, two separate cultures containing 4 x I06 PBMC/ml were incubated in supplemented RPMI medium in the presence of inactivated or infectious FMDV C-$8 (3 pg/ml), a viral concentration previously shown to induce significant in vifro proliferative responses of PBMC from immunized pigs (S~iz eta],, 1992). After 2 weeks of culture, the cells were supplemented with conditioned medium to a final concentration of 20%, and syngeneic irradiated (2000 rads) PBMC (2 x 10 ~ cells/ml) were added as a source of APC and feeders. One week later, cells were harvested and cultured for a rest period of I week at 2 x 10 ~ cells/ml in the presence of 2 x 10 s irradiated PBMC cells/ml, and in the absence of viral antigen. Only the cell line restimulated with infectious virus was viable and was maintained for 33 days in culture. The cell line was maintained by alternating 1 week of antigen stimulation, using 3 ,g/ml of FMDV C-$8, with I week of rest. After 6 weeks of culture, cells were cloned by limiting dilution in the presence of 20% conditioned medium, irradiated feeder cells and virus according to Taylor et al. (I987). Briefly, cells were seeded in 9b-flat- bottom-well plates at 1, 5, 15 and 50 cells per well, using half a plate for each dilution. Cultures were scored for cell growth after 10-12 days and clones from dilutions with less than 10 % of wells with growing cells were expanded and subcloned twice using the same procedure. Under these experimental conditions, Poisson statistics indicate that the probability of having obtained a clone derived from one single cell is effectively 100 %. One of the clones obtained, CEd, was maintained as described above for ceil lines and was characterized during this study. The specificity of CE3 clone was highly dependent on the maintenance of the culture conditions, and modifications of these conditions usually resulted in non-specific autocrine growth.

• Flow o/ tometry analysis. Assays were performed as described by Pescovitz et al. (1984), using monoclonal antibodies (MAb) against the following porcine markers: CD2 (MSA4) (Hammerberg & Schurig, 1986), CD4 (74-12-4), CD8 (76-2-11) and SLA class I (74-11-10) (Pescovitz et al., 1984); SLA class II (2E9/13) (kindly provided by R. Bullido, CISA, INIA, Madrid); IgM (Mengeling, 1985); CD25 (IL-2 receptor) (Bailey ef aI., 1992), Cells (2"5 x 10~-5 x I05) were washed twice with PBS containing 0"1% BSA and 0"01% sodium azide (FACS buffer) and incubated for 30 min at 4 °C with 50 gl of MAb supematants (I :2 dilution) or ascites (I: 50 dilution). After washing twice in FACS buffer, ceils were incubated for 30 rain at 4 °C with 50 111 of fluorescein isothiocyanate (FITC)- conjugated rabbit anti-mouse F(ab') 2 (Dako) diluted 1 : 40 in FACS buffer. Cells were washed twice in FACS buffer, fixed in 0"37% formalin and analysed with a flow cytometer (FACscan; Becton Dickinson).

• Proliferation assays. Proliferation assays of the T cell clone were performed as described previously (Taylor et al., 1987), using cells grown for 1 week in the absence of infectious FMDV. Briefly, triplicates of 100 cells were incubated in 96-well plates with 105 irradiated syngeneic

_~09(

PBMC and different FMDV concentrations in a total volume of 200,1 of supplemented RPMI medium. After 4 days at 37 °C, 1 ,Ci of [aH]thymidine was added to each well and the cultures were incubated for a further 18 h. The [3H]thymidine incorporation was then measured in a Microbeta counter (Pharmacia). The following controls were used to confirm the specificity of the proliferative response: (i) supematants or clarified extracts of uninfected BHK-2I cells, and (ii) African swine fever or African horsesickness virus preparations, at a concentration of about 107 p.f.u./ml [kindly provided by J. A.M. Escribano (CISA, INIA, Madrid) and M. Dhz-Laviada (CISA, INIA, Madrid), respectively]. SLA restriction was assessed by incubation of CE3 cells with allogeneic feeder cells. Inhibition assays were carried out by adding 10 ,g/well of each purified MAb during the incubation period. MAb 2E9/13 (anti-SLA class II) inhibited ConA but not PHA ionophore-induced proliferation of swine PBMC, while SLA class I, CD2, CD4 and CD8 MAbs did not affect these proliferations (N. Domenech, CISA, INIA, Madrid, personal communi- cation). Plates (Transwell-COL; Costar), including a semipermeable membrane (0"4 ~,m pore size), were used to study the requirement for direct contact between CE3 cells and PBMC in the proliferative response.

• Determination of TCR usage. Total RNA was isolated by using a commercial kit (RNAgents; Promega) based on the method described by Chomczynski & Sacchi (1987). RNA was dissolved in DEPC-treated water, quantified by A260 measurement and stored in aliquots at - 20 °C until use. Total RNA (2-10 ~g) was reverse transcribed using 100 U MMLV-RT (Promega) and an appropriate reverse primer (0"4 ~M) in 50 ,l of PCR mixture (0"4 mM-dNTPs, 1 mM-MgC12, 10 mM-Tris-HC1, 50 mM- KC1, 0"005% Tween 20, 0"005% NP40) for 1 h at 37 °C. After this, 20 pmol of forward primer and 2"5 U of thermostable DNA polymerase (Replitherm; Epicentre Technologies) was added to the mixture and the amplification was carried out for 30--35 cycles (denaturation : 94 °C, 45 s; annealing: 60 °C, 45 s; extension: 72 °C, 2 min) followed by a final extension step of 7 min at 72 °C. Amplification products were analysed on agarose gels stained with ethidium bromide. The synthetic oligonu- cleotides (purchased from Ramon Comet) used for the specific RT-PCR amplification of the different swine TCR genes are shown in Table 4.

Results Specificity of the proliferative response of CE3 clone

PBMC from a FMDV-immunized SLA inbred pig were used to generate virus-specific T cell lines and clones as described in Methods. The ability of one of the clones obtained, CE3, to proliferate in response to FMDV was investigated. CE3 cells proliferated in the presence of infectious C-$8 FMDV, but not with BEI-inactivated virus, showing a typical T cell proliferation dose-dependent curve with an optimal concentration between 5 x 105 and 5 x 106 p.f.u./ml (Fig. 1).

FMDV has different serotypes and subtypes among which important antigenic differences exist. To characterize the antigenic specificity of the CE3 response, heterologous FMDV isolates of serotypes A, O and C were used to induce CE3 proliferation. The response observed was heterotypic, being significantly induced by each of the C1, A5 and O I viruses tested. The specificity of the FMDV recognition by CE3 was confirmed as no proliferative response could be detected when supernatants or extracts of uninfected BHK-21 cells were added to CE3 cultures (data not shown). In addition, African

swine fever virus or African horsesickness virus did not induce proliferation (Fig. I b).

Characterization of FMDV recognition by CE3 cells

To assess whether the recognition of FMDV antigens by CE3 cells was mediated by a conventional T cell receptor- antigen interaction, the following experiments were per- formed. The requirement for accessory cells for CE3 FMDV- specific proliferation was analysed in cultures containing either syngeneic or allogeneic irradiated PBMC. Significant pro- liferative responses were only obtained when syngeneic PBMC were present, suggesting SLA restriction of the antigen recognition by CE3 cells (Table 1).

The role of macrophages as APC for viral antigens is well established. Recently, these cells have also been associated with the multiplication and spread of FMDV (Baxt & Mason, 1995). Therefore, we determined whether isolated syngeneic macrophages could serve as APC for CE3 recognition. Macrophage-enriched cultures, obtained from syngeneic PBMC by washing out non-adherent cells, were sufficient to support CE3 activation in the presence of infectious virus (Table 1). At this point, we had evidence of the requirement for infectious FMDV as well as the presence of syngeneic adherent PBMC or macrophages for the CE3 activation. Classical antigen recognition by T ceils depends on a physical interaction between APC and the effector T cell. To examine whether this was the case here, a proliferation assay was carried out in which CE3 cells were separated from the PBMC by a semipermeable membrane, which allowed diffusion of soluble factors and virus but not cell--cell interaction. As shown in Table 2, the proliferative response was significantly inhibited when direct contact between APC and T cells was prevented.

To characterize the interaction between CE3 cells and the APC and to examine SLA restriction, MAbs against porcine CD4, CDS, SLA class I and SLA class II were used to inhibit the FMDV-specific proliferation of CE3. The results presented in Table 3 show that proliferation was strongly inhibited by MAbs to CD2 and CDS. MAbs to SLA class I and class II partially inhibited proliferation and a weak inhibition was observed with a MAb to CD4. The inhibition observed with MAbs to class I and CDS, together with the requirement for syngeneic PBMC, suggest that the recognition of FMDV antigen by CE3 cells is SLA class I-restricted and CD2 as well as CD8 molecules are involved in the cellular interaction.

Phenotypic characterization of CE3

The presence of porcine surface markers on CE3 cells was analysed by flow cytometry (Fig. 2). CE3 cells showed a phenotype characteristic of activated T lymphocytes: they expressed CD2, SLA class I and class 1I, and CD25 (interleukin- 2 receptor) antigens and were negative for IgM. In addition, the clone was highly positive for CD8 and showed a low expression of CD4. These results are consistent with the

:04

U

x

r~

G

80

60

40

20

6.1

(a)

• I Ii 6.4 6.7 7.0

- (b)

4.9 5.2 5-5 5.8 6.1 6.4 6.7 7.0 FMDV concentration (log p.f.u./ml)

Fig. I. Specificity of the proliferative response of CE3 cells to FMDV. Cells were incubated with APC and different virus preparations. Data indicate the [3H]thymidine incorporation by CE3 cells on the fourth day of culture (see Methods). (o) Requirement for infectious virus. Infectious C-$8 FMDV ( I ) , BEl-inactivated C-$8 FMDV (0) . (b). CE3 stimulation by different FMDV serotypes and other viruses. CI Oberbayern ( I ) , A5 Westerwald (,~), O1 Kaufbeuren (O), African swine fever and African horsesickness viruses (I~), Data are expressed as Ac,p.m (c.p.m. sample--c.p.m, medium alone), and the standard errors never exceeded 20% of the mean value. The backgrounds of the assays (proliferation without viral a~tigens) were: (o) 9979_+626 c.p.m.; (b) 3198_+987 c.p.m.

Table 1. Proliferative response of CE3 cells t o FMDV

with different PBMC

Stimulant

[3H]Thymidine incorporat ion (c.p.m.-t-G_l)

Syngeneic Syngeneic AIIogeneic adherent

PBMC PBMC* cel lst

Control 99794-2494 3090_+241 49124-I228 + FMDV:I: 794124-2977 3650+414 691894-1078

* FBMC from a SLA a/a inbred pig. -t Plastic adherent feeder cells were obtained by repeated washes of feeder cells following I h incubation at 37 °C in the wells. :1: FMDV was used at the optimum proliferative concentration (5 x 106 p.f.u./ml) as described in Methods.

proliferative response of CE3 cells, which required infectious virus and was inhibited by MAbs to class I and CD8 (Fig. la, Table 3).

E x p r e s s i o n o f TCR g e n e s o n CE3 ce l l s

To determine the expression of TCR in the CE3 clone we performed RT-PCR on RNA obtained from the cloned cells, using the specific oligonucleotides shown in Table 4. Only primers specific for constant segments of swine TCR a and// (but not ~) genes generated D N A products of the expected size, showing the presence in CE3 cells of TCR ~p transcripts

Table 2. Effect of a semipermeable membrane between CE3 and irradiated syngeneic PBMC in the proliferation t o FMDV

CE3 cells were incubated with FMDV antigen (5 x 106 p.f.u./ml) either in contact with irradiated syngeneic PBMC or separated by a semipermeable membrane (see Methods).

FMDV M e m b r a n e

[3H]Thymidine incorporation (c.p.m._ o'._1)

Infectious No 34922 __ 2906 Infectious Yes 5 455 + 5II Inactivated No 1784 4- 477 Inactivated Yes 2593 q- 533

(Fig. 3).The specificity of the primers was confirmed by partial sequencing of the amplification products (data not shown) or by amplification of plasmids containing cDNA of each of the TCR genes (Thome et al., 1993).

Discussion Our results indicate that in vitro stimulation of PBMC from

vaccinated pigs allowed the selection of virus-specific T cell lines and clones. Suitable conditions for the establishment of a T cell line, including weekly restimulations with FMDV, were explored. In vitro stimulation of immune PBMC with infectious

~_09;

Table 3. Inhibition of the prol i ferat ive response of CE3 cells to FMDV by monoclonal ant ibodies

Inhibition Treatment Ac.p.m. 4- a._~* (%)t

Control + ~ 9364 ___ 495 - Anti-CD2 285 4- 39 97 Anti-CD8 283 -I- 37 97 Anti-CD4 7587 + 460 I9 Anti-SLA I 4293 4- 971 54 Anti-SLA II 4543 4- 143 5I Anti-IPNV§ 8 802 4- 331 6

* Ac.p.m. is expressed as sample c.p.m. - c.p.m, of medium without FMDV. -1- Percentage of inhibition was calculated as [(ac.p.m. control- Ac.p.m. sample)/ac.p.m, control] x I00. :1:CE3 cells and irradiated syngeneic PBMC incubated with FMDV, as described in Methods, in the absence of MAb. § An irrelevant MAb against infectious pancreatic necrosis virus.

virus enabled maintenance and cloning of specific T ceils. One of the clones obtained, CE3, was shown to specifically proliferate, in a dose-dependent manner, in response to infectious FMDV and irradiated syngeneic PBMC. It could be argued that soluble factors secreted by cells infected with FMDV or other viruses may mediate non-specific activation of CE3 cells. This possibility was ruled out by two different assays: first, addition of supernatants or extracts of BHK-21 cells, infectious African swine fever or African horsesickness viruses to the cultures did not induce CE3 proliferation; second, the introduction of a semipermeable membrane between CE3 and PBMC, preventing contact between these two populations but allowing soluble factors and virus circulation, prevented specific proliferation.

The requirement for infectious virus for CE3 activation suggests that PBMC contain cells susceptible to FMDV infection that could be acting as APC for CE3 stimulation. FMDV productively replicates in a macrophage-derived swine cell line via Fc receptor-mediated endocytosis (Baxt & Mason, 1995), and evidence of limited viral replication in swine

50 ] CD2 50 ~ C D 8 50 t C D 4

101 10 z 10 3 10 4 101 10 2 10 3 10 4 101 10 2 10 3 10 4

50 C D 2 5 50 S L A I 50] S L A II

i01 lo 2 10 3 i0 4 i01 10 2 10 3 i0 4 i01 i0 2 10 3 10 4

50, IgM

• . . . . . , . , .

101 10 2 10 3 10 4

Fluorescence

Fig. 2. Flow cytometry histograms of CE3 cells stained with NIAbs against swine surface molecules. Background (grey curves) corresponds to the fluorescence obtained directly with FITC-conjugated antibody.

~_09.'-

T a b l e . 4 . Primers used for PCR a m p l i f i c a t i o n o f TCR RNAs

Primer* Sequence (5' -* 3')t Expected size (bp)t Source§

TCR-Ca (f) cccgggatccCCACTGTGTACCAGCTGAGA 425 (1) TCR-C~ (r) cccgggatccTCAACTGGACCACAGCCGCAG TCR-Cfl (f) CCATCGGAAGCGGAGATCTCC 374 (2) TCR-Cfl (r) ggccacgcgtcgacggatccGAAGCCACAGTCTGCTTTGCCC TCR-C3 (f) cccgggatccGTCAGCCTCCTGCCAAACCAT 494 (2) TCR-C~ (r) cccgggatccTCCTCATGCCAGTCAGCCT

* f, forward primer; r, reverse primer. ~- The lower case letters indicate additional nucleotides introduced for cloning purposes. $ Predicted size of the fragment amplified.

(1) Consensus sequence obtained after alignment of constant segment sequences of TCR a genes of human, mouse, rat, sheep and cow, obtained from the EMBL database. (2) Thome el al. (1993).

460 bp

396 bp 350 bp

Fig. 3. Agarose gel analysis of RT-PCR products obtained after amplification of CE3 clone RNA usin 9 TCR ¢¢, fl or 6 specific primers as labelled, DNA markers are shown on the left.

macrophages has been observed in the absence of antiviral antibodies (Baxt & Mason, I995; Wardley et al., I980; A. Rodrfguez and others, unpublished results). Accordingly, macrophage-enriched cultures from syngeneic PBMC were assayed in the proliferation experiments and proven to be sufficient to sustain virus-specific activation of CE3.

In addition, the results suggest that CE3 cells recognize in a conventional way an FMDV antigen presented in the context of SLA molecules, since prevention of CE3-APC contact abolished proliferation. This hypothesis is consistent with the restriction observed in the response when allogeneic PBMC are used and with the inhibitions achieved with MAbs to CDS. The T cell lineage of CE3 ceils was confirmed by the detection of the expression of TCR ~/? genes by PCR.

Attempts to set up experimental conditions that would enable a CTL assay of CE3 cells have been unsuccessful. Infection of syngeneic primary cultures of kidney cells resulted in a strong and rapid cytopathic effect (within 5 h p.i.) which hampered the detection of specific ~lCr release. The use of macrophages as target cells did not result in significant specific lysis (data not shown), probably because their susceptibility to FMDV is too low to allow the CTL-mediated lysis of a significant percentage of the 51Cr-labelled cells.

Certain characteristics make the porcine immune system different from that of other species. Among swine peripheral lymphocytes, typical single CD4 + and CD8 + subpopulations coexist with CD4+/CD8 + double-positive cells (unique to swine) as well as a double-negative population CD4 /CD8- that is subdivided in CD2 + and CD2- lymphocytes (Saalmiiller et al., 1994; Pescovitz et al., 1994). FACS analysis of CE3 ceils has revealed the expression of CD2 and IL-2 receptor markers. In addition, the CE3 clone expresses CD4 surface marker. However, the staining intensity of CE3 cells with anti-CD4 is lower than that normally found among CD4 + PBMC, while signal with CD8 MAb is in the same range as that found in CD8 ÷ PBMC (R. Bullido, personal communication). Therefore, the CE3 clone is not a typical double-positive T cell, since these cells normally exhibit strong intensity of the CD4 marker and a low CD8 intensity (Pescovitz et al., I994). MAbs to the CD8 and CD2 markers strongly inhibited CE3 proliferation. Con- versely, the MAb to CD4 did not significantly affect the response. In addition, both SLA class I and class II MAbs significantly inhibited proliferation. The inhibition observed with class II MAb is probably clue to a mechanism similar to that resulting in the inhibition exerted by this MAb in ConA stimulation of swine PBMC (N. Domenech, personal com- munication). Altogether, these results indicate that CE3 recognition of FMDV antigen is class I-restricted and hence CD8 acts as a co-receptor.

In spite of the considerable antigenic diversity of FMDV, the CE3 response is heterotypic, a characteristic also found in T cell epitope recognition among other picornaviruses (Kutubuddin et al., 1992). Cloning of different FMDV poly- peptides in vaccinia virus is now in progress in our laboratory to generate suitable target cells for CTL assays, and to provide us with a tool for the identification of the polypeptide bearing the FMDV epitope recognized by CE3 cells. In addition, we are investigating other possible biological activities of CE3 cells such as the secretion of soluble antiviral interleukins (Zinker- nagel, 1996). CE3 ceils might become activated upon rec-

~_09L

ognition of target cells that do not support a fully productive FMDV infection, but which are able to present viral antigens, as could be the case for macrophages.

A class I (CDS+)-restricted response is generally induced by endogenously synthesized antigens, such as those generated during viral infections, while induction of a class II (CD4 +) response is mediated by exogenous soluble proteins. Conse- quently, in order to induce a CD8 cell response, the strategy is usually the inoculation of an infectious or partially inactivated virus which can replicate in the host. Thus, it was unexpected to find that the phenotype of the clone obtained in this s tudy corresponded to that of a CD8 + T cell, since it was selected from a PBMC culture from an animal vaccinated with inactivated virus. However, it has been shown that purified proteins or peptides can induce class I-restricted CTL popula- tions in several systems (Aichele et al., 1990; Schirmbeck et aI., 1995) suggesting that our results may not be so unusual. The protocol for establishment of the cell line and maintenance of this clone, by using infectious virus for the in vitro restimu- lation, together with the ability of FMDV to infect, to some extent, APC, may have favoured the selection of a population enriched in CD8 + T cells. According to these results, the induction of a wide humoral and cellular response to FMDV could be induced by the inclusion of not only B and CD4 but also CD8 epitopes in synthetic peptide-based vaccines.

We wish to thank A. Canals, R. Bullido and A. Guti6rrez for their support and advice. We are also indebted to T. Collen, J. Domfnguez and J. Lunney for their suggestions, and corrections to the manuscript. Work was supported by CICYT (grant AGF93/12), DIGICYT (grant PM92-20I), INIA (grant SC93-155) and Fundaci6n Ram6n Areces.

References Acharya, R., Fry, E., Stuart, D., Rowlands, D. & F. Brown. (1989). Three-dimensional structure of foot-and-mouth disease virus at 2"9 A. resolution. Nature 337, 709-716.

Aichele, P., Hengartner, H., Zinkernagel, R. M. & Schulz, M. (1990). Antiviral cytotoxic T cell response induced by in vivo priming with a free synthetic peptide. Journal of Experimental Medicine 171, 1815-1820.

Bachrach, H. L. (1968). Foot-and-mouth disease virus. Annual Review of Microbiology 22, 201-244.

Bahnemann, H. G. (1974). Binary ethylenimine as inactivant for foot and mouth disease virus and its application for vaccine production. Archives of Virology 47, 47-56.

Bailey, M., Stevens, K., Blond, P.W. & Stokes, C.R. (1992). A monoclonal antibody recognizing an epitope associated with pig interleukin-2 receptors. Journal of Immunological Methods 153, 85-91.

Barteling, S. J. & Vreeswijk, J. (1991 ). Development in foot-and-mouth disease vaccines. Vaccine 9, 75-88.

Baxt, B. & Mason, W.P. (1995). Foot-and-mouth disease virus undergoes restricted replication in macrophage cell cultures foIiowing Fc receptor-mediated adsorption. Virology 207, 503-509.

Bittle, J. L., Houghten, R. A., Alexander, H., Shinnick, T. M., Sutcliffe, J. G., Lerner, R.A., Rowlands, D.J. & Brown, F. (1982). Protection against foot-and-mouth disease by immunization with a chemically synthesized peptide predicted from the viral nucleotide sequence. Nature 298, 30-33.

Brown, F. (1992). New approaches to vaccination against foot-and- mouth disease. Vaccine 10, 1022-1026.

Chomczynski, P. & Sacchi, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Analytical Biochemistry 162, 156-159.

Clarke, B. E., Newton, S. E., Carroll, A. R., Francis, M. J., Appleyard, G., Syred, A. D., Highfield, P. E., Rowlands, D.J. & Brown, F. (1987). Improved immunogenicity of a peptide epitope after fusion to hepatitis B core protein. Nature 330, 381-384.

Collen, T. (1991 ), T cell responses of cattle to foot-and-mouth disease virus. PhD thesis. Council for National Academic Awards, England.

Collen, T. (1994). Foot-and-mouth disease virus (Aphthovirus): viral T cell epitopes, pp. 173-197. In Cell-Mediated Immunity in Ruminants. Edited by B. M. L. Goddeevis & I. Morrison. Boca Raton, FL : CRC Press.

Collen, T., DiMarchi, R. & Doel, T. (1991 ). T cell epitope in VP1 of foot- and-mouth disease virus is immunodominant for vaccinated cattle. Journal of Immunology 146, 749-755.

Collen, T. & Doel, T. R, (1990). Heterotypic recognition of foot-and- mouth disease virus by cattle lymphocytes. Journal of General Virology 71, 309-315.

Collen, T., Pullen, L. & Doel, T, R. (1989). T cell dependent induction of antibody against foot-and-mouth disease virus in a mouse model. Journal of General Virology 70, 395-403.

Dillender, M. & Lunney, J. K. (1993}. Characteristics of T lymphocyte cell lines established from NIH minipigs inoculated with Trichinella spiralis. Veterinary Immunology and Immunopathology 35, 301-319.

DiMarchi, R., Brooke, G., Gale, J. K. C., Cracknell, V., Doel, T. & Mowat, N. (1986). Protection of cattle against foot-and-mouth disease by a synthetic peptide. Science 232, 639--641.

Doherty, P. C., Allan, W., Eichelberger, M. & Carding, S. R. (1992). Roles of 2//and y~ T cell subsets in viral immunity. Annual Review of Immunology 10, I23-151.

Domingo, E., Divila, M, & Ortfn, J. (1980). Nucleotide sequence heterogeneity of the RNA from a natural population of foot-and-mouth disease virus. Gene 11, 333-346.

Domingo, E., Mateu, M. G., Mart~nez, M. A., Dopazo, J., Moya, A. & Sobrino, F. (1990). Genetic variability and antigenic diversity of foot- and-mouth disease virus. Applied Virology Research 2, 233-266.

Glass, E.J. & Millar, P. (1994). Induction of effective cross-reactive immunity by FMDV peptides is critically dependent upon specific MHC-peptide-T cell interactions. Immunology 82, 1-8.

Glass, E. J. & Millar, P. (1995). Bovine T cells preferentially recognize non-viral spacer epitopes in a putative FMDV vaccina[ peptide. Vaccine 13, 225-229.

Grimm, D. R., Richerson, J. T., Theiss, P. M., Legrand, R. D. & Misfeldt, M. L. (1993). Isolation and characterization of T lymphocyte cell lines from sinclair swine peripheral blood. Veterinary Immunology and Immuno- pathology 38, 1-20.

Hammerberg, C. & Schurig, G. (1986). Characterization of monoclonal antibodies directed against swine leucocytes. Veterinary Immunology and Immunopathology 11, 107-121.

Kutubuddin, M., Simons, J. & Chow, M. (1992). Poliovirus-specific maior histocompatibility complex class I-restricted T-cell ep~topes in mice localize to neutralizing antigenic regions. Journal of Virology 66, 5967-5974.

Lea, S., Hern~ndez, J., Blakemore, W., Brocchi, E., Curry, S., Domingo, E., Fry, E., Abu-Ghazaleh, R., King, A., Newman, J., Stuart, D. & Mateu, M. G. (1994). Structure and antigenicity of a type C foot-and-mouth disease virus. Structure 2, 123-139.

!09!

Lindsley, M. D., Thiemann, R. & Rodriguez, M. (1991). Cytotoxic T cells isolated from the central nervous system of mice infected with Theiler's virus. Journal of Virology 65, 6612--6620.

McCullough, K., De Simone, F., Brocchi, E., Capucci, L., Crowther, J. R. & Kihm, U. (1992). Protective immune response against foot and mouth disease virus. Journal of Virology 66, 1835-1840.

Mengeling, W.L. (1985). Monoclonal precipitating antibodies to porcine immunoglobulin IgM. Veterinary Immunology and Immuno- pathology 8, 249-256.

Pfaff, E., Mussgay, M., B6hm, H.O., Schultz, G. E. & Schaller, H. (1982). Antibodies against a preselected peptide recognize and neutralize foot-and-mouth disease virus. EMBO Journal 1, 869-874.

Pescovitz, M.D., Lunney, J. & Sachs, D. (1984). Preparation and characterization of monoclonal antibodies reactive with porcine PBL. Journal of Immunology 133, 368-375.

Pescovitz, M. D., Sakopoulos, A. G., Gaddy, J.A., Husmann, R. J. & Zuckermann, F. A. (1994). Porcine peripheral blood CD4+/CD8 + dual expressing T cells. Veterinary Immunology and Immunopathology 43, 53-62.

Rodriguez, A., S~iz, J. C., Nombela, I. S., Andreu, D. 6. Sobrino, F. (1994). Antigenic specificity of porcine T cell response against foot-and- mouth disease virus : identification of T helper epitopes in VP1. Virology 206, 24-33.

Saalmiiller, A. (1994). Characteristics of porcine T lymphocytes and T cell lines. Veterinary ImmunoJogy and ImmunopathoJogy 43, 45-52.

Sachs, D., Leight, G., Cone, J., Schwarz, S., Stuart, L. & Rosenberg, S. (1976). Transplantation in miniature swine. I. Fixation of the major histocompatibility complex. Transplantation 22, 559-567.

S.~iz, J. C., Gonzalez, M. J., Morgan, D. 0., Card, J. L, Sobrino, F. & Moore, D. M. (1989). Antigenic comparison of different foot-and-mouth disease virus types using monoclonal antibodies defining multiple neutralizing epitopes on FMDV A5 subtypes. Virus Research 13, 45-60.

S~iz, J.C., Rodr(guez, A., Gonz,~lez, M., Aionso, F. & Sobrino, F. (1992). Heterotypic lymphoproliferative response in pigs vaccinated with foot-and-mouth disease virus. Involvement of isolated capsid proteins. Journal of General Virology 73, 2601-2607.

Schirmbeck, R., Deml, L., Melber, K., Wolf, H., Wagner, R. & Reimann, J. (1995), Priming of class I-restricted cytotoxic T lymphocytes by vaccination with recombinant protein antigens. Vaccine 13, 857-865.

Strohmaier, K., Franze, R. & Adam, K.H. (1982). Location and characterization of the antigenic portion of the FMDV immunizing protein. Journal of General Virology 59, 295-306.

Taylor, P. M., Thomas, D. B. & Mills, K. H. G. (1987). In vitro culture of T cell lines and clones, pp. 133-147. In Lymphocytes, A Practical Approach. Edited by G. G. B. Klaus. Oxford: IRL Press.

Thome, M., Saalmiiller, A. & Pfaff, E. (1993). Molecular cloning of porcine T cell receptor ~, fl, 2' and ~ chains using polymerase chain reaction fragments of the constant regions. European Journal of Immunology 23, 1005-1010.

Usherwood, E.J. & Nash, A.A. (1995). Lymphocyte recognition of picornaviruses. Journal of General Virology 76, 499-508.

van Lierop, M. J. C., Van Maanen, K, Meloen, R. H, Rutten, V. P. M. G, De Jong, W.A.C. & Hensen, E.J. (1992). Protective lymphocyte responses to foot-and-mouth disease virus and three FMDV pep,ides after vaccination or immunization with these pep,ides in cattle. Immunology 75, 406--413.

Van Lierop, M. J. C., Van Noort, J. M., Wagenaar, J. P. A., Rut'ten, V. P. M.G., Langeveld, J., Meloen, R. H. & Hensen, E.J. (1994). T cel]- stimulatory fragments of foot-and-mouth disease virus released by mild treatment with cathepsin D. Journal of General Virology 75, 2937-2946.

Villanueva, N., D~;vila, M., Ortfn, J. & Domingo, E. (1983). Molecular cloning of eDNA from foot-and-mouth disease virus el-Santa Pau (C-$8). Sequence of protein VP1 coding segment. Gene 23, 185-194.

Wardley, R. C., Lawman, M. J. & Hamilton, F. (1980). The establishment of macrophage cell lines from peripheral blood monocytes. Immunology 39, 67-73.

Zinkernagel, R. M. (1996). Immunology taught by viruses. Science 271, I73-178.

Received 17 January 1996; Accepted 10 May 1996

!09~