1

A venom-derived neurotoxin, CsTx-1, from the spider Cupiennius salei exhibits cytolytic

activities

Lucia Kuhn-Nentwig1, Irina M. Fedorova

2, Benjamin P. Lüscher

3, Lukas S. Kopp

4, Christian

Trachsel4, Johann Schaller

4, Xuan Lan Vu

5, Thomas Seebeck

5, Kathrin Streitberger

1, Wolfgang

Nentwig1, Erwin Sigel

3, and Lev G. Magazanik

2,6

From the 1Institute of Ecology and Evolution, University of Bern, Baltzerstrasse 6, CH-3012 Bern,

Switzerland 2I.M. Sechenov Institute of Evolutionary Physiology and Biochemistry, Saint-Petersburg; Russian

Academy of Sciences, Thorez pr. 44, 194223 Saint-Petersburg, Russia 3Institute of Biochemistry and Molecular Medicine, University of Bern, Bühlstrasse 28, CH-3012 Bern,

Switzerland 4Department of Chemistry and Biochemistry, University of Bern, Freiestrasse 3, CH-3012 Bern,

Switzerland 5Institute of Cell Biology, University of Bern, Baltzerstrasse 4, 3012 Bern, Switzerland

6Medical Faculty, 199034 Saint-Petersburg University, 7-9 University embank., Russia

*Running title: CsTx-1, a pore-former

To whom the correspondence should be addressed: Lucia Kuhn-Nentwig, Institute of Ecology and

Evolution, University of Bern, Baltzerstrasse 6, CH-3012 Bern, Switzerland, Tel: +41 31 631 4532 Fax:

+41 31 631 4888, Email: lucia.kuhn@iee.unibe.ch

Keywords: CsTx-1, Cupiennius salei, cytolytic activity, Calliphora larvae muscle preparation, Rana

neuromusclular preparations, Xenopus oocytes, L-type Ca2+

channel inhibitor

Background: CsTx-1, an ICK motif containing

neurotoxin, acts as L-type Ca2+

-channel inhibitor.

Results: The partial α-helical C-terminus of CsTx-

1 exhibits cytolytic activity towards prokaryotic

and eukaryotic cell membranes.

Conclusion: one peptide with different domains

for ion channel inhibition and cytolytic activity.

Significance: An important new mechanism for

the evolution of spider venomous peptides.

CsTx-1, the main neurotoxic acting peptide

in the venom of the spider Cupiennius salei is

composed of 74 amino acid residues, exhibits an

ICK motif and is further characterised by its

highly cationic charged C-terminus. Venom

gland cDNA library analysis predicted for

CsTx-1 precursor a prepropeptide structure. In

the presence of trifluoroethanol, CsTx-1 and

the long C-terminal part alone (CT1-long;

Gly45-Lys74) exhibit an α-helical structure, as

determined by CD-measurements. CsTx-1 and

CT1-long are insecticidal towards Drosophila

flies and destroys Escherichia coli SBS 363 cells.

CsTx-1 causes a stable and irreversible

depolarisation of insect larvae muscle cells and

frog neuromuscular preparations which seem

to be receptor independent. Furthermore, this

membranolytic activity could be measured for

Xenopus oocytes, in which CsTx-1 and CT1-

long increase ion permeability non-specifically.

These results support our assumption that the

membranolytic activities of CsTx-1 are caused

by its C-terminal tail, CT1-long. Together,

CsTx-1 exhibits two different functions: as a

neurotoxin it inhibits L-type Ca2+

-channels and

as a membranolytic peptide it destroys a

variety of prokaryotic and eukaryotic cell

membranes. Such a dualism is discussed as an

important new mechanism for the evolution of

spider venomous peptides.

Spiders evolved some 300 million years ago

(1). With currently 42,055 species, spiders

represent the second most abundant group of

terrestrial organisms, after the insects (2). The

majority of spiders rely on the potency of their

venom for immediate prey immobilisation or to

repel aggressors. For fast paralysing or killing a

prey item, spiders very successfully developed a

variety of multicomponent venoms in which

components usually act synergistically. It seems

2

that araneomorph spiders have evolved a much

greater variety of different substance

combinations, which provide likewise immediate

paralysis of prey than the ancient mygalomorph

spiders. Additive interactions between different

venom compounds of the same group, or

synergistic interactions between different venom

compound groups, such as ions, low molecular

mass compounds, enzymes, neurotoxins, small

cationic peptides (SCPs) and α-helical small

cationic peptides (α-SCPs), have been identified

recently (for review see (3)).

The venom strategy of species in the wolf

spider superfamily such as Lycosa singoriensis (4-

6), Oxyopes takobius (7-9), and Cupiennius salei

(3,10-13) is based on synergistic interactions

between low molecular mass compounds,

neurotoxins, and α-SCPs with cytolytic activities

(3). Moreover, first results indicate that two

different venomous functions can even be

combined within one peptide. The spider

Cheiracanthium punctorium, also from this

superfamily, contains a large two-domain modular

protein (CpTx 1a; 15.1 kDa) forming a putative

amphipathic structure, that exhibits a pronounced

insecticidal and cytolytic effect. This protein is

composed of two similar domains, both exhibiting

the putative inhibitory cysteine knot (ICK) motif

and additional C-terminal putative α-helical parts

(14).

CsTx-1 (ω-ctenitoxin-Cs1a, [UniprotKB

P81694]) represents the prevalent and most active

neurotoxic peptide in the C. salei venom (10,15).

The peptide is composed of 74 amino acid

residues with an amidated C-terminus and four

disulfide bridges adopting the ICK motif. CsTx-1

blocks L-type Ca2+

channels in mammalian

neurons at nanomolar concentrations.

Furthermore, CsTx-1 produces a slow voltage-

independent block of mid/low (M-LVA) and high-

voltage-activated (HVA) Ca2+

channels in

cockroach neurons (16). Previous investigations

showed that the loss of the highly positively

charged C-terminal 13 amino acid residues,

resulting in CsTx-2a (ctenitoxin-Cs2a; Ser1-

Arg61) or of the last 14 amino acid residues

(CsTx-2b; ctenitoxin-Cs2b; Ser1-Phe60)

dramatically reduces its insecticidal activity (17).

Nevertheless, the synthetic C-terminal cationic

peptide (CT1-short, Gly62-Lys74) exhibits neither

insecticidal nor bactericidal activity at up to

millimolar concentrations (17). Obviously, 13 to

14 amino acid residues fragments are too short to

expect membranolytic activities. However, the

secondary structure prediction of the C-terminal

last 30 amino acid residues of CT1-long (Gly45-

Lys74) reveals a possible α-helical structure. This

could indeed indicate that CsTx-1 is a peptide with

two structurally different domains exerting two

different biological functions. To explore the

relationship of structure and function of CsTx-1

and its shorter variant CsTx-2a, transcriptomic

investigations into possible polymorphisms,

especially in its C-terminal part, are essential.

Here, we report on the mRNA structure of

CsTx-1, which underlines the importance of the

correct transcription and translation responsible

for the high bioactivity of the peptide. Also the

effects of CsTx-1, CT1-long, CT1-short, and

CsTx-2a have been investigated on different

membrane systems and bioassays. Our results

show that in addition to its published L-type Ca2+

channel blocking activity (16), CsTx-1

additionally exhibits cytolytic activity.

EXPERIMENTAL PROCEDURES

Spider Maintenance, Venom Collection, and

Peptide Purification — Spider breeding, venom

collection, and purification of CsTx-1 by RP-

HPLC in a four step protocol were done as

previously described (15). CsTx-2a was obtained

by digesting CsTx-1 with coagulation factor Xa as

reported (17). CT1-short and CT1-long were

synthesised using Fmoc solid phase chemistry and

were purified by GeneCust (Laboratoire de

Biotechnologie du Luxembourg S.A.). The

concentrations of CsTx-1, CsTx-2a, CT1-long and

CT1-short were determined in duplicate by amino

acid analysis.

cDNA Library of Venom Glands of C. salei —

From 20 adult female spiders venom glands were

prepared after milking at different time intervals

(24 h, 48 h, 62 h, 8 d and 14 d), stored in

RNAlater (Qiagen) and sent on dry ice to

SKULDTECH (Montpellier, France) to generate

the cDNA library by 454 sequencing. CsTx-1 was

identified in the venom gland cDNA library

(202,877 ESTs; 34,107 consensus sequences; 98%

assembly) using the SKULDTECH generated

database screening with BLASTp and analysis of

the cDNA sequences.

Circular Dichroism (CD) Measurements — For

CD measurements, samples (40 µM) were

3

dissolved in a 5 mM Na2HPO4/NaH2PO4 pH 7.2,

and 150 mM NaF or in same buffer containing

50% (v/v) 2,2,2,-trifluoroethanol (TFE).

Measurements were performed with a Jasco J-715

spectropolarimeter (Jasco, Japan) in a Suprasil R

110-QS 0.1 cm quartz cell (Hellma Analytics,

Germany) in the range of 178 - 260 nm at 20°C.

Three independent measurements were recorded

per sample and each spectrum was the average of

three scans to improve the signal-to-noise ratio.

All spectra were corrected for buffer or buffer/TFE

blank measurements. Secondary structure content

was deconvoluted using Dichroweb server,

applying the analysis program CDSSTR and

reference set 1 (18-20).

Insecticidal Activity — Drosophila

melanogaster were used to determine the

insecticidal activity of CT1-short and CT1-long.

Four different peptide concentrations of CT1-short

between 200 and 500 pmol / mg fly (injected in a

total volume of 0.05 l of insect ringer) and four

different peptide concentrations of CT1-long

between 36 and 130 pmol / mg fly were tested on

each of 20 flies and 20 flies were used as controls

(0.05 l of insect ringer only). Calculations of the

lethal doses LD50 (50% of the test flies died of

intoxication 24 h post injection) were performed

as described elsewhere (17).

Antimicrobial Activity — Antimicrobial activity

of CsTx-1, CsTx-2a, CT1-long, and CT1-short

against Escherichia coli ATCC 25922,

Escherichia coli souchier bactériologique de

Saclay (SBS) 363, Staphylococcus aureus ATCC

29213, and Trypanosoma brucei brucei

MiTat1.2(221) were determined as described in

(21).

Insect (Calliphora vicina) and Frog (Rana

temporaria) Neuromuscular Preparations and

Electrophysiological Experiments — Late third

stage larvae of Calliphora vicina (22,23) were

used in all experiments. After dissection, the

internal organs and the ventral ganglion were

removed so that the preparation consisted only of

muscles attached to the cuticle. The segmental

nerves were stimulated through the suction

electrode. Recordings of the resting membrane

potential were made by glass intracellular

microelectrodes from ventral longitudinal fibres.

The resting membrane potential of muscle fibres

was measured in several cells in control and after

30 and 60 min of continuous perfusion with saline

at room temperature (22°C). Saline was composed

of 172 mM NaCl, 2.5 mM KCl, 0.6 mM CaCl2, 4

mM MgCl2, 5 mM HEPES (pH 7.2). Different

concentrations of CsTx-1 and albumin (0.01%,

Sigma) were added to the bath. By nerve

stimulation excitatory postsynaptic currents were

evoked and recorded by a conventional two-

electrode voltage clamp (Axoclamp-2B amplifier,

Axon Instruments) and the data were filtered at 2

kHz.

To investigate the ionic nature of the current

induced by CsTx-1 on C. vicina muscle fibres, the

cells were clamped by conventional two electrode

method at -70 mV. Three series of experiments

were performed: (I) in saline (172 mM NaCl); (II)

95% of Na+ substituted by sucrose; (3) 95% of Na

+

substituted by N-methyl-D-glucamine (NMDG)

chloride. Changes in holding current and input

resistance were simultaneously recorded before

and up to 30 min after application of 100 nM

CsTx-1. Periodically (approximately, each 5 min)

a value of membrane potential by temporal

reduction of current to zero level was estimated.

The glass microelectrodes were filled with KCl

and had a resistance of 10-15 MΩ.

Frog muscle (musculus sartorius) preparations

of Rana temporaria were placed into a 1.5 ml

plastic chamber and super fused with saline at

22°C. Saline was composed of 117 mM NaCl, 2.5

mM KCl, 0.6 mM CaCl2, 4 mM MgCl2, 5 mM

HEPES (pH 7.2). Different concentrations of

CsTx-1 and albumin (0.01%, Sigma) were added

to the bath.

Frog (Xenopus laevis) Oocyte Preparations

and Electrophysiological Experiments — Female

Xenopus laevis were kept under a 12 h day/night

cycle. Other conditions were as described in

several links of www.xenopus.com/links. The

animals were anesthetized by immersion until loss

of all reflexes (~10–15 min) in prechilled water

containing 0.2% ethyl 3-aminobenzoate methane

sulphate (A5040; Sigma, St. Louis, MO, USA).

The female frogs were then laid on wet tissues

placed on an ice bed (ventral face up) and kept wet

by covering the animal with soaked tissue. The

nose of the animal was exposed to air to enable

breathing. Through a small abdominal incision

(0.5–0.8 cm) lobes of the ovary were pulled out

carefully. At least two, but not all lobes of the

ovary were removed to ensure oocyte

regeneration. Follicles were singled out from an

ovary lobe using a platinum loop. Follicles were

4

then stored at 18°C in sterile filtered Barth’s

medium containing NaCl (88 mM), KCl (1 mM),

NaHCO3 (2.4 mM), HEPES (10 mM, pH 7.5),

MgSO4 x 7H2O (0.82 mM), Ca(NO3)2 x 4H2O

(0.34 mM), CaCl2 x 2H2O (0.41 mM), and

penicillin/streptomycin (100 U/ml).

Peeling of the oocytes were carried out as

previously described (24). Briefly, follicles were

exposed for 20 min at 36°C to ~1 mg/ml

collagenase (Type IA, C-9891, 800 U/mL; Sigma),

0.1 mg/mL trypsin inhibitor (Type I-S, Sigma T-

9003) in Barth’s solution in borosilicate glass

tubes. Subsequently, follicles were exposed for 4

min at room temperature to a doubly concentrated

Barth’s solution containing 4 mM Na-EGTA.

Oocytes were then conveniently freed from the

surrounding layers by rolling them in a plastic

culture dish.

Currents were measured using a modified two-

electrode voltage clamp amplifier oocyte clamp

OC-725 (Warner Instruments Corp.) in

combination with a XY-recorder (90% response

time 0.1s) or digitized at 100 Hz using a PowerLab

2/20 (AD Instruments). Voltage protocols to elicit

reversal potential, and data recordings were

performed using the computer programs Chart and

Scope (ADInstruments GmbH, Spechbach,

Germany). Tests with a model oocyte were

performed to ensure linearity in the larger current

range. The response was linear up to 15 µA.

Electrophysiological experiments were carried out

in the media specified in (Online resource 1) at a

holding potential of -80 mV. The perfusion

solution (6 ml/min) was applied through a glass

capillary with an inner diameter of 1.35 mm, the

mouth of which was placed about 0.4 mm from the

surface of the oocyte (25). Perfusion was stopped

for 5 min to perform electrophysiological

experiments on oocytes exposed to the toxin. 100

µl of a toxin were applied directly to the bath

(volume 200 µl).

RESULTS

cDNA Structure of CsTx-1 — Scanning our

venom gland cDNA library, we analysed several

contigs to elucidate the complete cDNA sequence

encoding CsTx-1. The cDNA sequence starts with

a 5’-UTR of 71 bps, followed by an ORF of 369

bps and a 3’-UTR of 102 bps. The predicted

polypeptide consists of the signal peptide

comprising 20 amino acid residues, followed by an

acidic prosequence of 27 amino acid residues, the

premature peptide of 75 amino acid residues and

the stop codon. Three different posttranslational

processing steps are involved in the maturation

process of CsTx-1: (1) cleavage of the signal

peptide, (2) limited proteolysis of the acidic

propeptide at the processing quadruplet motif

(PQM: 44EQAR47) according to the EtoR rule

(26) and (3) additionally, a C-terminal amidation

taking place in which Gly75 is removed and Lys74

simultaneously amidated (27) (Fig. 1).

Remarkably, the codons encoding the different

amino acid residues of the mature peptide CsTx-1

are highly conserved. Screening 782 EST

sequences encoding mature CsTx-1, and focusing

on the C-terminal part, two silent mutations by

substitution in the third codon position for Asp33

ga(c/t) and Lys67 aa(g/a) have been detected. For

Asp33 the point mutation ‘GAT’ behave to 36.2%

and the point mutation of Lys67 ‘AAA’ amounts

to 8.4% (Fig. 1).

Interestingly, CsTx-2a as well as CsTx-2b

seem to be posttranslational modification products

of CsTx-1 because no cDNA sequence could be

identified with clear stop codons behind Phe-60

(CsTx-2b) or Arg-61 (CsTx-2a). In spite of an

amidation of CsTx-2a isolated from the venom

(28) no stop codon could be identified behind Gly-

62. The amidation could be a posttranslational

modification product in which Gly 62 erroneously

could serve as NH2 donator.

Circular Dichroism Spectroscopy of CsTx-1,

CsTx-2a, CT1-short and CT1-long — In order to

assess the secondary structure of the different

peptides, the CD-spectra of CsTx-1 were recorded

in sodium phosphate buffer adopting mainly a β-

sheet, β-turn and unordered conformation (Fig. 2,

Table 1). These findings are consistent with the

secondary structure of ICK motif containing

peptides (14). The addition of TFE induces

pronounced spectral changes of CsTx-1. In TFE

solution the peptides are considered to adopt α-

helical structures and the TFE-induced helicity of

the peptides is a measure of their helix propensity

(29). The α-helical structure content of the peptide

increases from 2 to 42% with a simultaneous

decrease of the β-sheet from 38 to 19% and

unordered structure content from 40 to 18%. Only

a minor increase of the α-helical structure with

simultaneously minor transformations of the β-

sheet, β-turn and unordered structure content is

5

visible in CsTx-2a after TFE addition (Fig. 2,

Table 1).

The prediction of α-helical structures

(http://www.expasy.ch, (30)) for CsTx-1 resulted

in the identification of a putative α-helical segment

(Ala-52 to Lys-65) in the C-terminal cysteine-free

part of CsTx-1 (Fig. 3a). As expected, CT1-short

exhibits a non-α-helical conformation even in the

presence of TFE (Fig. 2, Table 1). CD-

measurements of CT1-long in PBS buffer suggest

non-α-helical structure (Fig. 2, Table 1). However,

addition of TFE resulted in a high α-helical

conformation of CT1-long (66%) and

simultaneously decreases of the β-sheet from 28 to

16%, and unordered structure content from 48 to

11% (Fig. 2, Table 1).

Insecticidal Activity of CsTx-1, CsTx-2a, CsTx-

2b, CT1-short and CT1-long — Truncation of the

last 13 C-terminal amino acids of CsTx-1 (CsTx-

2a) decreases its insecticidal activity about seven-

fold, and a further truncation of Arg 61 (CsTx-2b)

provokes an activity loss of about 190-fold (17).

CT1-short is not insecticidal up to a concentration

of 500 pmol / mg fly. Remarkable, CT1-long

exhibits an insecticidal activity with an LD50 of

82.64 pmol / mg fly (Table 2).

Antimicrobial Activity of CsTx-1, CT1-short

and CT1-long — No bactericidal activity of CsTx-

1 (250 µM), CT1-long (149 µM) and CT1-short

(250 µM) against E. coli (ATCC 25922) and S.

aureus (ATCC 29213) is observable.

Nevertheless, CT1-long (149 µM) reduced the

growth of S. aureus four-fold when compared with

the bacterial control group without peptide.

Surprisingly, CsTx-1 destroys the E. coli mutant

SBS 363 in a concentration of 31.25 µM and CT1-

long in one third of this concentration.

Furthermore, CT1-long exhibits a trypanocidal

activity in a concentration of 5 µM. CT1-short is

up to a concentration of 250 µM neither

bactericidal nor trypanocidal.

Effects of CsTx-1 on Calliphora and Frog

Neuromuscular Preparations — Spontaneous and

nerve evoked postsynaptic currents of C. vicina

late third stage larvae were unaffected by CsTx-1

at concentrations between 50 and 200 nM.

Depolarising effects of CsTx-1 on C. vicina larvae

and frog neuromuscular preparations were

investigated at 50-900 nM. Fly muscle fibres were

depolarised at 100 nM, whereas frog muscle fibres

exhibit this effect only in a three-fold higher

concentration (300 nM) of the peptide. The drop

of the resting membrane potential for both types of

muscle fibres was irreversible and could not be

removed by long-lasting washing (30-60 min)

(Table 3). In the presence of 300 nM CsTx-1, the

depolarisation of fly muscle is about 33% and was

accompanied with muscle contractions which

ceased at a very low (~ 30 mV) membrane

potential.

Furthermore, three different series of

experiments under voltage clamp conditions were

performed to elucidate the effects of CsTx-1 (100

nM) on fly muscle cells: (I) in saline (172 mM

NaCl), (II) 95% of Na+ has been substituted by

sucrose, and (III) 95% of Na+ has been substituted

by NMDG, which is known to block a high

diversity of Na+, K

+, Ca

2+ and other ion channels

(31). In the presence of 172 mM NaCl an

increasing inward current, a decreasing cell input

resistance (Fig. 4a) and a strong depolarisation

were observed after application of CsTx-1 (Fig.

4b). Increasing the Na+ concentration to 277 mM

did not intensify the depolarising effect of CsTx-1.

However, a ten-fold elevation of Ca2+

from 0.6 to

6 mM in the bathing solution substantially damped

the depolarising effect of CsTx-1. Interestingly, an

unspecific blockade of Ca2+

channels by 5 mM

Co2+

diminished the depolarizing effect of CsTx-1

(Fig. 4d). After replacement of Na+ (172 mM)

with sucrose the depolarising effect was very

small. In contrast, CsTx-1 induced a strong

depolarisation in the presence of NMDG alone

(Fig. 4B). A clear drop of the cell input resistance

was observed in the presence of Na+ or NMDG

alone, when compared with the input resistance in

the presence of sucrose (Fig. 4c).

Effects of CsTx-1 on Xenopus Oocyte Plasma

Membranes — We investigated possible effects of

these peptides on the permeability of Xenopus

oocytes. The membrane potential was maintained

at -80 mV and the oocytes exposed to different

concentrations of CsTx-1. Submicromolar

concentrations (0.05-0.5 µM) induce ion currents

amounting to 8-32 µA (Fig. 5a). The current

showed a variability of up to 10-fold in amplitude

and often a lag phase of 10-60 sec upon exposure

to CsTx-1. Furthermore, we analysed the effect of

pH and divalent cations on the membrane

permeability induced by CsTx-1 (0.5 µM).

Decreasing the pH of pH 7.4 to pH 6.4 was

without significant effect. In contrast, at pH 8.4

the conductance induced by CsTx-1 amounted to

only about 30% of that at pH 7.4.

6

To exclude a contribution of the endogenous

Ca2+

activated Cl-channel to the conductance

increase, experiments in Ca2+

free medium

(medium 6, online resource 1) were performed. It

should be noted that the concentration of Ca2+

in

the medium is crucial for the size of the induced

permeability increase (Table 4). Decreasing the

Ca2+

concentration from 1 mM (medium 1, online

resource 1) to below 10-9

M (medium 6, online

resource 1) resulted in an about 5 to 10-fold

enhancement of the permeability increase induced

by CsTx-1 in spite of the presence of 5 mM of the

divalent cation Mg2+

. In a medium containing 40

mM of the divalent cation Ba2+

(medium 5, online

resource 1), 0.5 µM CsTx-1 failed to increase the

membrane permeability.

To determine the relative permeability of

different ions, current induced by continuous

voltage ramps from -80 to +80 mV were

monitored in the absence and presence of 0.5 µM

CsTx-1 (Fig. 6). Such experiments were repeated

in media of different ion compositions (not shown)

and reversal potentials (Er) were determined

(Table 4). From these values, relative ion

permeabilities were determined using the

Goldman-Hodking-Katz (GHK) voltage equation

(32). The following relative permeabilities were

found: Cl- (1) >K

+(0.8) >Na

+(0.7) >Choline

+ (0.6)

>methansulfonate- (0.2) and small anions are

preferred to cations.

Identification of the Domain of CsTx-1

Responsible for the Permeability Increase —

Several fragments of CsTx-1 were used for this

purpose. Applying CsTx-2a and CT1-short alone

at a concentration of 0.5 µM or 5 µM to oocytes,

did not induce a permeability increase.

Additionally, a combination of CsTx-2a and CT1-

short at a concentration of 1 µM or 5 µM did not

increase the oocyte membrane permeability.

Remarkably, 5 µM CT1-long induced an increase

in membrane permeability (Fig. 5b).

DISCUSSION

Insecticidal and Antimicrobial Activity of

CsTx-1 and CT1-long — The inhibitory activity of

CsTx-1 toward L-type Ca2+

channels in

mammalian neurons, as well as on mid/low and

high-voltage-activated Ca2+

channels in cockroach

neurons clearly define the neurotoxic activity of

CsTx-1 (16). This insecticidal activity is strongly

dependent on the intact structure of CsTx-1 (Table

2) and the last 14 or 13 C-terminal amino acids

(CT1-short) have been postulated to be important

for the toxicity (10,17). The cationic C-terminal

part of CsTx-1 could act as an anchor and the

inhibition of ion channels could be the result of a

direct contact of the ICK containing structure of

CsTx-1 with the target ion channel. In the same

way, an interaction of CsTx-1 with the ion channel

surrounding lipid layer is also thinkable. Such a

case could be shown for GsMTx4, a specific

inhibitor for pro- and eukaryotic stretch-activated

mechanosensitive channels acting via bilayer

tension (33,34). The neurotoxic activity of the ICK

structure of CsTx-1 is than further synergistically

assisted by the pore-forming activity of the

peptides’ C-terminal α-helical part.

Several biological activities of CT1-long

support the proposed combined acting mechanism.

The insecticidal activity of CT1-long and CsTx-2a

are comparable, whereas CT1-long is only about

threefold less active when compared with the

cytolytic peptide cupiennin 1a (Table 2).

Especially for CsTx-1 and CT1-long, the

bactericidal activity depends strongly on the

lipopolysaccharide (LPS) chain length which is

connected to the outer membrane of Gram

negative bacteria. In contrast to E. coli ATCC

22592 which was not susceptible below 250 µM

towards CsTx-1 and CT1-long, the E. coli mutant

SBS 363 exhibits a high susceptibility. CsTx-1

was only three-fold less bactericidal than CT1-

long. Access to the negatively charged

phospholipids of the outer membrane is more

pronounced towards shorter LPS chains in the case

of E. coli SBS 363 (35).When compared with the

bactericidal activity of cupiennin 1a, CT1-long is

15-fold- and CsTx-1 50-fold less active.

Differences in the activity towards Gram negative

and Gram positive bacteria may reflect different

access to negatively charged membrane structures

due to peptide size and its amphipathic domain.

Target Specific or Broad Cytolytic Effects on

Excitable Membrane Systems? — CsTx-1 causes

irreversible and concentration dependent

depolarisation of fly larvae or frog muscle fibres

resulting in fly larvae muscle contractions and

subsequent damage of the fibres. However,

spontaneous and nerve evoked postsynaptic

currents of fly larvae muscle fibres were

unaffected. To elucidate more in detail a proposed

membranolytic effect of CsTx-1, voltage clamp

experiments revealed that after CsTx-1 application

7

the transmembrane current increased with a

simultaneous drop of the cell input resistance

which was also measured, when Na+ was

substituted by NMDG. In contrast, when Na+ was

substituted by sucrose, no depolarisation was

measured. Thus, we have reliable evidence that

CsTx-1 increases unspecifically the permeability

of a membrane for ions because the rather large

organic cation NMDG becomes able to enter a

cell. These findings are similar to the results of

Vassilevski and coworkers concerning CpTx-1

which also increased the membrane permeability

of frog muscle fibres in a comparable manner (14).

A reduced depolarisation effect caused by

increasing Ca2+

or Co2+

ion concentrations maybe

explained by occupying negatively charged

membrane structures which prevent an attraction

of the cationic C-terminus of CsTx-1 and possibly

the induction of the α–helix. Thus, positively

charged divalent cations seem to protect the

membrane from the toxin.

Function of the C-Terminal α–Helical Part of

CsTx-1 — Similar as shown above for excitable

membranes, CsTx-1 also increases the

permeability of Xenopus oocyte plasma

membranes. No permeability increase was

detected when administering CsTx-2a, CT1-short

or the combination of CsTx-2a and CT1-short.

This confirmed previously performed insect

bioassays which clearly demonstrated that CT1-

short has to be covalently linked to CsTx-2a to

cause toxicity (17). Remarkably, CT1-long alone

induces membrane permeability even though

about a ten-fold higher concentration than CsTx-1

is needed. These results and the above mentioned

CD-measurements of CsTx-1, CsTx-2a, CT1-long

and CT1-short confirm our hypothesis that without

the last 13 C-terminal cationic amino acids no

helix formation is possible. Depending on

membrane access and structure, CsTx-1 seems to

be more successful in increasing the membrane

permeability of oocyte membranes whereas CT1-

long is more successful in E. coli SBS 363.

To exclude a contribution of the endogenous

Ca2+

activated Cl- channel to conductance increase,

experiments in Ca2+

free medium (medium 6,

online resource 1) were performed. Under Ca2+

free conditions, this channel is not activated.

Interestingly, the permeability increase was even

larger in this medium as compared to the medium

containing 1mM Ca2+

. In medium containing large

concentration of the divalent cation Ba2+

(medium

5, online resource 1), the effect of CsTx-1 was

completely blocked which is similar to the

findings described for fly larvae muscle fibres. An

exception is Mg2+

that was present at 5 mM in the

Ca2+

free medium. The permeability increase for

monovalent ions induced by CsTx-1 has relatively

low ion selectivity, but small anions are preferred

over cations.

Secondary Structure of the C-Terminal α-

Helical Part of CsTx-1 — Secondary structure

predictions (http://www.expasy.ch/tools/, (30))

reveal an α-helical structure for the C-terminal part

of CsTx-1 from Ala 52 to Lys 65 (Fig. 3a,c). The

adjoining highly cationic section seems to be a

more random coiled structure. Likewise, we could

show by CD-measurements, that α-helical

structures are formed in CsTx-1 and CT1-long

after addition of 50% TFE. In contrast, no α-

helical structures were detectable in CsTx-2a and

CT1-short after administration of 50% TFE (Fig.

2) which shows the important role of the Gly 62 to

Lys 69 segment in helix formation induction of

CsTx-1 (Fig. 3b,c). These results point to a dual

role for the cationic C-terminus of CsTx-1: first,

the attraction of CsTx-1 at negatively charged

membranes by the cluster of Lys 67, 68, 69, 71,

72, 74 and second, simultaneously inducing the

formation of an α-helical structure. The

hydrophobic face which builds an amphipathic

structure is defined mainly by the α -helical

structure derived from Met 48, Gly 49, Ala 52, Ile

53, Gly 56, Leu 57, Ile 59, Phe 60, Leu 63, and

Phe 64 (Fig. 3b,c), as predicted by HELIQUEST

(36).

Importance of a Correct Transcription and

Translation of CsTx-1 — About 1,000

neurotoxically or cytolytically acting peptides

have been described from different spider venoms,

but up to now CsTx-1 seems to be unique

concerning its highly charged C-terminal part (3).

Surprisingly, neither in the venom nor in the

cDNA library of C. salei further related peptides

with such a highly cationic C-terminal part have

been identified. CsTx-1 is the prominent and most

insecticidal acting neurotoxin in this venom,

responsible for the main part of venom toxicity

(10,13).

It seems that the C-terminal α-helical part of

CsTx-1 is evolutionary optimised: we did not

detect mutations in its C-terminal part, probably

because already small changes within the amino

acid sequence result in a dramatical loss of the

8

cytolytic and neurotoxic activities, as

demonstrated by the cases of CsTx-2a and CsTx-

2b (17).

Structurally Similar Venomous Peptides —

BLASTn and BLASTp results as well as ClustalW

2.1 sequence alignments of CsTx-1 exhibit only

for CsTx-9, a further neurotoxically acting peptide

from C. salei, 52 % sequence similarity (10).

Remarkably, the toxin-like structure LsTx-A53

[UniprotKB B6DCP2], identified in a cDNA

library of Lycosa singoriensis (6), exhibits also 53

% sequence similarity. However, both peptides do

not possess such a highly cationic C-terminal part

as CsTx-1.

CpTx 1a, a large two-domain modular protein

(15.1 kDa, [UniprotKB D5GSJ8]) is composed of

two similar modules, both exhibiting the putative

inhibitory cysteine knot (ICK) motif and an

additional C-terminal putative α-helical part (14).

The second module of this peptide (amino acid

residues 65-134) exhibits similarity of only 37 %

with CsTx-1 (Fig. 3a). Nevertheless, the protein

exhibits a secondary structure, insecticidal and

cytolytic properties comparable to CsTx-1.

Though we know only few examples of

modular or two-domain containing neurotoxic

acting peptides from spider venoms (14,37,38),

they were also found in some scorpion venoms

(39,40). Scorpine, isolated from the venom of

Pandinus imperator, exhibits an α-helical N-

terminal domain and a cysteine-stabilized α/β (CS-

αβ) motif located in the C-terminal part. The N-

terminal part itself exhibits antimicrobial activity

as verified for a synthetic peptide based on this

sequence (40). The multifunctional family of the

β-KTx polypeptides identified in venoms from

different scorpions are further such two-domain

peptides. They consist of 45-68 amino acids and

contain three disulfide bridges. The putative α-

helical N-terminal part is followed by the C-

terminal region, which is structured according to

the CS-αβ motif (41). Different members of this

family exhibit both activities: cytolytic in the N-

terminal part and Kv-channel blocking in the C-

terminal part (41,42).

Conclusions — The discovery of cytolytic

activity and its localisation in the C-terminal part

of CsTx-1, in addition to its L-type Ca2+

channel

inhibitory effect, highlights the evolutionary trend

to combine two venomous functions in one

compound: ion channel inhibitor and

membranolytic activity. This trend is not new or

restricted to spiders, since the older arachnid group

of scorpions also give some examples, as

previously assumed (41-43). The strategy of

spiders, to combine different venom compounds to

enhance synergistically the toxicity of single

compounds is evolutionarily optimized in the case

of CsTx-1 and CpTx 1a (3,14) with a proposed

synergistic interaction even within one peptide.

Such mechanisms probably enable spiders to

subdue a broader range of prey even if some of

them do not express specific ion channels which

are targeted by these spider neurotoxins. At the

same time this mechanism will impede the

development of resistance to a single venom

compound. If the combination of two venomous

functions in one compound is an evolutionary

fascinating strategy, one may ask why no more

examples are known. This may be due to the still

limited knowledge of spider toxins and their

functions, so, we encourage focusing specifically

on such dual function peptides in the future

research.

Acknowledgements — We thank the Swiss National Science Foundation (grants 310030_127500 and

31003A-113681) for funding. The work was further supported by a grant from the Russian Academy of

Science "Molecular and cell biology" and a grant by the Ministry of Education and Science of the

Russian Federation (State contract n.16.512.11.2197). We are grateful to Dr. D. Destoumieux-Garzón-for

the provided E. coli SBS 363 strain. Special thanks to Prof. E. Grishin and Dr. A. Vassilevski (Shemyakin

& Ovchinnikov Institute, Moscow) for helpful exchange of views and to Prof. J. Tytgat (University of

Leuven) who hypothesized ten years ago a possible cytolytic activity of CsTx-1.

REFERENCES

1. Selden, P. A., Shear, W. A., and Sutton, M. D. (2008) Fossil evidence for the origin of spider

spinnerets, and a proposed arachnid order. Proc. Natl. Acad. Sci. U.S.A. 105, 20781-20785

9

2. Platnick, N. I. (2011) The world spider catalog, version 11.5. online at

http://research.amnh.org/entomology/spiders/catalog/index.html.

3. Kuhn-Nentwig, L., Stöcklin, R., and Nentwig, W. (2011) Venom composition and strategies in

spiders: is everything possible? Adv. Insect Physiol. 40, 1-86

4. Xu, K., Ji, Y., and Qu, X. (1989) Purification and characterization of an antibacterial peptide

from venom of Lycosa singoriensis. Acta Zool. Sin. 35, 300-305

5. Budnik, B. A., Olsen, J. V., Egorov, T. A., Anisimova, V. E., Galkina, T. G., Musolyamov, A. K.,

Grishin, E. V., and Zubarev, R. A. (2004) De novo sequencing of antimicrobial peptides isolated

from the venom glands of the wolf spider Lycosa singoriensis. J. Mass Spectrom. 39, 193-201

6. Zhang, Y., Chen, J., Tang, X., Wang, F., Jiang, L., Xiong, X., Wang, M., Rong, M., Liu, Z., and

Liang, S. (2010) Transcriptome analysis of the venom glands of the Chinese wolf spider Lycosa

singoriensis. Zoology (Jena) 113, 10-18

7. Villegas, E., Adachi-Akahane, S., Bosmans, F., Tytgat, J., Nakajima, T., and Corzo, G. (2008)

Biochemical characterization of cysteine-rich peptides from Oxyopes sp. venom that block

calcium ion channels. Toxicon 52, 228-236

8. Corzo, G., Villegas, E., Gomez-Lagunas, F., Possani, L. D., Belokoneva, O. S., and Nakajima, T.

(2002) Oxyopinins, large amphipathic peptides isolated from the venom of the wolf spider

Oxyopes kitabensis with cytolytic properties and positive insecticidal cooperativity with spider

neurotoxins. J. Biol. Chem. 277, 23627-23637

9. Dubovskii, P. V., Vassilevski, A. A., Samsonova, O. V., Egorova, N. S., Kozlov, S. A., Feofanov,

A. V., Arseniev, A. S., and Grishin, E. V. (2011) Novel lynx spider toxin shares common

molecular architecture with defense peptides from frog skin. FEBS J. 278, 4382-4393

10. Kuhn-Nentwig, L., Schaller, J., and Nentwig, W. (2004) Biochemistry, toxicology and ecology of

the venom of the spider Cupiennius salei (Ctenidae). Toxicon 43, 543-553

11. Kuhn-Nentwig, L., Trachsel, C., Nentwig, W. (2009) Spider venom and hemolymph-derived

cytolytic and antimicrobial peptides. in Bioactive Peptides (Howl, J., Jones, S. ed.), CRC Press,

Taylor & Francis Group, Boca Raton. pp 447-464

12. Wullschleger, B., Kuhn-Nentwig, L., Tromp, J., Kämpfer, U., Schaller, J., Schürch, S., and

Nentwig, W. (2004) CSTX-13, a highly synergistically acting two-chain neurotoxic enhancer in

the venom of the spider Cupiennius salei (Ctenidae). Proc. Natl. Acad. Sci. U.S.A. 101, 11251-

11256

13. Wullschleger, B., Nentwig, W., and Kuhn-Nentwig, L. (2005) Spider venom: enhancement of

venom efficacy mediated by different synergistic strategies in Cupiennius salei. J. Exp. Biol. 208,

2115-2121

14. Vassilevski, A. A., Fedorova, I. M., Maleeva, E. E., Korolkova, Y. V., Efimova, S. S.,

Samsonova, O. V., Schagina, L. V., Feofanov, A. V., Magazanik, L. G., and Grishin, E. V. (2010)

Novel class of spider toxin: active principle from the yellow sac spider Cheiracanthium

punctorium venom is a unique two-domain polypeptide. J. Biol. Chem. 285, 32293-32302

15. Kuhn-Nentwig, L., Schaller, J., and Nentwig, W. (1994) Purification of toxic peptides and the

amino acid sequence of CSTX-1 from the multicomponent venom of Cupiennius salei

(Araneae:Ctenidae). Toxicon 32, 287-302

16. Kubista, H., Mafra, R. A., Chong, Y., Nicholson, G. M., Beirao, P. S., Cruz, J. S., Boehm, S.,

Nentwig, W., and Kuhn-Nentwig, L. (2007) CSTX-1, a toxin from the venom of the hunting

spider Cupiennius salei, is a selective blocker of L-type calcium channels in mammalian neurons.

Neuropharmacology 52, 1650-1662

17. Kuhn-Nentwig, L., Schaller, J., Kämpfer, U., Imboden, H., Malli, H., and Nentwig, W. (2000) A

lysine rich C-terminal tail is directly involved in the toxicity of CSTX-1, a neurotoxic peptide

from the venom of the spider Cupiennius salei. Arch. Insect Biochem. Physiol. 44, 101-111

10

18. Sreerama, N., and Woody, R. W. (2000) Estimation of protein secondary structure from circular

dichroism spectra: comparison of CONTIN, SELCON, and CDSSTR methods with an expanded

reference set. Anal. Biochem. 287, 252-260

19. Whitmore, L., and Wallace, B. A. (2004) DICHROWEB, an online server for protein secondary

structure analyses from circular dichroism spectroscopic data. Nucleic Acids Res 32, W668-673

20. Whitmore, L., and Wallace, B. A. (2008) Protein secondary structure analyses from circular

dichroism spectroscopy: methods and reference databases. Biopolymers 89, 392-400

21. Kuhn-Nentwig, L., Willems, J., Seebeck, T., Shalaby, T., Kaiser, M., and Nentwig, W. (2011)

Cupiennin 1a exhibits a remarkably broad, non-stereospecific cytolytic activity on bacteria,

protozoan parasites, insects, and human cancer cells. Amino Acids 40, 69-76

22. Fedorova, I. M., Magazanik, L. G., and Tikhonov, D. B. (2009) Characterization of ionotropic

glutamate receptors in insect neuro-muscular junction. Comp. Biochem. Physiol. C Toxicol.

Pharmacol. 149, 275-280

23. Magazanik, L. G., Fedorova, I. M., Kovalevskaya, G. I., Pashkov, V. N., Bulgakov, O. V., and

Grishin, E. V. (1992) Selective presynaptic insectotoxin (alpha-latroinsectotoxin) isolated from

black widow spider venom. Neuroscience 46, 181-188

24. Sigel, E. (1987) Properties of single sodium channels translated by Xenopus oocytes after

injection with messenger ribonucleic acid. J. Physiol. (Lond.) 386, 73 -90

25. Baur, R., and Sigel, E. (2007) Replacement of histidine in position 105 in the α5 subunit by

cysteine stimulates zolpidem sensitivity of α5β2γ2 GABAA receptors. J. Neurochem. 103, 2556-

2564

26. Kozlov, S. A., and Grishin, E. V. (2007) The universal algorithm of maturation for secretory and

excretory protein precursors. Toxicon 49, 721-726

27. Eipper, B. A., Milgram, S. L., Husten, E. J., Yun, H. Y., and Mains, R. E. (1993) Peptidylglycine

alpha-amidating monooxygenase: a multifunctional protein with catalytic, processing, and routing

domains. Protein Sci. 2, 489-497

28. Trachsel, C. (2010) Biochemical analysis and recombinant expression of venom components of

the Central American hunting spider Cupiennius salei. PhD thesis, University of Bern,

Switzerland

29. Lehrman, S. R., Tuls, J. L., and Lund, M. (1990) Peptide alpha-helicity in aqueous

trifluoroethanol: correlations with predicted alpha-helicity and the secondary structure of the

corresponding regions of bovine growth hormone. Biochemistry 29, 5590-5596

30. Garnier, J., Gibrat, J. F., and Robson, B. (1996) GOR method for predicting protein secondary

structure from amino acid sequence. Methods Enzymol. 266, 540-553

31. Wang, Z., Wong, N. C., Cheng, Y., Kehl, S. J., and Fedida, D. (2009) Control of voltage-gated K+

channel permeability to NMDG+ by a residue at the outer pore. J. Gen. Physiol. 133, 361-374

32. Hille, B. (2001 ) Ionic Channels of Excitable Membranes (third edition), Sinauer Associates,

Sunderland, MA

33. Hurst, A. C., Gottlieb, P. A., and Martinac, B. (2009) Concentration dependent effect of GsMTx4

on mechanosensitive channels of small conductance in E. coli spheroplasts. Eur. Biophys. J. 38,

415-425

34. Nishizawa, M., and Nishizawa, K. (2007) Molecular dynamics simulations of a stretch-activated

channel inhibitor GsMTx4 with lipid membranes: two binding modes and effects of lipid

structure. Biophys. J. 92, 4233-4243

35. Gonzalez, M., Gueguen, Y., Destoumieux-Garzon, D., Romestand, B., Fievet, J., Pugniere, M.,

Roquet, F., Escoubas, J. M., Vandenbulcke, F., Levy, O., Saune, L., Bulet, P., and Bachere, E.

(2007) Evidence of a bactericidal permeability increasing protein in an invertebrate, the

Crassostrea gigas Cg-BPI. Proc. Natl. Acad. Sci. U.S.A. 104, 17759-17764

36. Gautier, R., Douguet, D., Antonny, B., and Drin, G. (2008) HELIQUEST: a web server to screen

sequences with specific alpha-helical properties. Bioinformatics 24, 2101-2102

11

37. Bohlen, C. J., Priel, A., Zhou, S., King, D., Siemens, J., and Julius, D. (2010) A bivalent tarantula

toxin activates the capsaicin receptor, TRPV1, by targeting the outer pore domain. Cell 141, 834-

845

38. Vassilevski, A. A., Kozlov, S. A., Samsonova, O. V., Egorova, N. S., Karpunin, D. V.,

Pluzhnikov, K. A., Feofanov, A. V., and Grishin, E. V. (2008) Cyto-insectotoxins, a novel class

of cytolytic and insecticidal peptides from spider venom. Biochem. J. 411, 687-696

39. Zhu, S., and Tytgat, J. (2004) The scorpine family of defensins: gene structure, alternative

polyadenylation and fold recognition. Cell. Mol. Life Sci. 61, 1751-1763

40. Conde, R., Zamudio, F. Z., Rodriguez, M. H., and Possani, L. D. (2000) Scorpine, an anti-malaria

and anti-bacterial agent purified from scorpion venom. FEBS Lett. 471, 165-168

41. Diego-Garcia, E., Abdel-Mottaleb, Y., Schwartz, E. F., de la Vega, R. C., Tytgat, J., and Possani,

L. D. (2008) Cytolytic and K+ channel blocking activities of -KTx and scorpine-like peptides

purified from scorpion venoms. Cell. Mol. Life Sci. 65, 187-200

42. Diego-Garcia, E., Schwartz, E. F., D'Suze, G., Gonzalez, S. A. R., Batista, C. V. F., Garcia, B. I.,

de la Vega, R. C. R., and Possani, L. D. (2007) Wide phylogenetic distribution of scorpine and

long-chain -KTx-like peptides in scorpion venoms: Identification of "orphan" components.

Peptides 28, 31-37

43. Zhu, S., Gao, B., Aumelas, A., del Carmen Rodriguez, M., Lanz-Mendoza, H., Peigneur, S.,

Diego-Garcia, E., Martin-Eauclaire, M. F., Tytgat, J., and Possani, L. D. (2010) MeuTXK1, a

scorpion venom-derived two-domain potassium channel toxin-like peptide with cytolytic activity.

Biochim. Biophys. Acta 1804, 872-883

44. DeLano, W. L. (2002) The PyMOL molecular graphics system, available at http://pymol.org,

2002

Figure Legends

FIGURE 1. cDNA sequence encoding the prepropeptide of CsTx-1. The deduced amino acid

sequence is presented below the nucleotide sequence. The signal peptide is in bold, the prosequence is in

italics and the mature peptide sequence is in bold and underlined. The asterisks mark the stop codon. The

blackish boxed nucleotides indicate silent mutations as described in the text. The dark grey underlined

part of the sequence corresponds to CT1-short. The grey and dark grey underlined part of the sequence

corresponds to CT1-long.

FIGURE 2. CD spectra of CsTx-1, CsTx-2a, CT1-long, and CT1-short. CD characteristics of

CsTx-1, CsTx-2a, CT1-long, and CT1-short (C= 4 x 10-5 M) in buffer (5 mM sodium phosphate, 150

mM sodium fluoride, pH 7.2) (____) and in 5 mM sodium phosphate, 150 mM sodium fluoride, pH 7.2,

50% TFE (----). Θ is the mean residue ellipticity. Error bars, SD; every 10 nm.

FIGURE 3. Amino acid sequence of CsTx-1, CsTx-2a, CsTx-2b, CT1-short, CT1-long and CpTx

1a. (a) Disulfide bridges forming the ICK motif are represented by lines and the corresponding cysteine

residues are within black boxes. Basic amino acids are within grey boxes and the predicted α-helical parts

(30) of CsTx-1, CT1-long and CpTx 1a (only amino acid residues 65-134) are in italics within boxes.

Asterisks mark an amidated C-terminus. (b) Helical wheel projection of the proposed C-terminal α-helical

part of CsTx-1 (Met48-Lys65). Blue and red circles correspond to charged amino acids; rose and

interrupted circles to polar amino acids. (c) Modelling of the C-terminal part of CsTx-1. The colours

correspond to (b). The figure was produced with PyMOL (44).

12

FIGURE 4. Toxic effects of CsTx-1 (100 nM) on Drosophila muscle fibres in the presence of

different media. (a) Effect of CsTx-1 on input resistance and inward current recorded from C. vicina

larvae muscle cells. Normalized averaged resistance values (black squares, n = 7) and current values

(white squares, n = 8). (b) Effect of CsTx-1 on the resting membrane potential or membrane resistance (c)

of C. vicina larvae muscle cells dependent on the bathing solution: Na+ (172 mM, black squares, n = 5 / n

= 6); 95 % sucrose in place of Na+ (white triangles, n = 4 / n = 3); 95% NMDG in place of Na

+ (white

squares, n = 8 / n = 8). Values are given in all experiments as mean ± SE. (d) Effect of 100 nM CsTx-1 at

0.6 mM and 6.0 mM Ca2+

, at 0.6 mM Ca2+

and 5 mM Co2+

. C – control, Tx30’, 60’ min exposition.

FIGURE 5. Effects of CsTx-1 and CT1-long on Xenopus oocytes. The membrane potential of a

denuded Xenopus oocyte in medium 1 was adjusted to -80 mV using the 2-electrode voltage clamp. The

oocyte was exposed to 0.5 µM CsTx-1 (a) or 5 µM CT1-long (b) and after a short lag-phase an inward

current amounting to several µA gradually developed.

FIGURE 6. Influence of CsTx-1 on the membrane permeability of Xenopus oocytes. Instantaneous

current voltage curves were recorded in medium 1 (online resource 1) before and after exposure of an

oocyte to 0.5 µM CsTx-1. The reversal potential was determined as -12 mV.

13

Tables

TABLE 1

Estimation of secondary structure of CsTx-1, CsTx-2a, CT1-long, and CT1-short by circular

dichroism

Secondary structure content (%)

Peptides

in solution α-helix β-sheet turns unordered total NRMSD

§

CsTx-1 PBS* 2 38 18 40 98 0.083

CsTx-1 TFE# 42 19 21 18 99 0.022

CsTx-2a PBS 2 41 19 37 98 0.086

CsTx-2a TFE 8 36 22 35 100 0.074

CT1-long PBS 1 28 23 48 99 0.019

CT1-long TFE 66 16 7 11 100 0.005

CT1-short PBS -2 30 21 49 97 0.010

CT1-short TFE 2 31 22 45 99 0.023

*PBS: 5 mM sodium phosphate, 150 mM sodium fluoride, pH 7.2 #TFE:

5 mM sodium phosphate, 150 mM sodium fluoride, pH 7.2, 50% trifluoroethanol

§NRMSD: normalized root mean square deviation, calculated by DICHROWEB server / CDSSTR,

reference set 1 (19,20)

TABLE 2

Biological activities of CsTx-1, CsTx-2a, CsTx-2b, CT1-long, and CT1-short

Peptide LD50 pmol/mg

Drosophila

EC50 (µM)

Trypanosoma

brucei brucei

MiTat1.2(221)a

MIC (µM)

E. coli S. aureus

SBS 363b ATCC 29213

c

CsTx-1 0.35 n.d. 15.63-31.25 > 250

CsTx-2a 2.58 n.d. n.d. n.d.

CsTx-2b 66.51 n.d. n.d. n.d.

CT1-long 82.64 5.01 4.66-9.32 > 149*

CT1-short > 500 > 40 > 250 > 250

Cu1a 24.4d 0.120

e 0.313-0.625 0.157-0.313

a 1x10

4 cells/ml;

b 6.9x10

2 cfu/ml;

c 2.7x10

3 cfu/ml;

d [41],

e [26]

* the growth of S. aureus is four-fold reduced when compared with the control group without peptide

14

TABLE 3

CsTx-1 causes a concentration dependent irreversible decrease of the resting membrane potential

(MP) of fly and frog muscle fibres

CsTx-1 (nM) MP (mV)

control

MP (mV)

30 min

MP (mV)

60 min

Calliphora vicina

50 -70.0 ± 4.8 (3) -72.0 ± 1.9 (4) -68.4 ± 4.7 (3)

100 -66.3 ± 1.5 (27) -47.0 ±1.5 (28)** -42.0 ± 2.2 (3)**

300 -60.3 ± 1.7 (7) -25.2 ± 4.0 (7)** -20.7 ± 1.7 (4)**

Rana temporaria

100 -80.0 ± 3.2 (3) -80.6 ± 2.0 (3) -77.1 ± 1.5 (3)

300 -84.5 +-2.9 (4) -57.2+-9.2 (4)* -46.8 ± 12 (4)*

900 -84.4 ± 1.6 (3) -64.1 ± 1.6 (3)** -59.0 ± 7.0 (3)*

The numbers of experiments are given in brackets (n)

Significances are given as:*p ≤ 0.05, **p ≤ 0.01

TABLE 4

Reversal potential and conductance of CsTx-1 in different media

Medium CsTx-1

(µM)

Er

(mV)

Conductance

(µS)

M1 0.0 - 0.8-2

M1 0.5 -15 ± 1 10-40

M2 0.5 -11 ± 3 20-40

M3 0.05-0.5 -16 ± 6 40-60

M4 0.5 -2 ± 2 10-20

M5 0.5 n.d. 0.4-1.2

M6 0.05-0.1 -12 ± 2 10-30

15

Figures

FIGURE 1

1-

3-

63-

123-

183-

243-

303-

363-

423-

483-

GA

TTCATACAGAACTTTCTTGAGAAAGTTTAGACTGAGTGAGAGAGAAAGAATTTTCCCTCG

CTAATCATCATGAAAGTTCTCATTATCTCTGCTGTGCTCTTCATAACTATTTTCAGCAAC

M K V L I I S A V L F I T I F S N

ATTTCAGCTGAAATAGAAGATGATTTCTTGGAAGACGAAAGTTTTGAAGCTGAGGACATA

I S A E I E D D F L E D E S F E A E D I

ATACCTTTCTTTGAAAACGAACAAGCCAGAAGCTGCATTCCGAAGCACGAGGAATGTACC

I P F F E N E Q A R S C I P K H E E C T

AACGATAAACACAACTGCTGTAGGAAGGGCCTGTTCAAGTTGAAGTGCCAGTGCTCAACA

N D K H N C C R K G L F K L K C Q C S T

TTTGACGACGAAAGCGGACAGCCAACGGAAAGATGCGCCTGCGGAAGACCGATGGGCCAC

F D D E S G Q P T E R C A C G R P M G H

CAGGCTATTGAAACGGGCCTCAACATCTTCAGGGGTCTTTTTAAAGGGAAGAAGAAGAAT

Q A I E T G L N I F R G L F K G K K K N

AAGAAAACAAAGGGCTAAGAAATTTATTGGAATAGAGTGAATACAAGTCATTGGATCTTA

K K T K G ***

ATTATCTTTTATAATGTTTAATAAATTTTTCAGAAATAGTGAAAACCTTTACTTTGAAAA

- 2

- 62

-122

-182

-242

-302

-362

-422

-482

-542

16

FIGURE 2

17

FIGURE 3

18

FIGURE 4a

19

FIGURE 4b

20

FIGURE 4c

21

FIGURE 4d

22

FIGURE 5

23

FIGURE 6