Embed Size (px)
Citation preview
www.elsevier.com/locate/plantsci
Plant Science 172 (2007) 76–84
Antioxidative response of Mesembryanthemum crystallinum
plants to exogenous SO2 application
Ewa Surowka a,*, Piotr Karolewski b, Ewa Niewiadomska a,Marta Libik a, Zbigniew Miszalski a,c
a Polish Academy of Sciences, Institute of Plant Physiology, 30-239 Cracow, Niezapominajek 21, Polandb Polish Academy of Sciences, Institute of Dendrology, 62-035 Kornik, Parkowa 5, Poland
c Institute of Biology, Pedagogical Academy, Podbrzezie 3, 31-054 Krakow, Poland
Received 15 May 2006; received in revised form 21 July 2006; accepted 21 July 2006
Available online 24 August 2006
Abstract
The facultative halophyte, Mesembryanthemum crystallinum shifts its mode of carbon assimilation from the C3 pathway to crassulacean acid
metabolism (CAM) in response to many factors that lead to the generation of reactive oxygen species (ROS) at the cellular level. Reactive oxygen
species have been suggested to be involved in the initiation of CAM induction. In our experiment we would like to test whether the space/place of
ROS production could play a role in CAM induction. In the present studies we applied exogenously sulphur dioxide to M. crystallinum plants as an
oxidative stress factor that accumulates mainly in chloroplasts. On the basis of our data, one can suggest that oxidative stress in the cellular space,
mainly in chloroplasts, is not sufficient to induce functional CAM in M. crystallinum plants. The second aim was to evaluate the influence of SO2
fumigation/sulphite incubation on the activity and mRNA transcript level of SOD isoenzymes, especially FeSOD, that is pointed out as a one of the
first indicators correlating with the C3/CAM transformation. The data indicate that the activity of FeSOD and CuZnSOD isoforms increase under
SO2/sulphite stress, despite of no induction of functional CAM. The increase of the activity level both of these enzymes were not accompanied by
the induction of their mRNA transcript levels, suggesting a post-transcriptional regulation of activity of these enzymes. The pattern of FeSOD and
CuZnSOD induction suggests that CuZnSOD might take over the role of FeSOD in conditions of severe oxidative stresses. The induction of
CuZnSOD is probably due to the action of sulphite per se.
# 2006 Elsevier Ireland Ltd. All rights reserved.
Keywords: Crassulacean acid metabolism; Superoxide dismutase; Reactive oxygen species; Sulphur dioxide
1. Introduction
Exposure of plants to many environmental stress factors
leads to oxidative stress characterized by the generation of
reactive oxygen species (ROS), such as O2�� (superoxide), OH�
(hydroxyl radical) and H2O2 (hydrogen peroxide) in plant
tissues [1].
Sulphur dioxide is a well-known widespread air pollutant.
From the atmosphere, it can easily penetrate, especially in the
light, into chloroplasts, which are the main place of action of
sulphite ions [2,3]. In the cell, sulphite and/or bisulphite ions
(HSO3� and SO3
2�) lead to an increase of the levels of ROS
including O2�� and H2O2 [4–6]. The detoxification in the
* Corresponding author. Tel.: +48 12 425 18 33; fax: +48 12 425 18 44.
E-mail address: [email protected] (E. Surowka).
0168-9452/$ – see front matter # 2006 Elsevier Ireland Ltd. All rights reserved.
doi:10.1016/j.plantsci.2006.07.018
apoplast of sulphite and bisulphite ions, which might proceed
by a radical chain reaction, is slow. Its rate depends on the rate
of apoplastic hydrogen peroxide generation, ascorbate presence
and on the steady-state apoplastic concentration of phenolics
and sulphite [7]. The toxicity of SO2 may also be alleviated by
antioxidative enzymes, such as superoxide dismutases (SODs
EC 1.15.1.1) [8], which are considered as the first line of
defence against oxygen toxicity [5,9]. In Mesembryanthemum
crystallinum, a C3/CAM intermediate plant, three main
isoforms of SODs were found in leaves: MnSOD in
mitochondria, FeSOD in chloroplasts and CuZnSOD putatively
in the cytoplasm [10,11]. Such subcellular compartmentation of
SOD forms enables compartment-specific responses of the
antioxidative response system to be evaluated simply by
measuring activities of the different SOD classes. Our previous
results show that one of the first indicators of the C3/CAM
transformation could be the distinct increase of FeSOD isoform
E. Surowka et al. / Plant Science 172 (2007) 76–84 77
activity which happen before the increase of the MnSOD and
CuZnSOD activity [11]. The mRNA increase of FeSOD
isoform during the C3/CAM shift was described by Slesak et al.
[19].
CAM-performing plants are characterized by nocturnal
accumulation of malate (day/night Dmalate difference) and
much higher activity of phosphoenolpyruvate carboxylase
(PEPCase) in comparison with C3 plants [12]. M. crystallinum
plants shift their metabolism from C3 photosynthesis to CAM
(crassulacean acid metabolism) with increasing age or in
response to factors which lead to osmotic stress at the cellular
level, such as: salinity, drought stress [11,13,14] and abscisic
acid (ABA) treatment [15]. Factors causing oxidative stress in
the plant tissue, such as: high light intensity [16–18] and
exogenously applied H2O2 [19] also cause CAM induction.
Stimulation of malate accumulation was also found in leaf discs
from obligate CAM plant Kalanchoe daigremontiana incu-
bated in the presence of sulphite during the light period [20].
Thus, it could be expected that the exposure to sulphite stress
can cause the C3/CAM shift in M. crystallinum. However, other
oxidative stress factor, such as ozone and ethylene [21,22] did
not induce CAM in M. crystallinum despite the induction of
CAM-related enzymes. However, it is not clear if oxidative
stress per se is involved in CAM induction and in which cell
compartment the signal for CAM induction is produced.
Broetto et al. [18] have shown that high light conditions and
NaCl presence act additively and affect mainly intracellular
compartments in M. crystallinum mesophyll cells. These
factors lead to an increase of ROS production and can affect
ethylene emission [23,24]. However, the main effect of NaCl
has been attributed to the toxicity of Na+ and Cl� ions [25].
NaCl can easily penetrate through the cell wall and
plasmalemma, while ozone acts in the extracellular space
and rapidly reacts with a range of compounds associated with
cell walls and membranes [26,27]. The exposure of plants to
ozone leads to the generation of O2�� as a prevailing ROS and
in some species additionally causes H2O2 accumulation (for
review see [28]). Similarly to high light and NaCl, ozone also
leads to the emission of ethylene [29,30].
The aim of the present study was to examine the hypotheses,
that a high level of ROS, in intracellular space, mainly in
chloroplasts, resulting from exogenously applied SO2 may
induce a functional CAM in M. crystallinum. The second aim
was to evaluate the influence of SO2/sulphite effect on the
activities of SOD in M. crystallinum plants. We try to
distinguish between the effects of acidification, the changes in
H2O2 level and sulphite action per se on the activity of SOD
forms.
2. Material and methods
2.1. Plant material, fumigation with SO2
The M. crystallinum L. (Aizoaceae) plants were grown in
soil culture in phytotron chambers, under 8/14 h photoperiod,
irradiance about 240–300 mmol m�2 s�1 (PAR range), tem-
perature 25/20 8C (day/night) and 60–70% RH. Plant about
4-week old (after appearance of third pair of leaves) were
transferred to the SO2 chambers (SO2: Analysis Model LD-
24, Ansyco GmbH, Germany). Plants were fumigated during
the light period with 1.0 ppm SO2 for 8 h/day (8:00 a.m.–
4:00 p.m.) for 7 days or with 6.0 ppm SO2 4 h/day for 8
days. For all biochemical determinations the second and
third leaves were taken at the end of the light period and
stored at �40 8C until further use. Each fumigation was
repeated two times and each measurement was done three
times.
2.2. Leaf discs experiment
Leaf discs (Ø12 mm) were cut from third pairs of M.
crystallinum leaves showing the C3 pathway of carbon fixation,
and 20 leaf discs were immediately an incubated at irradiance
of about 140 � 20 mmol m�2 s�1 (PAR range), for 30 min at
25 8C in 7.5 � 10�2 dm3 of buffer containing 0.5 mmol dm�3
sorbitol, 1.0 mmol dm�3 CaCl2, 100 mmol dm�3 Tricine and
Na2SO3 (20.0 mmol dm�3), at pH 8.0 in the light (TL’D 30 W/
54 Philips lamps, 140 � 20 mmol photons m�2 s�1). After
incubating leaf discs the following analyses were made:
estimation of the rate of SOD activity as well as the levels of
mRNA for FeSOD and CuZnSOD and measurement of H2O2
concentration.
2.3. The extraction and determination of soluble proteins
The extraction of soluble proteins was done in 100 mmol
dm�3 Tricine–Tris-buffer pH 8.0, containing 100 mmol dm�3
MgSO4, 1 mmol dm�3 dithiotreitol (DTT) and 3 mmol dm�3
EDTA. Leaves (1 g) were homogenized in 1.5 � 10�3 dm3 of
extraction buffer, and centrifuged for 2 min at 12,000 � g. The
whole procedure was carried out at 4 8C. The level of soluble
proteins was determined by the method described by Bradford
[31].
2.4. The evaluation of SOD activity
The activity of superoxide dismutase (SOD) was estimated by
the semi-quantitative method of polyacrylamide gel electro-
phoresis (PAGE), and staining of the native gel according to the
protocol previously described [11].
2.5. The influence of acidification, sulphite and H2O2 level
on SOD activity pattern
To determine the effect of pH on SOD activity pattern crude
extracts of M. crystallinum leaves were acidified with HCl and
incubated for 15 min at pHs of 2.0, 3.0, 4.0, 5.0, 6.0, 7.0 and 8.0,
activity of SODs isoforms was visualized on native poly-
acrylamide gels. The effect of sulphite on SOD activity pattern
was determined in crude extracts after incubation with
10 mmol dm�3 Na2SO3 for 15 min. To evaluate the effect of
H2O2 on SOD activity pattern, polyacrylamide gels were
stained in 0.05 and 0.20 mmol dm�3 of H2O2 according to the
protocol previously described [32].
E. Surowka et al. / Plant Science 172 (2007) 76–8478
2.6. Reverse transcriptase polymerase chain reaction (RT-
PCR) of FeSOD, CuZnSOD
The relative transcript levels for cytosolic and chloroplastic
SOD genes in leaves and the leaf discs of M. crystallinum were
evaluated by reverse transcription polymerase chain reaction
(RT-PCR). Relative quantitative RT-PCR was performed
according to the Intermedica Instruction Manual. Total RNA
(1 mg) was converted to the first strand of cDNA with random
primer mixture at 42 8C for 1 h using Superscript II RNAse H�
reverse transcriptase (BRL). RNA samples were treated with
DNAse I, RNAse-free (Boeringer, Mannheim) and control PCR
was run to check the absence of genomic DNA. 18S RNA was
used as an internal, constitutive control and was co-amplified
with specific primers in the same reaction vial. The number of
cycles (24–29), as chosen empirically to amplify the target and
the control cDNA in the linear range. cDNA sequences were
taken from TIGR (ice plant) GenBank database (http://tigr.org/
tdb/tdi/mcgi) (FeSOD, AW266633; CuZnSOD, U80069). The
following primers were designed: FeSOD-reverse TTTTACGG-
CATTGGGAGTCTTGA (amplified FeSOD fragment of
764 bp); CuZnSOD-forward ACGTCAAGGGTTCTCTCCAA;
CuZnSOD-reverse TCGCATTAAGCCTTTTCCAT (amplified
CuZnSOD fragment of 816 bp).
2.7. Malate content analysis
The malate concentration in cell sap was determined
according to the protocol previously described [33].
Fig. 1. Activities of different SOD forms (FeSOD and CuZnSOD) showing as the v
(SOD form) in control Mesembryanthemum crystallinum plants and in plants treate
loaded on each well of the gel. Enzyme activities were visualized on native polya
2.8. Spectrophotometric analysis of H2O2 content
The endogenous H2O2 level was investigated following the
modified procedure previously described by Brennan and
Frenkel [34]. Hydrogen peroxide was extracted by the
homogenization of 1 g of tissue in 2 � 10�3 dm3 of acetone.
After 5 min of centrifugation at 10,000 � g the supernatant was
collected. Titanium reagent (0.2 � 10�3 dm3 of 20% titanic
tetrachloride in concentrated HCl, v/v) was added to 2 �10�3 dm3 of the extract, followed by the addition of 0.4 �10�3 dm3 of NH4OH to precipitate the peroxide–titanium
complex. After 5 min of centrifugation at 12,000 � g, the
supernatant was discarded and the precipitate was washed
repeatedly with acetone, then the precipitate was dissolved in
2 � 10�3 dm3 of 2 mol dm�3 H2SO4, and brought to a final
volume of 2 � 10�3 dm3. Absorbance of the resulting solution
was read at 415 nm against a water blank. The concentration of
peroxide in the extract was determined by comparing the
absorbance against a standard curve representing the titanium–
H2O2 complex in the range from 0.05 to 0.3 mmol in
1.0 � 10�3 dm3.
2.9. Statistical analysis
A two-way ANOVA was used to test any significant effects
of SO2 or sulphite on M. crystallinum leaves. A one-way
ANOVA followed by a Duncan’s multiple range test was then
used to determine individual treatment effects at a P level of
0.05.
olume corresponding to the sum of intensities included inside the defined area
d for 7 days with 1.0 ppm SO2. Extracts with 20.0 mg of soluble protein were
crylamide gels.
E. Surowka et al. / Plant Science 172 (2007) 76–84 79
3. Results
Plants fumigated with 1.0 ppm SO2 over 7 days did not
present any necrotic spots at the end of the experiment, while
plants exposed to 6.0 ppm SO2 showed necrosis on the second
day of treatment.
To determine the effect of a high level of ROS, on the
metabolic state of M. crystallinum plants, we fumigated plants
with SO2. Induction of CAM metabolism was determined as day/
night differences in the cell sap malate concentration (Dmalate).
On the first day of fumigation plants with 1.0 ppm SO2 Dmalate
amounted to 0.61 � 0.03 and 0.64 � 0.06 mmol dm�3 in the
SO2 treated samples and control plants, respectively. Fumigation
with 1.0 ppm SO2 over 7 days resulted in a Dmalate 3.60 �0.12 mmol dm�3 in comparison to 1.85 � 0.12 mmol dm�3 in
the control at the same time.
Fig. 2. (a) Activities of FeSOD and CuZnSOD isoforms in control M. crystallinum
proteins were loaded with 20.0 mg protein on each well of the gel. Enzymes activities
of three repetitions. (b) Densitograms corresponding to the activities of FeSOD and
days with 6.0 ppm SO2. The volumes corresponding to the sum of intensities included
To investigate the level of oxidative stress in chloroplasts
and cytoplasma we measured the activities of the two SOD
isoforms (FeSOD and CuZnSOD, respectively) in extracts of
M. crystallinum leaves. The effect depended on the SO2
concentration and the duration of the experiment. When plants
were fumigated with 1.0 ppm SO2 for 7 days an initial increase
in FeSOD activity was observed and a continual increase in
CuZnSOD activity observed to day 7 (Fig. 1). Fumigation with
6.0 ppm SO2 caused increase in FeSOD activity over 2 days of
the experiment, though prolonged treatment (4–8 days) caused
a strong decline of its activity. In parallel, CuZnSOD activity
was strongly stimulated during the whole fumigation time
(Fig. 2a and b).
To evaluate the rate and level of FeSOD and CuZnSOD
isoforms induction, leaf discs from M. crystallinum leaves were
incubated in sulphite solution by only 30 min. This kind of
plants and in plants treated for 8 days with 6.0 ppm SO2. Extracts of soluble e
were visualized on native polyacrylamide gels. We showed the typical example
CuZnSOD isoforms in control M. crystallinum plants and in plants treated for 8
inside the defined area (of SOD isoforms) are presented under the densitograms.
E. Surowka et al. / Plant Science 172 (2007) 76–8480
Fig. 3. Native activity gel and the corresponding densitograms of FeSOD and CuZnSOD forms in extracts of soluble proteins from M. crystallinum leaf discs
incubated 00 and 300 in solution with 20.0 mmol dm�3 sulphite at pH 8.0 in the light. Control leaf discs were incubated without sulphite. The volumes corresponding to
the sum of intensities included inside the defined area (of SOD isoforms activity) are presented under the densitograms. The experiment was repeated two times.
Fig. 4. Expression of mRNA transcripts for FeSOD and CuZnSOD in leaf discs
from M. crystallinum. Leaf discs were incubated 00 and 300 in solution with
20.0 mmol dm�3 sulphite at pH 8.0 in the light. Control leaf discs were
incubated without sulphite. The experiment was repeated two times.
experimental approach enabled to control the sulphite
application to the tissue and to make the statistic repetitions
during the short time, and also (most important) to repeat the
experiment on the plant material in the same metabolic phase.
The metabolism of CAM plants changes during the day and
there are characterized by IV phases of CAM [35]. The C3/
CAM transformation is relatively quick (4–12 days) and it is
accompanied by daily CAM-related metabolic alterations
connected with, e.g. the activity of CAM-related enzymes,
Dmalate, and antioxidative enzymes induction. So, the
collection of samples, e.g. in different hours or days probably
caused the mistakes due to the metabolic alterations in plant
material.
The first step of this part of the experiment was a selection of
the experimental conditions that lead to alterations in the
activity of SOD pattern parallel to that observed in plant leaves
fumigated with 1.00 ppm SO2.
The activity of chloroplastic SOD forms in control leaf discs
incubated for 30 min at pH 8.0 in comparison to leaf discs
immediately after cutting showed a tendency to the increase,
while the activity of CuZnSOD was not changed during such
short time (Fig. 3). Treatment of leaf discs for 30 min with
20.0 mmol dm�3 sulphite caused a strong increase of FeSOD
and a tendency for an increase of CuZnSOD activities in
comparison with the control.
To determined the regulation of the two SOD isoforms
(FeSOD and CuZnSOD) in the presence of the increased ROS
level due to sulphite action, the relative transcript levels for
genes of these enzymes were evaluated. The RT-PCR analyses
showed that after 30 min of incubation of leaf discs in sulphite
solution the mRNA transcript levels for both FeSOD and
CuZnSOD were similar to the control (Fig. 4). Exposure of leaf
discs to sulphite in the light led to a significant increase of the
total H2O2 level in comparison with the control (Fig. 5).
To determine the effects of SO2—caused by pH decline,
crude extracts were acidified with HCl to pH 2.0, 3.0, 4.0, 5.0,
6.0, 7.0 and 8.0 for 30 min. In the pH range from 8.0 to 6.0 both
SOD forms (FeSOD and CuZnSOD) were well detectable on
native PAGE, as it was shown in Fig. 6. The sensitive SOD form
to acidification was CuZnSOD (visible on the gel down to pH
E. Surowka et al. / Plant Science 172 (2007) 76–84 81
Fig. 5. Concentration of H2O2 in extracts from M. crystallinum leaf discs
incubated 00 and 300 in 20.0 mmol dm�3 sulphite at pH 8.0 in the light. Control
leaf discs were incubated without sulphite. Bars represent the standard deviation
from three independent experiments (P � 0.05, Duncan test, homogenous
groups).
Fig. 6. (a) Activities of SODs forms (native PAGE) in extracts of soluble proteins fro
5.0, 6.0, 7.0 and 8.0. Control samples were not treated with HCl. The experiment was
and CuZnSOD isoforms in control samples and samples acidified with HCl. The volu
SOD isoforms) are presented under the densitograms.
6.0) and the resistant one was FeSOD (visible on the gel down
to pH 4.0).
As the effect of SO2 might also be mediated though the
formation of H2O2, extracts of soluble proteins were treated
with 0.05 and 0.2 mmol dm�3 of H2O2 at pH 8.0 for 30 min. In
the presence of 0.05 mmol dm�3 of H2O2, FeSOD activity was
similar to the control while CuZnSOD decreased more than
40%. The higher H2O2 concentration (0.2 mmol dm�3) caused
a reduction of FeSOD activity by about 26%, and CuZnSOD
activity about 42% (Fig. 7).
In order to avoid stomatal sulphite effects, this part of the
experiment was performed in vitro—the crude extracts were
treated with 10 mmol dm�3 sulphite at pH 8.0. The exposure of
crude extracts to 10 mmol dm�3 sulphite at pH 8.0 led to
increases of CuZnSOD by about 20% (Fig. 8).
4. Discussion
It can be hypothesised that ROS produced in the intracellular
space leads to functional CAM induction in M. crystallinum. In
this study, we used sulphur dioxide as an exogenously applied
oxidative stress factor accumulating mainly in chloroplasts
[2,3]. A signal transduction pathway for induction of some
m M. crystallinum leaves. Samples were acidified with HCl to pH 2.0, 3.0, 4.0,
repeated two times. (b) Densitograms corresponding to the activities of FeSOD
mes corresponding to the sum of intensities included inside the defined area (of
E. Surowka et al. / Plant Science 172 (2007) 76–8482
Fig. 7. Densitograms corresponding to the activities of SODs forms (FeSOD and CuZnSOD) in extracts of soluble proteins from M. crystallinum leaves visualized on
native PAGE. The volumes corresponding to the sum of intensities included inside the defined area (of SOD isoforms) are presented under the densitograms. H2O2 was
added to a staining solution at the concentration of 0.05 and 0.2 mmol dm�3, while control sample was stained without H2O2. The experiment was repeated two times.
antioxidative enzymes might be initiated in chloroplasts and
regulated, at least in part, by the redox status of the
plastoquinone pool. This signal is followed by a photooxidative
burst of hydrogen peroxide and is associated in Arabidopsis
with photoinhibition of photosynthesis [37]. The increase of
H2O2 level in M. crystallinum leads to the induction of CAM
metabolism [19]. Slesak et al. [38] suggested that in this plant
redox events in the proximity of PSII play a major role in the
regulation of ROS scavengers and CAM-related enzymes. In
this study, we present an indication that fumigation of M.
crystallinum plants with 1.0 ppm SO2 causes only a weak
accumulation of malic acid characteristic for CAM metabo-
lism. However, the level of CAM metabolism induced in M.
crystallinum plants treated with SO2 was not as high as that
previously described in plants treated with NaCl in which
Dmalate amounted to 21.6 mmol dm�3 [11]. On the basis of our
data one can state that oxidative stress induced by SO2/sulphite
Fig. 8. Densitograms corresponding to the activities of SODs forms in extracts of so
was not treated with sulphite. Extracts were prepared from M. crystallinum leaves. T
area (of SOD isoforms) are presented under the densitograms. The experiment wa
in the intracellular space (mainly in chloroplasts) is not
sufficient to induce the C3-CAM shift in M. crystallinum. Also,
results of Niewiadomska et al. [21], Borland et al. [36] and
Hurst et al. [22] indicated that ROS produced due to fumigation
with O3 or treatment with ethylene do not induce CAM
metabolism.
On the other hand, oxidative stress seems to be an important
factor in the induction of CAM metabolism. This view is
supported by the significant increase of SOD activities when a
routine way, such as NaCl applied to the root medium to evoke a
C3-CAM shift is used [11]. During C3-CAM transition the
FeSOD form was the first one to be induced at the levels of
protein activity and mRNA transcript, and this was measurable
before the appearance of the nocturnal malate accumulation
[11–38]. In this study, increases in FeSOD activity were
observed when plants were fumigated 7 days with 1.0 ppm SO2
(Fig. 1), and 2 days with 6.0 ppm SO2 (Fig. 2). The induction of
luble proteins treated with 10.0 mmol dm�3 sulphite at pH 8.0. Control sample
he volumes corresponding to the sum of intensities included inside the defined
s repeated two times.
E. Surowka et al. / Plant Science 172 (2007) 76–84 83
FeSOD activity due to sulphite presence might be as rapid as
30 min (Fig. 3). However, the stable level of FeSOD transcripts
(Fig. 4) gives support to the hypotheses of post-transcriptional
regulation of this enzyme in the presence of the increased ROS
level.
The resistance of plants to SO2 has previously been
attributed to the induction of cytosolic and plastidic SOD
isoforms [39,40]. In our study induction of the CuZnSOD
isoform was observed in all the experiments (fumigation of
plants with 1.0 and 6.0 ppm SO2, incubation of leaf discs in
sulphite solution, treatment of crude extracts with sulphite)
(Figs. 1–3 and 8). However, the strongest increase of CuZnSOD
activity was observed in parallel with a decrease in FeSOD
activity during prolonged 6.0 ppm SO2-fumigation, when
necrosis was visible on the leaves (Fig. 2). Induction of
CuZnSOD activity, similar to FeSOD isoform, was not
accompanied by the induction of its mRNA transcript level,
suggesting a post-transcriptional regulation of activity of this
enzyme (Fig. 4). Post-transcriptional regulation of CuZnSOD
activity is in agreement with previous reports [18,22,40]. Our
previous results [11] and data presented in this paper suggest
that the decline of FeSOD activity is somehow linked with the
induction of CuZnSOD. The pattern of FeSOD and CuZnSOD
induction after different treatments of plant material (Figs. 1–3)
may suggest that CuZnSOD could take over the role of FeSOD
in conditions of severe oxidative stresses. These changes may
represent the compensation and regulation mechanisms
suggested previously by Alscher et al. [6,9], where the lower
expression of a member of one antioxidant gene family leads to
an increase in expression of another member of the family.
However in the experiments we presented here no changes in
the transcript level were detected, though such a compensation
mechanism might be observed at the level of protein activity.
The action of SO2 on the mesophyll cells, apart of the effects
of sulphite per se, is associated with acidification [41]. Results
presented in this study showed that FeSOD is the most resistant
form to acidification (visible on the gel down to pH 4.0), whilst
the most sensitive is CuZnSOD (visible down to pH 6.0)
(Fig. 6). Thus, it can been concluded that both the reduction of
FeSOD and the parallel significant increase of CuZnSOD
activity in plants treated with 6.0 ppm SO2 not can be the effect
of acidification of cell sap resulting from SO2 treatment
(Fig. 2).
SO2 applied to plant tissues causes the generation of H2O2
[42,43]. The increase of H2O2 concentration in the cell leads to
the irreversible inhibition of CuZnSOD and FeSOD activities
[43]. Broetto et al. [18] suggested that elevated H2O2
concentration within the cell probably occurs when the product
of the SOD reaction is not scavenged by the action of H2O2-
scavengers. In such conditions CuZnSOD and FeSOD might be
inactivated. Our results showed, that more resistant to H2O2
present in plant tissues treated with sulphite (Fig. 5) is FeSOD
isoform (Figs. 3 and 7). However, the addition of sulphite to
protein extracts caused an increase of CuZnSOD activity
(Fig. 8). These results show that the higher level of H2O2
generated in plant tissues exposed to sulphite was not sufficient
to lead to a rapid decreasing of the activity of FeSOD. It seems
also that sulphite per se caused the increase of the CuZnSOD
activity (Fig. 8).
5. Conclusions
In conclusion, we can state that oxidative stress caused by
SO2/sulphite in the cellular space (mainly in chloroplasts) is not
sufficient to induce a functionally CAM in M. crystallinum
plants. The induction of FeSOD activity due to SO2/sulphite
treatment might be very rapid and observed before CuZnSOD
induction. FeSOD and CuZnSOD seem to be post-transcrip-
tionally regulated. The induction of CuZnSOD under sulphite
stress probably is mainly due to sulphite action per se. The
pattern of FeSOD and CuZnSOD induction may suggest that
CuZnSOD could closely cooperate with FeSOD in the defence
mechanisms. CuZnSOD in M. crystallinum exposed to severe
oxidative stresses might take over the role of FeSOD.
Acknowledgements
We are grateful for support from KBN grant no. 6P04C 003
20 and EU grant QoL-2001-Integr to the Institute of Plant
Physiology, the Polish Academy of Sciences. We want to
express our gratitude to Mr. Steve Querry for the language
correction and all essential advances connected with this
manuscript.
References
[1] B. Halliwell, J.M.C. Gutteridge, Free Radicals in Biology and Medicine,
Oxford University Press Inc., New York, 1999.
[2] H. Pfanz, E. Martinoia, O.L. Lange, U. Heber, Flux of SO2 into leaf cells
and cellular acidification by SO2, Plant Physiol. 85 (1987) 928–933.
[3] Z. Miszalski, H. Ziegler, Uptake and efflux of [35S] sulphite by protoplasts
and their chloroplasts of oat (Avena sativa L.), Z. Naturforsch. 44c (1989)
509–513.
[4] G.D. Peiser, S.F. Yang, Biochemical and physiological effects of SO2 on
non-photosynthetic processes in plants, in: W.E. Winner, H.A. Mooney,
R.A. Goldstein (Eds.), Sulphur Dioxide and Vegetation, Stanford Uni-
versity Press, 1985, pp. 148–161.
[5] Ch. Bowler, M. Van Montagu, D. Inze, Superoxide dismutase and stress
tolerance, Annu. Rev. Plant Physiol. Plant Mol. Biol. 43 (1992) 83–116.
[6] R.G. Alscher, J.L. Donahue, C.L. Cramer, Reactive oxygen species and
antioxidants: relationships in green cells, Physiol. Plant. 100 (1997) 224–
233.
[7] U. Takahama, S. Veljovic-Ivanovic, U. Heber, Effects of the air pollutant
SO2 on leaves. Inhibition of sulfite oxidation in the apoplast by ascorbate and
of apoplastic peroxidase by sulphite, Plant Physiol. 100 (1992) 261–266.
[8] N.R. Madamanchi, R.G. Alscher, Metabolic bases for differences in sensi-
tivity of two pea cultivars to sulphur dioxide, Plant Physiol. 97 (1991) 88–93.
[9] R.G. Alscher, N. Erturk, L.S. Heath, Role of superoxide dismutases
(SODs) in controlling oxidative stress in plants, J. Exp. Bot. 372
(2002) 1331–1341.
[10] I. Emig, K. Owens, R. Ratajczak, U. Luttge, J.C. Cushman, Isolation of a
full length cDNA clone encoding a cytosolic Cu/Zn superoxide dismutase
(accession no. AF034832) from the common ice plant, Mesembryanthe-
mum crystallinum L., Plant Physiol. 116 (1998) 868.
[11] Z. Miszalski, I. Slesak, E. Niewiadomska, R. Baczek, U. Luttge, R.
Ratajczak, Subcellular localization and stress responses of superoxide
dismutase isoforms from leaves in the C3-CAM intermediate halophyte
Mesembryanthemum crystallinum L., Plant Cell Environ. 21 (1998) 169–
179.
E. Surowka et al. / Plant Science 172 (2007) 76–8484
[12] J.C. Cushman, H.J. Bohnert, Crassulacean acid metabolism: molecular
genetics, Annu. Rev. Plant Mol. Biol. 50 (1999) 305–332.
[13] U. Luttge, The role of crassulacean acid metabolism (CAM) in the
adaptation of plants to salinity, N. Phytol. 125 (1993) 59–71.
[14] P. Adams, D.E. Nelson, S. Yamada, W. Chmara, G. Jensen, H.J. Bohnert,
H. Griffiths, Growth and development of Mesembryanthemum crystal-
linum (Aizoaceae), N. Phytol. 138 (1998) 171–190.
[15] C. Chu, Z. Dai, M.S.B. Ku, G.E. Edwards, Induction of crassulacean acid
metabolism in the facultative halophyte Mesembryanthemum crystallinum
by abscisic acid, Plant Physiol. 93 (1990) 1253–1260.
[16] E.F. McElwain, H.J. Bohnert, J.C. Thomas, Light mediates the induction
of phosphoenolpyruvate carboxylase by NaCl and abscisic acid in Mesem-
bryanthemum crystallinum L., Plant Physiol. 86 (1992) 180–187.
[17] Z. Miszalski, E. Niewiadomska, I. Slesak, U. Luttge, M. Kluge, R.
Ratajczak, The effect of irradiance on carboxylating/decarboxylating
enzymes and fumarase activities in Mesembryanthemum crystallinum
L. exposed to salinity stress, Plant Biol. 3 (2001) 17–23.
[18] F. Broetto, U. Luttge, R. Ratajczak, Influence of light intensity and salt
treatment on mode of photosynthesis and enzymes of antioxidative
response system of Mesembryanthemum crystallinum, Funct. Plant Biol.
29 (2002) 13–23.
[19] I. Slesak, B. Karpinska, E. Surowka, Z. Miszalski, S. Karpinski, Redox
changes in the chloroplast and hydrogen peroxide are essential for
regulation of C3-CAM transition and photooxidative stress responses in
the facultative CAM plant Mesembryanthemum crystallinum L., Plant Cell
Physiol. 44 (2003) 573–581.
[20] Z. Miszalski, M. Kluge, H. Ziegler, Stimulatory effect of sulphite on
photosynthtic 14CO2-fixation in Kalanchoe daigremontiana, Hamet et
Perrier, J. Plant Physiol. 151 (1997) 535–540.
[21] E. Niewiadomska, B. Pater, Z. Miszalski, Does ozone induce a C3-CAM
transition in Mesembryanthemum crystallinum leaves? Phyton (Horn
Austria) 42c (2002) 69–78.
[22] A.C. Hurst, T.E.E. Grams, R. Ratajczak, Effects of salinity, high irra-
diance, ozone and ethylene on mode of photosynthesis, oxidative stress
and oxidative damage in the C3/CAM intermediate plant Mesembryanthe-
mum crystallinum L., Plant Cell Environ. 27 (2004) 187–197.
[23] P.K. Bassi, M.S. Spencer, Does light inhibit ethylene production in leaves?
Plant Physiol. 73 (1983) 758–760.
[24] A. Chrominski, M.A. Khan, D.J. Weber, B.N. Smith, Ethylene and ethane
production in response to salinity stress, Plant Cell Environ. 9 (1986) 687–
691.
[25] G.F. Soldatini, C. Monetti, M.R. Waggan, Photosynthesis and related
parameters in sunflower seedlings as affected by sodium chloride and
polyethyleneglycol, Biochem. Physiol. Pflanzen. 184 (1989) 49–53.
[26] R.L. Heath, The biochemistry of ozone attack on the plasma membrane of
plant cells, Adv. Phytochem. 21 (1987) 29–54.
[27] R.L. Heath, The modification of photosynthetic capacity induced by ozone
exposure, in: N.R. Baker (Ed.), Photosynthesis and the Environment,
Kluwer Academic Publishers, Dordrecht, 1996, pp. 469–476.
[28] C. Langebartels, H. Wohlgemuth, S. Kschieschan, S. Grun, H. Sander-
mann, Oxidative burst and cell death in ozone-exposed plants, Plant
Physiol. Biochem. 40 (2002) 567–575.
[29] H. Kende, J.A.D. Zeevaart, The five ‘‘classical’’ plant hormones, Plant
Cell 9 (1997) 1197–1210.
[30] E.J. Pell, C.D. Schlagnhaufer, R.N. Arteca, Ozone-induced oxidative
stress: mechanism of action and reaction, Physiol. Plant. 100 (1997)
264–273.
[31] M.M. Bradford, A rapid and sensitive method for the quantitation of
microgram quantities of protein utilizing the principle of protein–dye
binding, Anal. Biochem. 72 (1976) 248–254.
[32] C. Beachamp, I. Fridovich, Superoxide dismutase: improved assays and
an assay applicable to acrylamide gels, Anal. Biochem. 44 (1973) 276–
287.
[33] H. Mollering, L-(�) malate,, in: H.U. Bergmeyer (Ed.), 3rd revised
edition, Methods in Enzymatic Analysis, vol. 7, VHC Verlagsgesellschaft,
Weinheim, 1985, pp. 39–47.
[34] T. Brennan, C. Frenkel, Involvement of hydrogen peroxide in the regula-
tion of senescence in peas, Plant Physiol. 59 (1977) 411–416.
[35] U. Luttge, Ecophysiology of crassulacean acid metabolism (CAM), Ann.
Bot. 93 (2004) 629–652.
[36] A. Borland, S. Elliott, S. Patterson, T. Taybi, J. Cushman, B. Pater, J.
Barnes, Are the metabolic components of crassulacean acid metabolism
up-regulated in response to an increase in oxidative burden? J. Exp. Bot.
57 (2006) 319–328.
[37] S. Karpinski, C. Escobar, B. Karpinska, G. Creissen, P.M. Mullineaux,
Photosynthetic electron transport regulates the expression of cytosolic
ascorbate peroxidase genes in Arabidopsis during excess light stress, Plant
Cell 9 (1997) 627–640.
[38] I. Slesak, Z. Miszalski, B. Karpinska, E. Niewiadomska, R. Ratajczak, S.
Karpinski, Redox control of oxidative stress responses in the C3-CAM
intermediate plant Mesembryanthemum crystallinum, Plant Physiol. Bio-
chem. 40 (2002) 669–677.
[39] K. Tanaka, K. Sugahara, Role of superoxide dismutase in defence against
SO2 toxicity and an increase in superoxide dismutase activity with SO2
fumigation, Plant Cell Physiol. 21 (1980) 601–611.
[40] N.R. Madamanchi, J.L. Donahue, C.L. Cramer, R.G. Alscher, K. Ped-
ersen, Differential response of Cu, Zn superoxide dismutase in two pea
cultivars during a short-term exposure to sulphur dioxide, Plant Mol. Biol.
26 (1994) 95–103.
[41] D.J. Kliebenstein, R.-N. Monde, R.L. Last, Superoxide dismutase in
Arabidopsis: an electric enzyme family with disparate regulation and
protein localization, Plant Physiol. 118 (1998) 637–650.
[42] K. Huve, S. Veljovic-Jovanovic, C. Wiese, U. Heber, Oxygen and light
accelerate recovery from SO2-induced inhibition of leaf photosynthesis
and from cytoplasmic acidification, J. Plant Physiol. 156 (2000) 537–544.
[43] J.A. Baum, J.G. Scandalios, Developmental expression and intracellular
localization of superoxide dismutases in maize, Differentiation 13 (1979)
133–140.
