Efficient Detection of Alport Syndrome COL4A5Mutations With Multiplex Genomic PCR-SSCP

David F. Barker,1* Joyce C. Denison,1 Curtis L. Atkin,2,3† and Martin C. Gregory3

1Department of Physiology, the University of Utah Health Sciences Center, Salt Lake City, Utah2Department of Biochemistry, the University of Utah Health Sciences Center, Salt Lake City, Utah3Department of Medicine, the University of Utah Health Sciences Center, Salt Lake City, Utah

We have performed effective mutationscreening of COL4A5 with a new method ofdirect, multiplex genomic amplificationthat employs a single buffer condition andPCR profile. Application of the method to aconsecutive series of 46 United States pa-tients with diverse indications of Alportsyndrome resulted in detection of muta-tions in 31 cases and of five previously un-reported polymorphisms. With a correctionfor the presence of cases that are not likelyto be due to changes at the COL4A5 locus,the mutation detection sensitivity is greaterthan 79%. The test examines 52 segments, in-cluding the COL4A6/COL4A5 intergenic pro-moter region, all 51 of the previously recog-nized exons and two newly detected exonsbetween exons 41 and 42 that encode an al-ternatively spliced mRNA segment. New ge-nomic sequence information was generatedand used to design primer pairs that spansubstantial intron sequences on each side ofall 53 exons. For SSCP screening, 16 multi-plex PCR combinations (15 4-plex and 13-plex) were used to provide complete, par-tially redundant coverage of the gene. Theselected combinations allow clear resolu-tion of products from each segment usingvarious SSCP gel formulations. One of the29 different mutations detected initiallyseemed to be a missense change in exon 32but was found to cause exon skipping. An-other missense variant may mark a novelfunctional site located in the collagenousdomain. © 2001 Wiley-Liss, Inc.

KEY WORDS: COL4A5; multiplex PCR;SSCP; mutation detection;Alport syndrome

INTRODUCTION

Defects in the COL4A5 basement membrane (TypeIV) collagen gene, located at Xq22, cause about 85% ofAlport syndrome (AS), a glomerular membranopathythat progresses to end-stage renal disease (ESRD) andis usually associated with progressive hearing loss [Al-port, 1927; Gregory and Atkin, 1997; Kashtan, 1998].The most deleterious COL4A5 mutations cause ESRDfor males in their second or third decade, whereasmilder variants may be associated with ESRD onset inmiddle age or later as well as tardive onset of hearingloss [Barker et al., 1996, 1997]. For female carriers ofCOL4A5 mutations, ESRD at ages similar to that oc-curring in male relatives is rare, but the lifetime inci-dence is about 15%. The general pattern of phenotypicexpression in females is consistent with typical varia-tion in X-inactivation, although the role of X-inactivation has not been confirmed by experimentalobservation [Vetrie et al., 1992]. Nearly all COL4A5defects are unique and a wide spectrum of mutationtypes have been presented in previous publications[Barker et al., 1990; Boye et al., 1995; Heiskari et al.,1996; Kawai et al., 1996; Knebelmann et al., 1996; Re-nieri et al., 1996; Plant et al., 1999]. Mutations in theCOL4A3 or COL4A4 basement membrane collagengenes, located at 2q35–2q37, cause a recessive form ofAlport syndrome with expression in homozygotes of ei-ther gender that is similar to that in males withCOL4A5 mutations [Lemmink et al., 1994b; Mochizukiet al., 1994]. The recessive form is thought to accountfor about 15% of cases. Phenotypic expression in het-erozygous carriers of COL4A3 or COL4A4 mutations isvariably present and may include mild hematuria, mildproteinuria, hearing loss and, in rare cases, late-ageonset renal failure [Lemmink et al., 1996; Boye et al.,1998; Smeets et al., 1998] that may be construed asdominant expression in some instances [Jefferson etal., 1997].

All six Type IV collagen genes are large, withmRNAs of 6 to 10 kb, encoded by ∼50 exons that are dis-

†Curtis L. Atkin is deceased.Grant sponsor: NIH; Grant numbers: DK43761, CA42014.*Correspondence to: David F. Barker, Department of Physiol-

ogy, Room 156, 410 Chipeta Way, University of Utah ResearchPark, Salt Lake City, Utah 84108.E-mail: david.f.barker@m.cc.utah.edu

Received 21 February 2000; Accepted 15 September 2000Published online 29 December 2000

American Journal of Medical Genetics 98:148–160 (2001)

© 2001 Wiley-Liss, Inc.

persed in a genomic segment of at least 100 kb [Soin-inen et al., 1989; Mariyama et al., 1994; Zhou et al.,1994; Zhang et al., 1996; Boye et al., 1998]. Mutationanalysis of such large and complex genes is generallydifficult and tedious. Although significant efficienciesmay be realized in simultaneously analyzing a largeseries of patients for mutations, the timely analysis ofsmall numbers of samples for diagnostic purposes in aclinical context is extremely inefficient. This is partlydue to the effort involved in using several differentPCR conditions to individually amplify numerous ex-ons followed by mutation analysis of each single prod-uct using SSCP, direct sequencing or other methods.This report describes a whole gene SSCP fingerprintapproach that uses a single PCR condition for simulta-neous multiplex amplification of 52 segments contain-ing all of the COL4A5 coding regions and the intergenicportion of the promoter. The multiplex combinationswere chosen to allow subsequent mutation analysis bySSCP using various gel formulations.

We have applied this method prospectively in 46 in-dependent cases of possible Alport syndrome from theUnited States, resulting in the identification of definiteor likely causal changes for 31 of them. Five previouslyunreported polymorphisms were also characterized, in-cluding two relatively common intronic changes nearexons 33 and 10 that are highly associated with eachother. A rare polymorphism, L685L, occurs in associa-tion with a previously described haplotype of five otherpolymorphisms. Two other rare polymorphisms werefound in single individuals. The raw sensitivity of mu-tation detection in the present study (>65%) comparesfavorably to SSCP detection rates of #50% described inpublished reports of large-scale simplex PCR-SSCPanalysis of COL4A5 [Kawai et al., 1996; Renieri et al.,1996; Knebelmann et al., 1996; Plant et al., 1999].

The mutations discovered in this series include de-letions, frameshifts, alterations in consensus splicesites and missense changes that affect glycine residuesin the collagenous domain. Other missense changeswere found in known functional residues in the non-collagenous domain. Analysis of ectopic mRNA re-vealed that the 2948 A→G change, located inside exon32 and not close to either consensus splice sequence,causes skipping of exon 32, a rare type of splicing mu-tation not previously reported for COL4A5. The prob-able missense change, M898V, associated with an un-usually mild disease phenotype, may indicate the siteof a novel chain-specific functional domain within thecollagenous segment. The mutation L1649R was foundin three different families, two from the WesternUnited States and one from an Eastern state, providingfurther evidence for its relatively high prevalenceamong United States Alport cases [Barker et al., 1996].

MATERIALS AND METHODSPatients and Clinical Criteria

The prospective analyses described here include 46families from the United States who entered the Uni-versity of Utah Alport study between January 1, 1998and July 1, 1999 and also provided a blood sample froman affected individual or an apparent obligate carrier

during that time. The relatively broad clinical criteriafor inclusion in mutation screening were either 1) oneor more instances of kidney biopsy morphologicallyconsistent with AS, or 2) family history of renal insuf-ficiency or failure, coincident with hematuria, or hear-ing loss or anterior lenticonus. The University of UtahAlport study also includes a series of more than 200families collected before 1998, most of which have alsobeen screened for COL4A5 mutations and polymor-phisms by a variety of different methods. All interac-tions with patients are according to a protocol approvedby the University IRB.

Genetic Linkage Marker Analysis

For genetic linkage evaluation of AS families, sixSTR markers in the immediate vicinity of COL4A5were used. These are DXS101, (DXS1230, DXS1120),COL4A5 2B6, DXS1210 and DXS456, listed in chromo-somal order [Fain et al., 1995; Kendall et al., 1997].Linkage at the COL4A3/A4 locus was evaluated with aseries of 9 STR markers, D2S408, D2S2158, D2S1344,ATA24E12, CA11, D2S439, D2S2285, D2S362 andD2S2213. The site for the CA11 STR is within theCOL4A3/A4 locus [Lemmink et al., 1994b, 1996]. Thelisted order of markers is as described at the White-head Institute Human Physical Mapping Project website [http://www-genome.wi.mit.edu]. Additional ge-netic linkage data [D.B., unpublished] indicate thatD2S1344 and possibly D2S2158 are closer to CA11than ATA24E12 is. Primers for the CA11 locus are de-scribed by [Lemmink et al. 1996] and for other loci inthe Genome database [http://gdbwww.gdb.org]. An al-ternate primer pair was used for DXS456 (58 ACTACA-CATGTGATTCTCCCTC 38 and 58 ACACTTGTGCA-CAGGTCTC 38). Allele data were obtained as describedin [Barker and Fain 1993], except that multiplex am-plifications and gel analyses were used where possible.

Multiplex PCR-SSCP

Reactions in a 10 ml volume included 25–50 ng oftemplate human genomic DNA, 67 mM Tris pH 9.0, 16mM (NH4)2SO4, 6.7 mM MgCl2, 0.01% Tween 20, 0.25mM of each primer, 200 mM each of dGTP, dATP anddTTP, 25 mM dCTP, 0.75 mCi of alpha-32P-dCTP (3,000Ci/mmol) and 1 U of BioLase Platinum polymerase(Bioline USA, Reno, NV). The thermal cycling profile,in an Ericomp EasyCycler, included 50 sec at 94°C,followed by 30 cycles of 94°C for 5 sec, 56°C for 1 minand 72°C for 1 min. In a typical screening experiment,four different samples were amplified with the 16 dif-ferent multiplex primer combinations in a 96-well plateformat.

After PCR amplification, 15 ml of denaturing-dye-dilution mix (4.5 mM Tris pH 8, 53% formamide, 11mM Na2EDTA, 0.0275% bromophenol blue and0.0275% xylene cyanol FF) were added. Mixtures wereheated at 85°C for 5 min and placed on ice immediatelybefore loading 2.5 ml. All gels for SSCP [Orita et al.,1989; Hayashi and Yandell, 1993; Sheffield et al., 1993]were 35 cm × 43 cm × 0.4 mm and were prepared andrun at room temperature without cooling. Detailed de-scriptions and comparisons of different gel conditions

COL4A5 Multiplex PCR-SSCP 149

are described in the Appendix. After electrophoresis,gels were dried and autoradiographed.

Sequence Analysis

When SSCP variants were detected, the original ge-nomic template was used for duplicate preparativescale PCR reactions. Pooled products were then gel-purified from agarose, using Wizards (Promega, Madi-son, WI) or Qiaex II (Qiagen, Santa Clarita, CA) kits,and sequenced with 32P end-labeled primers using thefmolt cycle sequencing system (Promega).

RT-PCR

RNA was prepared from fresh leukocytes by themethod of [Chomczynski and Sacchi 1987]. Reversetranscription with Superscript II enzyme (Gibco-BRL,Grand Island, NY) was carried out as described by thesupplier, in a 10 ml reaction including an appropriatelylocated COL4A5 specific primer at 2.5 mM. Four ml ofthe product was used in a primary nested PCR. A sec-ondary nested PCR was prepared with 1 ml of the pri-mary nested product. RT-PCR products were gel-purified and sequenced as described for genomicproducts.

RESULTSDetection and Initial Characterization of

COL4A5 Variants

Full details of development and application of themultiplex method are described in the Appendix. Forprospective SSCP screening, 31 affected males and 15affected or carrier females representing 46 differentfamilies (Fig. 1) were tested. A total of 39 differentCOL4A5 gene variants were detected. These includedthree deletions of two or more exons, 26 differentsingle-base mutations and 10 different single-basepolymorphic variants (Table I). Nearly all of these vari-ants were detected in an initial screen with a singleSSCP gel condition, either 0.4XMDE or 8% (75:1) acryl-amide + 12 mM HEPES gels.

It is possible to readily classify 27 of the detectedCOL4A5 variants listed in Table I as mutations. Theseinclude three multi-exon deletions, three frameshiftingsingle base deletions, seven alterations in consensussplice signal sequences, 12 glycine substitutions in col-lagenous (gly-X-Y) segments and two missensechanges, L1649R and R1677P, affecting conserved resi-dues in the non-collagenous domain. One of the mis-sense changes, L1649R, represents a previously stud-ied mutation that is common in the United Statespopulation due to a founder effect [Barker et al., 1996],whereas the other affects the R1677 residue for whicha missense change to glutamine has also been de-scribed [Barker et al., 1997].

Nine other variants shown in Table I are apparentpolymorphisms. A polymorphic haplotype includingG365G, I444S, P783P, Q1171Q and D1425D has beendetected previously [Knebelmann et al., 1996]. Thishaplotype occurred in two of the 46 families in thisseries and in both cases the silent substitution L685Lwas also present, apparently a sixth polymorphic vari-

ant that is associated with the other five. This raresix-part haplotype was also found in families from ourearlier series and it does not always segregate with thedisease, ruling out the possibility that L685L repre-sents a pathogenic change. A strong allelic associationalso exists for the intronic variants 811+21 T→C and2970 −11 A→G. In eight of 46 samples tested, the SSCPshift patterns corresponding to these two sequencechanges were found together, and the presence of bothvariants was further confirmed by sequencing in threeof the cases. Whereas different pathogenic changeswere found in four of these 8 kindreds, we concludethat these two intronic differences represent polymor-phic variation, with an approximate allele and haplo-type frequency of 8/61 (13%). Another polymorphism,1235 −15delT, was detected in K2302, in an affectedmale with the mutation G295D. The 1235 −15delTvariant did not occur in any of the other 46 tested fami-lies or any of our larger series of more than 200 AScases, and is probably a rare simple repeat polymor-phism (T10→T9).

For three remaining variants M898V (2894 A→G),S916G (2948 A→G), both located in exon 32, and 2712−33 A→G in IVS30, any functional significance was notimmediately evident. Each of these changes is so farunique to the family or case where it was detected andnone is associated with any other apparently causalmutation. To examine the possibility that any of thesechanges causes a disruption of normal gene splicing,mRNA structure was examined by ectopic RT-PCRanalysis. A sample from K2326 was also examined, be-cause the mutation in this kindred, G1006V is a G→Tchange at the +1 position of the exon 35 splice acceptorsite.

The ectopic RT-PCR revealed no RNA changes forthe G1006V, M898V or 2712 −33 A→G samples. In thetwo individuals carrying 2948 A→G, however, onemale and one female, the major cDNA product wasfound to have a complete skip of exon 32. Because 2948A→G occurs at the −22 position with respect to thesplice donor site of exon 32, it seems to be one of thevery rare class of apparent missense or silent muta-tions that cause exon skipping even though they arenot immediately adjacent to splice sites. Previous ex-amples have been described for FBN1 [Liu et al., 1997]and ATM [Teraoka et al., 1999], with no known mecha-nistic basis.

Inspection of related protein structures suggests apotential biological significance for M898. A compari-son of the human Type IV collagens [Leinonen et al.,1994] shows that the evolutionarily related alpha 1, 3and 5 chains all possess a cluster of two or three me-thionine residues in the same immediate vicinity, ei-ther in the same gly-X-Y repeat as M898 or the adja-cent one (Fig. 2). A similar pattern may be present inmouse Col4a1, and mouse Col4a3 but not thealpha3(IV) chain of sea urchin or the alpha1(IV) chainof Drosophila melanogaster (GenBank accession num-bers P02463, AAD50449, A45407, and A31893 respec-tively). Although the human alpha2(IV) chain has twomethionine residues within gly-X-Y repeats that arejust distal to the M898 site, there are none in eithervicinity in the alpha4(IV) or alpha6(IV) chains. Be-

150 Barker et al.

Fig. 1. Pedigrees of the 46 families tested for COL4A5 mutation with the multiplex PCR-SSCP test. Arrows indicate the tested individuals. Clinicalphenotypes relevant to Alport are indicated as summarized in the key. Unfilled quadrants represent the presumed absence of the phenotype or instanceswhere no clinical records were available to confirm the phenotype. The latter group includes absence of documentation for the hematuria phenotype beforeESRD or death in a number of affected males from families with COL4A5 mutations, although all of these males would be presumed to have hadhematuria before renal failure.

cause the methionine codon is unique, the apparentconservation of a cluster of these codons in the humanand mouse alpha1(IV)-related chains but not thealpha2(IV)-related chains is consistent with evolution-ary preservation of an as yet undefined biological func-tion. This function may be related to distinctions in thestructural roles of the alpha1-related chains, alpha3and alpha5, vs. the alpha2-related chains, alpha4 andalpha6. It is notable that the apparent subtlety of thisfunctional significance is mirrored by mild expressionof disease phenotype. In K2347, there are two knowncarriers of M898V, one of each gender. Disease expres-sion in the man, who is more than 65 years old, is so farlimited to moderate hematuria and hearing loss. Mod-erate hematuria in his daughter was the clinical indi-cation for a kidney biopsy that detected changes indica-tive of possible AS or thin GBM disease, a mild andoften benign change in the glomerular basement mem-brane.

The disease phenotype of the individual with the2712 −33 A→G variant in K2319 is also relatively mild.This man has progressive hearing loss, slight renal in-sufficiency in the latter part of his sixth decade and hereports a diagnosis of anterior lenticonus, that is con-

sidered specific for AS. The family history (Fig. 1B) iscomplex, including maternal uncles of the proband whoexperienced renal failure in their seventh decade andcousins whose renal disease and death may have beendue to distinct causes. Most relatives are deceased andno samples are available to examine co-segregation. Apossible functional significance for the observed changeis that it occurs immediately adjacent to a potentialsplice donor sequence (Agtactt→Ggtactt). It is notablethat this change resembles the reverse of a mutationreported at the end of exon 48 (Ggtaagg→Agtaagg),that results in skipping of exon 48 [Lemmink et al.,1994b]. Changing the last nucleotide of exon 49 from Gto C (Ggtattt→Cgtattt) also results in skipping of exon49 [Nomura et al., 1993]. Although these comparisonssuggest that 2712 −33 A→G could result in the activa-tion of a novel splice donor site, no evidence for anynovel ectopic RT-PCR product was found, even whenan intronic primer located upstream of the change wasused in the second stage of a nested RT-PCR. We cannot rule out the possibilities that an undetected level ofalternative splicing at this site is pathogenic or that thepattern of RNA processing in kidney is different thanin leukocytes. The available evidence, however, does

TABLE I. Summary of COL4A5 Mutations and Polymorphisms Detected in 46 Families

No. Classa Exon(s) Kindred(s) Variant Sequence

1 del all 2315 del Pr-ex51 del Pr-ex512 del many 2338 del ex3-ex37 del ex3-ex373 del 43,44 2341 del ex43-ex44 del ex43-ex444 fs 5 2304 495delC 495delC5 fs 19 2328 1264insT 1264insT6 fs 31 2310 2845delG 2845delG7 sp 3 2348 433+1 G→A 433+1 G→A8 sp 4 2306 434−1 G→T 434−1 G→T9 sp 32 2339 ser916gly (sp) AGT→GGT

10 sp 33 2296 3119+1 G→T 3119+1 G→T11 sp 34 2316 3218+1 G→T 3218+1 G→T12 sp 35 2332 3219−1 G→A 3219−1 G→A13 sp 40 2317 3756−1 G→A 3756−1 G→A14 sp 47 2324 4500−1 G→C 4500−1 G→C15 ms 10 2301 gly192arg GGG→AGG16 ms 15 2299 gly292arg GGA→CGA17 ms 15 2302 gly295asp GGC→GAC18 ms 17 2318 gly325arg GGA→AGA19 ms 24 2307 gly558arg GGT→CGT22 ms 25 2323 gly603val GGT→GTT21 ms 25 2308 gly624asp GGT→GAT20 ms 25 2294 gly629asp GGC→GAC23 ms 28 2335 gly722glu GGA→GAA24 ms 32 2347 met898val ATG→GTG25 ms 35 2326 gly1006val gGT→gTT26 ms 36 2331 gly1066ala GGT→GCT27 ms 41 2305 gly1244asp GGT→GAT28 ms 50 2311,2321,2329 leu1649arg CTG→CGG29 ms 51 2342 arg1677pro CGA→CCA30 pmsm 31 2319 2712−33 A→G 2712−33 A→G31 pmsm 19 2302 1235−15 delT 1235−15 delT32 pmsm 19 2303,2309 gly365gly GGG→GGC33 pmsm 20 2303,2309 ile444ser ATT→AGT34 pmsm 27 2303,2309 leu685leu CTT→CTC35 pmsm 29 2303,2309 pro783pro CCG→CCA36 pmsm 39 2303,2309 gln1171gln CAA→CAG37 pmsm 46 2303,2309 asp1425asp GAC→GAT38 pmsm 10 8 Kindreds 811+21 T→C 811+21 T→C39 pmsm 33 8 Kindreds 2970−11 A→G 2970−11 A→G

aVariant classes are del, deletion; fs, frameshift; sp, splicing; ms, missense; pmsm, polymorphism.

152 Barker et al.

not directly support a pathogenic significance for thischange.

Recurrently Observed Mutations

Mutations identical to those described in previousreports occur in four of the 31 families in which mu-tations were detected in this study. Three instances(K2311, K2321 and K2329) of the L1649R changeconfirm the relatively high prevalence of this change,previously reported in 9/121 United States families[Barker et al., 1996]. Two of these newly identifiedL1649R cases reside in the Western half of the UnitedStates and the third is from a large Northeastern state.For these three additional families, no genealogicalconnection has been established with any other familywith the same mutation, although haplotype analysiswith STR markers closely linked to COL4A5 confirmsthat all 12 of the L1649R families share a commonancestral haplotype (data not shown).

Another recurrently observed mutation is G325R inK2318. This mutation has previously been detected inthree different studies [Knebelmann et al., 1992, Re-nieri et al., 1996, Heiskari et al., 1996], with the last ofthese representing K1988, a family from our earliercollection. Comparison of COL4A5 region haplotypes inK1988 and K2318 shows that common ancestry is un-likely. In particular, an affected K1988 male does nothave the less frequent alleles of the exon 10 and exon33 intronic polymorphisms that are present in the af-fected K2318 male. The two independent cases ofG325R most likely reflect the enhanced rate ofCpG→CpA mutations. The mutation G325X, involvinga change of the same nucleotide to T has also beenreported [Kawai et al., 1996].

Assessment of Detection Sensitivity byRe-Evaluation of Mutation-Negative Families

It is not possible to explicitly calculate the mutationdetection efficiency achieved by the test described herebecause the true status of 15 families with no mutationfound is still unknown. To estimate the efficiency, thelikelihood of COL4A5 involvement was reassessed inthese 15 cases. Disease segregation and clinical pheno-types, including biopsy data when available, were re-viewed for diagnostic certainty and likely inheritancemode. All available samples useful for linkage weretyped for genetic markers near COL4A5 and COL4A3/A4. Results, summarized in Table II, indicate that halfor fewer of the mutation-negative cases are likely to

represent instances of undetected COL4A5 mutations.Genetic data for just two kindreds (K2297, K2309) in-dicates COL4A5 linkage to be relatively likely (TableII). In K2295, the affected individual is homozygous fora series of markers near the COL4A3/A4 locus andboth of his parents exhibit mild hematuria. Becauselinkage marker data provide no evidence for uniparen-tal disomy, it is most likely that the parents of theaffected individual share a distant common ancestorwith a COL4A3 or COL4A4 recessive mutation. InK2314, linkage data are consistent with recessive dis-ease linkage to the COL4A3/A4 locus and inconsistentwith COL4A5 linkage. In three other kindreds, (K2320,K2325, K2337) the possibility of any COL4A5 mutationis unlikely because of inconsistencies with COL4A5 re-gion marker linkage or X-linked segregation. Also, inK2337 the diagnosis of Alport syndrome is question-able because there is mainly a strong family history ofhearing loss, and the only living person with chronicrenal symptoms does not have hematuria (Fig. 1). InK2322, marker data provide stronger support for re-cessive COL4A3/A4 linkage than for COL4A5 linkage.Also biopsies on four individuals in this kindred con-sistently include features not typically associated withAS (Table II). Among the seven kindreds in which link-age and segregation data provide no discrimination oflikely inheritance mode, biopsy data are available inthree (Table II). In K2312 the biopsy is consistent withX-linked or recessive Alport. In K2303, the hematuricfemale exhibits uniform thinning of the GBM, that ismore likely to have an autosomal cause. In K2336, thebiopsy results of an affected male do not support a di-agnosis of Alport Syndrome because none of the typicalGBM alterations were observed. Altogether the link-age, phenotype and clinical data indicate that the prob-ability of X-linked Alport is low or very low in eightkindreds, K2295, K2303, K2314, K2320, K2322,K2325, K2336 and K2337 and odds of X-linked diseaseare no better than even in five others. A conservativeassumption is that between 7 and 11 of the 15 muta-tion-negative families have no COL4A5 mutation, im-plying that the sensitivity of the whole gene SSCP fin-gerprint in this patient series is between 79% [31/(46−7)] and 89% [31/(46−11)].

DISCUSSION

The whole gene SSCP fingerprint method describedhere combines effective multiplex PCR amplificationwith sensitive SSCP detection to provide a useful andpractical method for the detection of COL4A5 muta-tions in Alport syndrome. The relatively rapid andsimple procedure provides nearly equal sensitivity formale or female samples with respective raw mutationdetection rates of 21/31 (68%) and 10/15 (67%). Thetechnique can provide results in a time frame suitablefor clinical utility. For one case in this series, where theattempt was made to complete the procedure as quicklyas possible, the sequence of an unknown mutation wasdetermined within seven days of receiving blood froman affected male. Negative results are obtained morequickly, because they do not require the further step ofsequence analysis. Modest protocol refinements, in-

Fig. 2. The clustering of methionine residues in Type IV collagen chainsrelated to COL4A1 (upward carets) is apparently conserved in the vicinityof COL4A5 M898. In contrast, methionine resides that occur in the corre-sponding region of COL4A2 (downward carets) have no counterpart in therelated COL4A4 and COL4A6 genes. Gene alignments are as described by[Leinonen et al. 1994].

COL4A5 Multiplex PCR-SSCP 153

cluding the use of non-radioactive labels that permitreal-time gel migration analysis could further speedthe process and improve its suitability for use in theclinical test laboratory.

The development of a single PCR condition andprimer set that allow direct multiplex amplification ofall functional segments of COL4A5 is a key to the util-ity of the described method. Previous PCR-SSCPscreens of COL4A5 used at least 6 and as many as 22different amplification conditions for single-product re-actions. Though multiplex PCR-SSCP has been de-scribed for several large genes, in most cases the mul-tiplex covers only part of the gene [Kneppers et al.,1995], or requires more than one PCR condition for acomplete set of multiplex combinations [Ozcelik andAndrulis 1995; Berx et al., 1997]. In some multiplexapplications it is also necessary to include a secondarydetection step, such as hybridization with specificprobes, to observe the products specific for each exon[Weiss et al., 1996; Pogue et al., 1998]. Multiplex am-plification of very large genes has also been used effec-tively in conjunction with mutation detection by 2-DDGGE [Van Orsouw et al., 1998; Van Orsouw and Vijg,

1999] or by the high density oligonucleotide arrayscalled DNA chips [Hacia et al., 1998]. These applica-tions employed a two-stage nested PCR or PCR fol-lowed by transcriptional amplification respectively togenerate the nucleic acid samples for scanning. 2-DDGGE and DNA chip hybridization are also more tech-nically demanding or capital intensive than SSCP, al-though also providing a potentially higher degree ofdetection sensitivity. Nevertheless, the single-condition multiplex direct PCR-SSCP approach hasconsiderable advantages of logistic simplicity that mayoften justify the slight sacrifice of detection sensitivity.For example, the method may provide a convenientpreliminary screen to reduce the use of more elaborateand expensive detection techniques [Ganguly andWilliams, 1997].

Based on the detection of pathogenic changes andphenotypic and genetic characterization, we estimatethat between 79% and 89% of the COL4A5 mutationspresent were detected in the 46 screened families. Theunadjusted detection rate of 67% compares favorably torates between 33% and 50% reported for previousSSCP screens of COL4A5 [Kawai et al., 1996; Renieri

TABLE II. Summary of Genetic Linkage and Disease Segregation Patterns in the 15 Mutation-Negative Kindreds andComparison of Biopsy Features With Those From Patients With Detected Mutations*

Kin.4A5

Mutation4A5a

Link4A5Seg

4A3/A4Link

4A3/A4Seg Genetic evaluation

Biopsy datab

Gender/Age Sclerotic T t Split Foam

2295 none found O − ++ ++ 4A3/A4 —2314 none found −− − ++ ++ 4A3/A4 —2322 none found + + ++ + 4A3/A4 more likely than A5 M/3.8c 0/115 — — f NA

M/3.8c 0/77 — — f NAM/6.4c 0/45 f — — NAF/35c 2/29 NA NA NA NA

2325 none found O − + + 4A3/A4 likely F/8.4 0/14 f f f none2320 none found − + − + 4A3/A4 or A5 unlikely M/5 0/29 f f + none2337 none found O − O − not 4A3/A4 or A5, Alport? —2298 none found O + O + either possible —2303 none found O + O + either possible F/9.3 0/18 — U — NA2312 none found + + + + either possible M/21 1/3 f f + many2319 none found O O O O either possible —2327 none found O + O + either possible —2336 none found O O O O either possible M/31.6 18/32 — — — none2346 none found O + O + either possible —2297 none found O + O − 4A5 more likely than A3/A4 —2309 none found O ++ O − 4A5 likely —2294 gly629asp 4A5 mutation F/43 5/9 f f + few2305 gly1244asp 4A5 mutation M/41 2/31 f f + NA2308 gly624asp 4A5 mutation M/44 12/15 f — + NA2310 2845delG 4A5 mutation M/7 0/25 f f + few2335 gly722glu 4A5 mutation F/33.4 2/20 f f + many2341 del ex43-44 4A5 mutation M/9.1 0/20 f f + few2347 met898val 4A5 mutation F/40.8 0/25 — f NA NA2348 433+1 g→a 4A5 mutation M/21.9 3/16 — f — NA

*Kindreds are listed in a spectrum ranging from those most likely to represent recessive disease (COL4A3/A4) to indeterminate to those with likely orproven X-linked disease (COL4A5).aColumns marked 4A5 link and 4A3/A4 link summarize results of examining genetic markers tightly linked to these loci. “0” indicates non-informativeness for linkage. Generally, “+” and “++” indicate consistency of one or two phase-established meioses with linkage to the locus, whereas “−”and “− −” indicate the number of phase-established meioses that are inconsistent with linkage, based on apparent phenotypes. In columns marked 4A5seg and 4A3/A4 seg, a segregation score, −, 0, + or ++ was assigned to reflect the likelihood of X-linked (COL4A5) or autosomal recessive inheritance(COL4A3/A4) based on review of all disease history and inheritance information available in each kindred.bRenal biopsy data are for individuals of the indicated gender and age (in years). Pathology reports from various institutions were collated and therelevant ultrastructural abnormalities tabulated. The number of sclerotic glomeruli among those observed in each specimen is shown. In columns T(thickening), and t (thinning) the feature is absent (−), focal (f) or uniform (U). In column Split (splitting) the feature is present (+), focal (f) or absent (−).The presence and quantitative impression of foam cells is shown. A mark of NA indicates that no mention occurs in the biopsy report.cIn K2322, the three affected males had anterior lenticonus, generally considered a pathognomonic feature of Alport syndrome, but also had varyingdegrees of vesico-ureteric reflux. All four biopsied members had clear immunofluorescence and ultrastructual evidence of immune complex glomerulo-nephritis.

154 Barker et al.

et al., 1996; Knebelmann et al., 1996; Plant et al., 1999]even though our clinical criteria for initial inclusion inthe screening were relatively broad. The use of HEPESadditive noticeably reduced the missed detection ratefor a series of different COL4A5 point mutations andpolymorphisms (see Appendix), strongly confirming itsreported utility [Liu and Sommer, 1998]. The primerset used in this experiment was also designed to pro-vide better coverage of exon-adjacent regions. The pro-portion of intronic mutations detected, 7/29 (24%), isnotably higher than the proportion of these mutationsdetected in the combined total, 32/207 (15%), from thefour earlier large-scale SSCP screens. This result mayindicate a significant improvement in detection of in-tronic mutations with this primer set, although one ofthe four earlier studies also reported a relatively highproportion, 26%, of intronic mutations [Knebelmann etal., 1996]. The inclusion of additional intronic sequencein the PCR products screened here also resulted in thedetection of four novel intronic polymorphisms.

The low rate of undetected mutations in families thatare likely to be X-linked and the absence of any directevidence for the involvement of any other X-linkedgene in the etiology of AS are consistent with the viewthat any undetected X-linked mutations occur inCOL4A5. These cryptic mutations may include dele-tions in female samples or other gross rearrangementsthat also do not result in alterations of any genomicPCR product. Point mutations that do not cause SSCPshifts of the PCR products screened under the gel con-ditions employed or mutations located in promoter orintronic regions that we have not assayed would also bemissed. Because the COL4A5 gene contains more than100 kb of intron sequence, there are also significantpossibilities for point mutations, small insertions orother minor rearrangements within introns that couldalter production or structure of normal mRNA. An ex-ample of this is a point mutation within an intron ofCOL4A3 that activates a cryptic splice acceptor siteresulting in a transcript that is disrupted by a 74 baseinsertion [Knebelmann et al., 1995].

The 2948 A→G mutation does not cause the expectedS916G amino acid substitution, but rather results inskipping of exon 32, and represents a class of mutationnot previously reported for COL4A5. In two previouscases of mutations affecting COL4A5 coding sequencesand resulting in exon skipping, the affected nucleotideis immediately adjacent to the splice donor sequence[Nomura et al., 1993; Lemmink et al., 1994a]. In con-trast, the 2948 A→G change is located at position −22with respect to the splice donor site. No mechanisticbasis to explain this class of mutation is known [Liu etal., 1997; Teraoka et al., 1999]. Because very few of theapparent missense mutations affecting glycine resi-dues in COL4A5 or other collagen genes have beencharacterized for an effect on splicing, it is possible thatsome of these might also cause exon skipping.

Two other novel and unique variants detected in thisstudy, M898V and 2712 −33 A→G have been tentative-ly classified as a missense mutation and a polymor-phism respectively. The conservation of methionineresidues in the vicinity of M898 in the Type IV collagenchains related to alpha1 but not in those related to

alpha2 suggests a chain-specific functionality. The sixdifferent Type IV chains have different developmentaland organ-specific expression patterns and are foundin only a limited number of the possible trimeric forms[reviewed by Sado et al., 1998]. Specific aspects of pri-mary structure must underlie the inferred distinctionsin functional properties, however no mutations affect-ing chain-specific elements have been identified. Asidefrom the conserved gly-X-Y repeat and the presence ofdistinctive interruptions in the gly-X-Y repeat patternof different Type IV collagens [Leinonen et al., 1994;Long et al., 1995] there is little detailed knowledge ofany chain-specific structure/function relation. There isalso considerable uncertainty in attributing pathogenicsignificance to a site with only a moderate degree ofevolutionary conservation. Opportunities for detection,accurate diagnosis and characterization of relativelymild disease phenotypes caused by loss of a secondaryfunctionality in a Type IV chain may often be missed.Because M898V occurs at a site exhibiting a modestlevel of evolutionary conservation and is associatedwith a very mild phenotypic expression, it has the pos-sible characteristics of a mutation affecting a chain-specific functional domain. In the case of another noveland unique variant, 2712 −33 A→G, we have been un-able to obtain direct evidence for any pathogenic dis-ruption and have therefore tentatively classified it as arare polymorphism. The nature of this variant and itsassociation with relatively mild disease expression,however, leaves open the possibility that it or othersimilar sequence alterations could cause relativelysubtle and mildly pathogenic disruptions in normalmRNA production.

In summary, the adaptable method described hereprovides a rapid and effective mutation screening toolfor COL4A5. With appropriate modification for clinicalapplication, it could, in many cases, obviate the needfor more elaborate and expensive mutation detectionapproaches such as sequencing of all exons or oligo-nucleotide array analysis. This would provide a safer,less expensive, and in some circumstances, a more con-clusive diagnostic test for possible Alport syndromethan renal biopsy. Further insights into the biologicalproperties of the COL4A5 gene and its product mightbe revealed by using this convenient test to screen forgenetic variants in a broader clinical population.

ACKNOWLEDGMENTS

This work was supported by NIH DK43761 to D.B.and NIH CA42014 to the University of Utah CancerCenter core peptide and DNA synthesis facility. Itwould not have been possible without the helpful coop-eration of individuals in every studied family. Wethank Matthew R. Donaldson, Eduardo Almeida,Xudong Liu, Miao He and Jian Zhou for providing labo-ratory assistance during this work. We are indebted toJing Zhou, Sirkka-Liisa Hostikka and Karl Tryggvasonfor providing genomic COL4A5 clones and to PaulaMartin and Karl Tryggvason for access to genomic se-quence information while it was still in press. The sur-viving authors wish to express their deep appreciationof their deceased colleague, Curtis L. Atkin, for his

COL4A5 Multiplex PCR-SSCP 155

friendship, scholarly guidance and the enduring inspi-ration that he provided for studies related to Alportsyndrome at the University of Utah.

REFERENCES

Alport AC. 1927. Hereditary familial congenital haemorrhagic nephritis.Br Med 1:504–506.

Barker DF, Hostikka S-L, Zhou J, Chow LT, Oliphant AR, Gerken SC,Gregory MC, Skolnick MH, Atkin CL, Tryggvason K. 1990. Identifica-tion of mutations in the COL4A5 collagen gene in Alport syndrome.Science 248:1224–1227.

Barker DF, Fain PR. 1993. Definition and mapping of STSs at STR andRFLP loci in Xp11–Xq22. Genomics 18:712–716.

Barker DF, Pruchno CJ, Jiang X, Atkin CL, Stone E, Denison J, Fain PR,Gregory MC. 1996. A mutation causing Alport syndrome with tardivehearing loss is common in the western United States. Am J Hum Genet58:1157–1165.

Barker DF, Denison J, Atkin CL, Gregory MC. 1997. Common ancestry ofthree Ashkenazi-American families with Alport syndrome andCOL4A5 R1677Q. Hum Genet 99:681–684.

Berx G, Nollet F, Strumane K, van Roy F. 1997. An efficient and reliablemultiplex PCR-SSCP mutation analysis test applied to the human E-cadherin gene. Hum Mut 9:567–574.

Bloem LJ, Yu L. 1991. A time-saving method for screening cDNA or geno-mic libraries. Nucleic Acids Res 18:2830.

Boye E, Flinter F, Zhou J, Tryggvason K, Bobrow M, Harris A. 1995.Detection of 12 novel mutations in the collagenous domain of theCOL4A5 gene in Alport syndrome patients. Hum Mut 5:197–204.

Boye E, Mollet G, Forestier L, Cohen-Solal L, Heidet L, Cochat P, GrunfeldJ-P, Palcoux J-B, Gubler M-C, Antignac C. 1998. Determination of thegenomic structure of the COL4A4 gene and of novel mutations causingautosomal recessive Alport syndrome. Am J Hum Genet 63:1329–1340.

Chomczynski P, Sacchi N. 1987. Single-step method of RNA isolation byacid guanidinium thiocyanate-phenol-chloroform extraction. Anal Bio-chem 162:156–159.

Fain PR, Kort EN, Chance PF, Nguyen K, Redd DF, Econs MJ, Barker DF.1995. A 2D crossover-based map of the human X chromosome as amodel for map integration. Nat Genet 9:261–265.

Ganguly A, Williams C. 1997. Detection of mutations in multi-exon genes:comparison of conformation sensitive gel electrophoresis and sequenc-ing strategies with respect to cost and time for finding mutations. HumMut 9:339–343.

Glavac D, Dean M. 1993. Optimization of the single-strand conformationpolymorphism (SSCP) technique for detection of point mutations. HumMut 2:404–414.

Gregory MC, Atkin CL. 1997. Alport syndrome, Fabry Disease, and NailPatella Syndrome, In: Schrier RW, Gottschalk CW, editors. Diseases ofthe kidney. Boston: Little, Brown and Company. p 561–590.

Guo C, Van Damme B, Van Damme-Lombaerts R, Van den Berghe H,Cassiman J-J, Marynen P. 1993. Differential splicing of COL4A5mRNA in kidney and white blood cells: a complex mutation in theCOL4A5 gene of an Alport patient deletes the NC1 domain. Kidney Intl44:1316–1321.

Hacia JG, Sun B, Hunt N, Edgemon K, Mosbrook D, Robbins C, Fodor SP,Tagle DA, Collins FS. 1998. Strategies for mutational analysis of thelarge multiexon ATM gene using high-density oligonucleotide arrays.Genome Res 12:1245–1258.

Hayashi K, Yandell DW. 1993. How sensitive is PCR-SSCP? Hum Mut2:338–346.

Heiskari N, Zhang X, Zhou J, Leinonen A, Barker D, Gregory M, Atkin C,Netzer KO, Weber M, Reeders S, Gronhagen-Riska C, Neumann H,Trembath R, Tryggvason, K. 1996. Identification of 17 mutations in tenexons in the COL4A5 collagen gene, but no mutations found in fourexons in COL4A6: a study of 250 patients with hematuria and sus-pected of having Alport syndrome. J Am Soc Nephrol 7:702–709.

Jefferson JA, Lemmink HH, Hughes AE, Hill CM, Smeets HJM, DohertyCC, Maxwell AP. 1997. Autosomal dominant Alport syndrome linked tothe type IV collagen alpha3 and alpha4 genes (COL4A3 and COL4A4).Nephrol Dial Transpl 12:1595–1599.

Kashtan CE. 1998. Alport syndrome and thin glomerular basement mem-brane disease. J Am Soc Nephrol 9:1736–1750.

Kawai S, Nomura S, Harano T, Harano K, Fukushima T, Osawa G, The

Japanese Alport network. 1996. The COL4A5 gene in Japanese Alportpatients: spectrum of mutations of all exons. Kidney Intl 49:814–822.

Kendall E, Evans W, Jin H, Holland J, Vetrie D. 1997. A complete YACcontig and cosmid interval map covering the entirety of human Xq21.33to Xq22.3 from DXS3 to DXS287. Genomics 43:171–182.

Knebelmann B, Deschenes G, Gros F, Hors M-C, Grunfeld J-P, TryggvasonK, Gubler M-C, Antignac C. 1992. Substitution of arginine for glycine325 in the collagen alpha 5 (IV) chain associated with X-linked Alportsyndrome: characterization of the mutation by direct sequencing ofPCR amplified lymphoblast cDNA fragments. Am J Hum Genet 51:135–142.

Knebelmann B, Forestier L, Drouot L, Quinones S, Chuet C, Benessy F,Saus J, Antignac C. 1995. Splice-mediated insertion of an Alu sequencein the COL4A3 mRNA causing autosomal recessive Alport syndrome.Hum Mol Genet 4:675–679.

Knebelmann B, Breillat C, Forestier L, Arrondel C, Jacassier D, Giatras I,Drouot L, Deschenes G, Grunfeld J-P, Broyer M, Gubler M-C, AntignacC. 1996. Spectrum of mutations in the COL4A5 collagen gene in X-linked Alport syndrome. Am J Hum Genet 59:1221–1232.

Kneppers ALJ, Deutz-Terlouw P, den Dunnen JT, van Ommen GJB, Bak-ker E. 1995. Point mutation screening for 16 exons of the dystrophingene by multiplex single-strand conformation polymorphism analysis.Hum Mut 5:235–242.

Lemmink HH, Kluijtmans LAJ, Brunner HG, Schroder CH, KnebelmannB, Jelinkova E, van Oost BA, Monnens LAH, Smeets HJM. 1994a.Aberrant splicing of the COL4A5 gene in patients with Alport syn-drome. Hum Mol Genet 3:317–322.

Lemmink HH, Mochizuki T, van den Heuvel LPWJ, Schroder CH, Barri-entos A, Monnens LAH, van Oost BA, Brunner HG, Reeders ST,Smeets HJM. 1994b. Mutations in the type IV collagen alpha3(COL4A3) gene in autosomal recessive Alport syndrome. Hum MolGenet 3:1269–1273.

Lemmink HH, Nillesen WN, Mochizuki T, Schroder CH, Brunner HG, vanOost BA, Monnens LAH, Smeets HJM. 1996. Benign familial hematu-ria due to mutation of the type IV collagen alpha4 gene. J Clin Invest98:1114–1118.

Leinonen A, Mariyama M, Mochizuki T, Tryggvason K, Reeders ST. 1994.Complete primary structure of the human type IV collagen alpha4(IV)chain: comparison with structure and expression of the other alpha(IV)chains. J Biol Chem 269:26172–26177.

Liu Q, Sommer SS. 1998. The SSCP phenomenon: addition of HEPESbuffer dramatically affects electrophoretic mobility. Biotechniques 25:50–56.

Liu W, Qian C, Francke U. 1997. Silent mutation induces exon skipping offibrillin-1 gene in Marfan Syndrome. Nat Genet 16:328–329.

Long CG, Thomas M, Brodsky B. 1995. Atypical Gly-X-Y sequences sur-round interruptions in the repeating tripeptide pattern of basementmembrane collagen. Biopolymers 35:621–628.

Mariyama M, Leinonen A, Mochizuki T, Tryggvason K, Reeders ST. 1994.Complete primary structure of the human alpha3(IV) collagen chain. JBiol Chem 269:23013–23017.

Martin P, Heiskari N, Zhou J, Leinonen A, Tumelius T, Hertz JM, BarkerD, Gregory M, Atkin C, Styrkarsdottir U, Neumann H, Springate J,Shows T, Pettersson E, Tryggvason K. 1998. High mutation detectionrate in the COL4A5 collagen gene in suspected Alport syndrome usingPCR and direct DNA sequencing. J Am Soc Nephrol 9:2291–2301.

Mochizuki T, Lemmink HH, Mariyama M, Antignac C, Gubler M-C, PirsonY, Verellen-Dumoulin C, Chan B, Schroder CH, Smeets HJ, ReedersST. 1994. Identification of mutations in the alpha3(IV) and alpha4(IV)collagen genes in autosomal recessive Alport syndrome. Nat Genet 8:77–81.

Nomura S, Osawa G, Sai T, Harano T, Harano K. 1993. A splicing mutationin the alpha5(IV) collagen gene of a family with Alport syndrome. Kid-ney Intl 43:1116–1124.

Ozcelik H, Andrulis IL. 1995. Multiplex PCR-SSCP for simultaneousscreening for mutations in several exons of p53. Biotechniques 18:742–744.

Orita M, Suzuki Y, Sekiya T, Hayashi K. 1989. Rapid and sensitive detec-tion of point mutations and DNA polymorphisms using the polymerasechain reaction. Genomics 5:874–879.

Plant KE, Green PM, Vetrie D, Flinter FA. 1999. Detection of mutations inCOL4A5 in patients with Alport syndrome. Hum Mut 13:124–132.

Pogue R, West S, Bushby K. 1998. Multiplex SSCP and heteroduplexanalysis with Southern hybridization for large-scale mutation detec-tion. Genomics 54:1–4.

156 Barker et al.

Renieri A, Bruttini M, Galli L, Zanelli P, Neri T, Rossetti S, Turco A,Heiskari N, Zhou J, Gusmano R, Massella L, Banfi G, Scolari F, SessaA, Rizzoni G, Tryggvason K, Pignatti PF, Savi M, Ballabio A, DeMarchiM. 1996. X-linked Alport syndrome: an SSCP-based mutation surveyover all 51 exons of the COL4A5 gene. Am J Hum Genet 58:1192–1204.

Sado Y, Kagawa M, Naito I, Ueki Y, Seki T, Momota R, Oohashi T,Ninomiya Y. 1998. Organization and expression of basement mem-brane collagen IV genes and their roles in human disorders. J Biochem(Tokyo) 123:767–776.

Sheffield V, Beck JS, Kwitek AE, Sandstrom DW, Stone EM. 1993. Thesensitivity of single-strand conformation polymorphism analysis forthe detection of single base substitutions. Genomics 16:325–332.

Smeets HJM, Jais JP, Knebelmann B, DeMarchi M, Rizzoni G, Renieri A,Weber M, Gross O, Flinter F, Pirson Y, Verellen C, Wieslander J, Pers-son U, Tryggvason K, Hertz JM, Sanak M, Carvalho MF, Saus J, An-tignac C, Gubler MC. 1998. A multicenter European study on genotype-phenotype correlations in autosomal recessive Alport syndrome. Am JHum Genet 63S:A386.

Soininen R, Huotari M, Ganguly A, Prockop DJ, Tryggvason. 1989. Struc-tural organization of the gene for the alpha1 chain of human type IVcollagen. J Biol Chem 264:13565–13571.

Sugimoto M, Oohashi T, Ninomiya Y. 1994. The genes COL4A5 andCOL4A6, coding for basement membrane collagen genes alpha5(IV)and alpha6(IV), are located head-to-head in close proximity on humanchromosome Xq22 and COL4A6 is transcribed from two alternativepromoters. Proc Natl Acad Sci USA 91:11679–11683.

Teraoka SN, Telatar M, Becker-Catania S, Liang T, Onengut S, Tolun A,Chessa L, Sanal O, Bernatowska E, Gatti RA, Concannon P. 1999.Splicing defects in the ataxia-telangiectasia gene, ATM: underlyingmutations and consequences. Am J Hum Genet 64:1617–1631.

van Orsouw NJ, Dhanda RK, Rines RD, Smith WM, Sigalas I, Eng C, VijgJ. 1998. Rapid design of denaturing gradient-based two-dimensionalelectrophoretic gene mutational scanning tests. Nucleic Acids Res 26:2398–2406.

van Orsouw NJ, Vijg J. 1999. Design and application of 2-D DGGE-basedgene mutational scanning tests. Genet Anal 14:205–213.

Vetrie D, Flinter D, Bobrow M, Harris A. 1992. X inactivation patterns infemales with Alport syndrome: a means of selecting against a delete-rious gene? J Med Genet 29:663–666.

Weiss N, Eggersdorfer I, Keller C. 1996. Multiplex-PCR-based single-strand conformation polymorphism protocol for simultaneous analysisof up to five fragments of the low-density-lipoprotein receptor gene.Biotechniques 20:421–429.

Zhang X, Zhou J, Reeders ST, Tryggvason. 1996. Structure of the humantype IV collagen COL4A6 gene, which is mutated in Alport syndrome-associated leiomyomatosis. Genomics 33:473–479.

Zhou J, Leinonen A, Tryggvason K. 1994. Structure of the human type IVcollagen COL4A5 gene. J Biol Chem 269:6608–6614.

APPENDIX: MULTIPLEX PCR-SSCPOF COL4A5

Primer Set Development

At the time this work began, published intronic se-quence adjacent to each end of most COL4A5 exonswas limited to about 20 bases, and genomic clones forexons 2 and 37 were unavailable [Zhou et al., 1994;Heiskari et al., 1996]. To design PCR primers thatwould allow complete screening coverage of consensussplice sites, and all coding regions, additional genomicsequence information was required. Lambda vector ge-nomic clones for COL4A5 exons 2 and 37 were isolatedfrom the Los Alamos X-specific library LAOXNL01 bycombining PCR-monitored fractionation and standardplaque hybridization [Bloem and Yu, 1991]. The origi-nating laboratories provided several previously iso-lated COL4A5 genomic clones [Zhou et al., 1994]. Prim-ers designed from cDNA and published genomicsegments were then used to obtain additional se-quences adjacent to exons.

The genomic structures of exons encoding the differ-entially spliced 18 base cDNA segment between exons41 and 42 [Guo et al., 1993] were determined by se-quencing a genomic clone spanning this region withprimers designed from the novel portion of cDNA. Ini-tial results showed that only the 58 9 bp of this segmentwere included in one exon, and a sequencing primerspecific for the second 9 base segment was used to de-termine the sequence in the vicinity of the second exon.

While this work was in progress, Martin et al. [1998]published additional sequence information that wasalso used in some cases to design genomic primers. Theprimer set used here includes sequences beyond thosedescribed by Martin et al. [1998] for exons 6, 7, 9, 16,17, 20–23, 26, 30–35, 39, 40, 42, 44–49 and the differ-entially spliced exons. Primers for the COL4A5/A6 in-tergenic region were designed with the D28116 se-quence from GenBank [Sugimoto et al., 1994].

Selection of Multiplex Combinations

Selection of possible multiplex combinations for mu-tation analysis was based on relative mobilities andbanding patterns observed with single products. Theinclusion of overlapping segments, such as those in thepromoter region and the exon 12/13 region that wouldcreate very short competing products was avoided.Testing of candidate multiplexes showed generallygood product yields and specificity, allowing gel reso-lution to be used as a primary criterion in the finalselection of combinations for screening. Single-productand multiplex testing also showed that a single largeproduct containing exon 1 produced a very diffuse,smeared pattern on SSCP gels. Additional primerswere designed to amplify exon 1 in two overlappingsegments and each of these produced more discreteSSCP bands. Products for two other exons, 18 and 23,gave poor yields in multiplex reactions and this wascorrected by choosing alternate primers for these ex-ons. Only one multiplex combination, S8, showed anovel non-specific product and this did not affect theyield or SSCP analysis of the specific products in thismultiplex. One of the analyzed Alport samples laterproved to have a complete deletion of the COL4A5gene, and in this instance, the non-specific productbands in S8 showed that the absence of COL4A5 prod-ucts was not due to technical error.

Table III summarizes the primers used for multiplexgenomic amplification. Four primer pairs provide over-lapping coverage of a region that includes the shortintergenic COL4A5/A6 promoter region and extendspast the 38 end of COL4A5 exon 1. Single PCR productsinclude each of the remaining exons of COL4A5 exceptfor four segments containing closely adjacent exons 5/6,11/12, 14/15 and 43/44, that are amplified together. Allexon-specific primers are well separated from spliceconsensus sequences, with an average upstream dis-tance of 70 bp (minimum 30 bp) and an average down-stream distance of 54 bp (minimum 16 bp). The rangeof fragment sizes is 181–443 with an average of 280 bp.

Table IV summarizes the combinations of primerpairs used for whole gene SSCP fingerprinting. In ad-

COL4A5 Multiplex PCR-SSCP 157

dition to the pairs described in Table III, two alternateprimer pairs for exons 41 and 51 were also included.The alternate exon 51 pair was included because thesmaller product shows a more evident SSCP shift withthe relatively frequent R1677Q mutation [Barker etal., 1997]. Segments 1 58, 1 38, 11+12, 14+15, 16, 31, 37,38, 41 and 50 were selected for duplicate coveragebased on various secondary considerations such as fre-quency of mutation (exons 31, 41 and 50), occasional

variability in normal SSCP pattern (exons 1 58, 1 38 and31) or the availability of open mobility slots in the fin-gerprint pattern. Although redundancy is not essentialto the method, it can aid the interpretation of multiplexSSCP patterns by providing additional visual cues con-cerning pattern orientation and band specificity. Com-parison of duplicate patterns also provides informationon the degree of variation in the appearance of identi-cal fragment groups. This can differ with very slight

TABLE III. COL4A5 Specific Primers for Multiplex Amplification

COL4A5segment 58 Primer sequence Dista Codeb 38 Primer sequence Dista

Size(bp)

Pseg1 TGTGAGCAGCTGGAAGGTA NA Promoter GAGGGAAACTTCCAGACTAGTT NA 278Pseg2 ATAGTCCCAGTTTAGATCTATTTGT NA Promoter CCCTCCCCTCCCCAAAG NA 382exon 1 58 CTGGACAGAAGGGAAAAGTT NA 58UTR CCGCAGCTCCTTCAGCA NA 237exon 1 38 TTATGTCAATTGGTTAGAGCCA NA UTR,81 AAAAAGGTAATTTCAGCGTGA 41 214exon 2 GTAAGTCAGAGTCTGATTTTTGG 42 60 AAAACCATTAGTTTACTGGCTT 34 181exon 3 TCTCAACCATGCCTGTGCTT 44 90 TGATGTGACACCTACTCCCAC 54 229exon 4 TCACAGATGTTTACAGTAGTTTAAA 79 45 GTCTCATAATACTTCATTTGTTCT 50 223exon 5 + 6 TATTTTATTTTTATGGGTTGTCAT 30 45,63 TTGATTTCTTTAGGTTTTTAAGTT 46 317exon 7 TGGGATAGATGAATTGGGATAA 184 54 GCATTGGGCTCTCTCACTACA 57 338exon 8 CAGAAATGACGCTACAGCAGT 93 27 ATTGAAGTTGCCAGCTTTCCT 45 208exon 9 CATTTTTCTGGTTTTGCTGGTT 49 81 GAGAGTACTAAAGGTTGAGGGAT 58 233exon 10 CGACACAAGTGAGACTTTGTGTAA 71 63 AAAGAAGTCAGAAAGGAAAGGG 30 211exon 11 + 12 TCACACCTTACTCTTTCTGAAACT 65 36,42 AAAAGACAGTTCAAATGACTACA 48 328exon 13 TCCAGGGACCCAAAGGT 177 6(pt),93 TGTGATGTGATTACCACCAT 58 359exon 14 + 15 ATGAAAATGCATGTTCCAGTA 35 54,57 CACACACACACACATTTAGAAT 36 320exon 16 TTAATATAGTCCAAGCCAGGAA 83 45 CTGCCACCTTATGTTATACCAA 49 221exon 17 GAGAAGACAATCTTTGGAGATT 51 54 AAGAAAAGGATTATTTTAGCTAGAC 34 186exon 18 TGGAAAGTTTCTCTTATATTCTTG 58 42 TTAAGGCACAAAAATGATAATGC 43 190exon 19 CAGGCTTTTCTTCTTTGCAT 31 133 ACATGGATTAGTAAGGATGCT 34 239exon 20 CCAGAATTATATGTTAAAGGAAGAT 82 174 GCCAACCTTTAGCTAGAGTTACTT 57 362exon 21 TTTTTCTGGCTTGTCAGGCT 64 84 GTGATGGAGGATACAGGGGAT 59 248exon 22 GTGGAAATGCTGTCCCTTAG 80 93 GACTAGTTATAAAATGAGAAACTGG 75 293exon 23 ATGGGATTGAATGGGGTTCT 117 71 TGTGTAAAATGCCTTCCTTCTACT 32 264exon 24 AATGTTAGAAAAAAAGAAACTGATT 58 192 TCCTTTGAATTAACTTAGAAAACA 52 351exon 25 ACCAACCTACAGATAGTTGTTGTA 36 169 GGAAGCCATGAGTAGCCAA 58 306exon 26 TTAAAAAGAGACCTTTAGTTGAGT 40 93 AAAAAAAAAAGCCATCGGTGTT 31 209exon 27 CTGATGGCTTCTTTCTTTGAA 34 105 TATGAGAGAATAACATCATGCTAA 39 223exon 28 TTGAATATCTTTCTTAAAGTGCCT 38 98 AGAGCTAGAAATAAGGAAGGTGG 44 227exon 29 AGGACAGAAAAGTCATGGGAGT 32 151 AACTTTCCCAAAGGTGTCAA 49 274exon 30 CTTAATATGATATGGTTCCCAAG 54 114 GGTTTCACTTTATTGATGAGCTAA 51 266exon 31 GGGTTCTATCACTTGTTTACTAGA 66 168 CATGGGAATTATCTACCAGAGT 54 334exon 32 CAATAGTTTTCTGGTTGACATCT 69 90 AAATATTCTGTACTGACATAAAGC 51 255exon 33 TTATATGCATTAATCTTTGATGGA 40 150 AAGTGCCTTTGTTGGTGAAT 89 323exon 34 TGAGTAGCTTGCTTTGCCA 60 99 TCCACAGCATCTTCAAACAT 74 272exon 35 GCATTTTAATGACTATCCATTCC 63 90 CCACCTTTCATTAATGGGACT 28 225exon 36 TGCTTTGTCATATGCATCTTAGA 56 140 AAAAATTTCATATCTGCTCAAGT 30 272exon 37 ACTTACTGGAGTGCCTGACA 90 127 GCTCTGTGATACTGGTTGGAG 46 304exon 38 TCACTGTTTCTATGCTAGCACT 78 81 ACATGATTTTGACTTTCCCA 58 259exon 39 GGAAGTAAAAGGGAGTTGGA 42 99 GGCAAGTTAAATTCAACACAGA 39 222exon 40 ATACATTGCTGCACCTAATGA 90 51 TGAGTTTTCTGGGTTCTTACA 101 284exon 41c AATTGCCCTAATGTATGTGAA 68 186 ACTGAATAACCTGCCAGCAA 54 349exon 41.3K GCATGGATATGAACTTTCAGA 142 9 GAATTGGCACATATGCTCTT 87 279exon 41.6K TATAAGAAATGCTGGCAAAGA 125 9 GCACTCTCCAATGACTTCTGA 87 263exon 42 TGACTGATATTTTAAAAGCCTGA 58 134 TGTTAATTAAAATGATGCAGCTT 67 305exon 43 + 44 ATGCCCTCAATCACCTTC 49 73,72 TGGCTGAAAGACAGAATGA 64 428exon 45 TCACTTTGGCTTCCATTTC 47 129 AACCACCATGGCAAGTGTA 88 302exon 46 TGTCTCCTAGATCTGTCCAGA 48 99 TCACCAGTCAGCTATGCTAA 103 291exon 47 TCCTAGCCCATGATATCTGA 133 213 GGCTACTCTAGAACCCAACAG 56 443exon 48 AGGCTGGCAAGTTTCCT 86 178 GGATTGGTAAAAGTCACAGC 16 317exon 49 TTGTGATCATTGAAAGAGACAT 100 115 GCAAATGACAGGGATTCC 73 328exon 50 AGCACACATCTTTGGATATTCA 62 173 TGTTGAGGATAAACCATCCA 71 340exon 51c AACCAGTAACAGAATTGAAATACC 40 82,38UTR TCATATATAGTAGCACCATTGACG NA 268

Na indicates that a primer is either not immediately adjacent to or lies within a coding region.aNumber of nucleotides between the 38 end of the primer and the first nucleotide of the exon coding region.bLength of the coding region(s) included in the product or the nature of any non-coding portion.cSee Table IV for alternate 38 primer used for redundant coverage of these exons.

158 Barker et al.

changes in experimental conditions and critically af-fects assessment of the significance of subtle SSCPshifts.

PCR Reaction and SamplePreparation Conditions

The use of BioLase Platinum enzyme contributedsignificantly to the production of legible SSCP pat-

terns. Although standard Taq polymerases (e.g., Pro-mega, Sigma) resulted in successful multiplex amplifi-cation under these conditions, the BioLase enzymeproduced more uniform product yields and a lower non-specific background.

Under the conditions described for preparingsamples for gel-loading, duplexes and heteroduplexesmay re-form rapidly, but at least 50% of the product

TABLE V. Evaluation of Detection of Reported COL4A5 Single-Base Variants With VariousGel Formulations*

# Exon Sequence Gender

A B C D E

ss ds hdx ss ss ss ss

4 5 495delC F 2 0 3 3 3 35 19 1264insT F 1 1 2 2 1 26 31 2845delG M 3 1 3 3 3 37 3 433+1 G→A M 0 1 1 2 1 28 4 434−1 G→T M 0 0 1 1 0 09 32 AGT→GGT M 1 NS 2 2 2 2

10 33 3119+1 G→T M 2 NS 3 3 3 311 34 3218+1 G→T F 0 0 1 2 0 112 35 3219−1 G→A M 1 NS 3 3 2 313 40 3756−1 G→A F 2 2 3 2 2 214 47 4500−1 G→C M 0 0 1 1 2 215 10 GGG→AGG M 3 0 3 3 3 316 15 GGA→CGA F 0 0 1 0 0 017 15 GGC→GAC M 1 NS 2 2 2 218 17 GGA→AGA M 1 0 3 3 0 ND19 24 GGT→CGT F 0 NS 2 2 0 222 25 GGT→GTT M 2 0 1 2 2 221 25 GGT→GAT M 0 1 1 1 1 120 25 GGC→GAC F 0 NS 2 2 2 123 28 GGA→GAA F 2 1 2 2 2 324 32 ATG→GTG F 0 0 4 4 2 225 35 gGt→gTT M 1 1 3 2 2 326 36 GGT→GCT F 2 1 2 2 2 127 41 GGT→GAT F 1 0 3 3 2 228 50 CTG→CGG M 1 0 3 2 2 329 51 CGA→CCA M 0 1 0 1 0 230 31 2712−33 A→G M 0 0 1 1 0 131 19 1235−15 delT M 1 NS 2 2 2 232 19 GGG→GGC M 2 0 2 2 2 333 20 ATT→AGT M 2 0 3 3 3 334 27 CTT→CTC M 1 1 1 1 2 235 29 CCG→CCA M 0 0 1 1 0 036 39 CAA→CAG M 2 0 2 2 2 237 46 GAC→GAT M 1 NS 2 2 2 138 10 811+21 T→C M 0 0 1 1 1 ND39 33 2970−11 A→G M 0 0 0 0 0 1

AVE 0.97 0.3 0.63 1.94 1.94 1.53 1.91

*For gel detection evaluations, an individual of the indicated gender was analyzed for each variant, numbered as inTable I. A score of 0 indicates no or ambiguous shift. Scores of 1–4 reflect the patterns and magnitudes of increasinglyevident shifts. On the A gel, double-stranded (ds) fragments were visualized and scores for ds or heteroduplex (hdx)bands are reported for male and female samples respectively. Other abbreviations are AVE, average detection score; NS,weak signal; ND, no data. Gel formulations are described in the text with distinctions as follows: A, 8% (75:1) acrylamide+ 10% sucrose; B, 8% (75:1) acrylamide + 12 mM HEPES; C, 8% (75:1) acrylamide + 20 mM HEPES; D, 0.4× SequagelMD; E, 0.4× Sequagel MD + 20 mM HEPES.

TABLE IV. Summary of Multiplex Combinations and Relative Mobilities*

Group→ S1 S2 S3 S4 S5 S6 S7 S8 S9 S10 S11 S12 S13 S14 S15 S16

pair1 ex41 ex7 ex11+12 ex14+15 ex13 ex20 ex24 Pseg2 ex31 ex50 ex43+44 ex47 ex14+15 ex37 ex31 ex50pair2 ex30 ex48 ex32 ex5+6 Pseg1 ex22 ex25 ex45 ex42 ex33 ex41.3K ex11+12 ex49 ex46 ex48 ex37pair3 ex29 ex23 ex16 ex21 ex4 ex19 ex9 ex3 ex51 ex41.6K ex51alt ex40 ex34 ex16 ex36 ex41altpair4 ex1 58 ex23 ex8 ex27 ex10 ex26 − − ex2 ex35 ex39 ex18 ex38 ex1 38 ex17 ex1 38 ex1 58

*Multiplex product combinations, with the primers shown in Table III, are listed according to the relative mobilities of the corresponding single-strandedproducts in SSCP gels. The order of mobilities of the double-stranded fragments in such gels is the same except in Group S4, where the order of ex14+15and ex5+6 are reversed and in Group S5, where the order of Pseg1 and ex4 are reversed. Combinations S11 and S16 include secondary alternate productsfor exons 51 and 41 with the alternate 38 primers GCAGCAGTAGTAAAGTTGGGG and AGACCATTCTCCTACCACTCA respectively.

COL4A5 Multiplex PCR-SSCP 159

DNA remains in the single-stranded form. Because thereannealing process has a bimolecular concentrationdependence, the presence and strength of doublestranded product bands is relatively sensitive to PCRproduct yield.

Description and Comparison of Different SSCPGel Formulations

For legibility of the multiplex SSCP gel patterns, it isessential that there be a substantial and general dif-ference between the mobility of double and single-stranded DNAs. This may be achieved with the use ofrelatively high acrylamide:bis ratios or either of thesimilar commercial preparations, MDE (BMA, Rock-land, ME) or Sequagel MD (National Diagnostics, At-lanta, GA). For example, in initial stages of this work,0.4 × MDE gels were electrophoresed for 8 hr at a con-stant power of 5 watts. This condition allowed resolu-tion of double and single-stranded products in separategroupings located in the lower and upper portions ofthe same gel. Prospective SSCP screening was per-formed with 0.4 × MDE or, in most cases, with 8% (75:1acrylamide:bis) gels containing 12 mM HEPES as anadditive to enhance SSCP sensitivity [Liu and Som-mer, 1998]. Samples revealing no mutation in an initialscreen with 0.4 × MDE were re-tested with the lattergel condition. For optimum SSCP resolution, gels wererun for 16–17 hr at 4 watts constant power. About 1⁄4 ofthe screened samples were additionally tested on 8%(75:1) gels containing 10% sucrose that were run for 6hr at 15 watts constant power. These sucrose-containing gels provide an alternate SSCP condition[Glavac and Dean, 1993] and also allow visualization ofboth duplex and heteroduplex products.

To compare alternate SSCP gel conditions for usewith multiplex products, all of the 36 single nucleotidevariants were re-amplified in the multiplex format andelectrophoresed in the different gel conditions shown inTable V. Four of the gels were for detection of SSCP

variants only, because all duplex products were run off.An 8% (75:1) gel containing 10% sucrose was run sothat the single-stranded material migrated about halfas far as on the SSCP-only gels, retaining the double-stranded and heteroduplex products on the gel. Foreach condition, each variant pattern was scored on a 5point (0–4) scale reflecting the number of shifted bandsand the magnitude and direction(s) of the shifts.

The results summarized in Table III show that mostof the variants are readily detectable using any one ofthe multiplex-compatible SSCP-only gel conditions. Animportant factor affecting SSCP sensitivity, however,was the addition of HEPES buffer to the gel formula-tion. The single gel condition tested without theHEPES additive failed to detect nine different variantscompared to just two or three failed detections with anyof the HEPES-containing formulas. Only two variantswere evident in just a single gel condition, G292R inexon 15 and the IVS32 polymorphism, 2970−11A→G.The latter was initially detected as a questionable shiftthat was eventually deemed significant because it ap-peared on several different gels, and always in samplesthat exhibited the exon 10 fragment SSCP shift asso-ciated with the 811+21T→C polymorphism. Duplexand heteroduplex product patterns provide minimalcomplementary information in this group of variants,although this may partially reflect the inclusion of rela-tively few heterozygous female samples and the vari-ability in duplex product yield. The R1677P changewas initially detected on a gel containing 10% sucrosewhere a shift in the ds product band was significantlymore evident than the SSCP shift on the same gel,however this type of shift pattern is unusual. Eithertype B or C gels with 12 mM and 20 mM HEPES re-spectively seem best to use if a single SSCP test con-dition is required, as they each result in only twomissed detections and the average SSCP scores areidentical (Table III).

160 Barker et al.