ATM regulates a DNA damage response posttranscriptional RNA operon in lymphocytes

LYMPHOID NEOPLASIA

ATM regulates a DNA damage response posttranscriptional RNA operon inlymphocytesKrystyna Mazan-Mamczarz,1 Patrick R. Hagner,1 Yongqing Zhang,2 Bojie Dai,1 Elin Lehrmann,2 Kevin G. Becker,2

Jack D. Keene,3 Myriam Gorospe,4 Zhenqui Liu,1 and Ronald B. Gartenhaus1,5,6

1Marlene and Stewart Greenebaum Cancer Center, University of Maryland, Baltimore, MD; 2Gene Expression and Genomics Unit, National Institute on Aging,National Institutes of Health, Baltimore, MD; 3Department of Molecular Genetics & Microbiology, Duke University Medical Center, Durham, NC; 4Laboratory ofCellular and Molecular Biology, National Institute on Aging, National Institutes of Health, Baltimore, MD; 5Department of Medicine, University of MarylandMedical School, Baltimore, MD; and 6Veterans Administration Medical Center, Baltimore, MD

Maintenance of genomic stability de-pends on the DNA damage response, abiologic barrier in early stages of cancerdevelopment. Failure of this responseresults in genomic instability and highpredisposition toward lymphoma, as seenin patients with ataxia-telangiectasia mu-tated (ATM) dysfunction. ATM activatesmultiple cell-cycle checkpoints and DNArepair after DNA damage, but its influenceon posttranscriptional gene expressionhas not been examined on a global level.

We show that ionizing radiation modu-lates the dynamic association of the RNA-binding protein HuR with target mRNAsin an ATM-dependent manner, potentiallycoordinating the genotoxic response asan RNA operon. Pharmacologic ATM inhi-bition and use of ATM-null cells revealeda critical role for ATM in this process.Numerous mRNAs encoding cancer-re-lated proteins were differentially associ-ated with HuR depending on the func-tional state of ATM, in turn affecting

expression of encoded proteins. The find-ings presented here reveal a previouslyunidentified role of ATM in controllinggene expression posttranscriptionally.Dysregulation of this DNA damage re-sponse RNA operon is probably relevantto lymphoma development in ataxia-telangiectasia persons. These novel RNAregulatory modules and genetic networksprovide critical insight into the functionof ATM in oncogenesis. (Blood. 2011;117(8):2441-2450)

Introduction

The DNA damage response (DDR) is essential for maintaining theintegrity of the genome, and the failure of this response results ingenomic instability and a predisposition to malignancy.1 In re-sponse to genotoxic agents, cells remain homeostatic via activationof signaling pathways that turn on specific gene expressionprograms. A crucial guardian of genomic integrity is the checkpointkinase ATM (Ataxia Telangiectasia Mutated),2 one of the mostoften mutated kinases in human cancers.3 A deleted or inactivatedATM gene results in ataxia-telangiectasia (AT), a human geneticdisorder characterized by progressive neurodegeneration, immuno-deficiency, premature aging, radiation sensitivity, and a highpropensity to develop cancer.4,5 A total of 30% to 40% of all ATpatients develop neoplasia during their lifetime and 10% to 15%, ofthose patients present with a lymphoid malignancy in childhood.6

To date, there is no effective therapeutic strategy for this disease,and treatment has focused on slowing the progression of theneurodegeneration and developing approaches for the treatment oftumors while minimizing side effects and treatment for theimmunodeficiency.7

ATM is critical for the initial response to double-strandedDNA breaks and is required for subsequent activation of anothermaster checkpoint kinase, the ATM- and Rad3-related proteinATR.8 In response to double-stranded DNA breaks, the ATMkinase phosphorylates and regulates a cascade of downstreameffectors, including the checkpoint kinase Chk2 and othercomponents of the DNA repair pathways and the cell-cycle

checkpoints, to minimize the risk of genetic damage.7,9 Ionizingradiation (IR)–induced double-stranded DNA breaks sequen-tially activate ATM and Chk2, which phosphorylates multiplesubstrate proteins, which in turn delays cell-cycle progression tofacilitate DNA repair, or induces cellular apoptosis to eliminatethe damaged cells, thereby protecting the organism againstcancer.10,11 Recently, it was reported that, in response toH2O2-induced oxidative stress, Chk2 interacts and phosphory-lates the RNA-binding protein (RBP) HuR (Hu antigen R,ELAVL1), altering its association with SIRT1 mRNA.12 HuRbinds to and regulates posttranscriptionally many mRNAs thatencode proteins involved in the stress response, cell prolifera-tion, tumorigenesis, and cell apoptosis.13-26 The effect of HuR onthe stability and translation of target mRNAs has been linked toits subcellular localization.15

RBPs and microRNAs are major posttranscriptional regulatorsof gene expression. They generally regulate subsets of targetmRNAs by associating with their 3�- or 5�-untranslated regions(UTRs) in a manner that be modulated by genotoxic stresses andgrowth conditions.20,27 The coordinated regulation of mRNAsubsets is the basis of the posttranscriptional “RNA-operon” modelwhereby RBPs coregulate multiple mRNAs and thereby regulatethe expression of collections of proteins involved in the samefunction.28 Recently, posttranscriptional regulatory mechanismswere also shown to control the kinetics of proinflammatorycytokine-induced gene expression.29,30

Submitted September 30, 2010; accepted December 30, 2010. Prepublishedonline as Blood First Edition paper, January 5, 2011; DOI 10.1182/blood-2010-09-310987.

The online version of this article contains a data supplement.

The publication costs of this article were defrayed in part by page chargepayment. Therefore, and solely to indicate this fact, this article is herebymarked ‘‘advertisement’’ in accordance with 18 USC section 1734.

2441BLOOD, 24 FEBRUARY 2011 � VOLUME 117, NUMBER 8

For personal use only.on March 3, 2016. by guest www.bloodjournal.orgFrom

http://www.bloodjournal.org/

http://www.bloodjournal.org/site/subscriptions/ToS.xhtml

The crucial role of ATM in regulating Chk2 activation andfindings that Chk2 regulates HuR binding activity suggests a modelin which ATM and Chk2 cooperate to regulate the association ofHuR with subsets of target mRNAs and thereby regulates theexpression of subsets of genes. Here, we identified a network ofinteracting proteins encoded by mRNAs differentially bound toHuR in ATM wild-type compared with ATM null lymphocytes afterexposure to IR. Our findings establish a hierarchy of molecularevents in which IR-triggered activation of the ATM/Chk2 cascadeleads to the subsequent phosphorylation of HuR and modulates itsposttranscriptional regulation of a network of target mRNAsencoding functionally related proteins. Our results highlight acritical biologic role of ATM and Chk2 in global mRNA-HuRinteractions in response to DNA damage and contribute to a betterunderstanding of the attenuated response to irradiation of ATM-deficient lymphocytes.

Methods

Cell culture, treatment, and transfections

B-lymphocyte cell lines GM02184, GM00536 (wild-type, ATM�/�) andGM03332, GM03189, and GM01526 (AT, ATM�/�) were purchased fromCoriell Cell Repositories and cultured in RPMI medium 1640 (QualityBiologicals) with 15% fetal bovine serum and penicillin/streptomycin.Human embryonic kidney (HEK-293) cell lines were cultured in Dulbeccomodified Eagle medium (Invitrogen) supplemented with 10% fetal bovineserum and antibiotics. GM5849 AT fibroblast cells stably transfected withthe pFLAG empty vector (Vector) or pFLAG-ATM (ATM; generous giftsfrom Dr F. Carrier) were cultured in minimum essential medium (Invitro-gen) supplemented with 15% fetal bovine serum and antibiotics. Cells wereexposed to 1 Gy of IR and lysed 6 hours later unless indicated otherwise.ATM kinase inhibitor (KU-55933) was purchased from Calbiochem, andChk2 inhibitor (Inhibitor II) was from Sigma-Aldrich. HEK-293 cells weretransfected either with Lipofectamine 2000 (Invitrogen), when plasmids forHuR overexpression (pcDNA3-TAP) and pHuR-TAP point mutants S88A,S100A, T118A, S202A12,31 were used, or Oligofectamine (Invitrogen),when with small interfering RNAs (siRNAs, control, targeting HuR,QIAGEN; or Chk2, Santa Cruz Biotechnology) were used. Seventy-twohours after transfection, cells were collected for analysis.

IPs of RNP complexes and real-time quantitative RT-PCR

Immunoprecipitations (IPs) of ribonucleoprotein (RNP) complexes fol-lowed by microarray analysis (RIP-Chip) was performed as previouslydescribed.24,25 In short, lymphocytes were harvested in lysis buffer (150mMKOAc, 2.5mM Mg(OAc)2, 20mM K-N-2-hydroxyethylpiperazine-N�-2-ethanesulfonic acid, pH 7.5, dithiothreitol, phenylmethylsulfonyl fluo-ride, RNasin, and protease inhibitors), and 3 mg of protein was used for IPfor 1 hour at 4°C in the presence of excess antibody (30 �g of eitheranti-HuR antibody, Santa Cruz Biotechnology; or control immunoglobulinIgG, BD Biosciences PharMingen). After thorough washes with NT2 buffer(50mM Tris-HCl [pH 7.4], 150mM NaCl, 1mM MgCl2, and 0.05% NonidetP-40) beads were treated with 20 units of RNase-free DNase I (15 minutesat 37°C) and incubated (20 minutes, 55°C) in 100 �L NT2 buffercontaining 0.1% sodium dodecyl sulfate and 0.5 mg/mL Proteinase K. RNAfrom IP material was extracted using phenol and chloroform method in thepresence of GlycoBlue (Ambion). For TAP-IP of RNP complexes, cellswere transfected with pTAP, pHuR(WT)TAP, pHuR(S88A)TAP,pHuR(S100A)TAP, or pHuR(T118A)TAP, pHuR(S202A)TAP, orpHuR(S100D)TAP lysates were incubated with protein rabbit IgG-agarose(Sigma-Aldrich) and assay was performed as described for HuR IP of RNP.RNA from RNP IP reactions was reverse transcribed using the iScriptcDNA synthesis kit (Bio-Rad). The levels of HuR target mRNAs werequantified by real-time quantitative PCR analysis using iQSYBR GreenSupermix (Bio-Rad) and Bio-Rad iCycler instrument. Background binding

of the abundant glyceraldehyde-3-phosphate dehydrogenase (GAPDH)mRNA was used as a loading control. Each reaction was carried out intriplicate, and 3 independent experiments were performed.

Microarray data analysis

RNA from IP material was labeled using Illumina TotalPrep RNAAmplification Kit (Ambion). Human HT-12, Version 1.0 gene expressionBeadChips containing 48 000 RefSeq transcripts (Illumina), were used formicroarray analysis. Raw microarray data were filtered by the detection(P � .02), normalized by Z-score transformation32 and tested for significantdifferences in signal intensity. The sample quality was analyzed by scatterplot, principal component analysis, and gene sample Z-scores basedhierarchy clustering to exclude possible outliers. Analysis of variance testwas used to eliminate the genes with larger variances within eachcomparison group. Genes were considered to be significantly changed aftercalculating Z ratio, indicating fold difference (Z � 1.5 or � �1.5), falsediscovery rate, which controls for the expected proportion of false rejectedhypothesis (false discovery rate � 0.3) and P � .05. Genes differentiallyassociated with HuR in studied groups were analyzed by DAVID bioinfor-matics resource (www.david.abcc.ncifcrf.gov) according to predefinedpathways annotated by the Kyoto Encyclopedia of Genes and Genomes(KEGG) database33 and were visualized on the KEGG pathway map.Ingenuity Pathways Analysis (IPA; www.analysis.ingenuity.com; IngenuitySystems) were used to identify the top network functions among IR-dependent differentially associated genes with HuR in ATM wild-type incontrast to ATM null cells. Network analysis uses a curated knowledge baseon known functional interactions and protein functions to algorithmicallyinfer biochemical interactions. Significance of functions and pathways wascalculated using the right-tailed Fisher test (complete array results:www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc � GSE25848).

Western blotting

For Western blot analysis, 20 to 50 �g of protein lysates was resolved bysodium dodecyl sulfate–polyacrylamide gel electrophoresis (Invitrogen)and transferred onto polyvinylidene difluoride membranes. Blots wereprobed with polyclonal pChk2 (T68), pChk1 (Ser345), Chk1, FOXO3,MEK2, MEK1, and ZFP36L1 from Cell Signaling, Chk2 from Santa CruzBiotechnology, and DUSP10 from Sigma-Aldrich, or monoclonal pATM(Ser1981) (Cell Signaling), HuR, p21 (Santa Cruz Biotechnology), �-H2AX(Upstate), GAPDH, and -actin (Abcam) antibodies. After incubation withthe appropriate secondary antibodies, signals were detected by enhancedchemiluminescence (Pierce Chemical).

Polyribosome fractionation

Cells were incubated for 15 minutes with 100 mg/mL cycloheximide,shortly (1 minute) lysed in cytoplasmic lysis buffer containing 150mMKOAc, 2.5mM Mg(OAc)2, 20mM K-N-2-hydroxyethylpiperazine-N�-2-ethanesulfonic acid, pH. 7.5, RNaseOUT, and protease inhibitor cocktail,and centrifuged for 1 minute (13 000g, 4°C). Lysates were fractionatedthrough linear sucrose gradients, as previously described.24

Oligonucleotides used for real-time quantitative RT-PCRanalysis of HuR target mRNAs

Real-time quantitative PCR quantification of selected HuR targets wasperformed with using following gene-specific primer pairs: ATGAAAT-TCACCCCCTTTCC and AGGTGAGGGGACTCCAAAGT for p21mRNA, GATGCATTGCAGAGGCACTA and CCCTAATGCTGGAAG-CACTC for FOXO3 mRNA, CCCTTCCAGCTGAGGACAG andACGGGCAGGAGAGGAGAC for MEK2 mRNA, GCTTGGGGCTATTT-GTGTGT and TCCCGAAAATACAGGCAGAC for MEK1 mRNA, AT-TACCTCTTCAGCGCCAGA and AATGAGGGAAGGTGCAGTTG forZFP36L1 mRNA, TCACCTCCCACAAACTGACA and GGAAAAGGGG-GAGAAACAAG for DUSP10 mRNA and, CGGAGTCAACGGATTTG-GTCGTAT and AGCCTTCTCCATGGTGGTGAAGAC for GAPDH mRNA.

2442 MAZAN-MAMCZARZ BLOOD, 24 FEBRUARY 2011 � VOLUME 117, NUMBER 8




Results

Differential association of HuR with target mRNAs in ATMwild-type versus ATM null cells after IR

In this study, we set out to examine the influence of the ATM/Chk2signaling pathway on global HuR posttranscriptional gene regula-tion in response to DNA damage. To ensure that ATM-dependentdownstream signaling was not confounded by activation of ATR,we examined the kinetics and dose-dependent phosphorylation ofChk1 (at Ser345) and Chk2 (at Thr68) after IR in both ATMwild-type and null lymphocytes (supplemental Figure 1A-B,available on the Blood Web site; see the Supplemental Materialslink at the top of the online article). Six hours after treatment with1 Gy of IR induced ATM/Chk2 but not the ATR/Chk1 pathway;therefore, we chose 1 Gy as the optimal dose for further study.Increased levels of �-H2AX, a DNA double-strand break marker,confirmed DNA damage after 1 Gy of IR (supplemental Figure 1C).

To gain insight into the alteration of HuR binding activity in thepresence or absence of ATM/Chk2 signaling, we performed RNP IPanalysis using an anti-HuR antibody (supplemental Figure 2A-B)and compared the collection of mRNAs associated with HuR inATM wild-type and ATM null lymphocytes after exposure to IR.HuR-associated mRNAs were detected by RNP IP of endogenousHuR followed by microarray analysis of the obtained mRNAs. Theratios of mRNA expression were determined for each group at

6 hours after IR, compared with untreated cells. Venn diagramanalysis of the common and specific genes whose association withHuR after IR was altered showed a small number of genesoverlapping in response to IR between ATM wild-type and ATMnull cells (Figure 1A). IR treatment of ATM wild-type cellsmodulated HuR-mRNA association of 822 genes (380 mRNAsincreased and 442 decreased association), and the majority of thesemessages (706 mRNAs) did not appear to have an alteredassociation with HuR in ATM null cells. This subset of genes isregulated through an IR-triggered activation of ATM/Chk2 path-way, which consequently modulates HuR phosphorylation and itsbinding activity. Among the top genes with significant changes inthe association with HuR after IR in ATM wild-type, we foundwell-known HuR target genes (eg, p21, PTMA, BCL2; Figure1B-C), which strongly validated the influence of the ATM signalingcascade on the modulation of HuR-mRNA interactions of genesinvolved in cellular functions, such as proliferation and apoptosis.IR altered the association of HuR with other target mRNAs in ATMnull cells, suggesting that additional, ATM-independent pathwaysregulate HuR-mRNA interaction.

Functional analysis of the mRNAs differentially associated withHuR in response to IR in ATM wild-type and ATM nulllymphocytes

KEGG pathway databases were used to examine whether the genesdifferentially associated with HuR in IR-treated ATM wild-type and

Figure 1. Global comparison of HuR association with mR-NAs triggered by IR (1 Gy, 6 hours) in ATM wild-type(GM02184�/�) and ATM null (GM03332�/�) lymphocytes.(A) Venn diagram comparison of mRNAs whose association withHuR was significantly (Z-ratio difference values � or � 1.5;P � .05) increased (red) or decreased (green) in IR-treatedcompared with untreated (Ctrl) cells. (B-C) Examples of genesdemonstrating different association with HuR in response to IR inATM wild-type and ATM null cells. Clusters of genes showing thebiggest differences in association with HuR, measured by Z-ratiovalues. Values increase from green to red.

ATM REGULATES DDR POSTTRANSCRIPTIONAL RNA OPERON 2443BLOOD, 24 FEBRUARY 2011 � VOLUME 117, NUMBER 8




ATM null lymphocytes are components of functionally regulated genegroups. Importantly, KEGG pathway analysis revealed that the mitogen-activated protein kinase signaling pathway was characterized by themost abundant number of transcripts differentially associated withHuR in response to IR in both ATM wild-type and ATM null cells(Figure 2A). Notably, in ATM wild-type cells, IR triggered anincrease in MEK2 mRNA association with HuR, whereas ATM nullcells showed elevated association of HuR with MEK1 mRNA. Togain insight into the potential functional implications of ATM/Chk2on HuR-mRNA association, genes markedly affected by IR in ATMwild-type but not ATM null cells were placed in the context of the

known molecular interactions using IPA. The top 5 networksrevealed molecular functions that were coupled to DNA damageresponse, cellular growth and proliferation, and cancer (supplemen-tal Table 1). The top ranked network, derived from genes unique forATM wild-type cells in response to IR treatment, was centered onthe increase in HuR binding to p21 mRNA, surrounded by otherinteracting genes whose association with HuR was affected by IRtreatment (Figure 2B). This suggests that the network containingp21 as a hub is indicative of the differences in response to IRbetween ATM wild-type and null cells in term of ATM/Chk2influence on HuR binding and posttranscriptional gene regulation.

Figure 2. Networks most highly represented by transcripts differentially associated with HuR after IR treatment. (A) Genes related to the mitogen-activated proteinkinase signaling pathway, showing altered association with HuR after IR were visualized on KEGG pathway maps. (B) The top ranked network of genes differentially associatedwith HuR after IR in ATM wild-type but not in ATM null lymphocytes as defined by IPA “DNA Replication, Recombination, and Repair, Nucleic Acid Metabolism, Small MoleculeBiochemistry.” Red represents up-regulated genes; and green, down-regulated genes. Solid lines indicate direct interaction between genes; and dashed lines, indirectinteraction between genes.





Considering the role of both ATM and HuR in the DNA damageresponse and cancer, we wished to gain further insight into thecancer-related genes and their interactions that mediate the biologiceffect of ATM/Chk2/HuR in response to DNA damage. To this end,we selected cancer-related genes showing altered association withHuR in response to IR treatment in ATM wild-type (functionalATM) in contrast to ATM null cells for analysis of potentialmolecular networks (supplemental Table 2).

IR-triggered changes in HuR-associated mRNAs influenceprotein expression patterns

Of the microarray-identified transcripts showing differential asso-ciation with HuR in ATM wild-type compared with null lympho-cytes after IR, we selected 6 cancer-related targets for detailedverification. The genes selected play important roles in theregulation of tumor development pathways, such as the DNAdamage response, cell arrest, cell proliferation, and signal transduc-tion (Figure 3A). These HuR target transcripts were validated byquantitative reverse-transcribed polymerase chain reaction (RT-PCR) of mRNA from HuR IP samples in ATM wild-type and nulllymphocytes (Figure 3B). To evaluate the functional consequenceof the HuR-mRNA associations shown in Figure 3B, we measured

the levels of the encoded proteins after IR treatment and aftertransfecting cells with siRNA targeting HuR. The levels of theproteins examined were elevated (in 6 hours after IR or at the latertime points examined) when HuR binding to the correspondingmRNAs increased in IR-treated ATM wild-type lymphocytes(Figure 3C) and were reduced when HuR binding declined or afterHuR silencing (Figure 3C-D). The finding that the basal levels ofstudied mRNAs were lowered in the HuR-silenced cultures beforeexposure to IR supported the notion that HuR regulates theseproteins in unstimulated cultures, and further modifies theiralteration after IR irradiation.

To gain biologic insight into these findings, we verified HuRbinding to several selected target mRNAs in multiple ATMwild-type and ATM null lymphocytes under basal and IR-treatmentconditions. Although we observed variations in basal binding ofHuR to some transcripts (ie, ZFP36L1 mRNAs), the response to IRHuR-mRNA association changed only in ATM wild-type cells(Figure 3E). To understand the molecular process whereby IRregulates HuR target mRNAs expression in the presence of intactATM/Chk2 signaling, we first investigated whether IRs influenceabundance of their total mRNA levels. We compared IR-treatedrelative to untreated ATM wild-type lymphocytes by quantitative

Figure 3. Analysis of selected HuR targets after IRexposure. (A-B) ATM wild-type (GM02184�/�) and ATMnull (GM03332�/�) lymphocytes were either untreatedor exposed to 1 Gy of IR and collected 6 hours later(unless otherwise indicated). The selected mRNAs im-munoprecipitated using an anti-HuR antibody (demon-strating changes in association with HuR after IR bymicroarray analysis) were validated by quantitative RT-PCR; the individual enrichment of each mRNA in HuRIPs was normalized to IgG IPs; afterward, the differ-ences in HuR binding were calculated. Backgroundbinding of an abundant transcript encoding a housekeep-ing protein (GAPDH mRNA) served as a loading control.(C) Western blot analysis of the proteins encoded by theHuR target mRNAs shown in panel B, assayed inwhole-cell lysates prepared from lymphocytes that weretreated with 1 Gy of IR. -Actin and GAPDH wereassessed as loading markers; relative protein abun-dance was calculated by densitometry and is expressedas percentage change relative to the levels in nonirradi-ated ATM wild-type cells. (D) HEK-293 cells were trans-fected with the indicated siRNAs; cells were eitheruntreated or, 24 hours after transfection, IR treated(1 Gy) and collected 6 hours later (p21, MEK2, ZFP36L1,DUSP10) or 18 hours later (FOXO3, MEK1) for Westernblot analysis. (E) HuR binding of target messages inmultiple wild-type and ATM null lymphocytes treated withIR (1 Gy, 6 hours); wild-type and ATM null cell lines werepurchased from Coriell Cell Repositories. Each cell linewas acquired from a different donor. (F) The levels oftotal mRNA genes validated in panel B were measuredby quantitative RT-PCR in ATM wild-type IR-treatedcompared with untreated lymphocytes. All graphs repre-sent the mean plus or minus SEM from 3 independentexperiments.





RT-PCR analysis of total RNA; by contrast to HuR-mRNAassociation data (Figure 3B), IR had minimal influence on totalmRNAs levels of all studied HuR’s target transcripts (Figure 3F).We observed that IR-induced changes in studied proteins expres-sion were HuR modulated (Figure 3C-D) but were not accompa-nied by a concomitant differences in total mRNAs abundance(Figure 3F). Because HuR has other roles in posttranscriptionalregulation of gene expression in addition to message stability, weinvestigated other potential mechanisms. Therefore, we askedwhether IR affected the translation of examined HuR targetmRNAs by monitoring the fractions of mRNAs associated with thepolysomes in each untreated and IR-treated ATM wild-type andcompared with null lymphocytes. As shown in supplemental Figure3, consistent with the IR-triggered increase in HuR binding to p21and FOXO3 mRNAs (Figure 3B), we observed increased levels ofthose transcripts in the actively translating fractions of the gradient(fractions 9-11), and lower levels in nontranslating and low-translating fractions of the gradient after treatment with IR.Correspondingly, mRNAs with decreased binding to HuR after IRtreatment (as ZFP36L1 and DUSP10 mRNAs), were found to bedecreased in the translationally engaged, polysomal fractions

(fractions 6-12) of IR-treated cells (supplemental Figure 3). Thesedifferences were not seen when testing the distribution of thosemRNAs in ATM null lymphocytes or the housekeeping GAPDHmRNA in both ATM wild-type or null cells. Through its ability toregulate several antiapoptotic effector proteins, HuR was shown topromote an antiapoptotic function in unstimulated and short-wavelength ultraviolet light-irradiated cells.14,22 Our study of theinfluence of HuR function, vis-a-vis cell survival in response to IR,demonstrated increased cell death in populations expressing re-duced HuR levels (supplemental Figure 4A-B), which stronglysupports HuR’s prosurvival role.

Pharmacologic inhibition of ATM and Chk2, silencing of Chk2,and reintroduction of ATM gene into ATM null cells affectHuR-mRNA association

To confirm the specificity of the influence ATM/Chk2 signalingexerts on IR-induced modulation of HuR/mRNA association,small-molecule inhibitors of both ATM and Chk2 were used(Figure 4A). As measured by mRNA IP, IR altered the associationof HuR with mRNAs in ATM wild-type lymphocytes but not in the

Figure 4. Specificity of ATM/Chk2 signaling onHuR-mRNA association. (A) Left: ATM wild-type(GM02184�/�) lymphocytes were pretreated for 2 hourswith Chk2 or ATM inhibitors and then exposed to 1 Gy ofIR and harvested after 6 hours of further incubation.pChk2 and Chk2 levels were assessed by Westernblotting. Middle: Chk2 levels by 72 hours after transfec-tion of HEK-293 cells with either control (Ctrl) or Chk2-directed siRNAs. Right: ATM levels in GM5849 ATfibroblasts stably reintroduced with ATM gene. (B) Theassociation of HuR-mRNA complexes after IR (1 Gy,6 hours) of cells pretreated with Chk2 or ATM inhibitor(10�M) (left), Chk2 knockdown (middle), and ATM rein-troduction (right) was tested by mRNP-IP followed byquantitative RT-PCR. Each reaction was carried out intriplicate and was repeated 3 times. The individualenrichment of each mRNA in HuR IPs was normalized toIgG IPs; afterward, the differences in HuR binding werecalculated. GAPDH mRNA background amplification inthe IP material served as the internal control. Data arethe mean SEM from 3 independent experiments.





cells pretreated with either ATM or Chk2 inhibitors, or in ATM nullcells (Figure 4B left). A similar outcome to that obtained usingsmall-molecule inhibitors was found when analyzing cells in whichChk2 was knocked down by siRNA (Figure 4A-B middle). Inaddition, IR-altered association of HuR with its target mRNAs wasobserved when using ATM null cells stably reintroduced with ATMgene (Figure 4A-B right). These results lend strong support to theview that inhibiting the function of either ATM or Chk2 directlyinfluences HuR-mRNAs complexes, and underscore the influenceof the ATM/Chk2 signaling pathway in regulating the expression ofHuR targets after IR.

HuR residues phosphorylated by Chk2 in response to IR

A recent study identified Chk2 as a protein that interacted with HuRafter oxidative stress, phosphorylated HuR at residues Ser-88,Ser-100, and Thr-118, and impacted on the ability of HuR’s abilityto bind SIRT mRNA.12 We examined the Chk2-HuR interaction

and HuR phosphorylation at serine and threonine in lymphocytes inresponse to IR, by co-IP of HuR followed by Western blotting(supplemental Figure 5A-B). A total of 1 Gy of IR did notsignificantly affect total protein levels or the subcellular localiza-tion of HuR (supplemental Figures 1B and 5C), which excludes thepossibility that 1 Gy of IR triggers HuR phosphorylation at S158and S221 by PKC and S202 by Cdk1, which was previously shownto influence its subcellular distribution.32,34 To identify the HuRphosphorylation residue(s) regulated by ATM-induced Chk2 activ-ity and that are critical for HuR-mRNA interaction in response toIR exposure, we examined HuR-TAP fusion proteins mutated atChk2 phosphorylation sites: HuR(S88A), HuR(S100A),HuR(T118A)12 (Figure 5A). As shown in Figure 4B, treatment witheither ATM or Chk2 inhibitors could effectively inhibit the functionof these molecules and subsequently modulate HuR bindingactivity. Therefore, cells pretreated either with ATM or Chk2inhibitors served us as controls, confirming contribution of ATM/

Figure 5. Association of HuR’s point mutated atChk2 phosphorylation sites with target mRNAs.(A) Schematic of point-mutated HuR residues phosphor-ylated by Chk2 (top) and HuR-TAP proteins expressionin transfected HEK-293 cells. Cells were left untreated,treated with ATM or Chk2 inhibitors (10�M, 8 hours), orpretreated with ATM or Chk2 inhibitors for 2 hours, andthen irradiated (1 Gy, 6 hours). (B) Binding of HuR-TAPchimeric proteins HuR target mRNAs was measured byTAP IP followed by quantitative RT-PCR. The individualenrichment of each mRNA in HuR-TAP fusion proteinsIPs compared with TAP (vector control) IPs is indicated.The average of 2 similar experiments is shown.





Chk2 pathway in the HuR-mRNA association. Importantly, analy-sis of the binding capacity of each HuR-TAP mutant protein to thevalidated mRNAs, which increased its association with HuR afterIR (p21, FOXO3, and MEK2), consistently showed a lowerassociation with HuR(S100A) compared with HuR(WT), and othermutants (Figure 5B). By contrast, binding of mutant HuR(T118A)to mRNAs after IR was generally similar to binding of HuR(WT).To corroborate the role of Ser-100 site, the binding of fusionproteins mimicking phosphorylated residues S100,HuR(S100D)TAP, was also tested and demonstrated increasedassociation with validated transcripts after IR compared withHuR(WT) (Figure 6).

In summary, mutation of the HuR residues phosphorylated byChk2 suggests that phosphorylation at Ser-100 is important forincreased association of HuR with target mRNAs and Thr118 canbe relevant for the dissociation of HuR-mRNA complexes after IR.These results demonstrate that ATM/Chk2-mediated phosphoryla-tion of HuR is required for optimal HuR binding in response to IR,providing an important functional linkage between ATM/Chk2signaling and HuR activity after DNA damage.

Discussion

In response to DNA double-strand breaks, ATM phosphorylatesmultiple proteins involved in cell-cycle checkpoints, including thecheckpoint kinase Chk2.35,36 ATM-activated Chk2 prevents replica-tion of damaged DNA and controls cell fate by subsequentphosphorylation of multiple downstream proteins involved in genetranscription, DNA repair, growth arrest, and apoptosis, such asE2F1,37 BRCA1,38 Cdc25C and Cdc25A,35,39 and p53.40 Given thatmodulation of phosphorylation sites on RBPs has been shown toinfluence the association of mRNAs with the protein,41 here wepropose a model in which ATM and Chk2 cooperate to phosphory-late HuR and thereby modulate HuR association with its targetmRNAs. We set out to examine this regulation experimentally,using AT patient-derived B-cell lines as well as normal donors thatdiffer in their ATM status and exposing them to IR. The relativelylow dose we used (1 Gy) precludes the confounding influence ofparallel pathways, such as the ATR/Chk1 signaling (supplementalFigure 1A), which was not affected at these doses. We identifiedcadres of mRNAs whose association with HuR was altered in cellswith wild-type ATM but not in cells without a functional ATM inresponse to IR-triggered DNA damage stimuli. These data supportthe view HuR functions as a downstream effector of ATM/Chk2phosphorylation, enhancing its association with one subset ofmRNAs while reducing its association with others.

After genotoxic stress, the levels of expressed genes arecontrolled through both transcriptional and posttranscriptionalevents. HuR has been shown to stabilize target mRNAs, modulatetheir translation, or affect splicing and export.15,17 Recently,phosphorylation of HuR at a region of RNA recognition motifs1 and 2 by the checkpoint kinase Chk2 was shown to affect HuR’sability to bind to the SIRT1 mRNA, in turn affecting the stability ofthe transcript.12 However, there are scant data examining themodulation of HuR binding to target RNAs after IR exposure.Although the impact on transcription of the AT null state haspreviously been explored,42-44 there are limited data on post-transcriptional events in AT null cells in response to IR. In ourstudy, IR exposure triggered reproducible changes in HuR bindingof target mRNAs, and subsequent protein synthesis, accompaniedby minor or no significant changes in total mRNA levels ofvalidated genes (Figure 3B-F; supplemental Figure 3). These noveldata demonstrated that, in response to IR, the main influence ofHuR is exerted on the translation of its targets. However, thiscontrol may be specific to subsets of target mRNAs and needs to beconfirmed by additional experiments in future studies. Based onour findings, we propose that HuR plays a central role inATM-mediated Chk2 regulation of genes after DNA damage. Thisregulation probably occurs by Chk2-mediated HuR phosphoryla-tion resulting in modulation of HuR binding activity to targetmRNAs encoding proteins involved in control of cell fate afterDNA damage, and subsequent modulation of their expression viaposttranscriptional mechanisms.

Using biologic pathway analysis software, we classified mR-NAs that associate with HuR in response to IR into subsets offunctionally related genes to define the relationships amongproteins involved in the DNA damage response. Many proteinsimplicated in the MEK/extracellular signal-regulated kinase (ERK)signaling pathway, which is often dysregulated in cancer, wereencoded by transcripts differentially associated with HuR in anATM/Chk2-dependent manner in response to IR. Mitogen-activated protein kinase signaling works in concert to balance celldeath with growth and survival, and the deregulation of this pathwayleads to genomic instability and cancer.45 Furthermore, the MEK/ERK

Figure 6. Association of HuR-TAP fusion protein mimicking phosphorylatedresidue S100 with HuR target mRNAs. (A) HEK-293 cells were transfected withplasmids to express HuR-TAP fusion proteins (WT or bearing a phosphomimicmutation S100D). (B) HuR binding was assessed as explained in Figure 5. Theenrichment of each mRNA in HuR(S100D)TAP IPs compared with HuR(WT)TAP IPsis indicated. The average of 2 similar experiments is shown.





signaling pathway is constitutively activated in a large number ofcancers, including lymphomas.46-49 An exciting finding in this study wasthat 2 major components of this pathway, MEK1 and MEK2, werefound to be regulated by HuR in response to IR in a reciprocal mannerwhen using ATM wild-type and ATM null cells (Figures 2A, 3B-C).MEK1 and MEK2 contribute to the divergent effects of ERK signaling,whereas MEK1-activated ERK2 induces cell proliferation, MEK2-activated ERK2 initiates growth arrest.50-52 In our study, the HuR-MEK2 mRNA interaction, and MEK2 protein levels increased in ATMwild-type but not inATM null cells after treatment with IR. These resultssupport the importance of ATM/Chk2 signaling on the role of HuR inregulation of MEK2 levels and its contribution to IR-induced cell arrest,an attenuated cellular response in the absence of an ATM protein (inATM null cells). The IR-induced increase in the binding of HuR toMEK1 mRNA (and modulation of HuR binding to subset mRNAs) thatwas observed in ATM null cells indicates the existence of otherATM-independent mechanisms influencing HuR binding capacity,leading to an IR-induced increase in cell proliferation in ATM null cells.Our previous finding that increased MEK1 mRNA-HuR association isimplicated in cellular transformation24 in conjunction with presentedresults support the notion that the dysregulation of HuR activity in theATM null phenotype may contribute to the high propensity of ATpatients to develop malignancies.

Although it is well known that HuR regulates numerous genesposttranscriptionally, of significant interest to us was to identifyspecific genes/pathways that are dependent on and selectivelyparticipate in the radioresponse through the ATM/Chk2/HuRregulation cascade. The cyclin-dependent kinase inhibitor p21/CDKN1A (a well-characterized HuR target) appeared as theprimary hub, in the top functional network derived from the genes,which changed association with HuR in response to IR exclusivelyin the ATM wild-type cells. p21 plays a major role in regulatingcell-cycle progression, and it has been shown to be involved inmediating growth arrest in response to a variety of stressors,including DNA damage.53,54 Expression of p21 protein is tightlyregulated at multiple levels. Although the best-understood induc-tion of p21 response to DNA damage occurs through a transcrip-tional mechanism by the tumor suppressor p53,53-56 HuR has beenreported as a major player in regulating p21 expression post-transcriptionally in response to short-wavelength ultraviolet light.14

Our study discovered the impact of ATM/Chk2 cascade onIR-mediated HuR regulation of the p21 network by post-transcriptional regulation of p21 mRNA and the mRNAs encodingmultiple p21-interacting proteins in the network. Notably, a recentpaper demonstrated the clinical relevance of p21 protein levels inpredicting clinical outcome of DLBCL patients older than 60 yearsafter treatment with R-CHOP.57

In addition, other data show that IR modifies gene expression atthe level of translation and suggests that IR-induced translationalcontrol of a subset of mRNAs is a fundamental component ofcellular radioresponse.58 Linking presented findings to the well-established role of HuR in regulating translation of target mRNAsin the damage response in concert with examining the upstreamparticipation of ATM in this regulation provides us with a uniqueopportunity to precisely define the role of HuR in the DNA damageresponse (DDR).

Chk2 was found to be activated by H2O2-induced free radicaldamage, physically interacted with HuR, and was shown tophosphorylate HuR at residues Ser-88, Ser-100, and Thr-118.12 Ourdata build on these earlier findings and suggest that, in response toIR exposure, HuR associates with target mRNAs when Ser-100 isphosphorylated and dissociates when site Thr-118 is phosphory-lated. In addition, HuR phosphorylation at Ser-202 by the G2-phase

kinase Cdk1 was shown to influence its subcellular distribution.31

Analyzed transcripts demonstrated the same binding affinity toHuR(S202) mutant compared with wild-type HuR (Figure 5B) andHuR subcellular localization did not change after 1 Gy of IR(supplemental Figure 5C) establishing an important role of ATM/Chk2signaling on HuR gene regulation in the double-stranded DDR.

Together, our studies are the first to demonstrate biologicallyrelevant differences in genome-wide ATM/Chk2/HuR-modulatedtranscripts occurring in response to IR treatment. Using a combina-tion of genetic and pharmacologic approaches, we established thatthe ATM/Chk2-induced HuR phosphorylation is able to induce acomplex and dynamic posttranscriptional RNA operon that medi-ates in part the DNA damage response. This response mostprobably involves the coordinated action of additional RBPs andmicroRNAs and probably additional factors in coordinating anintricate functional program. Nevertheless, identifying HuR as amain regulator in the posttranscriptional DNA damage response inlymphocytes reveals an important area for future studies. Thenewly identified role of ATM in Chk2 phosphorylation of HuRduring the DNA damage response provides a functional linkbetween ATM and HuRs oncogenic, survival, and antiapoptoticactivities. The findings presented here reveal a previously unidenti-fied defect in posttranscriptional regulation secondary to a lack ofATM activity, thereby contributing to the inappropriate DNAdamage response reported in ATM null cells. Because AT patientsshow a hypersensitivity to radiotherapy and an extraordinary highrisk of developing lymphoid malignancies, gaining a better under-standing of this hitherto unreported perturbation in the translationof cancer-related mRNAs will provide additional insight into thehigh predisposition to lymphoma of patients with AT.

Acknowledgments

The authors thank Dr F. Carrier for AT and ATM stably transfectedGM5849 fibroblasts and S. Corl for technical assistance.

This work was supported in part by the American CancerSociety (Institutional Research Grant; K.M.-M), the Department ofVeterans Affairs (Merit Review Award; R.B.G.), and the NationalInstitutes of Health (R01AA017972; R.B.G.). K.G.B. and M.G.were supported by the National Institute on Aging-IntramuralResearch Program, National Institutes of Health.

Authorship

Contribution: K.M.-M. performed research, analyzed data, andwrote the paper; P.R.H. performed research and wrote the paper;Y.Z., B.D., E.L., and K.G.B. performed research and analyzed data;J.D.K. wrote the paper; M.G. provided reagents and wrote thepaper; Z.L. analyzed data and wrote the paper; and R.B.G.conceived of and designed the research, analyzed data, and wrotethe paper.

Conflict-of-interest disclosure: J.D.K. has financial relation-ships with Ribonomics Inc and MBL Inc, which hold licenses totechnologies relevant to aspects of this study. The remainingauthors declare no competing financial interests.

Correspondence: Ronald B. Gartenhaus, Marlene and StewartGreenebaum Cancer Center, University of Maryland, Baltimore,MD, 21201; e-mail: [email protected].





References

1. Bartek J, Lukas J, Bartkova J. DNA damage re-sponse as an anti-cancer barrier: damage thresh-old and the concept of ‘conditional haploinsuffi-ciency.’ Cell Cycle. 2007;6(19):2344-2347.

2. Shiotani B, Zou L. Single-stranded DNA orches-trates an ATM-to-ATR switch at DNA Breaks. MolCell. 2009;33(5):547-558.

3. Greenman C, Stephens P, Smith R, et al. Pat-terns of somatic mutation in human cancer ge-nomes. Nature. 2007;446(7132):153-158.

4. Shiloh Y, Kastan MB. ATM: genome stability, neu-ronal development, and cancer cross paths. AdvCancer Res. 2001;83:209-254.

5. Biton S, Dar I, Mittelman L, et al. Nuclear ataxia-telangiectasia mutated (ATM) mediates the cellu-lar response to DNA double strand breaks in hu-man neuron-like cells. J Biol Chem. 2006;281(25):17482-17491.

6. Taylor AM, Metcalfe JA, Thick J, Mak YF. Leuke-mia and lymphoma in ataxia telangiectasia.Blood. 1996;87(2):423-438.

7. Lavin MF. ATM and the Mre11 complex combineto recognize and signal DNA double-strandbreaks. Oncogene. 2007;26(56):7749-7758.

8. Jazayeri A, Falck J, Lukas C, et al. ATM- and cellcycle-dependent regulation of ATR in response toDNA double-strand breaks. Nat Cell Biol. 2006;8(1):37-45.

9. Matsuoka S, Ballif BA, Smogorzewska A, et al.ATM and ATR substrate analysis reveals exten-sive protein networks responsive to DNA dam-age. Science. 2007;316(5828):1160-1166.

10. Bartek J, Lukas J. Chk1 and Chk2 kinases incheckpoint control and cancer. Cancer Cell.2003;3(5):421-429.

11. Lukas C, Falck J, Bartkova J, Bartek J, Lukas J.Distinct spatiotemporal dynamics of mammaliancheckpoint regulators induced by DNA damage.Nat Cell Biol. 2003;5(3):255-260.

12. Abdelmohsen K, Pullmann R Jr, Lal A, et al.Phosphorylation of HuR by Chk2 regulates SIRT1expression. Mol Cell. 2007;25(4):543-557.

13. Wang W, Caldwell MC, Lin S, Furneaux H,Gorospe M. HuR regulates cyclin A and cyclin B1mRNA stability during cell proliferation. EMBO J.2000;19(10):2340-2350.

14. Wang W, Furneaux H, Cheng H, et al. HuR regu-lates p21 mRNA stabilization by UV light. Mol CellBiol. 2000;20(3):760-769.

15. Brennan CM, Steitz JA. HuR and mRNA stability.Cell Mol Life Sci. 2001;58(2):266-277.

16. Akool el-S, Kleinert H, Hamada FM, et al. Nitricoxide increases the decay of matrix metallopro-teinase 9 mRNA by inhibiting the expression ofmRNA-stabilizing factor HuR. Mol Cell Biol. 2003;23(14):4901-4916.

17. Mazan-Mamczarz K, Galban S, Lopez de Silanes I,et al. RNA-binding protein HuR enhances p53 trans-lation in response to ultraviolet light irradiation. ProcNatl Acad Sci U S A. 2003;100(14):8354-8359.

18. Sheflin LG, Zou AP, Spaulding SW. Androgensregulate the binding of endogenous HuR to theAU-rich 3�UTRs of HIF-1alpha and EGF mRNA.Biochem Biophys Res Commun. 2004;322(2):644-651.

19. Yang X, Wang W, Fan J, et al. ProstaglandinA2-mediated stabilization of p21 mRNA throughan ERK-dependent pathway requiring the RNA-binding protein HuR. J Biol Chem. 2004;279(47):49298-49306.

20. Lopez de Silanes I, Zhan M, Lal A, Yang X,Gorospe M. Identification of a target RNA motiffor RNA-binding protein HuR. Proc Natl Acad SciU S A. 2004;101(9):2987-2992.

21. Lopez de Silanes I, Lal A, Gorospe M. HuR: post-

transcriptional paths to malignancy. RNA Biol.2005;2(1):11-13.

22. Lal A, Kawai T, Yang X, Mazan-Mamczarz K,Gorospe M. Antiapoptotic function of RNA-bind-ing protein HuR effected through prothymosinalpha. EMBO J. 2005;24(10):1852-1862.

23. Kuwano Y, Kim HH, Abdelmohsen K, et al. MKP-1mRNA stabilization and translational control byRNA-binding proteins HuR and NF90. Mol CellBiol. 2008;28(14):4562-4575.

24. Mazan-Mamczarz K, Hagner PR, Corl S, et al.Post-transcriptional gene regulation by HuR pro-motes a more tumorigenic phenotype. Oncogene.2008;27(47):6151-6163.

25. Mazan-Mamczarz K, Hagner PR, Dai B, et al.Identification of transformation-related pathwaysin a breast epithelial cell model using a ribonom-ics approach. Cancer Res. 2008;68(19):7730-7735.

26. Liu L, Rao JN, Zou T, et al. Polyamines regulatec-Myc translation through Chk2-dependent HuRphosphorylation. Mol Biol Cell. 2009;20(23):4885-4898.

27. Keene JD. Ribonucleoprotein infrastructure regu-lating the flow of genetic information between thegenome and the proteome. Proc Natl Acad SciU S A. 2001;98(13):7018-7024.

28. Keene JD. RNA regulons: coordination of post-transcriptional events. Nat Rev Genet. 2007;8(7):533-543.

29. Hao S, Baltimore D. The stability of mRNA influ-ences the temporal order of the induction ofgenes encoding inflammatory molecules. Nat Im-munol. 2009;10(3):281-288.

30. Anderson P. Intrinsic mRNA stability helps com-pose the inflammatory symphony. Nat Immunol.2009;10(3):233-234.

31. Kim HH, Abdelmohsen K, Lal A, et al. NuclearHuR accumulation through phosphorylation byCdk1. Genes Dev. 2008;22(13):1804-1815.

32. Cheadle C, Vawter MP, Freed WJ, Becker KG.Analysis of microarray data using Z score trans-formation. J Mol Diagn. 2003;5(2):73-81.

33. Kanehisa M, Goto S, Kawashima S, Okuno Y,Hattori M. The KEGG resource for decipheringthe genome. Nucleic Acids Res. 2004;32:D277-D280.

34. Doller A, Huwiler A, Muller R, et al. Protein kinaseCalpha-dependent phosphorylation of the mRNA-stabilizing factor HuR: implications for posttran-scriptional regulation of cyclooxygenase-2. MolBiol Cell. 2007;18(6):2137-2148.

35. Matsuoka S, Huang M, Elledge SJ. Linkage ofATM to cell cycle regulation by the Chk2 proteinkinase. Science. 1998;282(5395):1893-1897.

36. Chaturvedi P, Eng WK, Zhu Y, et al. MammalianChk2 is a downstream effector of the ATM-depen-dent DNA damage checkpoint pathway. Onco-gene. 1999;18(28):4047-4054.

37. Stevens C, Smith L, La Thangue NB. Chk2 acti-vates E2F-1 in response to DNA damage. NatCell Biol. 2003;5(5):401-409.

38. Zhang J, Willers H, Feng Z, et al. Chk2 phosphor-ylation of BRCA1 regulates DNA double-strandbreak repair. Mol Cell Biol. 2004;24(2):708-718.

39. Falck J, Mailand N, Syljuåsen RG, Bartek J,Lukas J. The ATM–Chk2–Cdc25A checkpointpathway guards against radioresistant DNA syn-thesis. Nature. 2001;410(6830):842-847.

40. Hirao A, Kong YY, Matsuoka S, et al. DNA dam-age-induced activation of p53 by the checkpointkinase Chk2. Science. 2000;287(5459):1824-1827.

41. Walker J, Dale M, Standart N. Unmasking mRNAin clam oocytes: role of phosphorylation of a 3�

UTR masking element-binding protein at fertiliza-tion. Dev Biol. 1996;173(1):292-305.

42. Heinloth AN, Shackelford RE, Innes CL, et al.ATM-dependent and -independent gene expres-sion changes in response to oxidative stress,gamma irradiation, and UV irradiation. RadiatRes. 2003;160(3):273-290.

43. Lee JS. Functional link between DNA damageresponses and transcriptional regulation by ATMin response to a histone deacetylase inhibitorTSA. Cancer Res Treat. 2007;39(3):116-124.

44. Ricaud L, Proux C, Renou JP, et al. ATM-medi-ated transcriptional and developmental re-sponses to gamma rays in Arabidopsis. PLoSONE. 2007;2(5):e430.

45. Golding SE, Rosenberg E, Neill S, et al. Extracel-lular signal-related kinase positively regulatesataxia telangiectasia mutated, homologous re-combination repair, and the DNA damage re-sponse. Cancer Res. 2007;67(3):1046-1053.

46. Dent P, Grant S. Pharmacologic interruption ofthe mitogen-activated extracellular-regulate ki-nase/mitogen-activated protein kinase signaltransduction pathway: potential role in promotingcytotoxic drug action. Clin Cancer Res. 2001;7(4):775-783.

47. Jazirehi AR, Vega MI, Chatterjee D, Goodglick L,Bonavida B. Inhibition of the Raf-MEK1/2-ERK1/2signaling pathway, Bcl-xL down-regulation, andchemosensitization of non-Hodgkin’s lymphomaB cells by Rituximab. Cancer Res. 2004;64(19):7117-7126.

48. Scholl FA, Dumesic PA, Khavari PA. Effects ofactive MEK1 expression in vivo. Cancer Lett.2005;230(1):1-5.

49. Dai B, Zhao XF, Hagner P, et al. Extracellular sig-nal-regulated kinase positively regulates the on-cogenic activity of MCT-1 in diffuse large B-celllymphoma. Cancer Res. 2009;69(19):7835-7843.

50. Ussar S, Voss T. MEK1 and MEK2, different regu-lators of the G1/S transition. J Biol Chem. 2004;279(42):43861-43869.

51. Skarpen E, Flinder LI, Rosseland CM, et al.MEK1 and MEK2 regulate distinct functions bysorting ERK2 to different intracellular compart-ments. FASEB J. 2008;22(2):466-476.

52. Scholl FA, Dumesic PA, Barragan DI, et al. Selec-tive role for Mek1 but not Mek2 in the induction ofepidermal neoplasia. Cancer Res. 2009;69(9):3772-3778.

53. el-Deiry WS, Tokino T, Velculescu VE, et al.WAF1, a potential mediator of p53 tumor sup-pression. Cell. 1993;75(4):817-825.

54. Macleod KF, Sherry N, Hannon G, et al. p53-de-pendent and independent expression of p21 dur-ing cell growth, differentiation, and DNA damage.Genes Dev. 1995;9(8):935-944.

55. Michieli P, Chedid M, Lin D, et al. Induction ofWAF1/CIP1 by a p53-independent pathway.Cancer Res. 1994;54(13):3391-3395.

56. Gartenhaus RB, Wang P, Hoffman P. Induction ofWAF 1 and apoptosis in HTLV-1 transformed lym-phocytes after exposure to adriamycin by using ap53 independent pathway. Proc Natl Acad SciU S A. 1996;93(1):265-268.

57. Winter JN, Li S, Aurora V, et al. Expression of p21protein predicts clinical outcome in DLBCL pa-tients older than 60 years treated with R-CHOPbut not CHOP: a prospective ECOG and South-west Oncology Group correlative study on E4494.Clin Cancer Res. 2010;16(8):2435-2442.

58. Lu X, de la Pena L, Barker C, Camphausen K,Tofilon PJ. Radiation-induced changes in geneexpression involve recruitment of existing mes-senger RNAs to and away from polysomes. Can-cer Res. 2006;66(2):1052-1061.





online January 5, 2011 originally publisheddoi:10.1182/blood-2010-09-310987

2011 117: 2441-2450

Becker, Jack D. Keene, Myriam Gorospe, Zhenqui Liu and Ronald B. GartenhausKrystyna Mazan-Mamczarz, Patrick R. Hagner, Yongqing Zhang, Bojie Dai, Elin Lehrmann, Kevin G. in lymphocytesATM regulates a DNA damage response posttranscriptional RNA operon

http://www.bloodjournal.org/content/117/8/2441.full.htmlUpdated information and services can be found at:

(2215 articles)Lymphoid Neoplasia Articles on similar topics can be found in the following Blood collections

http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requestsInformation about reproducing this article in parts or in its entirety may be found online at:

http://www.bloodjournal.org/site/misc/rights.xhtml#reprintsInformation about ordering reprints may be found online at:

http://www.bloodjournal.org/site/subscriptions/index.xhtmlInformation about subscriptions and ASH membership may be found online at:

Copyright 2011 by The American Society of Hematology; all rights reserved.of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society


http://www.bloodjournal.org/content/117/8/2441.full.html

http://www.bloodjournal.org/cgi/collection/lymphoid_neoplasia

http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests

http://www.bloodjournal.org/site/misc/rights.xhtml#reprints

http://www.bloodjournal.org/site/subscriptions/index.xhtml





Documents

ATM regulates a DNA damage response posttranscriptional RNA operon in lymphocytes