L-Type Calcium Channel Blockers Exert an Antiinflammatory Effect by Suppressing Expression of Plasminogen Receptors on Macrophages

L-Type Calcium Channel Blockers Exert anAntiinflammatory Effect by Suppressing Expression of

Plasminogen Receptors on MacrophagesRiku Das, Tim Burke, David R. Van Wagoner, Edward F. Plow

Abstract—L-type Ca2� channel (LTCC) blockers, represented by amlodipine and verapamil, are widely used antihyper-tensive drugs that also have antiinflammatory activities. Plasminogen (Plg) is an important mediator of macrophagerecruitment, and this role depends on its interaction with Plg receptors (Plg-Rs). Plg-Rs include histone 2B, �-enolase,annexin 2, and p11, all proteins which lack signal sequences for cell surface export. When human or murine monocytoidcells were induced to differentiate into macrophages, their Plg binding and Plg-R expression increased by 4-fold. Thesechanges were suppressed by pretreatment with verapamil and amlodipine. Expression of the Cav1.2 LTCC pore subunitwas induced in differentiated macrophages, and siRNA against this subunit suppressed the upregulation of Plg bindingand Plg-Rs. In vivo, amlodipine and verapamil suppressed peritoneal macrophage recruitment in response tothioglycollate by �60% at doses that did not affect blood pressure. In drug-treated animals, macrophages migratedinto but not through the peritoneal membrane tissue and showed reduced surface expression of Plg-Rs. Thesefindings demonstrate that Plg-R expression on macrophages is dependent on Cav1.2 LTCC subunit expression.Suppression of Plg-Rs may contribute to the antiinflammatory effects of the widely used LTCC blockers. (CircRes. 2009;104:167-175.)

Key Words: plasminogen � plasminogen receptors � amlodipine � verapamil � macrophages

Involvement of plasminogen (Plg) and its active enzymeplasmin (Plm) in macrophage recruitment has been docu-

mented in a number of inflammatory models in Plg�/�

mice.1–4 When bound to cell surfaces, Plg/Plm facilitatesmacrophage migration across adhesive substrates by directdegradation of extracellular matrix (ECM) proteins and byactivating matrix metalloproteinase. Plg receptors (Plg-Rs)are abundant on the surface of macrophages and are hetero-geneous but are usually characterized by the presence of aC-terminal lysine, which interacts with the lysine-bindingsites of Plg.5,6 The major Plg-Rs expressed on macrophagesare �-enolase, histone (H)2B, annexin 2, and p11.7–10 We andother have demonstrated that inflammation induces increasedPlg binding to mouse macrophages and differentiated humanmacrophages.11–16 The mechanisms that promote upregula-tion of Plg-Rs during monocyte maturation are poorly under-stood because none of the major Plg-Rs has a signal sequencefor export through the “conventional” endoplasmic reticulum(ER)/Golgi pathway.

In excitable cells, L-type Ca2� channels (LTCCs) arevoltage-dependent Ca2� channels composed of a pore-forming �1 subunit (Cav1.1, Cav1.2, Cav1.3, or Cav1.4) andseveral associated auxiliary subunits (�2-�, -�, -�). Cav1.2pore subunits have also been detected in cells of leukocyte

lineage.17–19 Besides lowering blood pressure, LTCC block-ers have antiinflammatory effects. Amlodipine, a long-actingdihydropyridine, limits the progression of arteriosclerosis anddecreases cardiovascular events.20,21 Verapamil, a phenylal-kylamine, also has antiinflammatory properties.22 In search ofa mechanism regulating exteriorization of Plg-Rs duringmonocyte to macrophage differentiation, we now report aprofound effect of amlodipine and verapamil on exterioriza-tion of H2B and other Plg-Rs in vitro. We further demonstratethat these drugs suppress macrophage recruitment and Plg-Rexpression on these cells in vivo.

Materials and MethodsAn expanded Material and Methods section is available in the OnlineData Supplement at http://circres.ahajournals.org.

Monocyte DifferentiationHuman monocytoid THP-1 cells were stimulated to differentiatewith 250 U/mL interferon (IFN)� (eBioscience) plus 100 nmol/LVD3 (Calbiochem) for 0 to 2 days in complete growth medium underconditions similar to those described by Kim et al.12

Fluorescence-Activated Cell SortingRabbit polyclonal anti-�1 Cav1.2 (Alomone) was used to detectLTCC on various cell types. Phycoerythrin-conjugated anti-CD14

Original received October 20, 2008; resubmission received May 4, 2009; accepted June 1, 2009.From the Joseph J. Jacobs Center for Thrombosis and Vascular Biology, Department of Molecular Cardiology, Cleveland Clinic, Ohio.Correspondence to Edward F. Plow, PhD, Department of Molecular Cardiology, Lerner Research Institute, Cleveland Clinic, 9500 Euclid Ave/NB50,

Cleveland, OH 44195. E-mail [email protected]© 2009 American Heart Association, Inc.

Circulation Research is available at http://circres.ahajournals.org DOI: 10.1161/CIRCRESAHA.109.200311

167 by guest on April 21, 2016http://circres.ahajournals.org/Downloaded from by guest on April 21, 2016http://circres.ahajournals.org/Downloaded from by guest on April 21, 2016http://circres.ahajournals.org/Downloaded from by guest on April 21, 2016http://circres.ahajournals.org/Downloaded from by guest on April 21, 2016http://circres.ahajournals.org/Downloaded from by guest on April 21, 2016http://circres.ahajournals.org/Downloaded from by guest on April 21, 2016http://circres.ahajournals.org/Downloaded from by guest on April 21, 2016http://circres.ahajournals.org/Downloaded from by guest on April 21, 2016http://circres.ahajournals.org/Downloaded from by guest on April 21, 2016http://circres.ahajournals.org/Downloaded from by guest on April 21, 2016http://circres.ahajournals.org/Downloaded from by guest on April 21, 2016http://circres.ahajournals.org/Downloaded from by guest on April 21, 2016http://circres.ahajournals.org/Downloaded from by guest on April 21, 2016http://circres.ahajournals.org/Downloaded from by guest on April 21, 2016http://circres.ahajournals.org/Downloaded from by guest on April 21, 2016http://circres.ahajournals.org/Downloaded from

http://circres.ahajournals.org/
















(eBioscience) was used to measure monocyte differentiation tomacrophages.

Plg BindingPlg binding was assessed as described previously.15

Cell Surface Biotinylation and Western BlottingCell surface biotinylation on THP-1 cells followed by Western blotwas performed as previously described.15

RNA InterferenceCav1.2 subunit of LTCC was knocked down by small interfering(si)RNA designed to target Cav1.2 subunit (SiCav1.2, Dharmacon)using the nucleofection protocol described by Amaxa. ControlsiRNA (SiControl) was a scrambled sequence and was provided byAmbion.

RNA Isolation and RT-PCRRNA isolation and RT-PCR were performed using RNeasy Mini Kits(Qiagen) and OneStep RT-PCR kit (Qiagen), respectively. Theprimers used to amplify Cav11.2 transcripts have been describedpreviously.18

Intracellular Ca2� MeasurementsFura-2–loaded THP-1 cells (Fura-2 from Invitrogen) were stimulatedwith 1 �mol/L fMLP (Sigma), and Ca2� mobilization was recordedusing a fluorimeter (Photon Technology International) with dualexcitation at 340 and 380 nm.

In Vitro Matrigel InvasionIn vitro Matrigel assay was performed as previously described.15

In Vivo ExperimentsAmlodipine, verapamil, or their vehicle controls were adminis-tered via subcutaneously implanted osmotic minipump, 0.25 �L/h(Alzet, Durect). Peritoneal inflammation was induced by IPadministration of thioglycollate (TG). Cells within the peritoneallavage, collected 3 days after TG, were counted and peritonealmembrane (PM) that lines the pancreas was isolated for furtherstudy.23

HistochemistryAnti-Mac3 (BD Biosciences) and biotinylated anti-rat antibody(mouse adsorbed, Vector) were used to stain sections of PM anddeveloped with Vectastain avidin–biotin complex (ABC) reagent(Vector) using DAB as a substrate and counterstainedwith hematoxylin.

Confocal MicroscopyRabbit polyclonal anti-peptide antibodies against H2B, �-enolase,annexin 2, p11, or nonimmune rabbit IgG were reacted with 8-�msections, followed by Alexa-488 –labeled anti-rabbit IgG(Invitrogen).

Statistical AnalysisValues are expressed as means�SD; probability values are based onpaired Student’s t tests. Results with P�0.05 were consideredsignificantly different.

ResultsMonocyte Differentiation Induces Plg BindingTo investigate the molecular pathway(s) by which cell sur-face expression of Plg-Rs is modulated during monocyteactivation, an in vitro model, THP-1 differentiation to mac-rophages, was implemented. When THP-1 cells were treatedwith IFN��VD3, expression of the macrophage differentia-tion marker CD14 was substantially enhanced on day 1 andfurther increased on day 2 (Figure 1A). As measured byFACS, Alexa-488–labeled Plg binding increased 4-fold atday 2 (Figure 1A). In parallel, cell surface expression of themajor Plg-Rs on these cells, annexin 2, �-enolase, H2B, andp11, increased by 3- to 4-fold (Figure 1B, left, and Figure1C), as measured by Western blots with specific antibodies toeach protein.15 CD14 expression was also increased at the cellsurface and in whole cell lysates (Figure 1B and 1C).Consistent with a previous report,14 cellular annexin 2 ex-pression increased with differentiation, both at the protein andmRNA levels (Figure 1B and 1C). However, increased cellsurface expression of �-enolase, H2B, and p11 occurred in

Figure 1. Effect of differentiation of THP-1monocytoid cells on plasminogen (Plg)binding. A, THP-1 cells were stimulatedwith IFN��VD3 and FACS was performedimmediately after stimulation (day 0), day1, or day 2 with Alexa-488–Plg andphycoerythrin–anti-CD14. Stimulationenhances Plg binding and CD14 expres-sion. Data are representative of 3 inde-pendent experiments. B, Western blots ofcell surface Plg-Rs as biotinylated pro-teins, isolated on streptavidin beads, fromTHP-1 cells on days 0, 1, or 2 afterIFN��VD3. For comparison, Westernblots of whole cell lysates show total cel-lular levels of the Plg-Rs. C, Intensity ofthe Western blot bands are plotted as thefold increase of each Plg-R compared tononstimulated THP-1 cells. Data are themeans�SD from triplicate blots. Striatedbars, whole cell lysates; black bars, cellsurface levels. *P�0.05 vs correspondingprotein on untreated cells.

168 Circulation Research July 17, 2009

by guest on April 21, 2016http://circres.ahajournals.org/Downloaded from


the absence of detectable changes in total cellular expressionat either the protein or mRNA levels, suggesting that changesin cell surface expression were independent of new proteinsynthesis (Figure 1B, right, and Figure 1C; Online Figure I).Similar results were demonstrated recently for �-enolase,16

using lipopolysaccharide to induce its cell surface expression.Together, these observations suggest changes in proteintrafficking.

LTCC Inhibitors Regulate Surface Expressionof Plg-RsTHP-1 cells pretreated with Brefeldin A, which blockstransport of protein from the ER to the Golgi, reduced Plgbinding by �25% (Figure 2A; P�0.02). Pathways involvedin “nonconventional” protein secretion can include the ABC1transporter.24 However, glyburide, an ABC1 transporter in-hibitor, did not reduce Plg binding significantly (Figure 2A).

Endolysosomal recycling (interleukin-1�) and Na�/K�-ATPase (fibroblast growth factor-2) have also been impli-cated as mediators of nonconventional protein surface expres-sion.25,26 However, methylamine, which blocks endosomalrecycling25 and ouabain, a Na�/K�-ATPase inhibitor, had noeffect on differentiation-induced Plg binding to THP-1 cells(Figure 2B). Increased [Ca2�]in is a primary cellular responseassociated with monocyte differentiation.27 Pretreatment ofTHP-1 cells with BAPTA-AM, a cell-permeant calciumchelator, blocked the IFN��VD3-induced increase in Plgbinding by 98% (Figure 2B). Consistent with a role for[Ca2�]in in modulating Plg-R expression, ionomycin, a Ca2�

ionophore, enhanced Plg binding to the IFN��VD3 treatedTHP-1 cells by 34�9.8% (P�0.01).

To further investigate the role of [Ca2�]in in regulation ofPlg binding, the effects of selective Ca2� channel inhibitorswere tested. Pretreatment of THP-1 cells with �-agatoxin and�-conotoxin, which block P-type and N-type Ca2� channels,respectively, had no effect on Plg binding (Figure 2B).However, 2 unrelated LTCC blockers, verapamil and amlo-dipine, effectively suppressed differentiation-induced Plgbinding (Figure 2B). The concentration of these LTCCblockers (10 �mol/L) was selected based on a previous studyon their effects on adhesion of THP-1 cells.17 LTCC blockerscan also attenuate the synthesis of superoxide anions.28

However, pretreatment of cells with tempol (4-hydroxy-2,2,6,6-tetramethyl-piperidininoxyl), a stable membrane-permeable superoxide dismutase mimetic, had only a modesteffect (26%; P�0.06) on the increase in Plg binding inducedby differentiation (Figure 2B). Activation of LTCC is asso-ciated with cAMP generation,29 and IFN� mediates �-enolasecell surface expression via mitogen-activated protein kinase(MAPK)/extracellular signal-regulated kinase (ERK)1/2 acti-vation.30 Pretreatment of cells with the adenylate cyclaseinhibitor SQ22536 or the ERK1/2 phosphorylation inhibitorPD98059 had no effect on differentiation-induced Plg bind-ing (Online Figure II, C), even though PD98059 blockeddifferentiation-induced cAMP generation and SQ22536blocked ERK1/2 phosphorylation in the cells (Online FigureII, A and B).

Presence of Functional LTCCs in Monocytesand MacrophagesThree independent approaches were used to evaluate thepresence and function of LTCC in the differentiated mono-cytoid cells. First, RT-PCR was performed on RNA isolatedfrom THP-1 cells, human blood monocyte–derived macro-phages (HBMM�), and TG-induced mouse peritoneal mac-rophages (TGMPM�). Using primers18 amplifying the IVS4-IVS6 domain of the Cav1.2 subunit of LTCC, an intense bandof the predicted size (350 kb) was amplified in each cell type(Figure 3A). Human aortic smooth muscle cells (HASMCs),used as a positive control,31 also yielded a similar product. Allof these cells also expressed LTCC �1 and �2 subunits(RT-PCR; data not shown). Second, using FACS, an anti-Cav1.2 antibody against a Cav1.2 intracellular sequenceepitope reacted well with permeabilized HASMCs andTHP-1, TGMPM�, and HMDM� cells. This signal wassubstantially reduced by exposure to the immunizing peptide

Figure 2. Export pathways involved in enhanced Plg binding todifferentiated THP-1 cells. THP-1 cells were pretreated for 1hour with the indicated drugs and then differentiated withIFN��VD3 for 24 hours. FACS of Alexa-488–Plg binding wasperformed as in Figure 1, assigning of Plg binding to the cellsstimulated with IFN��VD3 a value of 100%. A, Brefeldin A (ER/Golgi inhibitor), glyburide (ABC1 inhibitor), methylamine (endoly-sosomal pathway inhibitor), and ouabain (Na�/K�-ATPase inhib-itor) had minimal effects on Plg binding. B, Pretreatment withthe [Ca2�]in chelator BAPTA-AM or blockers of LTCCs amlodip-ine or verapamil completely blocked the increase in Plg bindingassociated with differentiation. Pretreatment with inhibitors ofP-type Ca2� channels (�-agatoxin IVA) or N-type Ca2� channels(�-conotoxin or tempol, a superoxide dismutase mimetic) hadno significant effect on Plg binding. Ionomycin, a Ca2� iono-phore, increased Plg binding. The values are the mean fluores-cence intensities from 3 independent FACS experiments.*P�0.05 compared to Plg binding to IFN��VD3-stimulated cellsin the absence of inhibitors.

Das et al Plasminogen Receptor and L-Type Calcium Channels 169



(Figure 3B). Additionally, Cav1.2 expression was enhancedon treatment of THP-1 cells with IFN��VD3 for 0 to 2 days(Online Figure III, A). Third, Ca2� mobilization in responseto fMLP increased with differentiation (Online Figure III, B).This Ca2� entry was blunted by amlodipine or verapamil,implicating LTCC in the [Ca2�]in response (Figure 3C).However, [Ca2�]in was unchanged when cells were treatedwith 50 mmol/L KCl to induce depolarization (data notshown), suggesting that the LTCC present in THP-1 cells arenot voltage-gated.

To eliminate the nonspecific actions of LTCC blockers,THP-1 cells were nucleofected with siRNA against Cav1.2(SiCav1.2) or a control siRNA (SiControl) and then stimu-lated with IFN��VD3. The upregulation of Cav1.2 inducedby differentiation was suppressed by SiCav1.2, but not bySiControl (Online Figure IV). Moreover, differentiation-induced Plg binding was reduced by �90% (Figure 5A) bySiCav1.2 compared to SiControl. Interference with Cav1.2expression also suppressed the [Ca2�]in response induced byfLMP in differentiated THP-1 cells (Figure 5C).

Involvement of LTCCs and [Ca2�]in inUpregulation of Plg-Rs on Stimulated THP-1 CellsWe sought to determine whether the dependence of Plgbinding on LTCC and their function was attributable tosuppression of one or more Plg-Rs. When THP-1 cells werepretreated with BAPTA-AM and then stimulated withIFN��VD3, BAPTA-AM prevented the cell surface upregu-lation of each of the 4 Plg-Rs (Figure 4A, left and right),without changing whole cell content of these proteins, ie,trafficking of these Plg-Rs is Ca2�-dependent. In THP-1 cellspretreated with amlodipine or verapamil and then induced to

differentiate, induction of each of the 4 Plg-Rs was reducedby the lower concentration (5 �mol/L) and was almost fullyblocked by their higher concentration (10 �mol/L), with noeffect on whole cell levels of these proteins (Figure 4B, topand bottom). Similarly, SiCav1.2 but not SiControl sup-pressed surface expression without affecting whole cell levelsof the Plg-Rs (Figure 5B).

LTCCs Blockers Impair Macrophage RecruitmentIn Vivo by Suppressing Plg-RsLTCC inhibitors are known to have antiinflammatory ef-fects,20–22,28 and we sought to determine whether suppressionof Plg-R expression might underlie this activity. To test thispossibility, we turned to a widely used inflammatory model.Verapamil and amlodipine were administered to mice viasubcutaneously implanted mini-pumps beginning 2 days be-fore thioglycollate (TG)-induced peritonitis, which involvesblood monocyte differentiation into macrophages and theirrecruitment to the site of inflammation.3,32 Amlodipine inhib-ited macrophage recruitment by 54% (P�0.004) at 1 mg/kgper day and by 87% (P�9.2210�7) at 3 mg/kg per daycompared to its vehicle control (Figure 6A). With verapamil,inhibition at the lower (1 mg/kg per day) and higher doses (3mg/kg per day) was 82% (P�1.2410�6) and 64%(P�0.001), respectively. The differences in recruitment at thehigh and low dose of verapamil were not significant(P�0.11). The vehicle control for each drug was not differentfrom the recruitment observed in untreated mice. Eventhough these drugs are antihypertensive, hypotensive effectswere only detected at the higher doses of both drugs (Table).At the lower doses at which both amlodipine and verapamilsuppressed macrophage recruitment by 54 and 80%, respec-

Figure 3. Presence and function of LTCCs on human and mouse mac-rophages. A, Agarose gels of the RT-PCR product amplified from RNAfrom HASMCs, THP-1 cells, thioglycollate-induced mouse peritonealmacrophages (TGMPM�), and human peripheral blood monocyte–derived macrophages (HBM�) reveal expression of Cav11.2 mRNA(n�3). B, FACS with anti-Cav1.2 (black open histogram) or anti-Cav1.2preincubated with the antigen peptide (gray solid histogram) shows thepresence of the LTCC. Representative of 3 experiments. C, Increase in

[Ca2�]in induced by fLMP in differentiated THP-1 cells (day 2 after IFN��VD3) is inhibited by amlodipine (100 �mol/L) (green) or verap-amil (100 �mol/L) (red). [Ca2�]in data representative of 4 experiments.




tively, systolic blood pressure was unaffected (Table). Simi-lar effects of these doses of LTCC blockers on blood pressurewere observed by Kataoka et al.33 These results suggest thatthe drugs were used in a biologically relevant range.

The reduction in macrophage recruitment in response toTG in mice deficient in Plg3 arises from their accumulation inthe membrane (PM) of the peritoneal cavity.23 If the decreaseof macrophage recruitment by the antihypertensive drugs wasassociated with modulation of Plg binding and Plg-R expres-sion, the antiinflammatory effects of amlodipine and verap-amil also might arise from the accumulation of macrophagesin the PM. Hematoxylin/eosin staining demonstrated a largeaccumulation of cells in the PM of mice treated at the lower,nonhypertensive dose of amlodipine and verapamil (Figure6B). The accumulated cells in the PM of the drug-treated

mice were identified as macrophages based on Mac3 staining(Figure 6C): the abundance of Mac3-positive cells was15�2.5% with amlodipine and 27�5.3% with verapamilversus 3.3�0.4% (P�0.001) and 3.4�0.4% (P�0.001), re-spectively, in PM of vehicle-treated mice. Thus, the accumu-lation was enhanced �7-fold by verapamil and �5-fold withamlodipine (Figure 6D).

To determine whether the accumulation of macrophages inthe PM of animals on the antihypertensive drugs was attrib-utable to effects on Plg-R expression, we examined theexpression of the 4 Plg-Rs of interest on the surface ofmacrophages arrested in the PM of the drug-treated micecompared to accumulated macrophages of Plg�/� mice.Confocal analyses of PM sections revealed H2B, �-enolase,annexin 2, and p11 on the surface (cells were not permeab-

Figure 4. Role of LTCC and [Ca2�]in in surface expression of Plg-Rs. THP-1 cells were pretreated with BAPTA-AM (A) or amlodipineand verapamil (B) for 45 to 60 minutes and then treated with IFN��VD3 for 24 hours. Western blots of biotinylated proteins show inhi-bition of surface expression of �-enolase, H2B, annexin 2, and p11 without affecting whole cell levels of these proteins. A and B, Barsare derived from densitometry of cell surface bands relative to unstimulated controls, calculated from 3 separate blots: �-enolase (openbars), H2B (black bars), annexin 2 (gray bars), and p11 (striated bars). *P�0.05 compared to corresponding Plg-R levels in IFN��VD3treated cells.




ilized) of arrested macrophages (Figure 7A) in Plg�/� mice.H2B was also present in the matrix of the PM in the Plg�/�

mice. After verapamil treatment, �-enolase levels were unaf-fected on the macrophages in the PM of the Plg�/� micecompared to Plg�/� mice (Figure 6A and 6B). However, cellsurface distribution of annexin 2 and H2B were drasticallyreduced in the drug-treated Plg�/� versus the Plg�/� mice(Figure 7A and 7B). p11 cell surface distribution was alsoreduced in drug-treated macrophages compared to Plg�/�

macrophages (Figure 7A and 7B). These results suggest thatLTCC blockers are antiinflammatory, and this phenomenonoccurs in concert with reductions of Plg-Rs on the surface ofmacrophages.

DiscussionReceptors for Plg play an important role in regulatinginflammatory cell recruitment.15,16,23,34 In the present study,we have sought to address the longstanding dilemma as tohow Plg-Rs are regulated on inflammatory cells, using THP-1differentiation to macrophages to drive surface expression ofPlg-Rs. Stimulation of THP-1 cells with IFN��VD3 led to�4-fold increase in Plg binding, consistent with a previousreport.13 Concomitant with this increase, stimulation of thecells for 24 to 48 hours led to increased cell surfaceexpression of the Plg-Rs. For H2B, �-enolase, and p11, the

increase in cell surface localization occurred without detect-able increases in total cellular protein and mRNA levels. Incontrast, cellular protein expression, mRNA levels, and cellsurface expression of annexin 2 were all increased withdifferentiation of the THP-1 cells, consistent with a previousreport.14

Several inhibitors of known nonconventional pathways ofprotein export were tested, using glyburide (to block theABC1 transporter), ouabain (Na�/K� ATPase), and meth-ylamine (endosomal pathway). All of these inhibitors hadminimal effects on Plg binding and Plg-R expression. Incontrast, the intracellular [Ca2�]in chelator, BAPTA-AM,suppressed the increment in Plg binding induced byIFN��VD3 by 98% and completely blocked the increasedexpression of the 4 Plg-Rs assessed. To further dissect therole of [Ca2�]in in regulation of Plg-Rs, we tested the effectsof verapamil and amlodipine, 2 distinct LTCC inhibitors.Both LTCC blockers completely suppressed the upregulationof Plg-Rs by IFN��VD3. In contrast, ionomycin, whichincreases [Ca2�]in, led to a significant increase in Plgbinding; its modest effect may be attributable to repression ofH2B gene expression by ionomycin.35

In support of the pharmacological data implicating theLTCC and cytosolic calcium in regulation of Plg-R mem-brane localization, we found that THP-1 cells, as well as

Figure 5. Cav1.2 siRNA decreases differentiation-induced Plg binding,surface expression of Plg-Rs, and [Ca2�]in. THP-1 cells were eitheruntreated or transfected with siRNA to Cav1.2 (SiCav1.2) or a controlsiRNA (SiControl) and then stimulated with IFN��VD3 for 1 or 2 days.Differentiation-induced Plg binding (A), Plg-R cell surface expression(B), and fMLP-stimulated [Ca2�]in (C) is suppressed by SiCav1.2 com-pared to untreated or SiControl-treated cells (C, blue; differentiatedTHP-1 cells, pink; SiControl differentiated, green; SiCav1.2 differenti-ated). Plg binding is the mean fluorescence intensities of FACS from 3independent experiments. Bars show densitometry of cell surfacebands relative to unstimulated controls, calculated from 3 separateblots: �-enolase (open bars), H2B (black bars), annexin 2 (gray bars)and p11 (striated bars). Data are the means�SD from triplicate blots.*P�0.05 compared to Plg binding/Plg-Rs expression to IFN��VD3stimulated cells. [Ca2�]in data are representative of 4 experiments.




mouse and human macrophages, express the LTCC Cav1.2. Toour knowledge, this is the first study to document the presence ofCav1.2 transcript and protein in human and mouse macrophages.Differentiation of monocytes to macrophages was associatedwith increased Cav1.2 expression and a concomitant increase infMLP-stimulated Ca2� mobilization (measured with fura2).This response was blocked by amlodipine, verapamil, andsiRNA against Cav1.2. In macrophages, the LTCC may benon–voltage-gated, because addition of KCl did not induceintracellular Ca2� mobilization. This speculation is consistentwith the nature of LTCC in other nonexcitable cells, such as Tand B lymphocytes,18,19 and likely explains our inability tomeasure voltage-gated calcium channel activity using whole cellpatch clamp (data not shown).

That knockdown of SiCav1.2 with siRNA showed the sameinhibitory effects as verapamil and amlodipine on Plg-R cellsurface expression suggests that the drug effects are attributable

to their interactions with LTCCs. SiCav1.2 inhibited upregulation ofPlg-R cell surface expression, Plg binding, and Plg-mediated Ma-trigel invasion (Online Figure V, A and B). Anti-H2B Fab frag-ments, which block Plg binding to H2B on the cell surface,15

reduced Plm-mediated THP-1 cell Matrigel invasion by 45%compared to nonimmune rabbit IgG Fab (Online Figure V, B), butthere was no additional effect of anti-H2B Fab on the SiCav1.2-treated cells (Online Figure V, B), showing that the suppressiveeffect of SiCav1.2 on Plm-mediated THP-1 Matrigel invasion wasindeed attributable to reduction of one or more candidate Plg-Rs.

Previous work by Brown et al36 showed that verapamilreduced tumor necrosis factor-� mRNA expression in re-sponse to ultrafine particles in rat alveolar macrophages, butwe did not observe changes in whole cell protein or mRNAexpression of Plg-Rs in THP-1 cells by either verapamil oramlodipine. Studies of intracellular signaling have implicatedadenylase cyclase and ERK/MAPK as pathways dependent on

Figure 6. Effect of amlodipine and verapamil on thioglycollate-induced mac-rophage recruitment in vivo. A, Inflammation was induced by IP TG intoPlg�/� mice either untreated, treated with vehicles (DMSO for amlodipine orsaline for verapamil), or treated with 2 concentrations of amlodipine and ve-rapamil administered via subcutaneous osmotic minipumps. Macrophagesrecruited into the peritoneal cavity were quantified by measurement of non-specific esterase activity in the lavage collected 72 hours after TG. *P�0.004for amlodipine vs vehicle (n�8); §P�0.001 for verapamil vs vehicle (n�8). B,Representative photomicrographs of hematoxylin/eosin-stained PM sectionsfrom mice 72 hours after TG. C, Representative anti-Mac3 staining (brown) ofPM sections of TG-treated mice showing extensive macrophage accumula-tion at the PM of amlodipine and verapamil treated mice compared to their

vehicles. Nuclei are stained with hematoxylin (blue). Images are representative of multiple PM sections derived from 3 mice per group.Original magnification, 10. D, Quantification of Mac3 staining per area of PM (%) quantified with Image Proplus shows increasedaccumulation of macrophages in amlodipine or verapamil treated mice: *P�0.001 vs DMSO (n�3); §P�0.001 vs saline (n�3).




LTCC, including in IFN�-mediated enolase cell surface expres-sion. However, in our study, inhibitors of these events failed toblock upregulation of Plg-Rs. The details of the pathway(s) bywhich LTCC and intracellular Ca2� modulate Plg-R cell surfacelocalization remains to be elucidated in future studies.

Macrophage recruitment in a TG-induced mouse peritonitismodel is reduced by �60% in Plg-deficient mice3 and isassociated with a large accumulation of these cells in the PM.23

In our study, we showed that both amlodipine and verapamil ledto a marked suppression (82% to 87%) of macrophage emigra-tion into the peritoneal cavity. The antiinflammatory effects ofamlodipine and verapamil have been demonstrated in previousstudies in other models.20–22,28,33 As in Plg�/� mice, suppressionof migration was associated with accumulation of macrophagesin the PM of the verapamil and amlodipine treated mice. Incomparing accumulated macrophages in mice treated withLTCC blockers and Plg deficiency, the drugs reduced cellsurface expression of H2B and annexin 2 markedly. Cell surfacelocalization of p11 was also reduced, but not as extensively, and�-enolase expression was unaltered. The availability of lowlevels of Plg-Rs may explain why the drugs were slightly lesseffective than absence of Plg in suppressing macrophage recruit-ment. In addition to cell surface localization, H2B protein wasfound in the ECM in the Plg�/� mice. Heparan sulfate proteo-glycans are known to bind the N termini of histones,37 andreleased histones have been shown to localize in the ECM.38

Matrix bound H2B may provide another mechanism for local-izing Plg, enhancing its activation to Plm and, thereby, facilitat-ing inflammatory cell migration.

In summary, our study identifies a pivotal role of increased[Ca2�]in in the upregulation of cell surface expression of Plg-Rson monocyte differentiation into macrophages. We further showthat verapamil and amlodipine, 2 commonly used LTCC block-ers, suppress surface expression of Plg-Rs. The influence ofthese drugs on cell surface expression of Plg-Rs has beendemonstrated both in vitro and in vivo. This previously unrec-

Table. Effects of Verapamil and Amlodipine on Systolic BloodPressure of Mice

TreatmentDay 0,mm Hg

Day 3,mm Hg

Untreated 119�3 116.10�4

DMSO Vehicle 121�6 121.5�5

Amlodipine (1 mg/kg per day) 118.9�8 116.6�6

Amlodipine (3 mg/kg per day) 87.8�4 83.4�3

Saline-Vehicle 118�4 119.7�3

Verapamil (1 mg/kg per day) 115.2�5 124.5�5

Verapamil (3 mg mg/kg per day) 91.18�4 85.6�3

Mice were either untreated or implanted with osmotic minipumps (SC)delivering amlodipine at 1 or 3 mg/kg per day, or its vehicle DMSO (0.1%), orverapamil at 1 or 3 mg/kg per day, or its vehicle (saline, 0.9% NaCl). After 2days, TG was administered via IP injection. Systolic arterial blood pressure wasmeasured with a tail cuff device immediately prior to TG and at day 3 after TGadministration. Pulse readings were collected from each mouse and analyzedusing the MP100WS software. Pulse values were averaged for each mouse.Values are means�SD of 5 mice per group.

Figure 7. Effects of amlodipine and ve-rapamil on Plg-R expression on macro-phages arrested in the PMA. Confocalmicroscopic images of sections of PMharvested from mice 72 hours afterTG-induced inflammation. Plg�/� mice orwild-type mice treated with amlodipineand verapamil or the drug vehicles. ThePM was stained with either rabbit anti-bodies to the individual Plg-R or nonim-mune (NM) IgG. Nuclei are stained bluewith DAPI. Images are representative ofmultiple areas of multiple slides at 63magnification. B, Quantification of fluores-cence intensities of the individual Plg-Rson the cell surface and ECM of micetreated with verapamil compared to thePlg�/� mice. H2B, annexin 2, and p11 inthe PM of the verapamil-treated micecompared to the same Plg-Rs in thePlg�/� mice are significantly reduced inthe drug-treated mice: *P�0.002 for H2Bin verapamil treated vs Plg�/� mice;§P�0.01 for annexin 2 in the verapamiltreated mice vs the Plg�/� mice; †P�0.02for p11 in the verapamil-treated vs thePlg�/� mice (n�3). �-Enolase expressionwas not significantly different in verapamiltreated vs Plg�/� mice.




ognized activity of these widely used drugs may contribute totheir beneficial antiinflammatory effects.

AcknowledgmentsWe gratefully acknowledge Cleveland Clinic coworkers ChristinaGaughan and Rui Chen for assistance in BP and [Ca2�]in measure-ment, respectively. We thank Dr Jane Hoover-Plow and laboratorymembers, Dr Maradumane Mohan for valuable discussion andtechnical help with in vitro experiments, and Drs Judy Drazba andJohn Peterson for help with microscopy studies.

Sources of FundingThis work was supported by NIH grant HL17964 (to E.F.P.) andAmerican Heart Association Fellowship 0825638D (to R.D.).

DisclosuresNone.

References1. Moons L, Shi C, Ploplis V, Plow E, Haber E, Collen D, Carmeliet P.

Reduced transplant arteriosclerosis in plasminogen-deficient mice. J ClinInvest. 1998;102:1788–1797.

2. Li J, Ny A, Leonardsson G, Nandakumar KS, Holmdahl R, Ny T. Theplasminogen activator/plasmin system is essential for development of thejoint inflammatory phase of collagen type II-induced arthritis. Am JPathol. 2005;166:783–792.

3. Ploplis VA, French EL, Carmeliet P, Collen D, Plow EF. Plasminogendeficiency differentially affects recruitment of inflammatory cell popu-lations in mice. Blood. 1998;91:2005–2009.

4. Swaisgood CM, Aronica MA, Swaidani S, Plow EF. Plasminogen is animportant regulator in the pathogenesis of a murine model of asthma.Am J Respir Crit Care Med. 2007;176:333–342.

5. Plow EF, Herren T, Redlitz A, Miles LA, Hoover-Plow JL. The cellbiology of the plasminogen system. FASEB J. 1995;9:939–945.

6. Miles LA, Hawley SB, Baik N, Andronicos NM, Castellino FJ, ParmerRJ. Plasminogen receptors: the sine qua non of cell surface plasminogenactivation. Front Biosci. 2005;10:1754–1762.

7. Miles LA, Dahlberg CM, Plescia J, Felez J, Kato K, Plow EF. Role ofcell-surface lysines in plasminogen binding to cells: identification ofalpha-enolase as a candidate plasminogen receptor. Biochemistry. 1991;30:1682–1691.

8. Hajjar KA. The endothelial cell tissue plasminogen activator receptor.Specific interaction with plasminogen. J Biol Chem. 1991;266:21962–21970.

9. MacLeod TJ, Kwon M, Filipenko NR, Waisman DM. Phospholipid-associated annexin A2–S100A10 heterotetramer and its subunits: charac-terization of the interaction with tissue plasminogen activator, plasmino-gen, and plasmin. J Biol Chem. 2003;278:25577–25584.

10. Herren T, Burke TA, Das R, Plow EF. Identification of histone H2B as aregulated plasminogen receptor. Biochemistry. 2006;45:9463–9474.

11. Felez J, Miles LA, Plescia J, Plow EF. Regulation of plasminogenreceptor expression on human monocytes and monocytoid cell lines.J Cell Biol. 1990;111:1673–1683.

12. Kim S-O, Plow EF, Miles LA. Regulation of plasminogen receptorexpression on monocytoid cells by �1-integrin dependent cellular adherenceto extracellular matrix proteins. J Biol Chem. 1996;271:23761–23767.

13. Lu H, Li H, Mirshahi SS, Soria C, Soria J, Menashi S. Comparative study offibrinolytic activity on U937 line after stimulation by interferon gamma, 1,25dihydroxyvitamin D3 and their combination. Thromb Res. 1993;69:353–359.

14. Brownstein C, Deora AB, Jacovina AT, Weintraub R, Gertler M, FaisalKhan KM, Falcone DJ, Hajjar KA. Annexin II mediates plasminogen-dependent matrix invasion by human monocytes: enhanced expression bymacrophages. Blood. 2004;103:317–324.

15. Das R, Burke T, Plow EF. Histone H2B as a functionally importantplasminogen receptor on macrophages. Blood. 2007;110:3763–3772.

16. Wygrecka M, Marsh LM, Morty RE, Henneke I, Guenther A, Lohmeyer J,Markart P, Preissner KT. Enolase-1 promotes plasminogen-mediatedrecruitment of monocytes to the acutely inflamed lung. Blood. 2009;113:5588–5598.

17. Yu T, Morita I, Shimokado K, Iwai T, Yoshida M. Amlodipine modulatesTHP-1 cell adhesion to vascular endothelium via inhibition of proteinkinase C signal transduction. Hypertension. 2003;42:329–334.

18. Stokes L, Gordon J, Grafton G. Non-voltage-gated L-type Ca2� channelsin human T cells: pharmacology and molecular characterization of themajor alpha pore-forming and auxiliary beta-subunits. J Biol Chem.2004;279:19566–19573.

19. Grafton G, Stokes L, Toellner KM, Gordon J. A non-voltage-gatedcalcium channel with L-type characteristics activated by B cell receptorligation. Biochem Pharmacol. 2003;66:2001–2009.

20. Hoshida S, Yamashita N, Kuzuya T, Hori M. Reduction in infarct size bychronic amlodipine treatment in cholesterol-fed rabbits. Atherosclerosis.1998;138:163–170.

21. Pitt B, Byington RP, Furberg CD, Hunninghake DB, Mancini GB, MillerME, Riley W. Effect of amlodipine on the progression of atherosclerosisand the occurrence of clinical events. PREVENT Investigators. Circu-lation. 2000;102:1503–1510.

22. Chandra M, Shirani J, Shtutin V, Weiss LM, Factor SM, Petkova SB,Rojkind M, Dominguez-Rosales JA, Jelicks LA, Morris SA, Wittner M,Tanowitz HB. Cardioprotective effects of verapamil on myocardial structureand function in a murine model of chronic Trypanosoma cruzi infectionBrazil Strain): an echocardiographic study. Int J Parasitol. 2002;32:207–215.

23. Gong Y, Hart E, Shchurin A, Hoover-Plow J. Inflammatory macrophagemigration requires MMP-9 activation by plasminogen in mice. J ClinInvest. 2008;118:3012–3024.

24. Hamon Y, Luciani MF, Becq F, Verrier B, Rubartelli A, Chimini G.Interleukin-1beta secretion is impaired by inhibitors of the Atp bindingcassette transporter, ABC1. Blood. 1997;90:2911–2915.

25. Andrei C, Dazzi C, Lotti L, Torrisi MR, Chimini G, Rubartelli A. Thesecretory route of the leaderless protein interleukin 1beta involves exocytosisof endolysosome-related vesicles. Mol Biol Cell. 1999;10:1463–1475.

26. Dahl JP, Binda A, Canfield VA, Levenson R. Participation of Na,K-ATPase in FGF-2 secretion: rescue of ouabain-inhibitable FGF-2secretion by ouabain-resistant Na,K-ATPase alpha subunits. Bio-chemistry. 2000;39:14877–14883.

27. Kockx M, Guo DL, Huby T, Lesnik P, Kay J, Sabaretnam T, Jary E, Hill M,Gaus K, Chapman J, Stow JL, Jessup W, Kritharides L. Secretion of apoli-poprotein E from macrophages occurs via a protein kinase A and calcium-dependent pathway along the microtubule network. Circ Res. 2007;101:607–616.

28. Mason RP. Mechanisms of plaque stabilization for the dihydropyridinecalcium channel blocker amlodipine: review of the evidence. Atheroscle-rosis. 2002;165:191–199.

29. Catterall WA. Structure and regulation of voltage-gated Ca2� channels.Annu Rev Cell Dev Biol. 2000;16:521–555.

30. Sousa LP, Silva BM, Brasil BS, Nogueira SV, Ferreira PC, Kroon EG,Kato K, Bonjardim CA. Plasminogen/plasmin regulates alpha-enolaseexpression through the MEK/ERK pathway. Biochem Biophys ResCommun. 2005;337:1065–1071.

31. Gollasch M, Haase H, Ried C, Lindschau C, Morano I, Luft FC, Haller H.L-type calcium channel expression depends on the differentiated state ofvascular smooth muscle cells. FASEB J. 1998;12:593–601.

32. Melnicoff MJ, Horan PK, Morahan PS. Kinetics of changes in peritoneal cellpopulations following acute inflammation. Cell Immunol. 1989;118:178.

33. Kataoka C, Egashira K, Ishibashi M, Inoue S, Ni W, Hiasa K, KitamotoS, Usui M, Takeshita A. Novel anti-inflammatory actions of amlodipinein a rat model of arteriosclerosis induced by long-term inhibition of nitricoxide synthesis. Am J Physiol Heart Circ Physiol. 2004;286:H768–H774.

34. Swaisgood CM, Schmitt D, Eaton D, Plow EF. In vivo regulation ofplasminogen function by plasma carboxypeptidase B. J Clin Invest. 2002;110:1275–1282.

35. Kozian D, Proulle V, Nitsche A, Galitzine M, Martinez MC, SchumannB, Meyer D, Herrmann M, Freyssinet JM, Kerbiriou-Nabias D. Identifi-cation of genes involved in Ca2� ionophore A23187-mediated apoptosisand demonstration of a high susceptibility for transcriptional repression ofcell cycle genes in B lymphoblasts from a patient with Scott syndrome.BMC Genomics. 2005;6:146.

36. Brown DM, Donaldson K, Borm PJ, Schins RP, Dehnhardt M, GilmourP, Jimenez LA, Stone V. Calcium and ROS-mediated activation of tran-scription factors and TNF-alpha cytokine gene expression in macro-phages exposed to ultrafine particles. Am J Physiol Lung Cell MolPhysiol. 2004;286:L344–L353.

37. Watson K, Gooderham NJ, Davies DS, Edwards RJ. Nucleosomes bind tocell surface proteoglycans. J Biol Chem. 1999;274:21707–21713.

38. Henriquez JP, Casar JC, Fuentealba L, Carey DJ, Brandan E. Extra-cellular matrix histone H1 binds to perlecan, is present in regeneratingskeletal muscle and stimulates myoblast proliferation. J Cell Sci. 2002;115:2041–2051.




Riku Das, Tim Burke, David R. Van Wagoner and Edward F. PlowExpression of Plasminogen Receptors on Macrophages

L-Type Calcium Channel Blockers Exert an Antiinflammatory Effect by Suppressing

Print ISSN: 0009-7330. Online ISSN: 1524-4571 Copyright © 2009 American Heart Association, Inc. All rights reserved.is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231Circulation Research

doi: 10.1161/CIRCRESAHA.109.2003112009;105:167-175; originally published online June 11, 2009;Circ Res.

http://circres.ahajournals.org/content/105/2/167World Wide Web at:

The online version of this article, along with updated information and services, is located on the

http://circres.ahajournals.org/content/suppl/2009/06/15/CIRCRESAHA.109.200311.DC1.htmlData Supplement (unedited) at:

http://circres.ahajournals.org//subscriptions/

is online at: Circulation Research Information about subscribing to Subscriptions:

http://www.lww.com/reprints Information about reprints can be found online at: Reprints:

document. Permissions and Rights Question and Answer about this process is available in the

located, click Request Permissions in the middle column of the Web page under Services. Further informationEditorial Office. Once the online version of the published article for which permission is being requested is

can be obtained via RightsLink, a service of the Copyright Clearance Center, not theCirculation Researchin Requests for permissions to reproduce figures, tables, or portions of articles originally publishedPermissions:


http://circres.ahajournals.org/content/105/2/167

http://circres.ahajournals.org/content/suppl/2009/06/15/CIRCRESAHA.109.200311.DC1.html

http://www.ahajournals.org/site/rights/

http://www.lww.com/reprints

http://circres.ahajournals.org//subscriptions/


1

SUPPLEMENT MATERIAL

Materials and Methods

Monocyte culture and differentiation– Human monocytoid THP-1 cells (ATCC,

Manassas, VA) were cultured as described previously1, and stimulated to differentiate

with 250 U/ml IFNγ (eBioscience) + 100 nmol/L VD3 (Calbiochem) for 0-2 days in

complete growth medium. Human aortic smooth muscle cells were grown in DMEM/F-

12 with 10% FBS. Human monocytes were isolated from peripheral blood of healthy

donors using Ficol Hypaque (Amersham) followed by adherence to fibronectin coated

plates (BD Bioscience). The adherent monocytes were cultured for 24 h in RPMI-1640

with 10% human AB serum (Cambrex) to obtain human peripheral blood derived

macrophages.

FACS- Cells were fixed in 2% paraformaldehyde, permeabilized with 0.1% saponin in

PBS containing 5% FBS, and incubated with rabbit polyclonal anti-α11.2 (Alomone) or

with anti-α11.2 that had been neutralized with the antigen peptide. Cells were stained

with goat anti-rabbit IgG labeled with alexa-488 (Invitrogen). The extent of IFNγ + VD3

mediated differentiation was measured by staining THP-1 cells with mouse monoclonal

PE-conjugated anti-human CD14 (eBioscience). Cell fluorescence was measured using

instruments from BD Bioscience (Bedford, MA) and the CellQuest software.

Plg binding- Plg binding was performed on viable THP-1 cells using Alexa-488 labeled

Glu-Plg as described previously2. For inhibition studies, THP-1 cells were pretreated with

2

the inhibitors for 45-60 min and then differentiated with IFNγ+VD3 for 24 h at which

time Plg binding was measured.

Cell surface biotinylation and Western blotting- THP-1 cells were surface labeled with

sulfo-NHS-biotin (Pierce), and biotinylated proteins, isolated on streptavidin beads or

whole cell lysates, were subjected to Western blot using rabbit anti-peptide antibodies

against annexin 2, α-enolase, H2B and p11 as previously described2. CD14 expression

was detected in Western blots with rabbit anti-human CD14 (Santa Cruz). The intensities

of Western blot bands were measured by using Kodak ID 3.6 software, assigning the

intensity of each band of interest in the unstimulated cells a value of 1.0; fold change of a

particular protein was calculated relative to the corresponding control band.

Real Time RT-PCR-Quantitative PCR was performed as described previously3 using 1

μg of total RNA from IFNγ + VD3 treated and untreated THP-1 cells. The primers pairs

used were as follows:

Gene Forward primer (5’-3’) Reverse primer (3’-5’)

α-enolase CTGGTGCCGTTGAGAAGGG GGTTGTGGTAAACCTCTGCTC

H2B ATGCCTGAACCGGCAAAATC TGGATCTCGCGGGATGTGAT

annexin 2 TCTACTGTTCACGAAATCCTGTG TGGCTGTTTCAATGTTCAAAGC

p11 GGGCTTCCAGAGCTTCTTTT CTTCTATGGGGGAAGCTGTG

GAPDH was amplified as a control in each sample and used to normalize values.

RNA interference- LTCC was knocked down with siRNA designed to target the Cav1.2

subunit (SiCav1.2, Dharmacon). A negative control siRNA (SiControl) was also used.

3

These siRNAs were introduced into THP-1 by nucleofection according to manufacture’s

protocol (Amaxa). At 16 h after nucleofection, the cells were either left untreated or treated

with IFNγ+VD3 for additional 24 h or then subjected to Western blotting using anti-

dihydropyridine receptor alpha-1 (Affinity Bioreagents) and anti-actin antibodies (Sigma).

RNA isolation and RT-PCR Total RNA was isolated from cells using RNeasy Mini Kits

(Qiagen). RT-PCR was performed using the OneStep RT-PCR kit (Qiagen). The primers

used to amplify Cav11.2 transcripts from these cells were previously described4. The RT-

PCR products were analyzed on 2% agarose gels.

Intracellular Ca2+ measurements- THP-1 cells (5 X 106) were loaded with 0.5 μM Fura-

2 AM (Invitrogen) in culture medium containing 2.5 mmol/L probenecid (Invitrogen) for

45 min at 37°C. Cells were washed twice with HBSS containing 0.1% BSA, 10 mmol/L

HEPES, 1.3 mmol/L CaCl2 and 2 mmol/L MgS04. Following a 5 min pre-incubation at

37°C, changes in [Ca2+]in induced by 1 μmol/L fMLP (Sigma) were recorded using a

fluorimeter (Photon Technology International) with dual excitation at 340 and 380 nm.

Emission was recorded at 510 nm over 4 min.

Cyclic AMP (3H) generation assay- THP-1 cells were pretreated with SQ22536

(Calbiochem) for 1 h and then treated with IFNγ+VD3 for 24 h. Cells were lysed by

homogenization in buffer containing 4mmol/L EDTA and 50 mmol/L Tris-Cl, pH 7.4.

Proteins were separated by heating the samples in boiling water followed by centrifugation.

cAMP in the supernatant was assayed according to the manufacturer’s instructions

(Amersham). The doses of SQ22536 (10 to 250 μmol/L) was selected based on previously

effective doses5 .

4

In vitro matrigel invasion– In vitro matrigel assay was performed according to previously

described method2.

In vivo experiments-All animal procedures were performed under a Cleveland Clinic

approved protocol. Plg+/+ mice (n=8, 8-10 wk) of C57Bl/6 background with mix gender

were treated with amlodipine or verapamil at 1 mg.kg-1.day-1 or 3 mg.kg-1.day-1 or vehicle

control for each drug (saline or DMSO, less than 0.1%, respectively) via an osmotic mini-

pump (Alzet, Durect, CA). For surgery, mice were anesthetized with xylazine (16 mg/kg,

i.p.) and ketamine (80 mg/kg, i.p.). Two days after subcutaneous pump implantation,

inflammation was induced by i.p. injection of TG. Mice were killed 72 h later, and the

peritoneal cells were collected by lavage and counted as described6. The peritoneal

membrane (PM) that lines the pancreas was carefully separated, washed with PBS and

fixed in 4 % paraformaldehyde for further study.

Non-invasive blood pressure measurements- Systolic arterial pressure in mice was

measured with a RTBP1001 blood pressure (BP) device for rodents (Harvard Apparatus).

BP was measured on each of the 3 consecutive days following TG induced inflammation.

Ten consecutive pulse readings were collected from each mouse.

Histochemistry- Paraformaldehyde fixed PM were dehydrated and embedded in paraffin.

Sections, 8-μm, were stained with hematoxylin and eosin. For immunonohistochemistry,

citrate retrieved paraffin sections were reacted with anti-Mac3 (BD Bioscience) and stained

with biotinylated anti-rat antibody (mouse adsorbed, Vector). Sections were developed

with Vectastain ABC reagent (Vector) using DAB as a substrate (Vector) and

counterstained with hematoxylin. Images were captured on an inverted microscope at 10X

magnification. Images were analyzed using Image ProPlus software.

5

Confocal Microscopy- Fixed PM were embedded in Tissue-Tek OCT Compound, and 8-

μm sections were stained with antibodies to H2B, α-enolase, annexin 2, p11 or non-

immune rabbit IgG, in presence of mouse Fc blocker (Seroblocker, Serotec). Sections were

washed, incubated with Alexa-488 labeled anti-rabbit IgG (Invitrogen) and mounted in

Vectashield mounting media containing DAPI (Vector). Images were captured on a Leica

TCS-SP2 laser scanning confocal microscope (Leica Micro-systems GmbH, Heidelberg,

Germany) at 63X magnification. Images were analyzed and green fluorescence was

measured using Image proPlus software and presented as IOD values of green fluorescence

per number of nuclei in an area of the membrane.

Statistical analysis- Values are expressed as mean ± SD, p values are based on the paired

student t test. Results were considered statistically significant with p<0.05.

6

Reference List (1) Kim S-O, Plow EF, Miles LA. Regulation of plasminogen receptor expression on

monocytoid cells by β1-integrin dependent cellular adherence to extracellular matrix proteins. J Biol Chem. 1996;271:23761-7.

(2) Das R, Burke T, Plow EF. Histone H2B as a functionally important plasminogen receptor on macrophages. Blood. 2007 ;110:3763-72.

(3) Hamik A, Lin Z, Kumar A, Balcells M, Sinha S, Katz J, Feinberg MW, Gerzsten RE, Edelman ER, Jain MK. Kruppel-like factor 4 regulates endothelial inflammation. J Biol Chem. 2007;282:13769-79.

(4) Stokes L, Gordon J, Grafton G. Non-voltage-gated L-type Ca2+ channels in human T cells: pharmacology and molecular characterization of the major alpha pore-forming and auxiliary beta-subunits. J Biol Chem. 2004;279:19566-73.

(5) Haraguchi S, Good RA, James-Yarish M, Cianciolo GJ, Day NK. Induction of intracellular cAMP by a synthetic retroviral envelope peptide: a possible mechanism of immunopathogenesis in retroviral infections. Proc Natl Acad Sci U S A. 1995;92:5568-71.

(6) Busuttil SJ, Ploplis VA, Castellino FJ, Tang L, Eaton JW, Plow EF. A central role for plasminogen in the inflammatory response to biomaterials. J Thromb Haemost. 2004;2:1798-805.

7

Figure legends

Online Figure I. Transcript levels of Plg-Rs upon differentiation. Total RNA isolated

from THP-1 cells treated with IFNγ+VD3 for 0 to 48 h and then subjected to quantitative

PCR analysis. Data are expressed as fold induction relative to the GAPDH control (n=3).

Online Figure II. Role of cAMP and ERK pathways in differentiation induced Plg

binding. (A&B) THP-1 cells were pretreated with either SQ22536 or PD98059 (Sigma) for

1 h and then treated with IFNγ+VD3 for 24 h. ERK1/2 phosphorylation was detected by

Western blot using anti-phospho ERK1/2 antibody and anti-ERK1/2 antibody. cAMP

generation was quantified by using the Cyclic AMP (3H) assay system (Amerasham

Bioscience) according to manufacturer’s instructions. Data show a reduction of ERK1/2

phosphorylation (A) and differentiation induced cAMP generation (B) in THP-1 cells,

verifying that the inhibitors were active in the cells. cAMP data are the means ± SD from

triplicate readings. Data are representative of 3 separate experiments. *p ≤ 0.05 vs.

IFNγ+VD3 alone treated cells (C) Pretreatment of THP-1 cells with SQ22536 or PD98059

has no effect on differentiation induced Plg binding. The values are the mean fluorescence

intensities of FACS from three independent experiments.

Online Figure III. Monocyte to macrophage differentiation enhances L-type Ca2+

channel expression and intracellular Ca2+ level. (A) THP-1 cells were stimulated with

IFNγ + VD3 and Western blot of whole cell lysates was performed using anti-Cav1.2. For

loading controls, blots were reprobed with anti-actin antibody. Intensities of the Western

8

blot bands are plotted as the fold increase of Cav1.2 expression compared to that in non-

stimulated THP-1 cells. Data are the means ± SD from triplicate blots. *p ≤ 0.05 vs.

corresponding protein levels of untreated cells. (B) fLMP stimulation (1 μmol/L, indicated

by arrow) of Fura-2 loaded cells shows an increased [Ca2+]in response in differentiated

THP-1 cells (gray day 0, green; day 1, blue; day 2). Data is representative of four

experiment.

Online Figure IV. Cav1.2 siRNA decreases Cav1.2 expression in differentiated THP-1

cells.

THP-1 cells were transfected with Cav1.2 siRNA (SiCav1.2) or negative siRNA control

(SiControl) by nucleofection and then treated with IFNγ + VD3 for 24 h. (A) Western blots

of whole cell lysates with anti-Cav1.2 show inhibition of Cav1.2 protein expression by

SiCav1.2 compared to the mock nucleofected or SiControl nucleofected cells. Actin serves

as a loading control (lower panel, A) in each cell extract. Bars shows band density of

Cav1.2 relative to unstimulated controls. Data are the means ± SD from triplicate blots *p ≤

0.05 compared to Cav1.2 levels in IFNγ + VD3 treated or SiControl nucleofected followed

by IFNγ + VD3 treated cells.

Online Figure V. Role of LTCC in Plg-mediated matrigel cell invasion. (A) THP-1

cells were loaded into the upper portion of Matrigel coated chambers, in the presence or

absence of Plg (200 nmol/L), IFNγ + VD3, aprotinin (50 U/ml) and TXA (200 μmole/L),

and were allowed to migrate toward MCP-1 (50 ng/ml) in the lower chamber for 24 h. The

invaded cells were quantified by using a Cyquant fluorescent dye (Invitrogen). (B) In

separate experiments, non-nucleofected THP-1 or nucleofected with control siRNA

(Sicontrol) or Cav1.2 SiRNA (SiCav1.2) were treated with anti-H2B Fab, non-immune

9

(NM) rabbit Fab. Cells were then treated for 24 h with IFNγ + VD3. The data are expressed

as the means + S.D. of two independent experiments, and statistical significance

determined by a Student’s t test. Cells migrating to MCP-1 were quantified as in Panel A

The data are expressed as the means + S.D. of two independent experiments and statistical

significance was determined by a Student’s t test. *p ≤ 0.05 compared to IFNγ+VD3

treated or SiControl nucleofected followed by IFNγ + VD3.

1

1.5

0

0.5

1

1

1.5

α-enolase

GA

PDH

)

0

0.5

1

H2B

4 *

over

con

trol

(G

0

2

annexin 2

1.5

*

ld in

duct

ion

o

0

0.5

1

p11

Day 0 1 2

Fo

Online Figure I

10

A

/

B

rote

in

p-ERK1/2

ERK1/2

IFNγ + VD3 - + + + +0

1

2

3

mol

cA

MP/

mg

pr

* * *

PD98059(μM) - - 10 20 50

%)

0pm

IFNγ + VD3 - + + + +SQ22536 (μM) - - 10 100 250

100

150C

ogen

bin

ding

(%

- + + + + +

- - 20 50 - -

0

50

IFNγ + VD3

PD98059 (μM)

Plas

min

o

- - - - 100 250PD98059 (μM)

SQ22536 (μM)

Online Figure II

11

Day 0 1 2 4

er c

ontr

ol

*

A

Cav1.2

Actin 0

2

Day 0 1 2Fold

cha

nge

ove

*

1.4

1.6

1.8B

atio

1

1.2

1.4

1 50 99 148 197

340/

380

ra

s

Online Figure III

12

Cav1.23

over

con

trol

IFNγ + VD3Si Control

Cav1.2

- + + +- - + -- - - +

Cav1.2

Actin

0

1

2

IFNγ + VD3Si Control

Fold

cha

nge

- + + +- - + -

*

Cav1.2 - - - +

Online Figure IV

13

nit)

A

4000

6000

8000

atrig

el-in

vasi

onve

Flu

ores

cenc

e U

n

* *0

2000M(R

elat

iv

Cells Plg

IFNγ+VD3 TXA

+ + + + +- + + + +- - + + +

*

TXA Aprotinin

- - - + +- - - - +

B

2500

3000

n e U

nit)

500

1000

1500

2000

2500

Mat

rigel

-inva

sion

elat

ive

Fluo

resc

ence

**

* *

0(Re

PlgIFNγ+VD3Si ControlSi Cav1.2

Anti-H2B Fab

+ + + + + + + +- + + + + + + +- - + - - - - -- - - + - - + +- - - - + - + -

NM IgG Fab - - - - - + - +

14

Online Figure V

Documents

L-Type Calcium Channel Blockers Exert an Antiinflammatory Effect by Suppressing Expression of Plasminogen Receptors on Macrophages