Acta Biomaterialia 6 (2010) 436–444

Contents lists available at ScienceDirect

Acta Biomaterialia

journal homepage: www.elsevier .com/locate /ac tabiomat

Microencapsulation and chondrogenic differentiation of human mesenchymalprogenitor cells from subchondral bone marrow in Ca-alginate for cell injection

M. Endres a,b,*, N. Wenda c, H. Woehlecke c, K. Neumann a, J. Ringe b,d, C. Erggelet e, D. Lerche c, C. Kaps a,b

a TransTissue Technologies GmbH, Berlin, Germanyb Charité University Medicine Berlin, Department of Rheumatology, Tissue Engineering Laboratory, Berlin, Germanyc Dr. Lerche KG, Rudower Chaussee 29, Berlin, Germanyd Berlin-Brandenburg Center for Regenerative Therapies, Charite University Medicine Berlin, Berlin, Germanye Universitätsklinikum Freiburg, Department of Orthopaedics und Traumatology, Freiburg, Germany

a r t i c l e i n f o a b s t r a c t

Article history:Received 2 February 2009Received in revised form 29 June 2009Accepted 7 July 2009Available online 19 July 2009

Keywords:Ca-alginate microcapsulesMSCChondrogenisisEncapsulation

1742-7061/$ - see front matter � 2009 Acta Materialdoi:10.1016/j.actbio.2009.07.022

* Corresponding author. Address: TransTissue TechnGermany. Tel.: +49 30 450 513 239; fax: +49 30 450

E-mail address: michaela.endres@transtissue.com

The application of stem cells is a promising therapeutic approach for cartilage regeneration. For cell ther-apies, a biocompatible injectable carrier, which improves retention and cell distribution and enables celldifferentiation, is a prerequisite. In this study, Ca-alginate microcapsules containing human subchondralcortico-spongious progenitor cells were prepared and the chondrogenic differentiation potential was ver-ified by real-time reverse transcription-polymerase chain reaction analysis of typical chondrogenic mar-ker genes. The results confirmed that these cells were able to differentiate along the chondrogenic lineagewhen encapsulated in Ca-alginate microcapsules with a mean diameter of 600–700 lm and stimulatedwith TGF-beta3. Chondrogenic marker genes type II collagen, aggrecan and cartilage oligomeric matrixprotein were induced together with type I collagen, whereas adipogenic and osteogenic marker genesshowed no induction over 14 days. After 28 days, proteoglycans and type II collagen were evident histo-chemically and immunohistochemically. Mechanical stability as well as permeability of Ca-alginate cap-sules were analysed over the course of cultivation and found to be qualified for stable cell immobilizationand sufficient exchange of solutes. Therefore, from the cell biology point of view, Ca-alginate, an estab-lished hydrogel scaffold material is suited for regenerative therapies of cartilage defects based on theinjection of progenitor cells.

� 2009 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

1. Introduction

In regenerative medicine, amongst other challenges, themethod of application of cells into the human body in variousrepair approaches has not been sufficiently established. Clinically,the injection of pure stem- and progenitor cell suspensions intothe defective site may be problematic because the cells do not ad-here directly within the defect but are flushed into the surroundingmilieu. Therefore, a biocompatible injectable carrier, whichimproves retention and cell distribution and enables cell differen-tiation, might be the answer. The combination of cells (especiallymesenchymal stem cells, MSCs) with hydrogels like fibrin [1],sodium hyaluronan/gelatine [2] alginate [3], agarose [4], poly(JV-isopropylacrylamide-co-acrylic acid) (p(NiPAAm-co-AAc)) copoly-mer [5], collagen gel, matrigel and PuraMatrix peptide hydrogel[6] can decrease the flow properties by increasing the viscosity ofthe cell suspension and providing a three-dimensional environ-

ia Inc. Published by Elsevier Ltd. A

ologies GmbH, 10117 Berlin,513 949.(M. Endres).

ment for an even cell distribution. A comparative study on cellapplication methods showed that the use of hydrogels (e.g. fibrin)for cell injection into the intervertebral disc increase the cell trans-fer efficiency compared to the use of cell/medium suspensions.Using the example of augmenting lumbar intervertebral discs,leakage through the injection site in vitro and in situ resulted inthe loss of more than 90% of the injected cells in a cell/medium sus-pension within the first 30 min [7].

Alginates are well known as excipients in drug products, e.g.release systems, and as a temporary matrix for cells in the field of tis-sue engineering. Their characteristics depend on the alginate concen-tration used, the concentration of the gelling solution (divalentcations, e.g. calcium ion) and the resulting crosslinking, which isresponsible for the type and size of the pores [8]. An increased concen-tration and crosslinking in the alginate matrix results in a decrease inpermeability, which is relevant for the diffusional exchange of solutesand nutrient supply for immobilized cells. Concentration and cross-linking of alginate also determine the mechanical strength of thecapsules and hence the stability of the cell encapsulation.

It is still a challenge to fabricate alginate-based microcapsuleswhere nutrients, oxygen and factors can be exchanged between

ll rights reserved.

M. Endres et al. / Acta Biomaterialia 6 (2010) 436–444 437

the encapsulated cells and the surrounding environment withoutaffecting the stability, mechanical strength, elasticity, swellingcharacteristics or size of the alginate beads [9].

The application of injectable autologous cell suspensions rangesfrom osteochondral defects in articular joints [2] and meniscusregeneration [10] to nasal augmentation [11]. Although mesenchy-mal cells from bone marrow are negative for immunologically rel-evant surface markers and inhibit proliferation of allogenic T cellsin vitro [12], there are some concerns that MSCs from bone marrowmay lose their immunosuppressive potential after expansionin vitro and after subsequent local implantation into allogenicrecipients [13]. Therefore, graft vs. host reaction may be preventedby the use of encapsulated allogenic MSCs or by administration ofautologous progenitors.

Progenitor cells suited for tissue repair, especially cartilage re-pair, reside in the subchondral bone marrow and are released bythe microfracture technique. Small articular cartilage defects up to8 cm2 in size [14] can be treated by the microfracture technique. Itis generally assumed that the microfractures create a connection be-tween the subchondral cortico-spongious bone marrow and the car-tilage defect, where mesenchymal stem and progenitor cells areflushed into the defect together with the bloodstream. Mesenchymalprogenitors found in the trabecular bone, which display stem cell-like capabilities [15], as well as human mesenchymal progenitorcells from the subchondral bone marrow (CSP) [16] are of more thefocus of interest. These CSP cells exhibit the typical cell surface anti-gen pattern known from human MSCs derived from bone marrowaspirates. Additionally, CSP cells have been shown to have an intrin-sic osteogenic differentiation capacity and show low adipocyticdevelopment when stimulated with adipogenic mediumcontaining insulin [16]. In contrast, stimulating CSP cells with TGF-beta3 strongly induced chondrogenic lineage development withinduction of typical chondrogenic marker genes and deposition ofcartilage matrix molecules like type II collagen and proteoglycan[16]. This suggests that CSP cells from the subchondral bone thatare released by microfracture have a prominent chondrogenic differ-entiation potential and therefore are also promising candidates forcell injection into articular joints.

The objective of this work was to develop a suitable and simpletechnique to encapsulate CSP cells in alginate and to verify themaintenance of capacity of the incorporated cells to differentiate.In addition, we aimed to characterize the mechanical stabilityand permeability of the microcapsules in the course of cultivationand differentiation of the immobilized cells.

2. Materials and methods

2.1. Isolation and characterization of human mesenchymal progenitorcells from subchondral bone marrow

Human CSP cells were isolated from the lateral tibial head dur-ing high tibial closed wedge osteotomy (three donors: two male,one female, aged 40–62 years) as described previously [17]. Thestudy was approved by the Ethical Committee of the ChariteUniversity Medicine, Berlin.

In brief, human cortico-spongious bone cylinders were cut intosmall pieces and treated enzymatically for 4 h in Dulbecco’s modifiedEagle’s medium (DMEM; Biochrom), 10% human serum (German RedCross), 100 U ml�1 penicillin, 100 mg ml�1 streptomycin (both Bio-chrom) and 256 U ml�1 collagenase XI (Sigma) in a spinner flask(Weaton) under gentle stirring at 37 �C. Subsequently, the bone frag-ments were placed into Primaria cell culture flasks (Becton–Dickin-son) and cultured in DMEM supplemented with 10% human serum,100 U ml�1 penicillin, 100 mg ml�1 streptomycin and 4 mM L-gluta-mine under standard cell culture conditions. After 5–7 days, the firstcells were evident. After reaching 70% confluence, cells were detached

with trypsin/ethylenediaminetetraacetic acid (EDTA) solution (Bio-chrom) and subcultured at a density of 8 � 103 cells cm�2. After cellexpansion over three passages, flowcytometric analysis (FACS) ofthe cells was performed. The CSP cells were characterized by FACS.Single-cell suspensions of 2.5 � 105 cells were washed once withphosphate-buffered saline (PBS) containing 0.5% bovine serum albu-min (BSA; Sigma) and incubated with either fluorescein isothiocya-nate (FITC)-labelled mouse anti-human CD105, FITC-labelled mouseanti-human CD45 (German Rheumatism Research Centre), FITC-la-belled mouse anti-human CD44 or CD90, R-phycoerythrin (PE)-la-belled mouse anti-human SH-3 (CD73), or PE-labelled CD166 orCD34 (Pharmingen) for 15 min on ice. Finally, cell samples werewashed in PBS containing 0.5% BSA. Prior to the analysis with the FAC-SCalibur (Becton–Dickinson), cells were stained with propidium io-dide (Sigma) to detect and exclude dead cells. Data were evaluatedusing the CellQuest software (Becton–Dickinson).

2.2. Encapsulation of cells and cultivation of cell-loaded Ca-alginate beads

Passage 3 cells were incubated with trypsin/EDTA (0.5 g l�1 tryp-sin, 0.2 g l�1 EDTA in PBS; Biochrom) for 5 min at 37 �C. Detachedcells were centrifuged at 1000g for 5 min. The resulting pellet wasresuspended in phosphate-free solution consisting of 8 g l�1 NaCl,0.2 g l�1 KCl, 0.1 g l�1 MgCl2�6 H2O and 0.1 g l�1 CaCl2. After count-ing, cells were pooled in equal amounts, centrifuged again and resus-pended in phosphate-free solution to a cell density of 2.4 �107 ml�1. The cell suspension was then mixed with an equal volumeof 2.4% (w/v) sodium alginate solution (St. Louis, MO, USA) and dis-solved in phosphate-free buffer to a final cell density of 1.2 �107 ml�1 and a final alginate concentration of 1.2% (w/v). Accordingto the manufacturer’s data, its mean molar mass is between 75,000and 100,000 g mol�1, the viscosity is 0.25 Pa s (2% in water, 25 �C)and the M/G ratio is 1.56, corresponding to 61% mannuronate (M)and 39% guluronate (G). Sodium alginate solution was sterilized byfiltration through a 0.22 lm filter (Stericup, Millipore GmbH, Sch-walbach, Germany). For the in vitro studies described here, no addi-tional purification of the Na-alginate was carried out.

Microspheres were produced using the laminar jet break-uptechnique with a vibrating nozzle, as described before [18]. The so-dium alginate cell suspension was pressed through a 300 lm nozzlewhile loading with a frequency of 675 Hz to form equal-sized drop-lets under sterile conditions. The droplets fell into a stirred precipi-tation bath (0.1 mol l�1 CaCl2) for solidification and forming ofspherical Ca-alginate beads. The precipitation was stopped after10 min. Cell-loaded Ca-alginate beads (approximately 2000 cellsper bead) were rinsed twice with washing solution (0.01 mol l�1

CaCl2, 0.15 mol l�1 NaCl) and transferred in equal amounts into dif-ferentiation medium or control medium. The microencapsulatedcells were cultured in suspension cultures and either stimulatedfor up to 4 weeks with DMEM supplemented with insulin–transfer-rin–selenium (ITS + 1, Sigma), 0.1 lM dexamethasone, 1 mM so-dium pyruvate, 0.17 mM ascorbic acid-2-phosphate, 0.35 mMproline (all purchased from Sigma) and 10 ng ml�1 TGF-beta3(R&D Systems, Wiesbaden, Germany) for chondrogenic differentia-tion or in DMEM supplemented with ITS + 1, dexamethasone, so-dium pyruvate, ascorbic acid and proline as control. The mediumwas replaced every other day. The cultures were stirred once a day.Ca-alginate spheres consisting of the same Ca-alginate but withoutcells were made in parallel and cultivated in control medium underidentical culture conditions.

2.3. Determination of size and mechanical strength of the microspheres

The diameters of the cell-loaded and cell-free Ca-alginatespheres were measured microscopically using a calibrated micro-metre eyepiece.

438 M. Endres et al. / Acta Biomaterialia 6 (2010) 436–444

Mechanical strength of Ca-alginate microspheres was analysedby uniaxial compression tests on single microspheres by meansof a LUMiTextureTM analyser consisting of a force sensor, a plungerwith a linear drive and programmable controls, data aquisition andanalysis. In total, 20–30 microspheres were picked up from the cul-ture vessel and kept in a Petri dish prior to the measurements. Indi-vidual microspheres were applied between the force sensor(precision balance, KERN 824, KERN & Sohn GmbH, Balingen-Frommern, Germany) and the cylindrical plunger fixed at the endof a linear actuator. The plunger moved downward with a constantvelocity and compressed the microsphere beyond the burst point.By means of the analysing system’s special software, the balanceforce was recorded continuously through the displacement of theplunger. Analysis of the changes in the acting forces allows precisedetection of the microsphere burst point. Hence the compressionyield strength of single microspheres was determined. This valueis expressed as the force (F) necessary to cause irreversible struc-tural changes in the microsphere. Statistical analyses were per-formed using the t-test or the Mann–Whitney rank sum test. A pvalue lower than 0.01 was considered significant.

2.4. Measurement of permeability of Ca-alginate microspheres

For complex characterization of molecular size-dependent per-meability of Ca-alginate microspheres, we adopted a method earlierdescribed for investigating the size limits of permeation of plant cellwalls [19] and polyelectrolyte microcapsules [20]. This fast and con-venient method is based on synchronous measurement of the per-meability of narrow size fractions of a polydisperse polymersolution by means of high-resolution size exclusion chromatogra-phy. A dextran probing solution (DPS) with a broad continuousmolecular size range of Stoke’s radius between 1 and 10 nm was pro-vided by Dr. Lerche KG. The DPS was applied to the microsphereswith and without cells, and the changes in the size dispersion aftera defined permeation period were analysed. The DPS modified bypermeation and the original DPS were chromatographed on a cali-brated Superdex HR 200 column (Pharmacia, Sweden) and the sizedispersion function of both samples were compared to calculatethe size limits of permeation. For a given Stokes’ radius, the quotientq = C/C� provides the ratio between the concentration of the corre-sponding dextran fractions of the original DPS (C) and the modifiedDPS (C*). After normalization of this quotient to completely excludedand completely permeable size fractions, a size-dependent distribu-tion coefficient (D) of permeable size fractions is obtained whereinvalues between 0 (excluded size fraction) and 1 (completely perme-able size fraction) describe the permeation behaviour. For measure-ments, a sample of microspheres (about 200 mg fresh weight,representing approximately 1200 capsules) was washed and equili-brated in 100 ml of Ringer solution (8.60 g l�1 NaCl, 0.30 g l�1 KCland 0.33 g l�1 CaCl2�2H2O, supplemented with 0.5 g l�1 NaN3 forantimicrobial protection) for at least 24 h at 6 �C, filtered on a sieveto remove free liquid between the microspheres and then incubatedin DPS (200 ll) for 24 h at 6 �C. After the diffusion period had fin-ished, the modified DPS was removed from the microspheres andanalysed by size exclusion chromatography.

2.5. Semi-quantitative real-time reverse transcription-polymerasechain reaction (RT-PCR)

Directly after Ca-alginate bead production and after 7 and14 days in culture, microcapsules from chondrogenic cultures orcontrols were poured through a cell strainer and washed twicewith PBS. After the washing step the Ca-alginate microcapsuleswere dissolved with a lysis buffer containing 55 mM sodium cit-rate, 150 mM sodium chloride and 30 mM EDTA (all Sigma–Al-drich; Germany) on ice, then centrifuged at 350g at 4 �C. The

resulting cell pellets were washed twice with PBS. Total RNA fromthe cells was isolated as described previously [21]. Subsequently,total RNA (3 lg) was transcribed into single-strand cDNA usingthe iScript Kit according to the manufacturer’s recommendations(Bio-Rad, Germany). The relative expression of the housekeepinggene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) wasused to normalize the cDNA samples. One microlitre of each nor-malized cDNA sample was analysed using the SYBR Green PCR CoreKit (Applied Biosystems) and a real-time PCR Cycler (iCycler; Bio-Rad) in triplicate. The expression of typical chondrogenic, osteo-genic and adipogenic marker genes (Table 1) was analysed and gi-ven as a percentage of the relative expression of the housekeepinggene GAPDH. The efficiency of the single PCRs was determined andincorporated into the calculation.

Statistical analysis was performed using Student’s t-test. A p va-lue less than 0.01 was considered as significant.

2.6. Histology and immunohistochemical staining

After 28 days in culture Ca-alginate microcapsules were embed-ded in TissueTek (Sakura, Japan) and cryopreserved at �20 �C.Cryosections with a thickness of 10 lm were made. To demon-strate the formation of proteoglycans, alcian blue staining (pH2.5) was carried out. Additionally, the presence of types I and II col-lagen was verified immunohistochemically. For this purpose, thesections were incubated for 1 h with the primary polyclonal anti-body rabbit anti-human type II collagen (Biochemicals) and rabbitanti-human type I collagen (Acris), with rabbit IgG (Dako) as thecontrol. Subsequently, the incubation with a biotinylized antibodyagainst IgG following incubation with peroxidase-conjugatedstreptavidin (Dako) and AEC substrate was performed. Counter-staining was performed with hematoxylin.

3. Results

3.1. Cell characterization and encapsulation

The outgrowth of CSP cells started within 7 days. The cells werenegative for the early haematopoetic stem cell marker CD34 andthe leucocyte antigen CD45. In contrast, the cells presented ecto-50-nucleotidase CD73 (SH-3), thy-1 cell surface antigen CD90,endoglin receptor CD105 (SH-2) and the activated leucocyte celladhesion molecule CD166 (ALCAM) (Fig. 1).

CSP cells from passage 3 were used for encapsulation in Ca-algi-nate beads. A cell density of 1.2 � 107 ml�1 was found to be mosteffective. Higher cell numbers resulted in unshaped and unstabledrop-like capsules and hence were not suitable for our purpose(data not shown).

Finally, produced Ca-alginate cell spheres were equally round,with a transparent alginate matrix (Fig. 2). Microspheres withoutcells had a mean diameter of 643 lm (n = 80, SD = 26 lm). Themean diameter of cell-loaded microspheres was 676 lm (n = 110,SD = 59 lm). During a chondrogenic cultivation period of 28 daysthe capsule size remained constant with homogenous and intactcapsule morphology (Fig. 2A). Cells inside the Ca-alginate capsuleswere uniformly distributed and arranged either as small cell clus-ters or as single cells (Fig. 2B).

3.2. Size and mechanical strength of Ca-alginate microspheres

The diameter of cell-loaded and cell-free Ca-alginate sphereswas measured microscopically using a calibrated micrometre eye-piece. The mechanical strength of Ca-alginate microspheres can beeffectively and reproducibly determined by uniaxial compressiontests. To determine whether the differentiation of cells in Ca-algi-

Table 1Oligonucleotid sequences of chondrogenic, osteogenic and adipogenic marker genes.

Gene name Accession No. Oligonucleotide (50–30) Base pairs

Aggrecan NM_013227.1 CCA GTG CAC AGA GGG GTT TG 146TCC GAG GGT GCC GTG AG

Cartilage oligomeric matrix protein NM_000095 CCGGAGGGTGACGCGCAGATTGA 133TGCCCTCGAAGTCCACGCCATTGAA

Type I alpha1 collagen NM_000088.2 CGA TGG CTG CAC GAG TCA CAC 180CAG GTT GGG ATG GAG GGA GTT TAC

Type II alpha1 collagen NM_001844 CCG GGC AGA GGG CAA TAG CAG GTT 128CAA TGA TGG GGA GGC GTG AG

Osteopontin NM_000582 GATGGCCGAGGTGATAGTGTGGT 161CCTGGGCAACGGGGATGG

Osteocalcin X51699 GAGCCCCAGTTCCCCTACCC 103GCCTCCTGAAAGCCGATGTG

Peroxisome proliferator-activated receptor-gamma NM_138711.2 GCCTTGCAGTGGGGATGTCTG 194CCTCGCCTTTGCTTTGGTCAG

Fatty acid binding protein 4 NM_001442.1 CCTTAGATGGGGGTGTCCTGGTA 156AATGTCCCTTGGCTTATGCTCTC

Glyceraldehyde-3-phosphate dehydrogenase NM_002046.3 GGC GAT GCT GGC GCT GAG TAC 149TGG TTC ACA CCC ATG ACG A

Fig. 1. Cell surface antigen pattern of subchondral spongious bone marrow-derived cells. Cells were positive for CD73, CD90, CD105 and CD166 and negative for CD34 andCD45.

M. Endres et al. / Acta Biomaterialia 6 (2010) 436–444 439

nate microspheres caused destabilization of the capsules, a mea-surement of compression yield strength was carried out. Thestrength of the Ca-alginate spheres and Ca-alginate cell sphereswas determined using a LUMiTextureTM microcapsule analyser.

Ca-alginate spheres without cells were almost threefold hard-er than the cell-loaded microspheres. They could withstand acompression force of approximately 8 mN (Fig. 3A), whereasthe cell-loaded microspheres could resist a lower compressionyield strength, ranging from 0.7 to 2.7 mN (Fig. 3B). Over the

whole cultivation period of 28 days there were less and non-sig-nificant differences between the strength values of cell-freemicrospheres. The strength of cell-loaded Ca-alginate micro-spheres decreased significantly for those treated with TGF-beta3over the whole cultivation period (p < 0.01). The mechanicalstrength of the TGF-beta3-free microspheres was also reducedsignificantly from day 0 to day 14, and at a lower level thanfor TGF-beta3-treated microspheres (p < 0.01). Differences incompression yield strength were significant between TGF-

Fig. 2. Cell-loaded microspheres treated with TGF-beta3 after 28 days of cultivation. Spheres are equally round (A), with single cells or small cell clusters inside (B).

Fig. 3. Mechanical stability in terms of compression yield strength in the course ofcultivation. The strength data of cell-free microspheres and cell-loaded micro-spheres are shown. The strength of the cell-loaded control spheres, which are nottreated with TGF-beta3, is also included. The error bars represent the SD of n = 20measurements (�Mann–Whitney rank sum test, p < 0.01 compared to day 0; +t-test,p < 0.01; #t-test, p < 0.01 compared to capsules without TGF-beta3).

440 M. Endres et al. / Acta Biomaterialia 6 (2010) 436–444

beta3-treated and TGF-beta3-free microspheres at days 14 and28, respectively (p < 0.01).

3.3. Permeability of Ca-alginate microspheres

To analyse whether cultivation conditions and immobilizedextracellular matrix-forming cells have an influence on permeabil-ity of Ca-alginate microcapsules, diffusion tests with polydispersedextran solutions and subsequent size exclusion chromatographicanalyses of changes in the molecular weight dispersion were per-formed. Molecule size limits allowing for complete diffusionalequilibration with D P 0.95 (MSL0.95) as well as the distributioncoefficient of a large molecule fraction with a Stokes radius of8 nm (D8nm) were determined. These parameters were chosen asthey could describe the permeability adequately since there wasno cut-off limit detectable in the size range considered. Capsulepermeability measurements were carried out shortly after produc-tion and at cultivation days 14 and 28. Permeability of cell-freecapsules did not change significantly over the whole cultivationperiod. The molecular size limit for complete permeation (distribu-tion coefficient 0.95) was 1.8 nm and the distribution coefficient ofmolecules with a Stokes radius of 8 nm was 0.5. In contrast, cell-loaded Ca-alginate capsules showed two fundamental changes in

their permeability. The MSL0.95 increased during cultivation froman initial 1.3 nm up to 2 nm at day 28 while the value of D8nm de-creased from 0.55 to 0.45 over the same observation period of28 days. These effects were measured for both the TGF-beta3-trea-ted and TGF-beta3-free cell-loaded capsules, with no significantdifferences between both variants.

3.4. Gene expression analysis of chondrogenic marker genes

Human CSP cells encapsulated in Ca-alginate and stimulatedwith TGF-beta3 as well as non-stimulated controls were analyseddirectly after capsule production (day 0) and after 7 and 14 daysin culture.

In Ca-alginate culture, the TGF-beta3-stimulated CSP cells andthe control CSP cells showed marginal induction of type I collagenexpression from day 0 to day 14 (Fig. 4). TGF-beta3-treated cul-tures showed a sixfold induction of type II collagen expressionand a nearly 400-fold increase in the expression of aggrecan after14 days. In contrast, in controls, the expression of the respectivegenes remained on the same level over the 14 day period. Afterstimulation of CSP cells with TGF-beta3 over 14 days, the expres-sion of cartilage oligomeric matrix protein (COMP) was up to 90times higher compared to the controls. Remarkably, the expressionof COMP strongly decreased in the controls from day 7 to day 14,whereas the expression in the induced samples showed only amarginal decrease.

3.5. Gene expression analysis of osteogenic and adipogenic markergenes

To exclude osteogenic or adipogenic differentiation of CSP cellsin Ca-alginate cultures, the gene expression of osteopontin, osteo-calcin, peroxisome proliferator-activated receptor-gamma (PPAR-gamma) and fatty acid binding protein 4 (FABP4) was analysed di-rectly after microcapsule production (day 0) and after 7 and14 days in culture (Fig. 5). The cells showed an initial inductionof osteopontin at day 7 when stimulated with TGF-beta3, whichdecreased slightly at day 14. The expression of osteocalcin re-mained at a low level, whereas the expression of osteocalcin inthe controls increased slightly until day 14. The expression of adi-pogenic marker genes PPAR-gamma and FABP4 increased at day 14in the control group and remained at a low level in the TGF-beta3group.

Fig. 4. Semi-quantitative real-time gene expression analysis of type Ia1 collagen, type IIa1 collagen, aggrecan and COMP in CSP cells during chondrogenic differentiation inCa-alginate microcapsules. TGF-beta3 induced the expression of the chondrogenic marker genes type IIa1 collagen, aggrecan and COMP, whereas type Ia1 collagen is inducedin TGF-beta3-supplemented cultures and controls. The mean of each triplicate well is plotted and the error bars represent the SD.

M. Endres et al. / Acta Biomaterialia 6 (2010) 436–444 441

3.6. Histological and immunohistochemical evaluation

The extracellular matrix production of encapsulated CSP cellswas analysed after a 28 day cultivation period for both the non-stimulated control and the TGF-beta3-stimulated cells. Althoughthe whole Ca-alginate microcapsule was clearly stained with alcianblue, indicating that the staining solution was unspecificallytrapped by the dense Ca-alginate structures, a dark blue stainencircling the stimulated cells could be observed (Fig. 6A, black ar-row). This suggests the deposition of proteoglycans in TGF-beta3-stimulated cells in contrast to the controls (Fig. 6B). The same phe-nomenon occurred in the immunohistochemical staining of types Iand II collagen, which was represented by brownish stain sur-rounding the cells (Fig. 6C–F). After 28 days, the cells stimulatedwith TGF-beta3 showed type I collagen accumulation around thecells (Fig. 6C; black arrows). The controls showed less matrix depo-sition of type I collagen (Fig. 6D). In contrast, the CSP cells showedno differences in type II collagen staining between stimulated cells(Fig. 6E) and controls (Fig. 6F).

4. Discussion

In the present study, we have shown that human CSP cells couldbe encapsulated in Ca-alginate mirocapsules. They displayed astem cell-like character, as shown by the cell surface antigen pat-tern after cell expansion in monolayer culture. Additionally, CSPcells showed chondrogenic differentiation when encapsulated withCa-alginate and stimulated with TGF-beta3. Mesenchymal progen-itors stimulated for 14 days showed an induced expression of

chondrocyte-specific genes such as COMP, aggrecan and collagentype II. A differentiation into the adipogenic or osteogenic lineagecould be diminished by the analysis of typical adipose and osseousmarker genes. The initiation of cartilage-specific extracellular ma-trix production of CSP cells in Ca-alginate microcapsules was dem-onstrated after 28 days.

These results confirm recent data, which showed the chon-drogenic differentiation potential of CSP cells in high-densitymicromass cultures under the influence of TGF-beta3 [16]. Theuse of TGF-beta3, a member of the TGF-beta superfamily, forchondrogenic induction of mesenchymal stem- and progenitorcells has been described in detail for high density pellet cultures[22,23].

Together with the excellent proliferation capacity, these cellsexhibit a valid option for cell-based regenerative approaches. Sincethese cells originally reside in the subchondral spongious bone,they might be involved in microfracture treatment [14]. The micro-fractures of the subchondral bone plate performed by the ortho-paedic surgeon provide access to the spongious part of thesubchondral bone. Mesenchymal progenitors are allowed to flushinto the defect together with the bloodstream and produce a repairtissue made of cartilage-like extracellular matrix. This process canbe increased by using cell-free resorbable implants for defect cover[24].

Only a few clinical studies have been reported using in vitropropagated bone marrow-derived MSCs or mesenchymal progeni-tor cells like periosteal cells for the restoration of articular cartilagesurfaces in osteoarthritic lesions [25], for the regeneration of bonein maxillary sinus floor augmentation [26,27] and for lumbar

Fig. 5. Semi-quantitative real-time gene expression analysis of osteopontin, osteocalcin, PPAR-gamma and FABP4. The expression of PPAR-gamma and FABP4 showed anincrease after stimulation of CSP cells with ITS after 14 days but not after induction with TGF-beta3. Osteopontin showed an increased expression, whereas osteocalcinremained at a stable level during chondrogenic differentiation with TGF-beta3. The mean of each triplicate well is plotted and the error bars represent the SD.

442 M. Endres et al. / Acta Biomaterialia 6 (2010) 436–444

segmental fusion [28]. The results are promising, and stem andprogenitor cell therapies might soon be used in clinical routines.

For cell-based applications in articular cartilage regeneration,mesenchymal progenitor cells can be injected directly as a cell sus-pension or can be embedded in hydrogels before injecting theminto the defect. The advantages of the cell encapsulation lie inthe protection against sheer stress and in avoiding cell loss byuncontrolled cell migration within the joint space. The feasibilityof using hydrogels such as fibrin as an injectable biocompatiblematrix has been shown recently [7]. With regard to the applicabil-ity of Ca-alginate as a cell carrier, Ca-alginate microcapsules wereproduced with a size of 70 lm as microdroplets [29], or as capsules300 [30] or 500 lm in diameter [31]. The size of injectable Ca-algi-nate microcapsules was indicated as �500 lm. These capsules canbe injected with a 16- to 18-gauge needle or catheter [31]. Themean diameter of our cell-loaded microspheres was 676 lm,which corresponds to the injectable range. Along with the suitabil-ity of Ca-alginate as a temporary matrix and carrier for cells, Ca-alginate might also protect the cells against shear stress duringthe injection process and overload until they form their own func-tional extracellular matrix in the defective site. The compressiontests indicate a sufficient mechanical stability of cell-loaded Ca-alginate beads for even longer times of cultivation. Even thougha compression test in vitro is close to physiological conditions, sta-bility tests in vivo remain to be carried out.

The permeability of the Ca-alginate microcapsules was found tobe sufficient for nutrient supply of the cells and additionally for thesupply with chondrogenic inductors like TGF-beta3. Microcapsulescoated by a membrane usually show a defined cut-off range, whichcan be characterized by a size limit of exclusion (distribution ratio

0.05), size limit of permeation (distribution ratio 0.95) and meansize limit (distribution ratio 0.50) [20]. In the case of the Ca-algi-nate microspheres described in this paper, a size exclusion limitis not definable because the value is above the limit of 8–10 nm(Stokes radius), which is the largest molecular size that we are ableto analyse by the chromatographic procedure. However, the per-meation properties of the Ca-alginate microspheres can be charac-terized by the size limit for complete permeation, whichcorresponds with a distribution coefficient of 0.95 and a second va-lue expressed by the distribution coefficient of molecules with aStokes radius of 8 nm. The higher this coefficient the higher isthe permeable volume part of the microsphere and hence the per-meability for this molecular size. Interestingly we have found thatafter 28 days of cultivation the permeability of cell-loaded micro-spheres was decreased for molecules with Stokes radius of 8 nm.In contrast, the size limit for complete permeation was increased,probably caused by the slow partial decomposition of the Ca-algi-nate matrix. This finding suggests that the extracellular matrixbuilt by the encapsulated cells is not permeable for molecules ofthat size (rS = 8 nm). It would be very interesting to continue inves-tigating the cut-off limit of the extracellular matrix and theamount of matrix accumulation by this convenient diffusion test.Mechanical stability and permeability are suitable physical param-eters for controlling the quality of Ca-alginate beads for cell encap-sulation in medical fields. The methods presented forcharacterization of these properties allow defined and convenientmeasurements.

The results suggest that microencapsulation of human CSP cellsin Ca-alginate is suited for regenerative medicine approaches. Fur-ther animal studies are needed to validate the clinical applicability

Fig. 6. Histological and immunohistochemical analysis of CSP cells in Ca-alginate microcapsules after 28 days in culture. Proteoglycans surrounding the cells were shown byalcian blue staining in (A) TGF-beta3-induced cultures, which was less prominent in (B) control cultures. The staining with an antibody against type I alpha collagen (C and D)and cartilage-specific type II alpha collagen (E and F) showed discrete staining around the TGF-beta3-induced cells (C and E) and controls (D and F), whereas the staining oftype I collagen around stimulated cells (C) is more prominent than in the control (D).

M. Endres et al. / Acta Biomaterialia 6 (2010) 436–444 443

of the injection of these progenitors in Ca-alginate for cartilagerepair.

Acknowledgements

This project was sponsored by the Investitionsbank Berlin (IBB)and the Europäischen Fonds für regionale Entwicklung (EFRE)(Grant Nos. 10138665 and 10129304).

Appendix. Figures with essential colour discrimination

Certain figures in this article, particularly Figures 1 and 6, are dif-ficult to interpret in black and white. The full colour images can befound in the on-line version, at doi: 10.1016/j.actbio.2009.07.022.

References

[1] Wilke MM, Nydam DV, Nixon AJ. Enhanced early chondrogenesis in articulardefects following arthroscopic mesenchymal stem cell implantation in anequine model. J Orthop Res 2007;25(7):913–25.

[2] Liu Y, Shu XZ, Prestwich GD. Osteochondral defect repair with autologousbone marrow-derived mesenchymal stem cells in an injectable, in situ,cross-linked synthetic extracellular matrix. Tissue Eng 2006;12(12):3405–16.

[3] Zhang WJ, Li BG, Zhang C, et al. Biocompatibility and membrane strength ofC3H10T1/2 cell-loaded alginate-based microcapsules. Cytotherapy2008;10(1):90–7.

[4] Mauck RL, Yuan X, Tuan RS. Chondrogenic differentiation and functionalmaturation of bovine mesenchymal stem cells in long-term agarose culture.Osteoarthritis Cartilage 2006;14(2):179–89.

[5] Park KH, Na K. Effect of growth factors on chondrogenic differentiation ofrabbit mesenchymal cells embedded in injectable hydrogels. J Biosci Bioeng2008;106(1):74–9.

[6] Dickhut A, Gottwald E, Steck E, et al. Chondrogenesis of mesenchymal stemcells in gel-like biomaterials in vitro and in vivo. Front Biosci2008;13:4517–28.

444 M. Endres et al. / Acta Biomaterialia 6 (2010) 436–444

[7] Bertram H, Kroeber M, Wang H, et al. Matrix-assisted cell transfer forintervertebral disc cell therapy. Biochem Biophys Res Commun2005;331(4):1185–92.

[8] Tonnesen HH, Karlsen J. Alginate in drug delivery systems. Drug Dev Ind Pharm2002;28(6):621–30.

[9] Zimmermann H, Zimmermann D, Reuss R, et al. Towards a medicallyapproved technology for alginate-based microcapsules allowing long-termimmunoisolated transplantation. J Mater Sci Mater Med 2005;16(6):491–501.

[10] Murphy JM, Fink DJ, Hunziker EB, Barry FP. Stem cell therapy in a caprinemodel of osteoarthritis. Arthritis Rheum 2003;48(12):3464–74.

[11] Park DJ, Choi JH, Kim YJ, et al. Nasal augmentation using injectable alginateand mesenchymal stem cells in the rabbit. Am J Rhinol 2006;20(5):520–3.

[12] Niemeyer P, Kornacker M, Mehlhorn A, et al. Comparison of immunologicalproperties of bone marrow stromal cells and adipose tissue-derived stem cellsbefore and after osteogenic differentiation in vitro. Tissue Eng 2007;13(1):111–21.

[13] Prigozhina TB, Khitrin S, Elkin G, et al. Mesenchymal stromal cells lose theirimmunosuppressive potential after allotransplantation. Exp Hematol2008;36:1370–6.

[14] Steadman JR, Rodkey WG, Briggs KK. Microfracture to treat full-thicknesschondral defects: surgical technique, rehabilitation, and outcomes. J Knee Surg2002;15(3):170–6.

[15] Tuli R, Tuli S, Nandi S, et al. Characterization of multipotential mesenchymalprogenitor cells derived from human trabecular bone. Stem Cells2003;21(6):681–93.

[16] Neumann K, Dehne T, Endres M, et al. Chondrogenic differentiation capacity ofhuman mesenchymal progenitor cells derived from subchondral cortico-spongious bone. J Orthop Res 2008;26(11):1449–56.

[17] Endres M, Neumann K, Haupl T, et al. Synovial fluid recruits humanmesenchymal progenitors from subchondral spongious bone marrow. JOrthop Res 2007;25(10):1299–307.

[18] Serp D, Cantana E, Heinzen C, et al. Characterization of an encapsulation devicefor the production of monodisperse alginate beads for cell immobilization.Biotechnol Bioeng 2000;70(1):41–53.

[19] Woehlecke H, Ehwald R. Characterization of size-permeation limits of cellwalls and porous separation materials by high-performance size exclusionchromatography. J Chromatogr A 1995;708:263–71.

[20] Dautzenberg H, Schuldt U, Lerche D, et al. Size exclusion properties ofpolyelectrolyte complex microcapsules prepared from sodium cellulosesulphate and poly[diallyldimethylammoniumchloride]. J Membr Sci1999;162:165–71.

[21] Chomczynski P. A reagent for the single-step simultaneous isolation of RNA,DNA and proteins from cell and tissue samples. Biotechniques15(3):1993;532–34, 536–37.

[22] Barry F, Boynton RE, Liu B, Murphy JM. Chondrogenic differentiation ofmesenchymal stem cells from bone marrow: differentiation-dependent geneexpression of matrix components. Exp Cell Res 2001;268(2):189–200.

[23] Johnstone B, Hering TM, Caplan AI, et al. In vitro chondrogenesis of bonemarrow-derived mesenchymal progenitor cells. Exp Cell Res1998;238(1):265–72.

[24] Erggelet C, Neumann K, Endres M, et al. Regeneration of ovine articularcartilage defects by cell-free polymer-based implants. Biomaterials2007;28(36):5570–80.

[25] Wakitani S, Imoto K, Yamamoto T, et al. Human autologous culture expandedbone marrow mesenchymal cell transplantation for repair of cartilage defectsin osteoarthritic knees. Osteoarthritis Cartilage 2002;10(3):199–206.

[26] Ueda M, Yamada Y, Ozawa R, Okazaki Y. Clinical case reports of injectabletissue-engineered bone for alveolar augmentation with simultaneous implantplacement. Int J Periodontics Restorative Dent 2005;25(2):129–37.

[27] Schmelzeisen R, Schimming R, Sittinger M. Making bone: implant insertioninto tissue-engineered bone for maxillary sinus floor augmentation – apreliminary report. J Craniomaxillofac Surg 2003;31(1):34–9.

[28] Putzier M, Strube P, Funk J, et al. Periosteal cells compared with autologouscancellous bone in lumbar segmental fusion. J Neurosurg Spine2008;8(6):536–43.

[29] Foltz WD, Ormiston ML, Stewart DJ, et al. MRI characterization of agarose gelmicro-droplets at acute time-points within the rabbit lumbar muscle.Biomaterials 2008;29(12):1844–52.

[30] Enomoto T, Oda T, Aoyagi Y, et al. Consistent liver metastases in a rat model byportal injection of microencapsulated cancer cells. Cancer Res2006;66(23):11131–9.

[31] Van Raamsdonk JM, Chang PL. Osmotic pressure test: a simple, quantitativemethod to assess the mechanical stability of alginate microcapsules. J BiomedMater Res 2001;54(2):264–71.