ORIGINAL PAPER

Functional characterization of GDP-mannose pyrophosphorylasefrom Leptospira interrogans serovar Copenhageni

Matıas D. Asencion Diez • Ana Demonte • Jorge Giacomelli • Sergio Garay •

Daniel Rodrıgues • Birgit Hofmann • Hans-Juerguen Hecht • Sergio A. Guerrero •

Alberto A. Iglesias

Received: 4 June 2009 / Revised: 3 December 2009 / Accepted: 7 December 2009

� Springer-Verlag 2009

Abstract Leptospira interrogans synthesizes a range of

mannose-containing glycoconjugates relevant for its viru-

lence. A prerequisite in the synthesis is the availability of

the GDP-mannose, produced from mannose-1-phosphate

and GTP in a reaction catalyzed by GDP-mannose pyro-

phosphorylase. The gene coding for a putative enzyme

in L. interrogans was expressed in Escherichia coli

BL21(DE3). The identity of this enzyme was confirmed by

electrospray-mass spectroscopy, Edman sequencing and

immunological assays. Gel filtration chromatography

showed that the dimeric form of the enzyme is catalyti-

cally active and stable. The recombinant protein was

characterized as a mannose-1-phosphate guanylyltransfer-

ase. S0.5 for the substrates were determined both in GDP-

mannose pyrophosphorolysis: 0.20 mM (GDP-mannose),

0.089 mM (PPi), and 0.47 mM; and in GDP-mannose

synthesis: 0.24 mM (GTP), 0.063 mM (mannose-1-phos-

phate), and 0.45 mM (Mg2?). The enzyme was able to

produce GDP-mannose, IDP-mannose, UDP-mannose and

ADP-glucose. We obtained a structural model of the

enzyme using as a template the crystal structure of man-

nose-1-phosphate guanylyltransferase from Thermus ther-

mophilus HB8. Binding of substrates and cofactor in the

model agree with the pyrophosphorylases reaction mech-

anism. Our studies provide insights into the structure of

a novel molecular target, which could be useful for

detection of leptospirosis and for the development of anti-

leptospiral drugs.

Keywords Leptospira interrogans �Mannose metabolism � Pyrophosphorylase

Introduction

Leptospirosis is considered to be the most widespread

zoonosis in the world, which is reflecting the ability of

pathogenic Leptospira interrogans species to adapt to the

renal tubules of a wide variety of mammalian reservoirs

(Barnett et al. 1999; Haake et al. 1999). Human lepto-

spiral infection frequently results in a hard life-threatening

illness characterized by liver dysfunction, kidney failure,

and pulmonary hemorrhage (Barnett et al. 1999; Haake

Communicated by Sebastian Suerbaum.

Electronic supplementary material The online version of thisarticle (doi:10.1007/s00203-009-0534-3) contains supplementarymaterial, which is available to authorized users.

M. D. Asencion Diez � J. Giacomelli � S. A. Guerrero

Laboratorio de Bioquımica Microbiana,

Universidad Nacional del Litoral, Santa Fe, Argentina

A. Demonte � A. A. Iglesias (&)

Laboratorio de Enzimologıa Molecular,

Instituto de Agrobiotecnologıa del Litoral, FBCB,

Universidad Nacional del Litoral,

S3000ZAA Santa Fe, Argentina

e-mail: iglesias@fbcb.unl.edu.ar

S. Garay � D. Rodrıgues

Departamento de Fısica, Facultad de Bioquımica y Ciencias

Biologicas, Universidad Nacional del Litoral,

Santa Fe, Argentina

B. Hofmann � H.-J. Hecht

Helmholtz Centre for Infection Research,

Inhoffenstraße 7, 38124 Braunschweig, Germany

Present Address:J. Giacomelli

Laboratorio de Biologıa Vegetal. Facultad de Bioquımica y

Ciencias Biologicas, Universidad Nacional del Litoral,

Santa Fe, Argentina

123

Arch Microbiol

DOI 10.1007/s00203-009-0534-3

et al. 1999). The present treatment for acute cases of

leptospirosis has variable effectiveness (Griffith et al.

2006, 2007; Zunino and Pizarro 2007). Characterization

of novel molecular targets for the design of new inhibitors

will surely help in the therapy of the disease. The car-

bohydrate metabolism is one of the biochemical pathways

to analyze in depth for this bacterium, not only for the

rational design of new therapeutic agents but for a better

knowledge of the metabolic pathway and its relevance on

the Leptospira sp. virulence, pathogenesis and host

immune response (Saavedra-Lira and Perez-Montfort

1996; Opperdoes and Michels 2001; Verlinde et al. 2001;

Gornik et al. 2006).

Different mannose-containing compounds are present in

the structure of the cell wall from bacteria, yeast, and lower

eukaryotic organisms (Preston et al. 1996; Kobayashi et al.

1997; Martins et al. 1999; Ning and Elbein 1999; Garami

and Ilg 2001). In many Gram-negative bacteria, mannose

derivative lipopolysaccharides (LPS) are highly toxic and

immunogenic molecules representing major components of

cell membranes (Preston et al. 1996). In Leptospira and

other pathogens (as in Yersinia enterocolitica), LPS con-

stitute the main virulence factor (Zhang et al. 1997; Bulach

et al. 2000a, 2000b; Bharti et al. 2003). In this context,

GDP-D-mannose (GDP-Man) is a key metabolite, as it is

the sugar activated form functioning as the mannosyl group

donor in the synthesis of several mannose-containing

structures (Ginsburg 1964; Ning and Elbein 1999; Ning

and Elbein 2000). GDP-Man is synthesized from mannose-

1-phosphate (Man-1-P) and GTP in a reaction catalyzed by

a specific sugar nucleotide pyrophosphorylase, namely

GDP-Man pyrophosphorylase (EC 2.7.7.22; GDP-ManP-

Pase). In this work, we present the cloning of the gene

encoding a putative GDP-ManPPase from genomic DNA

of Leptospira interrogans serovar Copenhageni, the

expression of the recombinant protein in Escherichia coli

and its chromatographic purification for kinetic and struc-

tural characterization. In addition, we report here a model

of the 3D structure of the enzyme obtained by homology

modeling using as a template the crystal structure of

homologous enzyme from Thermus thermophilus HB8.

Finally, we show that GDP-ManPPase represents a key

immunogenic target for detecting leptospirosis infection in

humans.

Materials and methods

Chemicals

All protein standards, antibiotics, isopropyl-b-thiogalacto-

side (IPTG), and oligonucleotides were of the highest

quality available.

Bacterial strains, growth conditions, and media

Bacterial strains used in this study were E. coli TOP 10 F0

and E. coli BL21(DE3) pLysS (Invitrogen). A protocol

previously described (Veloso et al. 2000) was used to

extract leptospiral DNA from bacteria grown axenically at

the Instituto Nacional de Enfermedades Respiratorias ‘‘Dr.

Emilio Coni’’, Santa Fe, Argentina.

All strains of E. coli were grown at 37�C in Luria–

Bertani broth (LB, per liter 10 g tryptone, 5 g yeast extract

and 10 g NaCl, pH 7.4). Solid media had agar–agar in a

concentration of 18 g/l. Antibiotics were used at the fol-

lowing final concentrations: 100 lg/ml ampicillin, 34 lg/

ml chloramphenicol. Protein expression was induced by

adding IPTG at a final concentration of 0.5 mM.

Cloning of the gene

Amplification of the gmp gene (NCBI acc No. NC005823),

coding for GDP-ManPPase was performed using primers

gmpfo: 50GAATTCATGAACCAAGACAAACCGGT30 and

gmpre: 50AAGCTTCTATTCCGTGTACTTTTGTA30, which

included recognition sites for EcoRI and HindIII, respec-

tively. PCR was performed in 19 Taq PCR Buffer (Invit-

rogen) containing 2 mM MgCl2, 50 ng template DNA,

200 nM of each primer, 0.2 mM dNTPs, 1 U DNA poly-

merase (Invitrogen), in a final volume of 50 ll. The ther-

mocycle program was: 94�C for 5 min, then 30 cycles

including denaturation at 94�C for 1 min, annealing at

60�C for 1 min and elongation at 72�C for 1 min 30 s,

followed by a final elongation step of 10 min. The PCR

product was purified with the QIAquick PCR purification

kit (QIAGEN) and cloned into the pGEM-T Easy cloning

vector (Promega) according to the manufacturer’s instruc-

tions. The gmp identity was confirmed by complete

sequencing. The construction [pGEM-TEasy/gmp] was

digested with EcoRI and HindIII, to release gmp which was

purified and cloned into an EcoRI/HindIII–digested

pRSETB vector. Consequently, 44 amino acids (including

six histidines and an enterokinase cleavage site) were

added to the N-terminal end of the recombinant protein.

The new construction, [pRSETB/gmp] was renamed

pGMP. Competent E. coli BL21(DE3) pLysS cells were

transformed with pGMP yielding the E. coli BL21 (DE3)

pLysS [pGMP] for protein expression.

Overproduction of GDP-ManPPase

E. coli BL21 (DE3) pLysS [pGMP] cells were grown

overnight at 37�C with shaking at 180 rpm in LB broth

supplemented with 100 lg/ml ampicillin and 34 lg/ml

chloramphenicol. The overnight culture was diluted 1/100

Arch Microbiol

123

in fresh media and grown under identical conditions to

exponential phase (OD600 of 0.6). The expression of the

recombinant protein was induced by adding IPTG at a

final concentration of 0.5 mM, followed by incubation at

30�C for 4 h. Cells were harvested by centrifugation,

washed once with ice-cold 50 mM Tris–HCl buffer, pH

8.0, and suspended in an extraction buffer containing

50 mM Tris–HCl, pH 8.0, 300 mM NaCl, and 1 mM

PMSF. After disruption using a Cell Disruptor (Constant

Systems), the crude extract was clarified by centrifugation

during 1 h at 15,0009g and then filtered through a 45-lm

membrane.

Purification of His-tagged GDP-ManPPase

GDP-ManPPase from L. interrogans was expressed in E.

coli with an N-terminal His-tag, which facilitates its further

purification. The enzyme was purified as by affinity chro-

matography, using Talon-Co?2 Superflow resin (Clontech)

according to the protocol supplied by the manufacturer.

The elution fractions containing the recombinant protein

were analyzed electrophoretically by SDS–PAGE (Lae-

mmli 1970) to check for purity. The final purification step

was carried out by gel filtration with a Superdex-200 FPLC

column (Amersham Pharmacia Biotech). The column was

equilibrated with 50 mM Tris–HCl buffer, pH 8.0, and

300 mM NaCl.

Protein detection and quantification

Protein concentration was determined by the method of

Bradford (1976) using BSA as standard. To reveal SDS–

PAGE gels, proteins were stained with Coomassie brilliant

blue.

Proteolytic cleavage

To remove the N-terminal His-Tag, the recombinant

GDP-ManPPase was treated with enterokinase (Novagen).

The cleavage was performed in 300 ll using the buffer

provided with the protease, 0.5 mg GDP-ManPPase, and

6 U enterokinase. The reaction was stopped by adding

1 mM PMSF. Complete cleavage was confirmed by SDS–

PAGE, with the difference between both forms of the

enzyme being in 4,600 Da. After cleavage, GDP-ManP-

Pase was purified by gel filtration by the procedure

described below.

Enzyme activity assay

GDP-ManPPase activity was determined at 37�C both, in

the GDP-Man pyrophosphorolysis (assay A) and synthesis

(assay B) directions.

Assay A

Pyrophosphorolysis of GDP-Man was followed by the

formation of [32P]GTP from [32P]PPi, as previously

described for other pyrophosphorylases (Ghosh and Preiss

1966). The reaction mixture contained 50 mM MOPS

buffer (pH 7.5), 5 mM MgCl2, 1.5 mM GDP-mannose,

1 mM [32P]PPi (ca. 3,000 cpm/nmol), 10 mM NaF, 0.2%

(w/v) bovine serum albumin, and enzyme in a total volume

of 150 ll. The reaction was started by the addition of

[32P]PPi, and after 10 min of incubation at 37�C it was

terminated by the addition of 1 ml of cold 5% (W/V) tri-

chloroacetic acid. The [32P]GTP formed was measured as

described by Ghosh and Preiss (1966).

Assay B

Synthesis of GDP-Man was assayed by following the for-

mation of Pi (after hydrolysis of PPi by inorganic pyro-

phosphatase) by a highly sensitive colorimetric method

previously described (Fusari et al. 2006). The reaction

mixture contained 50 mM MOPS buffer (pH 7.5), 5 mM of

MgCl2, 1 mM of GTP, 0.1 U of inorganic pyrophospha-

tase, 0.2% (w/v) bovine serum albumin and variable

amounts of the enzyme. Assays were initiated by addition

of 1 mM Man-1-P in a total volume of 50 ll. The reaction

mixture was incubated for 10 min at 37�C and terminated

by adding color reagent [Malachite Green, see (Fusari et al.

2006)]. The complex formed with the released Pi was

measured at 630 nm with an ELISA EMax detector

(molecular devices).

Under the conditions described earlier, one unit of

activity (U) is defined as the amount of enzyme catalyzing

the formation of 1 lmol of product (either GTP or PPi, for

assay A or B, respectively) per min. The kinetic constants

were determined by fitting the data with a non-linear least-

squares formula and the Hill equation using the program

OriginTM. Kinetic constants are the mean of at least two

independent sets of data, which were reproducible within

±10%.

Western blotting

Western blotting was performed after standard techniques

(Maniatis et al. 1982). Proteins in the gel were blotted onto

PVDF membranes using a Mini-PROTEANII (Bio-Rad)

apparatus. The membrane was blocked overnight at 4�C,

subsequently incubated with primary antibody at room

temperature for 1 h, and then incubated with a HRP-con-

jugated anti–human secondary antibody for 40 min.

Detection was carried out with 3,30-diaminobenzidine and

hydrogen peroxide (Sigma) in 50 mM Tris–HCl, pH 8.0,

150 mM NaCl. Sera from patients with leptospirosis

Arch Microbiol

123

(obtained from Instituto Nacional de Enfermedades Res-

piratorias ‘‘Dr Emilio Coni’’, Santa Fe, Argentina) were

used as the primary antibody.

Determination of native molecular mass

The native molecular mass of GDP-ManPPase was deter-

mined by gel filtration chromatography in a Superdex-200

column previously equilibrated with buffer 50 mM

Tris–HCl pH 8.0, and 300 mM NaCl. Ribonuclease A

(Mr = 13,700), chymotrypsinogen A (Mr = 25,000),

ovoalbumin (Mr = 43,000), bovine serum albumin

(Mr = 67,000) and aldolase (Mr = 158,000) were used as

molecular mass standards. One milligram of pure protein

was applied to the column. Masses were extrapolated from

the standard semi-log curve log Mr vs Kav (a parameter

defined by the following equation: Kav ¼ Ve�Vo

Vc�Vo; where Ve is

the elution volume, Vo is the void volume and Vc is the

column volume.

Electrospray-MS and Edman sequencing

All samples analyzed by ESI–MS and Edman sequencing

were buffer-changed to 10 mM NH4HCO3-NaOH, pH 8.0

by ultracentrifugation and analyzed at the Mass Spectrom-

etry Center-Biophysical Analysis Research Group in the

Helmholtz Institute for Infection Research (Braunschweig,

Germany) as previously described (Jaeckel et al. 2005).

ES–MS was performed with an ion trap mass spectrometer

(ESQUIRE-LC, Bruker Daltonik, Bremen, Germany).

N-terminal amino acid sequence analysis by Edman deg-

radation was carried out on a 476A protein sequencer

(Applied Biosystems, Weiterstadt, Germany).

Homology modeling

The 3D structure database RCSB-PDB (Berman et al.

2000) and template identification tools from the Swiss

Model Workspace (Arnold et al. 2006) were used for

sequence search. Sequence alignment was made with

Clustal X 1.81 (Thompson et al. 1994), and its assessment

was evaluated with the server ESPript 2.2 (Gouet et al.

1999). The homology model of L. interrogans GDP-

ManPPase was built with the software Modeller 8v2 (Sali

and Blundell 1993) and refined with 5,000 cycles of

steepest descent algorithm using the crystal structure of

GDP-ManPPase from T. thermophilus HB8 (code 2cu2) as

a template. The evaluation of the final model was done

with the structure assessment tool from the Swiss Model

Workspace, which includes Anolea, Verify3D, and What-

check analysis. The 3D model for the dimeric structure of

leptospiral GDP-ManPPase was built using the symmetry

operations of the crystallographic space group (Guex and

Peitsch 1997) of the specified T. thermophilus HB8 enzyme

template structure (Sugahara 2005). The substrate Man-1-P

was fitted manually in such a way that the hydroxyl group

on the C4 interacts with the oxygen of E174 and one of the

phosphate’s oxygen with the nitrogen of the residue K175

as described before (Jin et al. 2005); whereas the GTP

molecule was positioned on the structure using as a tem-

plate the position of ATP in the structure of potato tuber

ADP-GlcPPase (pdb-code _1_YP3) (Jin et al. 2005), which

was crystallized with the ATP in its binding site. After we

made a structural alignment of our model onto the _1_YP3

using the program STAMP (Russell and Barton 1992), the

GTP molecule was added in the model keeping the orien-

tation of the pentose, the triphosphate moiety and over-

lapping the purine base of GTP with that one of ATP.

Results and discussion

Isolation and heterologous expression of the gmp gene

The identification of a nucleotide sequence (geneID

2770489) encoding a putative GDP-ManPPase (gmp gene)

in the database of the L. interrogans genome project

(Leptospira interrogans serovar Copenhageni Genome

Project (NCBI access NC_005823 and NC_005824)

prompted us to perform the molecular cloning of the gene

full-length. The gene (1,062 bp in length) was amplified

from genomic DNA and its identity was confirmed by

DNA sequencing in both directions. It is predicted that gmp

encodes a protein of 353 amino acids, with a molecular

mass of 40.2 kDa and a calculated pI of 9.35.

We generated the construction pGMP (renamed from

pRSETB/gmp, see details under ‘‘Materials and methods’’),

which was used to transform competent E. coli BL21(DE3)

pLysS cells. After inducing expression and obtaining crude

extracts from the transformed cells, the recombinant protein

was 76-fold purified by affinity chromatography, the

enzyme reaching a specific activity of 3.8 U/mg (Table 1).

The analysis by SDS–PAGE showed in Fig. 1 indicates that

the recombinant enzyme reached a high degree of purifi-

cation and revealed a molecular mass of 45 kDa (Fig. 1a).

This mass corresponds to approximately 40 kDa for GDP-

ManPPase plus an enlargement of ca. 5 kDa caused by the

histidine-tag and extra amino acids, including the entero-

kinase cleavage site. This is reinforced by data obtained

after enterokinase digestion of the recombinant protein

(Fig. 1b). The native molecular mass of the GDP-ManP-

Pase forms (before and after enterokinase treatment) was

determined by gel filtration chromatography to correspond

to a dimeric arrangement in both cases (data not shown).

Interestingly, the purified enzyme was recognized by spe-

cific antibodies present in typified sera pool from patients

Arch Microbiol

123

with leptospirosis, as depicted in Fig. 1c; this identifying

GDP-ManPPase as a potential target to be used in immun-

odiagnostics. Figure 1 in supplemental data further rein-

forces this property of the enzyme, as it shows that the

immunogenic reaction in dot-blots of the antisera pool with

GDP-Man PPase is about 40% of that signal obtained with

the reference antigen Lipl-32 (Haake et al. 2000; Bomfim

et al. 2005; Boonyod et al. 2005).

Electrospray-MS and Edman sequencing

By means of ESI–MS and Edman degradation, we could

confirm the size and the sequence identity of the recom-

binant leptospiral enzyme. The amino acid sequence of

LinGDP-ManPPase obtained by these procedures corre-

sponds to that shown in Fig. 2, which is identical to that

deduced from the cloned gene. In this primary structure,

representative amino acid residues can be found. Thus,

K175 has been reported to be relevant for the union of

Man-1-P to GDP-ManPPase (May et al. 1994) and also is a

highly conserved residue within different pyrophospho-

rylases (Brede et al. 1991; Jiang et al. 1991; Ballicora et al.

2003, 2004; Jin et al. 2005; Cupp-Vickery et al. 2008).

Also, key residues of the sugar binding site, FXEKP

(positions 172–176) aligned in a remarkable conserved

manner when the leptospiral GDP-ManPPase was com-

pared with other pyrophosphorylases (i.e., with the ADP-

glucose pyrophosphorylase from Solanum tuberosum). The

leptospiral enzyme also contains the highly conserved

residues M11, K15, R19, N62, N89, D116, and D265, all of

them reported as finger-prints of pyrophosphorylases, as

they are involved in the interaction with the nucleotide-

triphosphate (NTP) substrate complexed with Mg2? (May

et al. 1994; Blankenfeldt et al. 2000; Jin et al. 2005). We

will discuss later how these critical residues arrange in the

3D structure of the leptospiral GDP-ManPPase.

Enzymatic activity and substrate specificity

The recombinant protein was assayed for GDP-ManPPase

activity in both, the forward (GDP-Man synthesis) and the

reverse (GDP-Man pyrophosphorolysis) directions of

catalysis. The enzyme retained its activity and kinetic

behavior after removal of the N-terminal tag by incubation

with enterokinase (data not shown). The kinetic para-

meters of the recombinant GDP-ManPPase (Table 2) were

comparable to those found by this enzyme isolated from

prokaryotic and eukaryotic sources (Shinabarger et al.

1991; Ning and Elbein 1999, 2000). Concerning substrate

specificity exhibited by the recombinant enzyme, Table 3

shows a comparison of the GDP-ManPPase activity uti-

lizing two hexoses-1-phosphate [Man-1-P and glucose-1-

phosphate (Glc-1-P)] and different NTPs. Maximal activity

was found with Man-1-P and GTP as substrates, but the

enzyme was active to different degrees utilizing Glc-1-P

and many NTPs. Thus, the activity with UTP or ITP and

Man-1-P resulted to be 2% (UDP-ManPPase), and 60%

(IDP-ManPPase) of the GDP-ManPPase activity (3.8 U/

mg) was used as a control (Table 3). No activity for ADP-

Man synthesis was detected. However, in our hands the

enzyme (although with a low capacity) was able to syn-

thesize GDP-Glc and ADP-Glc, as shown in Table 3.

These results agree with those previously reporting some

promiscuity exhibited by GDP-ManPPase purified from E.

coli O157:1H7 (Yang et al. 2005).

The ability of leptospiral GDP-ManPPase to synthesize

ADP-Glc could be related with key amino acid residues

found conserved in the ADPGlcPPase from potato tuber

(Jin et al. 2005). Since the latter has been crystallized,

kinetic results also support the possibility of using this

crystallographic structure to model the leptospiral enzyme

(see results on ‘‘Homology modeling’’). Curiously, the

Table 1 Purification table of recombinant L. interrogans GDP-ManPPase

Step Volume (mL) Protein (mg) Activity (U) Specific activity (U/mg) Yield (%) Purification (-fold)

Cell extract 50 375 19.0 0.05 100 1

IMAC 6 3.0 11.4 3.8 60 76

Fig. 1 Electrophoretic analysis of the purified recombinant LinGDP-

ManPPase. The proteins were defined by 15% (w/v) SDS–PAGE and

stained with Coomassie blue. a 10 lg GDP-ManPPase. b 10 lg GDP-

ManPPase after digestion with enterokinase. c Western blotting assay

of recombinant GDP-ManPPase (1 lg) revealed with human sera

obtained from patients with leptospirosis

Arch Microbiol

123

sequence of the GDP-ManPPase from the bacterium mat-

ches better with the above cited eukaryotic enzyme rather

than with the ADPGlcPPase from the prokaryote Agro-

bacterium tumefaciens, the structure of which has also been

recently solved by crystallography (Cupp-Vickery et al.

2005, 2008). On the other hand, the functional relevance (if

any) for L. interrogans that could have the ability of GDP-

ManPPase to synthesize ADP-Glc remains an open ques-

tion, since this microorganism seems to lack ADP-GlcP-

Pase and could have the former enzyme as the only

Fig. 2 Sequence alignment between chain A of 2cu2 and LinGDP-

ManPPase (YP_002178.1) which subsequently was used in the

homology modeling. In red background are highlighted the identical

residues, while the conserved ones are printed in red letters, within

blue squares. At the top of the alignments is drawn the secondary

structure of 2cu2 in order to show that no gaps or insertions were

allowed inside of them

Table 2 Kinetic parameters of recombinant L. interrogans serovar

Copenhageni GDP-ManPPase

Substrate S0.5 (mM) nH

Pyrophosphorolysis

GDP-Man 0.202 ± 0.017 1.2 ± 0.1

PPi 0.089 ± 0.014 1.2 ± 0.3

Mg2? 0.466 ± 0.030 1.3 ± 0.1

Synthesis

GTP 0.236 ± 0.018 1.6 ± 0.2

Man-1P 0.063 ± 0.005 1.6 ± 0.3

Mg2? 0.446 ± 0.030 1.4 ± 0.1

Table 3 Use of different NTPs and Man-1-P or Glc-1-P by GDP-

ManPPase from L. interrogans

Nucleotide [1 mM] Man-1-P [1 mM] (%) Glc-1-P [1 mM] (%)

ATP ND 2

UTP 2 ND

ITP 60 ND

GTP 100 1

Hundred percent of activity corresponds to the reaction of Man-1-P

and GTP catalyzed by the purified recombinant enzyme

ND no detected activity

Arch Microbiol

123

alternative to produce the sugar-nucleotide if necessary.

However, in the genome database of L. interrogans no

gene coding for enzymes involved in glycogen synthesis is

found, which makes doubtful the use of ADP-Glc by this

microorganism.

Homology modeling

With the aim of obtaining an in silico 3D structure of GDP-

ManPPase from L. interrogans, we searched for an accu-

rate template using bioinformatic tools specified under

‘‘Materials and methods’’. After comparing our target

sequence against the ExPDB (template library extracted

from PDB) using the gapped BLAST algorithm (Altschul

et al. 1997), we found two homologous proteins as the

more appropriate to templates for modeling. These two

proteins were: 2cu2, the GDP-ManPPase from T. thermo-

philus Hb8 (Sugahara 2005); and 2qh5, the mannose-6-

phosphate isomerase from Helicobacter pylori. We decided

to employ 2cu2 as a template because it matched several

more residues than 2qh5 with our target enzyme (102

identical residues against 77) and it also had fewer gaps (10

vs. 22), thus minimizing the probability of producing a

poor model (Larsson et al. 2008). Figure 2 shows the

alignment used in the homology modeling, and where the

GDP-ManPPase from T. thermophilus Hb8 (Sugahara

2005) exhibited 29% of identity and 47% of similarity

when compared with the enzyme form L. interrogans. In

selecting the appropriate template, special care was taken

to avoid the presence of breaks in the regions being part of

regular secondary structure motifs.

Utilizing the specified 2cu2 template and considering

the quaternary structure determined in the present study for

the recombinant enzyme, a 3D structural model was

established for the dimeric GDP-ManPPase from

L. interrogans (Fig. 3). As depicted in Fig. 3, the subunits

are arranged in a head-to-tail fashion. This characteristic

form of quaternary fold has also been documented for the

complex ATP-phosphoribosyl transferase from Thermoto-

ga maritima (Vega et al. 2005). Evaluation of the final 3D

structure showed in Fig. 3, utilizing Verify-3D (Bowie

et al. 1991; Luthy et al. 1992), indicated that our model

reached a Z-score value of 118, which is between the best

hope, considering its sequence length (353 residues) and

the lower limit of confidence (72). The calculated ANO-

LEA (Melo and Feytmans 1998) profile showed few

regions with positive values, mainly in loops. In addition,

the Ramachandran plot (Ramachandran et al. 1963) pointed

out that the overall conformation of the backbone was

reliable (less than 2% of the non-glycine residues in non

allowed areas).

Taking an insight look respect to how the substrates fit

in the GDP-ManPPase model, it is observed that the con-

sensus binding site of the sugar moiety exhibited a similar

orientation as that found in ADPGlcPPase from potato

tuber (Jin et al. 2005). This is in agreement with the above

described promiscuity of the leptospiral enzyme to use

different substrates, and is also supported by a previous

report (May et al. 1994) demonstrating that GDP-ManP-

Pase from Pseudomonas aeruginosa contains a catalytic

domain homologous to the Glc-1-P site found in other

sugar-nucleotide pyrophosphorylases. Also, a previous

analysis demonstrated that, even when the similarity

between GDP-ManPPases and ADP-GlcPPases is extre-

mely low (identity 8.8%), an alignment can be done in a

form that predicted structures match helices and sheets

(Ballicora et al. 2003). Using this approach, we obtained

the sequence alignment shown in Fig. 4, where the con-

servation state of each residue in key regions is represented

as histogram graphic.

By applying the structural alignment defined in Fig. 4, it

was possible to superimpose monomeric forms of our 3D

model of the leptospiral GDP-ManPPase (shown by Fig. 3)

onto the _1_YP2 structure of potato tuber ADP-GlcPPase,

as illustrated by Fig. 5. The residues of both structures

were colored according to their sequence similarity, using

BLOSUM 60 substitution matrix. Thick blue cylinders

show the most conserved residues, while thin red cylinders

the least ones (Fig. 5). Reinforcing the models derived

from this approach, the higher bars obtained in the histo-

gram graphic related with sequence alignment (shown in

Fig. 4) correspond to the latter specified thick blue cylin-

ders. The similarity of the binding site (residues in blue

around ATP) explains why we used the ATP coordinates

from _1_YP2 to insert our GTP in the pocket of our model.

Figure 6 is derived from the above detailed superim-

position of structures (Fig. 5), where the relative orienta-

tion of conserved residues FXEKP is compared between

Fig. 3 Cartoon renderization of the proposed dimeric form for the

GDP-ManPPase. b-sheets and a-helices are shown as arrows and

ribbons, respectively. The loops connectors are drawn as cylinders

Arch Microbiol

123

Arch Microbiol

123

the leptospiral GDP-ManPPase (yellow/light) and the

potato tuber ADP-GlcPPase _1_YP2 structure (red/dark).

On the other hand, following the same substrate positioning

strategy, the Man-1-P moiety locates far from residues

F172, Y173 and P176. The length of the Man-1-P (8.5 A)

allows for its interaction with at most two of the four

consecutive residues that have been already mentioned as

the motif of the sugar-P binding site. We found the distance

from OE1 of E174 to the NZ of K175 also appropriate for

interaction with Man-1P in the enzyme active site. We can

assume that other conserved residues are important for the

correct folding of this portion of the molecule. The Man-1-

P moiety could thus locate close to residues D244, I245,

and E249 which are highly conserved between several

pyrophosphorylases (Jin et al. 2005). Also, D244 and E249

are residues that could putatively interact with the cofactor

Mg2?, although at the present not enough experimental

evidence is available to support such a model.

We constructed a complete model of the enzyme toge-

ther with both of the substrates (GTP and Man-1-P) and the

cofactor (Mg2?), all of them positioned in the respectively

proposed binding site (Fig. 2 of supplemental data). As

shown, residues G13, G14, M11, A12 and I93 (orange

sticks) build up a hydrophobic pocket for the purine ring of

GTP, in agreement with that described in other pyrophos-

phorylases (Blankenfeldt et al. 2000; Zuccotti et al. 2001;

Ballicora et al. 2003; Jin et al. 2005). Residues E84 and

N89 (in red sticks) show the right alignment to make H-

bonds to the purine ring particularly with the O6 (bound to

C6) and amine N (bound to C2) (see Fig. 2 of supplemental

data). In green sticks are represented the D116 and S114

residues, which have their side chains in the appropriate

orientation to make H-bonds to the hydroxyl groups of the

ribose moiety. In the model depicted in Fig. 2 of supple-

mental data, the GTP molecule lays deeper inside the cleft

than the sugar, in a way that the phosphate moiety of Man-

1-P is next to the a-phosphate from GTP. This suggests that

the nucleotide would enter first to the cleft and after some

reordering on the surrounding residues the sugar might fit

in its place for taking part in the reaction. This view is in

agreement with the ordered bi-bi sequential kinetic reaction

mechanism proposed for this kind of enzymes (Klecz-

kowski et al. 1993; Zuccotti et al. 2001); where the GTP

molecule would arrive to its binding site before than Man-

1-P, and then the a-phosphate of the former substrate

would produce a nucleophilic attack on Man-1-P giving

PPi and GDP-Man as products (Melo and Glaser 1965;

Kleczkowski et al. 1993; Blankenfeldt et al. 2000). Addi-

tionally, in the 3D model (see Fig. 2 of supplemental data),

the R19 residue is positioned close to Mg2? and the

phosphates moieties of Man-1-P and GTP. This amino acid

has been described as critical partner of the GTP-Mg2? to

keep the full activity of GDP-ManPPases (May et al.

1994).

Given the 3D model and considering that GDP-ManP-

Pase was recognized by specific antibodies present in

typified sera pool from patients with leptospirosis, we

Fig. 5 Superimposition of _1_YP2 onto our 3D model, after a

structural alignment was applied. The residues of both structures were

colored according to their sequence similarity, using BLOSUM 60

substitution matrix. Thick blue cylinders show the most conserved

residues, while thin red cylinders the least ones

Fig. 6 Overlay of consensus region that binds sugar in GDP-

ManPPase model (yellow) onto _1_YP2 (red, potato tuber ADP-

pyrophosphorylase). It should be noted that the side chains are

oriented in a similar way in both structures

Fig. 4 Sequence alignment to the structural alignment depicted in

Fig. 5. Over the sequences is shown a histogram graphic, where the

higher bars indicate the more conserved residues. In a box is

highlighted the sugar binding site residues. _1_YP2 corresponds to

the potato tuber ADP-pyrophosphorylase amino acid sequence

b

Arch Microbiol

123

evaluated the possible structural regions in the protein

having potentiality as epitopes. Based on the predicted

structure of L. interrogans GDP-ManPPase, we identified

conformational (CE) and sequential (SE) epitopes, as

detailed in Table 4. For the epitope recognition, we

employed an algorithm previously developed (Kulkarni-

Kale et al. 2005), which demonstrated a good performance

reaching up to 75% of accuracy when it was applied to

known 3D structures of antigen–antibody complexes. The

specific regions shown in Table 4 are of interest for future

studies oriented to establish a structural insight for the

potential design of new improved vaccines or/and diag-

nostic tests for the leptospiral infection.

Concluding remarks

This work improves the knowledge about the carbohydrate

metabolism in L. interrogans serovar Copenhageni, spe-

cifically about GDP-Man metabolism, a key precursor in

the synthesis of several mannose-containing glycoproteins

and lypopolysaccharides. The gene encoding a GDP-

ManPPase was cloned from genomic DNA; the protein was

heterologously expressed and purified before its functional

characterization. The purified enzyme was identified as a

dimeric protein, exhibiting properties of GDP-ManPPase

with a relative promiscuity to utilize other hexose-1-Ps and

NTPs. The 3D structure of the enzyme was deducted from

molecular modeling on the basis of similarities with other

GDP-ManPPases and also PPases in general. Of particular

interest was that the purified enzyme was quite specifically

recognized in immunoassays by antibodies present in a sera

pool from patients with leptospirosis, which supports a

relevance of this protein as a useful antigen for the diag-

nosis of the disease. Studies on carbohydrate metabolism in

L. interrogans must be continued in depth in order to

determine its relevance both in the virulence of the path-

ogen, the interaction with the host and the identification of

molecular targets for the rational design of new chemo-

therapeutic agents.

Acknowledgments This work was supported by grants from AN-

PCyT (PICTO004 15-22427; PICTO005 05-13469), CONICET (PIP

112-2008-01-02519), and UNL (CAI ? D 2006, CAI ? D 2009

Orientados & Redes). DER, SAG and AAI are investigator career

members from CONICET. AAI is a Fellow from The John Simon

Guggenheim Memorial Foundation.

Table 4 Predicted CE and SE on LinGDP-ManPPase model

CE and SE predicted by the Kulkarni-Kale and col. Algorithm

CE No. AD within 6A of Ref. AD Res. within 6 A of Ref. AD

Predicted CE

1. 1MNQDK5 1 103: ERYGdP :108 R56, R200

2. 13GGKgER18 1333GDiKNLVSELRKNKTLQKYTE353

3. 24RIS26 1 62NASlKKSiLIqEKN75

4. 62NASlKKSiLIqEKN75 1 83IePEGkN89 R42, D55, K79, N80

5. 83IePEGkN89 1 62NASlKKSiLIqEKN75 ? 226KKAGElAA233 ? 236KIiPSEPvDI245

6. 161KSTDA165 1 168AvKSfYEKpDVKTaLK183

7. 168AvKSfYEKpDVKTaLK183 1 161KSTDA165 ? 186KKKN189 ? 236KIiPSEPvDI245 P150, I152, G153, G155, E249

8. 186KKKN189 1 168AvKSfYEKpDVKTaLK183

9. 226KKAGElAA233 1 83IePEGkN89 ? 236KIiPSEPvDI245 K220, E221, F223

10. 236KIiPSEPvDI245 1 83IePEGkN89 ? 168AvKSfYEKpDVKTaLK183 ? 226KKAGElAA233 E249

11. 274RvMPGDELGNrHmGkTiLFHK294 1303RKEFtAvLGVND314 K33

12. 303RKEFtAvLGVND314 1 274RvMPGDELGNrHmGkTiLFHK294 ? 321EDVLfIsTkS330

13. 321EDVLfIsTkS330 ? 303RKEFtAvLGVND314 ? 333GDiKNLVSELRKNKTLQKYTE353

14. 333GDiKNLVSELRKNKTLQKYTE353 ? 13GGKgER18 ? 321EDVLfIsTkS330

Predicted SE

1. 209KTYsP213 E206

2. 36SNK38 K33

3. 137KEH139 R200, R253

4. 120HPVKE124 K127, S260, G262

In capital letters are highlighted the residues with an Accessible Surface Area (ASA) higher than or equal to 30%. In the third column can be

observed the residues which are less than 6 A from the Antigenic Determinant (AD) highlighted in bold. These residues should be taken into

account as a part of the CE. It can also be noticed that some AD could participate in more than one CE, e.g.: AD 161KSTDA165 belong to CE 6

and 7

Arch Microbiol

123

References

Altschul SF et al (1997) Gapped BLAST and PSI-BLAST: a new

generation of protein database search programs. Nucleic Acids

Res 25:3389–3402

Arnold K, Bordoli L, Kopp J, Schwede T (2006) The SWISS-

MODEL workspace: a web-based environment for protein

structure homology modelling. Bioinformatics 22:195–201

Ballicora MA, Iglesias AA, Preiss J (2003) ADP-glucose pyrophos-

phorylase, a regulatory enzyme for bacterial glycogen synthesis.

Microbiol Mol Biol Rev 67:213–225 table of contents

Ballicora MA, Iglesias AA, Preiss J (2004) ADP-glucose pyrophos-

phorylase: a regulatory enzyme for plant starch synthesis.

Photosynth Res 79:1–24

Barnett JK et al (1999) Expression and distribution of leptospiral

outer membrane components during renal infection of hamsters.

Infect Immun 67:853–861

Berman HM et al (2000) The protein data bank. Nucleic Acids Res

28:235–242

Bharti AR et al (2003) Leptospirosis: a zoonotic disease of global

importance. Lancet Infect Dis 3:757–771

Blankenfeldt W, Asuncion M, Lam JS, Naismith JH (2000) The

structural basis of the catalytic mechanism and regulation of

glucose-1-phosphate thymidylyltransferase (RmlA). EMBO J

19:6652–6663

Bomfim MR, Ko A, Koury MC (2005) Evaluation of the recombinant

LipL32 in enzyme-linked immunosorbent assay for the serodi-

agnosis of bovine leptospirosis. Vet Microbiol 109:89–94

Boonyod D, Poovorawan Y, Bhattarakosol P, Chirathaworn C (2005)

LipL32, an outer membrane protein of Leptospira, as an antigen

in a dipstick assay for diagnosis of leptospirosis. Asian Pac J

Allergy Immunol 23:133–141

Bowie JU, Luthy R, Eisenberg D (1991) A method to identify protein

sequences that fold into a known three-dimensional structure.

Science 253:164–170

Bradford MM (1976) A rapid and sensitive method for the

quantitation of microgram quantities of protein utilizing the

principle of protein-dye binding. Anal Biochem 72:248–254

Brede G, Fjaervik E, Valla S (1991) Nucleotide sequence and

expression analysis of the Acetobacter xylinum uridine diphos-

phoglucose pyrophosphorylase gene. J Bacteriol 173:7042–7045

Bulach DM, Kalambaheti T, de la Pena-Moctezuma A, Adler B

(2000a) Functional analysis of genes in the rfb locus of

Leptospira borgpetersenii serovar Hardjo subtype Hardjobovis.

Infect Immun 68:3793–3798

Bulach DM, Kalambaheti T, de la Pena-Moctezuma A, Adler B

(2000b) Lipopolysaccharide biosynthesis in Leptospira. J Mol

Microbiol Biotechnol 2:375–380

Cupp-Vickery JR, Igarashi RY, Meyer CR (2005) Preliminary

crystallographic analysis of ADP-glucose pyrophosphorylase

from Agrobacterium tumefaciens. Acta Crystallogr Sect F Struct

Biol Cryst Commun 61:266–268

Cupp-Vickery JR, Igarashi RY, Perez M, Poland M, Meyer CR

(2008) Structural analysis of ADP-glucose pyrophosphorylase

from the bacterium Agrobacterium tumefaciens. Biochemistry

47:4439–4451

Fusari C, Demonte AM, Figueroa CM, Aleanzi M, Iglesias AA (2006)

A colorimetric method for the assay of ADP-glucose pyrophos-

phorylase. Anal Biochem 352:145–147

Garami A, Ilg T (2001) Disruption of mannose activation in Leishmaniamexicana: GDP-mannose pyrophosphorylase is required for

virulence, but not for viability. EMBO J 20:3657–3666

Ghosh HP, Preiss J (1966) Adenosine diphosphate glucose pyrophos-

phorylase. A regulatory enzyme in the biosynthesis of starch in

spinach leaf chloroplasts. J Biol Chem 241:4491–4504

Ginsburg V (1964) Sugar nucleotides and the synthesis of carbohy-

drates. Adv Enzymol Relat Areas Mol Biol 26:35–88

Gornik O, Dumic J, Flogel M, Lauc G (2006) Glycoscience—a new

frontier in rational drug design. Acta Pharm 56:19–30

Gouet P, Courcelle E, Stuart DI, Metoz F (1999) ESPript: analysis of

multiple sequence alignments in PostScript. Bioinformatics

15:305–308

Griffith ME, Hospenthal DR, Murray CK (2006) Antimicrobial

therapy of leptospirosis. Curr Opin Infect Dis 19:533–537

Griffith ME et al (2007) Efficacy of fluoroquinolones against

Leptospira interrogans in a hamster model. Antimicrob Agents

Chemother 51:2615–2617

Guex N, Peitsch MC (1997) SWISS-MODEL and the Swiss-

PdbViewer: an environment for comparative protein modeling.

Electrophoresis 18:2714–2723

Haake DA et al (1999) Leptospiral outer membrane proteins OmpL1

and LipL41 exhibit synergistic immunoprotection. Infect Immun

67:6572–6582

Haake DA et al (2000) The leptospiral major outer membrane protein

LipL32 is a lipoprotein expressed during mammalian infection.

Infect Immun 68:2276–2285

Jaeckel P, Krauss G, Menge S, Schierhorn A, Rucknagel P, Krauss GJ

(2005) Cadmium induces a novel metallothionein and phyto-

chelatin 2 in an aquatic fungus. Biochem Biophys Res Commun

333:150–155

Jiang XM, Neal B, Santiago F, Lee SJ, Romana LK, Reeves PR

(1991) Structure and sequence of the rfb (O antigen) gene cluster

of Salmonella serovar typhimurium (strain LT2). Mol Microbiol

5:695–713

Jin X, Ballicora MA, Preiss J, Geiger JH (2005) Crystal structure of

potato tuber ADP-glucose pyrophosphorylase. EMBO J 24:694–

704

Kleczkowski LA, Villand P, Preiss J, Olsen OA (1993) Kinetic

mechanism and regulation of ADP-glucose pyrophosphorylase

from barley (Hordeum vulgare) leaves. J Biol Chem 268:6228–

6233

Kobayashi H et al (1997) Structure of a cell wall mannan from the

pathogenic yeast, Candida catenulata: assignment of 1H nuclear

magnetic resonance chemical shifts of the inner alpha-1, 6-linked

mannose residues substituted by a side chain. Arch Biochem

Biophys 341:70–74

Kulkarni-Kale U, Bhosle S, Kolaskar AS (2005) CEP: a conformational

epitope prediction server. Nucleic Acids Res 33:W168–W171

Laemmli UK (1970) Cleavage of structural proteins during the

assembly of the head of bacteriophage T4. Nature 227:680–685

Larsson P, Wallner B, Lindahl E, Elofsson A (2008) Using multiple

templates to improve quality of homology models in automated

homology modeling. Protein Sci 17:990–1002

Luthy R, Bowie JU, Eisenberg D (1992) Assessment of protein

models with three-dimensional profiles. Nature 356:83–85

Maniatis T, Fritsch EF, Sambrook J (1982) Molecular cloning: a

laboratory manual. Cold Spring Harbor Laboratory, Cold Spring

Harbor

Martins LO et al (1999) Biosynthesis of mannosylglycerate in the

thermophilic bacterium Rhodothermus marinus. Biochemical

and genetic characterization of a mannosylglycerate synthase.

J Biol Chem 274:35407–35414

May TB, Shinabarger D, Boyd A, Chakrabarty AM (1994) Identi-

fication of amino acid residues involved in the activity of

phosphomannose isomerase-guanosine 50-diphospho-D-mannose

pyrophosphorylase. A bifunctional enzyme in the alginate

biosynthetic pathway of Pseudomonas aeruginosa. J Biol Chem

269:4872–4877

Melo F, Feytmans E (1998) Assessing protein structures with a non-

local atomic interaction energy. J Mol Biol 277:1141–1152

Arch Microbiol

123

Melo A, Glaser L (1965) The nucleotide specificity and feedback

control of thymidine diphosphate D-glucose pyrophosphorylase.

J Biol Chem 240:398–405

Ning B, Elbein AD (1999) Purification and properties of mycobac-

terial GDP-mannose pyrophosphorylase. Arch Biochem Biophys

362:339–345

Ning B, Elbein AD (2000) Cloning, expression and characterization

of the pig liver GDP-mannose pyrophosphorylase. Evidence that

GDP-mannose and GDP-Glc pyrophosphorylases are different

proteins. Eur J Biochem 267:6866–6874

Opperdoes FR, Michels PA (2001) Enzymes of carbohydrate

metabolism as potential drug targets. Int J Parasitol 31:482–490

Preston A, Mandrell RE, Gibson BW, Apicella MA (1996) The

lipooligosaccharides of pathogenic gram-negative bacteria. Crit

Rev Microbiol 22:139–180

Ramachandran GN, Ramakrishnan C, Sasisekharan V (1963) Stereo-

chemistry of polypeptide chain configurations. J Mol Biol 7:95–

99

Russell RB, Barton GJ (1992) Multiple protein sequence alignment

from tertiary structure comparison: assignment of global and

residue confidence levels. Proteins 14:309–323

Saavedra-Lira E, Perez-Montfort R (1996) Energy production in

Entamoeba histolytica: new perspectives in rational drug design.

Arch Med Res 27:257–264

Sali A, Blundell TL (1993) Comparative protein modelling by

satisfaction of spatial restraints. J Mol Biol 234:779–815

Shinabarger D, Berry A, May TB, Rothmel R, Fialho A, Chakrabarty

AM (1991) Purification and characterization of phosphomannose

isomerase-guanosine diphospho-D-mannose pyrophosphorylase.

A bifunctional enzyme in the alginate biosynthetic pathway of

Pseudomonas aeruginosa. J Biol Chem 266:2080–2088

Sugahara MKN (2005) Crystal structure of mannose-1-phosphate

guanyltransferase from Thermus thermophilus Hb8. Riken

Structural GenomicsPROTEOMICS, Initiative (Rsgi)

Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W:

improving the sensitivity of progressive multiple sequence

alignment through sequence weighting, position-specific gap

penalties and weight matrix choice. Nucleic Acids Res 22:4673–

4680

Vega MC et al (2005) Regulation of the hetero-octameric ATP

phosphoribosyl transferase complex from Thermotoga maritimaby a tRNA synthetase-like subunit. Mol Microbiol 55:675–686

Veloso IF, Lopes MT, Salas CE, Moreira EC (2000) A comparison of

three DNA extractive procedures with Leptospira for polymerase

chain reaction analysis. Mem Inst Oswaldo Cruz 95:339–343

Verlinde CL et al (2001) Glycolysis as a target for the design of new

anti-trypanosome drugs. Drug Resist Updat 4:50–65

Yang Y-H, Kang Y-B, Lee K-W, Lee T-H, Park S-S, Hwang B-Y,

Kim B-G (2005) Characterization of GDP-mannose pyrophos-

phorylase from Escherichia coli O157:H7 EDL933. J Mol Catal

B: Enzym 37:1–8

Zhang L, Radziejewska-Lebrecht J, Krajewska-Pietrasik D, Toivanen

P, Skurnik M (1997) Molecular and chemical characterization of

the lipopolysaccharide O-antigen and its role in the virulence of

Yersinia enterocolitica serotype O:8. Mol Microbiol 23:63–76

Zuccotti S, Zanardi D, Rosano C, Sturla L, Tonetti M, Bolognesi M

(2001) Kinetic and crystallographic analyses support a sequen-

tial-ordered bi bi catalytic mechanism for Escherichia coliglucose-1-phosphate thymidylyltransferase. J Mol Biol 313:831–

843

Zunino ME, Pizarro PR (2007) Leptospirosis: a literature review. Rev

Chilena Infectol 24:220–226

Arch Microbiol

123