Molecular phylogeny of the burying beetles (Coleoptera: Silphidae: Nicrophorinae)

This article appeared in a journal published by Elsevier. The attachedcopy is furnished to the author for internal non-commercial researchand education use, including for instruction at the authors institution

and sharing with colleagues.

Other uses, including reproduction and distribution, or selling orlicensing copies, or posting to personal, institutional or third party

websites are prohibited.

In most cases authors are permitted to post their version of thearticle (e.g. in Word or Tex form) to their personal website orinstitutional repository. Authors requiring further information

regarding Elsevier’s archiving and manuscript policies areencouraged to visit:

http://www.elsevier.com/authorsrights

http://www.elsevier.com/authorsrights

Author's personal copy

Molecular phylogeny of the burying beetles (Coleoptera: Silphidae:Nicrophorinae)

Derek S. Sikes a,⇑, Chandra Venables b

a University of Alaska Museum, 907 Yukon Dr, University of Alaska Fairbanks, Fairbanks, AK 99775, USAb Department of Biological Sciences, University of Calgary, 2500 University Drive NW, Calgary, Alberta T2N 1N4, Canada

a r t i c l e i n f o

Article history:Received 3 May 2013Revised 10 July 2013Accepted 22 July 2013Available online 2 August 2013

Keywords:SilphidaeNicrophorinaeNicrophorusSystematicsTaxonomyBurying beetle

a b s t r a c t

Burying beetles (Silphidae: Nicrophorus) are well-known for their monopolization of small vertebrate car-casses in subterranean crypts and complex biparental care behaviors. They have been the focus of intensebehavioral, ecological, and conservation research since the 1980s yet no thorough phylogenetic estimatefor the group exists. Herein, we infer relationships, test past hypotheses of relationships, and test biogeo-graphic scenarios among 55 of the subfamily Nicrophorinae’s currently valid and extant 72 species. Twomitochondrial genes, COI and COII, and two nuclear genes, the D2 region of 28S, and the protein codinggene CAD, provided 3,971 nucleotides for 58 nicrophorine and 5 outgroup specimens. Ten partitions, witheach modeled by GTR + I + G, were used for a 100 M generation MrBayes analysis and maximum likeli-hood bootstrapping with Garli. The inferred Bayesian phylogeny was mostly well-resolved with onlythree weak branches of biogeographic relevance. The common ancestor of the subfamily and of the genusNicrophorus was reconstructed as Old World with four separate transitions to the New World and fourreverse colonizations of the Old World from the New. Divergence dating from analysis with BEAST indi-cate the genus Nicrophorus originated in the Cretaceous, 127–99 Ma. Most prior, pre-cladistic hypothesesof relationships were strongly rejected while most modern hypotheses were largely congruent withmonophyletic groups in our estimated phylogeny. Our results reject a recent hypothesis that Nicrophorusmorio Gebler, 1817 (NEW STATUS as valid species) is a subspecies of N. germanicus (L., 1758). Two sub-genera of Nicrophorus are recognized: Necroxenus Semenov-Tian-Shanskij, 1933, and NicrophorusFabricius, 1775.

� 2013 Elsevier Inc. All rights reserved.

1. Introduction

Beetles of the genus Nicrophorus (Fabricius, 1775) (Coleoptera:Silphidae: Nicrophorinae), also known as ‘‘burying beetles,’’ arebest known for their biparental care of offspring and burial of smallvertebrate carcasses on which their young are brooded. Other sil-phids breed on large carcasses and lack parental care (Peck andAnderson, 1985).

Nicrophorus species are found primarily in the temperate north-ern hemisphere and are absent from Antarctica, subSaharan Africaand Australia (Fig. 1) (Sikes, 2005). There are 21 species in the NewWorld, two Holarctic species, and 49, or more, species in the OldWorld. A radiation of species in southeast Asia extends throughoutthe Malay and Melanesian Archipelagos. Three of the New Worldspecies occur in the South American Andes. In the few tropicalareas where this lineage occurs these beetles are found almostexclusively in cool habitats at high elevations.

Good reviews of the relatively extensive literature on silphidbiology are available in Anderson and Peck (1985), Ratcliffe(1996), Eggert and Müller (1997), and Scott (1998). The classicwork on the biology of Nicrophorus by Pukowski (1933) remainsvaluable today. Extensive use of burying beetles as research mod-els and the intensive study of the endangered American buryingbeetle (Nicrophorus americanus Olivier, 1790) have produced awealth of information on Nicrophorus distribution, habitat prefer-ences, phenology, diel periodicity, physiology, behavior, and theirphoretic mites, especially for a subset of the more common NorthAmerican, European and Japanese species (e.g. Anderson, 1982;Anduaga, 2009; Arce et al., 2012; Bedick et al., 1999; Boncoraglioand Kilner, 2012; Heinrich, 2012; Hocking et al., 2007; Hollowayand Schnell, 1997; Hwang and Shiao, 2011; Ikeda at al., 2006;Kishida and Suzuki, 2010; Knee et al., 2012; Leasure et al., 2012;Lomolino et al., 1995; Nisimura et al., 2005; Sikes and Raithel,2002; Smith et al., 2007; Trumbo and Robinson, 2008). Thisavailability of data on behavior and ecology, albeit for a relativelysmall subset of the world’s species, makes Nicrophorus a compel-ling group to analyze life history and ecological traits from aphylogenetic perspective.

1055-7903/$ - see front matter � 2013 Elsevier Inc. All rights reserved.http://dx.doi.org/10.1016/j.ympev.2013.07.022

⇑ Corresponding author.E-mail address: [email protected] (D.S. Sikes).

Molecular Phylogenetics and Evolution 69 (2013) 552–565

Contents lists available at ScienceDirect

Molecular Phylogenetics and Evolution

journal homepage: www.elsevier .com/locate /ympev


1.1. Previous phylogenetic research

Portevin (1926), Hatch (1927), and Semenov-Tian-Shanskij(1933) arranged the world nicrophorine species into informal spe-cies groups, subgenera, and genera. Hatch took an evolutionary ap-proach in his work; for example, he presented explicit argumentsas to which character states and species groups he thought wereancestral. Hatch’s approach was unusually advanced for his timebut his results require modern reassessment.

Nine modern studies have evaluated nicrophorine relationships.However, most were based on geographically localized assem-blages of non-monophyletic groups. Peck and Anderson (1985) re-vised the New World species and were the first to apply modernphylogenetic methods with Nicrophorus. Their cladistic analysis,based on adult and larval morphology, and behavior, placed the20 New World species known at that time into four species-groupswith two unplaced species. They concluded that the New Worldfauna (Fig. 1) did not form a monophyletic group and was derivedfrom as many as six colonizations by Old World lineages. A

manually calculated cladistic analysis of the Korean fauna was per-formed by Cho et al. (1988). Ruzicka (1992) applied parsimonymethods to a dataset based on larval characters of five centralEuropean species and was able to place four of these species intothree of Peck and Anderson’s (1985) species groups. Palestriniet al. (1996) presented the first phylogenetic assessment focusedentirely on the investigator group species. The first molecular phy-logenetic investigation of the family Silphidae, which focused onthe intergeneric relationships of the subfamily Silphinae and in-cluded four nicrophorine species, was conducted by Dobler andMüller (2000). The same year Szalanski et al. (2000), focusing onNicrophorus americanus, published a small molecular phylogenyincluding nine Nicrophorus species. The most recent molecularphylogenies, including many species of the two largest speciesgroups (nepalensis and investigator), were published by Sikeset al. (2006, 2008), and Mousseau and Sikes (2011).

Preliminary phylogenetics of the Nicrophorinae, based on themitochondrial genes COI, COII, and morphological data, resultedin tree topologies that were well resolved and supported at the

Fig. 1. Georeferenced records of the subfamily Nicrophorinae. Data available via www.DiscoverLife.org, and the Dryad Repository (http://dx.doi.org/10.5061/dryad.mr221).

D.S. Sikes, C. Venables / Molecular Phylogenetics and Evolution 69 (2013) 552–565 553


terminal nodes, but with a large polytomy at the base of the genusNicrophorus (Sikes, 2003), and one species, Nicrophorus carolinus(L., 1771), was placed outside of the genus Nicrophorus. This lackof resolution for basal Nicrophorus relationships involved 14 nodesand obscured answers to questions of historical biogeography andcharacter state evolution.

This study was conducted within the context of an ongoing sys-tematic revision of the subfamily (Mousseau and Sikes, 2011; Sikesand Peck, 2000; Sikes, 2003, 2005, 2008; Sikes et al., 2002, 2006,2008) in an attempt to infer a phylogeny using members of all pre-viously recognized non-monotypic species groups to improve ourunderstanding of the evolution of the Nicrophorinae.

2. Methods and materials

2.1. Taxon sampling

Our final dataset includes data from 63 specimens representing54 of the 68 extant, valid species of Nicrophorus (Sikes et al., 2002,2006, 2008; Sikes and Mousseau, in press) and six outgroup taxa(Table 1). All New World Nicrophorus species are represented inour analysis except N. chilensis Philippi, 1871. One outgroup, Aleoc-hara heeri Likovsky, 1982, from the family Staphylinidae, inferredto be the sister family of the Silphidae (Grebennikov and Newton,2012), was chosen. Outgroup species in the subfamily Silphinae in-cluded Necrodes surinamensis (Fabricius, 1775), Necrodes littoralis(L., 1758), Ptomaphila lacrymosa (Schreibers, 1802), and Ptomaphilaperlata Kraatz, 1876. A genus closely related to Nicrophorus, Pto-mascopus, was represented by the species, P. morio Kraatz, 1877(Sikes, 2005). The subfamily is well supported as monophyletic inboth past molecular and morphological analyses (Dobler and Mül-ler, 2000; Sikes, 2003, 2005).

Specimen identification numbers, GenBank accession numbers,and locality data are presented in Table 1. Data for 17,543 litera-ture-based occurrence and specimen records are available viawww.discoverlife.org and a specimen datafile was archived inthe Dryad Repository [http://dx.doi.org/10.5061/dryad.mr221].All specimens used in our phylogenetic analyses are archived inthe research collection of the first author. For preliminary analyses,to establish that molecular data and species identifications were inagreement, and test the monophyly of species, multiple exemplarswere included for each species when available, for a larger datasetof 109 sequences (Venables, 2007). Exemplars were chosen fromdistant regions of each species’ range whenever possible. Wepruned this larger dataset in the goal of having one sequence perspecies to reduce the computational complexity of the analyses.This resulted in a dataset of 55 nicrophorine sequences. Two spe-cies, N. lunatus Fischer von Waldheim, 1842 and N. quadrimaculatusMatthews, 1888, were retained as two specimens each becausethese specimens each lacked gene sequences of their conspecificother. One species, N. sepultor Charpentier, 1825, is representedby two sequences due to a recent synonymy of N. confusus Porte-vin, 1924, under N. sepultor (Sikes et al., 2008). These extras wereomitted from Fig. 2 for presentation purposes.

2.2. DNA extraction, amplification, and sequencing

Genome extraction from hind-leg muscle tissue of each abso-lute ethanol preserved specimen (Table 1) was completed usingQiagen DNeasy Tissue kit (Qiagen Inc. Valencia CA) following thepublished methods with the exception of using ddH20 for the finalelutions, instead of the buffer included in the kit.

Building on the thesis work of Sikes (2003), which included datafor COII (�687 bp) for about half of the extant species of Nicropho-rus, and COI (1443 bp) for about a third of the species (as well as

flanking tRNA’s leucine, lysine, and aspartic acid), we added COIand COII sequences for additional taxa, bringing the representationof the Nicrophorinae up to 55 species. We included the nuclearribosomal gene: D2 region of 28S, and the nuclear protein codinggene CAD (rudimentary).

For PCR of gene fragments, 50 lL reaction tubes were made upof 2 lL template DNA with 5 lL TAE buffer, 1 lL 10 mM dNTP,1.5 lL 50 mM MgCl2, 2.5 lL of forward primer, 2.5 lL reverse pri-mer, 0.25 lL Taq polymerase, and 35.25 lL ddH2O. In some caseswhere amplification of sequence data was weak, 4 lL of templateDNA was used and ddH20 was decreased to 33.25 lL per reactiontube. For long gene fragments (COI), primers were chosen to allowfor approximately 200 bp overlap (Table 2). The PCR program ap-plied had an initial temperature of 94 �C for 3 min, denaturationfor 30 s at 94 �C, annealing for 1 min at 47–50 �C, elongation for1 min at 72 �C. This cycle was run 29 times, followed by a final10 min stage at 72 �C.

2.3. DNA sequence editing and alignment

Sequences were bi-directionally amplified using automatedSanger sequencing methods with an Applied Biosystems3730 � l96 capillary DNA Analyzer. Forward and reverse sequenceswere compared and aligned using the program CodonCode Alignerv1.2.0 and proofread by eye. All homoplastic and autapomorphicnonsynonymous substitutions were verified carefully by reinspec-tion of original chromatogram files.

The correct reading frame and location of mitochondrial DNAsequences on the mitochondrial genome were determined usingsequences from the literature (COII: Liu and Beckenbach, 1992;COI: Lunt et al., 1996). The nuclear genes CAD and D2-28S werealigned by eye with reference to the genome of Drosophila melano-gaster Meigen, 1830, (GenBank: AE014298). Due to the low level ofvariation in these sequences, alignment by eye was unambiguous.These sequences are available from Genbank (Table 1) and thealigned NEXUS file is available from TreeBase (http://purl.org/phy-lo/treebase/phylows/study/TB2:S14395) under study Accessionnumber (14395). Missing data included 2 specimens without aCOI sequence, 4 without COII, 18 without D2/28S, and 18 withoutCAD (Table 1).

2.4. Model selection and phylogenetic analysis

MrModeltest v2.2 (Nylander, 2004) was used to evaluate the fitof 24 common models to our dataset. Both the hLRT and AIC chosethe most parameter-rich model, GTR + I + G, as the best fittingmodel for partition strategy 1 (Table 3) and for each gene whentested independently. All uses of gamma involved four discreterate categories.

Preliminary runs under the GTR + I + G model were conductedusing 10 partitioning strategies in MrBayes 3.1.2 (Ronquist andHuelsenbeck, 2003) under default priors, sampling every 1000 gen-erations, with 3 million generations initially, 10 million genera-tions with more complex schemes, and a final run of 100 milliongenerations for the most complex partitioning strategy with sam-ples taken every 10,000 generations (Table 4). Effective samplesizes for the log likelihoods, as calculated by Tracer v1.5 (Rambautand Drummond, 2003), showed 3 million and 10 million genera-tions were inadequate run lengths for these more complex parti-tioning schemes (Table 4). The final run of 100 milliongenerations had acceptable ESS values. Bayes factors (Kass and Raf-erty, 1995) were used to compare the different partitioning strate-gies. The 10 partition strategy was chosen because it yielded loglikelihoods 72 units better than the 7 partition strategy (Table 4)and a difference of 5 or more log likelihood units is considered very

554 D.S. Sikes, C. Venables / Molecular Phylogenetics and Evolution 69 (2013) 552–565


strong evidence in favor of the better model (Kass and Raferty,1995).

2.5. Phylogenetic analysis

Bayesian analyses were conducted using MrBayes v3.1.2 (Ron-quist and Huelsenbeck, 2003) using a separate GTR + I + G modelfor each of 10 partitions with non-branch-length parameters un-linked across partitions, with default priors. Two simultaneousMCMC runs with four chains each (3 hot and 1 cold) were per-formed for 100 million generations and sampled every 10,000 gen-erations discarding a burnin of 25%. To evaluate whether theMCMC analysis had reached stationarity, trace files were examinedin Tracer v1.5 (Rambaut and Drummond, 2003). These showedsigns of good mixing and had plateaued at equal values. The aver-age standard deviation of split frequencies between the two runshad dropped below 0.01 by 8% of the 100 M generation run, alsoindicating both runs had converged. The uncorrected potentialscale reduction factor of Gelman and Rubin (1992a,b) had valuesnear 1.00 for all 131 parameters estimated – further indicatingboth runs were sampling the same posterior distribution.

Maximum likelihood bootstrap analyses were performed usingGarli v.2.0.1019 (Zwickl, 2006) using a separate GTR + I + G modelfor each of 10 partitions with non-branch-length parameters un-linked across partitions. Given the computational complexity ofthese searches a single replicate took �24 h. To speed the analysiswe used the University of Alaska Life Science Informatics computa-tional cluster to launch 10 instances of Garli and combine theresulting 212 bootstrap trees, reducing 100 days of analysis to10. PAUP⁄ 4.0b10 (Swofford, 2001) was used to build a 50% major-ity rule consensus tree from the Garli result trees.

2.6. Divergence dating

Preliminary testing of the mtDNA data rejected a strict molecu-lar clock (Sikes, 2003) so divergence dates were estimated usingBEAST v.1.7.5 (Drummond et al., 2012) under a lognormal uncorre-lated relaxed clock. We used the 10 partition scheme selected byour Bayes Factor analysis, with a GTR + I + G model with four gam-ma categories and substitution parameters unlinked across parti-tions for each, combined with a Yule process of speciation. Wefixed the tree topology to the majority rule consensus phylogramfound in the prior MrBayes 100 M analysis although three polyto-mies needed to be resolved for BEAST to use this tree. The firstpolytomy was the basal split between the staphylinid Aleocharaoutgroup and the ingroup silphids. The remaining two involvedvery shallow branches in the nepalensis group for N. charon Sikesand Madge, 2006, and N. insignis Sikes and Madge, 2006. Thesewere resolved, keeping the branch lengths very short, to conformwith trees found by Mousseau’s (2011) analyses of this group.

Minimum node constraints were assigned a normal prior distri-bution, allowing for some uncertainty in the estimation of the fos-sil ages, with means equal to 10 My prior to the fossil date and thestandard deviations encompassing plausible, but wide (±12 Ma),youngest and oldest ages of each node. This assigns greater proba-bility to dates prior to the age of the fossils for the origins of thegroups because it is more reasonable to assume that the groupsoriginated and evolved prior to their fossilization events than to as-sume they originated and were fossilized concurrently.

Two node calibrations were used. Recent discoveries of silphidfossils from Mesozoic sediments in China are in the process ofbeing described by Chenyang Cai (Nanjing Institute of Geologyand Palaeontology, Nanjing, China) and colleagues (Cai et al., inpreparation). The taxonomic identities of these fossils, which areremarkably well preserved, have been confirmed by A. Newton(Field Museum of Natural History, Chicago, USA). A short video

documentary of this work is available online (Thayer et al.,2011). These fossils push back the oldest fossil-based dates forthe subfamily Nicrophorinae from 40 to 50 Ma (Flach, 1890) to125 Ma (Early Cretaceous Yixian Formation (Jehol biota) (Swisheret al., 1999)). Older silphid fossils, from the middle Jurassic Jiulong-shan Formation (Daohugou biota) (165 Ma, (Huang et al., 2006)),lack synapomorphies of the two extant subfamilies and thus can-not be assigned to either subfamily but are unquestionably silphids(Grebennikov and Newton, 2012). These two dates were used toassign node calibrations for the Nicrophorinae and the Silphidae.Allowing 10 My prior to the age of the fossils for the originationof the groups, the 165 Ma date for the Silphidae was used to seta mean of 175 Ma with the 95% credibility interval around themean spanning the period from 184.9 to 165.1 Ma. The 125 MaNicrophorinae date was used to set a mean of 135 Ma with the95% credibility interval around the mean spanning the period from144.9 to 125.1 Ma.

Earlier work (Sikes, 2003) using GTR + I + G corrected 2nd codonpositions of COII roughly agree with these calibration points basedon these new Chinese fossils. Combined with a wide estimate ofthe split between the two silphid subfamilies (70–150 Ma), a sub-stitution rate of 0.033–0.016% per million years was estimated.Using these rates Sikes (2003) estimated the divergence date forthe most recent common ancestor of the Nicrophorinae to have oc-curred between the early Cretaceous (125 Ma) and early Tertiary(�59 Ma).

Two MCMC analyses were run for 100 million generations withparameters sampled every 10,000 generations. These runs werecombined using LogCombiner1.7.5, with the first 25% of the gener-ations from each run discarded as burnin. Convergence of the runswas assessed using TRACER 1.5 which indicated most (116 of 134)parameter values had effective sample sizes well above 100. Tre-eAnnotator 1.7.5 was used to calculate node ages and upper andlower bounds of the 95% highest posterior density interval fordivergence times from a combined tree file of both runs. The chro-nogram was visualized using FigTree 1.3.1.

2.7. Hypothesis testing

Hypotheses of monophyly based on prior species groupings (Ta-ble 5) within the subfamily were tested by determination of theposterior probability of each clade based on the Bayesian analysis.If the clade was not present in any of the trees sampled during theMCMC run, the posterior probability was determined to be lessthan 1/(# of trees sampled) (Miller et al., 2002). Some hypothesescould not be tested because they were monotypic subgenera with-out assertions of relationship within the genus Nicrophorus. Suchmonotypic genera, or genera represented by a single exemplar inour study such as Ptomascopus, were not tested for monophylybut for whether they were inferred to have evolved from inside(=rejection of genus status) or outside (=support of genus status)the genus Nicrophorus.

2.8. Biogeographic ancestral character state reconstruction

Ancestral character state reconstruction for a binary datasetwith the character states ‘‘Old World’’ and ‘‘New World’’ was as-sessed using Mesquite v. 2.75 (Maddison and Maddison, 2011) un-der the Asymmetrical 2-parameter Markov k-state model, withtwo different rates of change (one for increases in state, one for de-creases in state), with rates of gains and losses estimated based onbranch lengths from Fig. 4. The forward rate was estimated as0.0042 and the backward rate as 0.0111. The two Holarctic species,N. investigator Zetterstedt, 1824, and N. vespilloides Herbst, 1783,were represented by two exemplars each, with one coded as OldWorld and New World, respectively. Although these duplicates



Table 1Taxa, GenBank accession numbers, specimen identifiers, and location of collection. Suffix numbers of specific epithets correspond with a specimen in a series of DNA vouchers.

Subfamily Genus Species GenbankNo. COI

GenbankNo. COII

Genbank No.D2-28S

GenbankNo. CAD

Specimen Id No. Locality

Aleocharinae Aleochara heeriGB AJ293068Silphinae Ptomaphila lacrymosa2 KC977954 KC977959 * Australia

perlata1 KC977955 KC977960 DSSC006469Nic Australia: New South Wales,Bawley point

Necrodes surinamensis2 KC977956 KC977961 EU147393 DSSC006364Nic USA: Connecticut, WindhamCounty

littoralis2 KC977957 KC977962 DSSC123354Nic China: Shaanxi Province, QinlingMountains

Nicrophorinae Ptomascopus morio2 KC977958 KC977963 DSSC006367Nic Japan: Honshu Province KyotoPrefecture

Nicrophorus americanus2 EU147412 EU147412 EU147318 EU147364 DSSC006194Nic USA: Rhode Island, Providenceantennatus1 EU147413 EU147413 EU147365 DSSC122003Nic Turkey: Erzurum Provinceapo5 EU147415 EU147415 EU147319 EU147366 DSSC93938Nic Phillipines: Mindanao, South

Cotabatoargutor 1 EF537636 EF537636 EU147367 DSSC73832Nic Russia: Khakassiacarolinus2 EU147320 EU147368 DSSC006360Nic USA: Florida, Alachva Countycharon1 EU147419 GQ343214.1 EU147322 EU147369 DSSC122824Nic Indonesia: Sulawesi, Rano Ranoconcolor2 EU147422 EU147422 EU147323 EU147370 DSSC006333Nic Japan: Honshu Province Kyoto

Prefecturedauricus1 EU147423 EU147423 EU147325 EU147372 DSSC73866Nic Russia: Khakassiadefodiens2 EU147426 EU147426 EU147326 DSSC006365Nic USA: Colorado, Gunnison Countydidymus1 EU147427 EU147427 EU147327 EU147373 DSSC006341Nic Ecuador: Napo Province,

Cosangadistinctus4 EU147430 EU147430 EU147328 EU147374 DSSC122807Nic Indonesia: Sulawesi, Tomado

villageencaustus1 EF537622 EF537622 EU147329 EU147375 DSSC006324Nic Nepal: Mustang Districtgermanicus4 EU147432 EU147432 EU147330 EU147376 DSSC73691Nic Hungary: Pestmegye, Kiskunsag

National Parkguttula5 EF537643 EF537643 EU147331 EU147377 DSSC007297Nic Canada: Alberta, Brooks regionheurni3 EU147433 EU147433 DSSC123271Nic Papua New Guinea: Eastern

Highlands, Gorokahispaniola1 EU147435 EU147435 EU147332 EU147378 DSSC006346Nic Dominican Republic: Pedemales

Provincehumator3 EU147437 AY825262 EU147379 DSSC006497Nic Russia: NW Caucasus, Krasnodar

regionhybridus3 EU147438 EF537627 EU147333 EU147380 DSSC007295Nic USA: Idaho. Targhee Nat. Forestinsignis2 EU147439 EU147439 EU147334 EU147381 DSSC122836Nic Indonesia: Flores Island, Golo.insularis1 EU147441 EU147441 EU147335 EU147382 DSSC122832Nic Indonesia: Bali, Mt. Bratan.interruptus4 EF537620 EF537620 EU147336 DSSC007304Nic Czech Republic: Bohemia, Kolin

Districtinvestigator10 EF537599 EF537599 EU147337 EU147383 DSSC73849Nic Russia: Krasnoyarskii Kraj.,

Krasnoyarskjaponicus1 EU147443 EU147443 EU147338 EU147384 DSSC006335Nic Japan: Honshu Province, Chiba

Prefecturekieticus1 EU147445 EU147445 EU147339 EU147385 DSSC93963Nic Solomon islands: Guadalcanallunatus3 EU147340 EU147386 DSSC73688Nic Kazakhstan: Fabrichnoelunatus4 EU147448 EU147448 EU147341 DSSC73689Nic Kazakhstan: Almaty regionmaculifrons3 EU147450 AY826809 EU147342 DSSC007293Nic Japan: Hokkaido Province,

Otoineppumarginatus1 EF537639 EF537639 EU147343 EU147387 DSSC006338Nic USA: Rhode Island,Washington

Countymelissae2 EU147452 AY826802 DSSC006377Nic Nepal: Mustang Districtmexicanus1 EF537632 EF537632 EU147344 EU147388 DSSC07299Nic Mexico: Veracruz, Municipio de

Tlacolulanmontivagus2 EU147453 AY826810 EU147345 DSSC006350Nic Japan: Honshu Province,

Chuzenji-komorio1 EU147454 EU147454 EU147346 EU147389 DSSC73836Nic Russia: Khakassianepalensis5 EU147457 EU147457 EU147347 EU147390 DSSC006474Nic Nepal: Mustang Districtnigricornis1 EU147458 EU147458 EU147348 EU147391 DSSC122011Nic Turkey: Ardahan Provincenigrita2 EF537629 EF537629 EU147349 DSSC006351Nic USA: California, Monteray

Countyoberthuri1 EU147460 EU147460 EU147394 DSSC123379Nic China: Sichuan Province Ganzi

Prefectureobscurus2 EF537642 EF537642 EU147350 EU147395 DSSC006358Nic USA: Idaho. Targhee National

Forestolidus3 EU147463 EU147463 EU147351 EU147396 DSSC007302Nic Mexico: Municipio de, el Fresnoorbicollis1 EU147464 EU147464 EU147352 EU147397 DSSC006340Nic USA: Conneticut,Windham

Countypodagricus2 EU147467 AY826799 EU147353 EU147398 DSSC006354Nic Malaysia: Borneo, Sabahprzewalskii2 EU147469 EU147469 EU147399 DSSC123389Nic China: Qinghai Province,

Yunning Sipustulatus2 EU147471 EU147471 EU147354 EU147400 DSSC006349Nic USA: Conneticut, Windham

County



were not present in the current phylogenetic analysis, prior studieshave found Old World and New World populations of each of thesespecies are sister lineages (Peck and Anderson, 1985; Venables,2007; Sikes et al., 2008). Results from this model were comparedto the two other probability models available in Mesquite (theAsymmetrical 2-parameter Markov k-state model with user fixedrates set to equal, and the one-parameter Markov k-state model(Lewis, 2001)).

3. Results

3.1. Sequence statistics

The final alignment had 3971 bp with most taxa sequenced forthe following four genes: COI, COII, CAD, and D2 of 28S. The align-ment included 2439 constant sites, 272 variable but parsimony-uninformative sites, and 1260 parsimony-informative sites. Withinthe subfamily Nicrophorinae the alignment included 2534 con-stant sites, 245 variable but parsimony-uninformative sites, and1192 parsimony-informative sites.

3.2. Bayesian inference phylogenetic analysis

The resulting 50% majority rule consensus phylogram from the100 M generation MrBayes analysis was mostly well resolved(Fig. 2). Two polytomies and some very short branches were foundinside the nepalensis group. Three weakly supported nodes (poster-ior probabilities <0.8) include the branch subtending N. sayi La-porte, 1840, the branch holding the marginatus and didymusgroups together, and a branch inside the investigator group (Fig. 2).

3.3. Maximum likelihood phylogenetic analysis

The resulting 50% majority rule consensus tree (Fig. 3) from 212bootstrap replicates using Garli was less well resolved than theBayesian tree. A large polytomy of eight branches is present inthe mid-level of the tree and also within the nepalensis group. Mostof the species groups supported in the Bayesian analysis (Fig. 2) are

recovered as monophyletic but the relationships among most ofthese groups are obscured.

3.4. Divergence dating

Age estimation using a lognormal uncorrelated relaxed clock inBEAST, using the two node dates based on the Chinese silphid fos-sils for minimum calibration points, resulted in a mean age estima-tion of 113.2 ± 14 Ma for the origin of the genus Nicrophorus (Fig. 4)with a 95% highest posterior density interval of 126.9–98.8 Ma. Thetwo calibrated nodes changed little from their prior values. Thesubfamily Nicrophorinae was dated to 144.4–123.9 Ma with amean of 133.4 Ma. The family Silphidae was dated to 186.3–164.1 Ma with a mean of 175.7 Ma. Speciation in the genus appearsto have been fairly regular, with no pattern of recent or ancientbursts of radiation excepting perhaps the radiation within thenepalensis group. Many species date to old splits. For example,the endangered species N. americanus was estimated to have splitfrom a common ancestor shared by N. orbicollis Say, 1825, 73–38 Ma and the eastern North American species, N. sayi, appearsto be 85–60 million years old. The oldest species in the genus ap-pears to be N. distinctus Grouvelle, 1885, which dates to a diver-gence 110–82 Ma. Twenty-two Nicrophorus species date todivergence events older than 25 Ma but the majority, 32 species,date to divergence events younger than 25 Ma.

3.5. Hypothesis testing

Only four of the 18 pre-1960 taxonomic assertions that wecould test were supported, while ten of the 15 post-1960 groupingswere supported (Table 5). Altogether 14 hypotheses could not betested due to monotypy.

3.5.1. Biogeographic ancestral character state reconstructionMaximum likelihood ancestral character state reconstruction

based on the Bayesian consensus phylogeny shows strong supportfor an Old World origin for Nicrophorus (proportional likelihoodP0.99). The biogeographic history within the genus is complex,

Table 1 (continued)

Subfamily Genus Species GenbankNo. COI

GenbankNo. COII

Genbank No.D2-28S

GenbankNo. CAD

Specimen Id No. Locality

quadrimaculatus1 EU147472 EU147355 EU147401 DSSC100190Nic Costa Rica: Puntarenas Province,Monteverde

quadrimaculatus2 EU147473 EU147473 DSSC100191Nic Costa Rica: Puntarenas Province,Monteverde

quadripunctatus1 EU147474 AY826813 DSSC006198Nic Japan: Honshu Province KyotoPrefecture

sayi2 GQ343191.1 AY826798 EU147356 EU147408 DSSC006472Nic USA: Conneticut, WindhamCounty

schawalleri2 EU147479 EU147479 DSSC123376Nic China: Sichuan Province GanziPrefecture

scrutator1 EU147480 EU147480 EU147357 EU147402 DSSC73684Nic Argentina: Catamarca Province,Villa La Merced

semenowi2 EF537638 EF537638 EU147403 DSSC123384Nic China: Qinghai Province, GangcaDasi

sepultor1 EF537645 EF537645 DSSC123395Nic Czech Republic: Bohemia bor.sepultor2 EF537634 EF537634 EU147324 EU147371 DSSC122008Nic Turkey: Erzurum Provincesmefarka1 EU147482 EU147482 EU147404 DSSC123368Nic China: Sichuan Province Ganzi

Prefecturetenuipes1 EU147484 EU147484 EU147358 EU147409 DSSC006329Nic Japan: Hokkaido Province,

Otoinepputomentosus5 EF537625 EF537625 EU147359 EU147405 DSSC007308Nic USA: South Dakota, Custer

Countytrumboi1 EU147486 AY826812 EU147360 DSSC006345Nic Nepal: Solu Khumbu Districtvespillo4 EU147489 EU147489 EU147361 EU147406 DSSC006496Nic Russia: NW Caucasus, Krasnodar

regionvespilloides3 EU147490 EU147490 EU147362 EU147407 DSSC006373Nic Czech Republic: Bohemia

* Dobler and Müller, 2000 – sequence provided by S. Dobler.



with four colonizations of the Nearctic and four subsequent returncolonizations of the Palearctic from the Nearctic (Figs. 4 and 5).

The first dispersal to the Nearctic was unambiguously by N.sayi (Figs. 4 and 5). The second dispersal to the Nearctic was bythe common ancestor of the clade that represents the majorityof the New World species (Fig. 5, node A, PL = 0.84 Nearctic).The third dispersal to the Nearctic was by (60% probability) thecommon ancestor of the sister species N. americanus and N. orbi-

collis, (Fig. 5, node B). The fourth dispersal event to the NewWorld was by N. investigator, the other Holarctic species ofNicrophorus.

From within the large New World clade, four lineages are recon-structed as return dispersal events to the Old World – N. tenuipesand N. vespilloides near node C (Fig. 5), and the far east Asian spe-cies N. semenowi (Reitter, 1887) (Fig. 5, node D, PL = 0.58 Nearctic).Finally, the remainder of the investigator group (Fig. 2) crown clade,

Fig. 2. Phylogeny of subfamily Nicrophorinae inferred using Bayesian methods. 50% Majority rule consensus phylogram of 5001 post burn-in trees from two independent 100million MCMCMC (2 chains) runs, sampled once every 10,000 generations, using a ten partition GTR + I + G model with the software MrBayes 3.1.2. Estimates of Bayesianposterior probabilities for branches with values >0.79 are provided for each branch. Three branches with weak support are marked with asterisks. The subgenus Necroxenusand informal species groups within the subgenus Nicrophorus are indicated. Inset photo shows dorsal and lateral views of Nicrophorus vespillo, the type species of Nicrophorus,scale = 5 mm, specimen ID = CMNC000225Nic.



which is unambiguously Old World with the exception of the Hol-arctic species N. investigator.

The two other probability models available in Mesquite (theAsymmetrical 2-parameter Markov k-state model with user fixedrates set to equal, and the one-parameter Markov k-state model (Le-wis, 2001)) both estimate five or six dispersal events to the NewWorld and only three reverse events to the Old World. The node thatdiffers in these reconstructions is node D (Fig. 5) which these mod-els reconstruct as 64% Old World, making the species pair N. nigritaand N. mexicanus the result of a dispersal from Old World to New.

4. Discussion

Although the Bayesian phylogeny (Fig. 2) was relatively wellsupported, with few branches with posterior probabilities below

0.8 and most above 0.9, the maximum likelihood analysis (Fig. 3)was less so – with at least eight important branches with bootstrapvalues below 50%. It is well known that bootstrap values are a con-servative measure of support, more likely to reject true hypothesesthan are Bayesian posterior probabilities (Erixon et al., 2003), andthat Bayesian methods are less prone to depressed clade supportvalues due to clade size effects and homoplasy (Brandly et al.,2009). Nevertheless, these results suggest this phylogenetic prob-lem would likely benefit from more data. We present these twotrees as representing our preferred (Fig. 2) and a more conservative(Fig. 3) estimate of phylogeny. Bayesian analyses with too-simplemodels have been shown to be prone to yielding inaccurately highbranch support (Erixon et al., 2003; Huelsenbeck and Rannala,2004). However, the models and partitioning scheme we usedwere among the most complex available and thus less likely togenerate exaggerated branch support, increasing our confidencein these results.

A combined molecular with morphological analysis, that in-cludes all species and genera of the subfamily, is in preparation.The three weakly supported branches in Fig. 2 indicated with anasterisk, and the eight branches in the large polytomy of Fig. 3,are the most likely to change with the addition of new data andmore taxa. The inter-relationships within the nepalensis groupare also poorly resolved in this analysis. Work on this clade is inpreparation by T. Mousseau based on Mousseau (2011).

Only four of the 18 pre-1960 taxonomic assertions that wecould test were supported, while ten of the 15 testable post-1960 groupings were supported (Table 5). Of note, the generaNicrophorus Fabricius (1775) and Ptomascopus Kraatz (1876) werewell supported. Hope’s (1840) hypothesis that Nicrophorus heldtwo groups, one with bent tibia, that he suggested should bemoved into his new genus Cyrtoscelis, and one without, was notsupported. None of Hatch’s (1927, 1928) eight species groups weremonophyletic. This was not surprising. Hatch used superficial char-acters to group species such as size and lack of maculations. Porte-vin’s (1923) hypothesis that Nicrophorus carolinus is a lineageworthy of genus rank, which he named Necrocharis, was soundlyrejected by our analyses (Figs. 2 and 3). Earlier taxonomists of thisgroup have followed Portevin’s classification; Semenov-Tian-Shan-skij (1933) retained Necrocharis as a distinct genus, and Hatch(1928) retained the group as a subgenus. Peck and Anderson(1985) and Madge (unpublished) placed N. carolinus, tentatively,as the basal lineage of the marginatus group (sensu Peck and Ander-son, 1985), in a derived position well within the genus Nicrophorus.Our results support these more recent hypotheses for this species.The species is unusual, however. It is a long-branch taxon (Fig. 2)

Table 2Sequence for primers, and original authors of the primers used in this study.

Primer Alias Target Sequence (50 - 30) Source

TY-J-1460 – 50 COI TACAATTTATCGCCTAAACTTCAGCC Simon et al.(1994)

C1-N-2191 Nancy 30 COI CCCGGTAAAATTAAAATATAAACTTC ‘‘C1-J-1718 – 50 COI GGAGGATTTGGAAATTGATTAGTTCC ‘‘C1-N-2329 K525 30 COI ACTGTAAATATATGAGCTCA ‘‘TL2-N-3014 PAT 50

COIIAATATGGCAGATTAGTGCA ‘‘

A8-N-3914 – 30

COIITCATATTATTGGTGATATTTGAGG ‘‘

XX-N-3785 – 30

COIIGTTTAAGAGACCAGTAGTACTTG ‘‘

28SA1 – 50 D2-28S

GAGTTCAAGAGTACGTGAAACCG Whitinget al.(1997)*

28SA335 – 30 D2-28S

TCGGARGGAACCAGCTACTA ‘‘

F787 – 50

CAD-CPS

GGDGTNCANCANGCNTGYTTYGARCC MoultonandWeigmann(2004)

R1098 – 30

CAD-CPS

TTNGGNAGYTGNCCNCCCAT ‘‘

* Primers originally published by Whiting et al. (1997), later modified (to thesequences seen here) by Sequeira et al. (2000) for use on Coleoptera.

Table 3Ten partitioning strategies explored. All partitions were modeled using GTR + I + G.

Partitioningstrategy

Partition identity

P1 All data as one partitionP2 2 Partitions: (COI, COII, CAD) vs (tRNAs, D2-28S)P3a 3 Partitions: (COI, COII) vs (CAD) vs (tRNAs, D2-28S)P3b 3 Partitions: codon positions (1&2 of COI, COII, CAD) vs

(codon position 3 of COI, COII, CAD) vs (tRNAs, D2-28S)P4a 4 Partitions: (COI) vs (COII) vs (CAD) vs (tRNAs, D2-28S)P4b 4 Partitions: codon positions (1) vs (2) vs (3) of combined

COI, COII, CAD, vs (tRNAs, D2-28S)P5 5 Partitions: codon positions (1&2 of COI, COII) vs (cod pos 3

of COI, COII), vs (1&2 of CAD) vs (3 of CAD) vs (tRNAs, D2-28S)

P6 6 Partitions: codon positions (1&2 of COI, COII) vs (3 of COI,COII) vs (1 of CAD) vs (2 of CAD) vs (3 of CAD) vs (tRNAs, D2-28S)

P7 7 Partitions: codon positions (1 of COI, COII) vs (2 of COI,COII) vs (3 of COI, COII) vs (1 of CAD) vs (2 of CAD) vs (3 ofCAD) vs (tRNAs, D2-28S)

P10 10 Partitions: codon positions (1 of COI) vs (2 of COI) vs (3 ofCOI) vs (1 of COII) vs (2 of COII) vs (3 of COII) vs (1 of CAD) vs(2 of CAD) vs (3 of CAD) vs (tRNAs, D2-28S)

Table 4Harmonic means of marginal log-likelihood scores from each partitioning strategy.The difference in log-likelihood units is listed between the model of that row and themodel one row above. Effective sample sizes, as calculated by the program Tracer v1.5are listed in parentheses. Total values were obtained by simultaneous analysis of twopost burn-in samples using Tracer. Chosen model and analysis is in bold.

Partition Generations run1(ESS)

run2(ESS)

Combined Difference

P1 3M �45,835(398) �45,834(258) �45,834(615)P2 3M �45,482(732) �45,481(574) �45,481(1303) 353P3a 3M �44,820(485) �44,819(556) �44,819(1022) 662P3b 3M �44,195(754) �44,195(782) �44,195(1534) 624P4a 3M �44,805(768) �44,805(671) �44,805(1445)�610P4b 3M �43,960(477) �43,962(226) �43,961(704) 844P5 3M �43,413(21) �43,424(4) �43,419(12) 542P6 3M �43,178(373) �43,189(6) �43,183(16) 236P7 3M �43,017(550) �43,039(4) �43,028(6) 155p7 10M �43,036(4) �43,022(15) �43,029(10) �1P10 10M �42,961(8) �42,953(1021) �42,957(19) 72P10 10M �42,958(15) �42,956(21) �42,957(37) 0P10 100M �42,953(2387)�42,953(2790)�42,953(4617) 4



and prior analyses with only mtDNA data (not used in this study)suffered greatly from long-branch attraction (Sikes, 2003). Theaverage corrected 2nd codon position distance of N. carolinus fromany other Nicrophorus is almost five times greater than that of anyother species sampled. These results suggest that the number ofnonsynonymous nucleotide changes within the mtDNA of N.

carolinus is greater than that of other, closely related species. It alsohas unusual morphology of adults and larvae (Sikes, 2003). Preli-minary analyses showed it to be a rogue taxon that moved widelyamong tree samples thereby reducing branch support. We feel theBayesian placement, which corroborates other morphologicalstudies (Peck and Anderson, 1985; Sikes, 2003), is most likelycorrect.

We could not test many of Semenov-Tian-Shanskij’s (1933)hypotheses because they were monotypic subgenera withoutstatements of relationship within Nicrophorus. Of the five we couldtest, two were well supported. His genus Necroxenus, which at thetime was monotypic and contained only N. przewalskii Semenov-Tian-Shankij, 1894, was found to be the sister group to the remain-ing Nicrophorus. We choose to consider this lineage a subgenus ofNicrophorus rather than a sister genus because these beetles sharetraits associated with burial of small carcasses such as a fossoriallateral process on the protibia, large body size relative to Ptomasc-opus, and a compact antennal club. Both subgenera appear to be‘‘burying beetles.’’ Neither species of Necroxenus has been studiedalive so this hypothesis, based on morphology, awaits confirmationfrom behavioral observations.

Ronald Madge has been studying nicrophorine taxonomy sincehis MS thesis (Madge, 1958) and has prepared as yet unpublishedkeys and classifications of the world nicrophorine species – which,it should be noted, were prepared using observation of morphologyprior to the commencement of our studies. It is striking that usingthe same morphological methods available to Hatch, eight ofMadge’s ten non-monotypic species groups were well supportedin our analysis (Table 5). Among the two that were not monophy-letic were his humator species group, which includes two species,N. humator (Gleditsch, 1767) and N. sayi. Although we did not re-cover these two species as sisters in a monophyletic group, theyhad weak support as paraphyletic adjacent lineages at the baseof the nepalensis group (Fig. 2) and therefore we have tentativelydecided to retain this grouping despite its paraphyletic nature.The nepalensis group sensu Madge was rejected as paraphyletic be-cause he excluded N. kieticus Mroczkowski, 1959, from the groupwhile our analyses found strong support for N. kieticus as a mem-ber of the nepalensis group. It is not surprising that Madge excludedthis species from his nepalensis group because it lacks almost all ofthe morphological synapomorphies of the group (Mousseau, 2011).However, biogeography is in agreement with our findings. Nicro-phorus kieticus occurs in the Solomon Island Archipelago with othermembers of the nepalensis group. This group has radiated through-out the Malay and Melanesian Archipelagos to the exclusion of allother species groups, with the sole exception being N. distinctus onSulawesi (Sikes et al., 2006).

One recent taxonomic study, that of Khatchikov and Popov(2006), included a number of changes to the taxonomy of theNicrophorinae based on their study of male and female genitaliaand use of apparently pre-cladistic ‘‘evolutionary taxonomy’’ clas-sification methods. These authors synonymized N. interruptus as asubspecies under N. investigator, an action rejected and reversed bySikes et al. (2008) who found these species well separated phyloge-netically – a conclusion corroborated in the current study based onadditional data (Figs. 2 and 3). Additionally, they synonymized N.morio as a subspecies of N. germanicus. This is also rejected byour findings, which show the two lineages date to a speciationevent 23 to 7 Ma (Fig. 4). See Sikes et al. (2002) for a discussionof diagnostic characters separating these species and the lack ofevidence of intergradation between these species. Khatchikovand Popov (2006) also restored four subgenera to validity (Acant-hopsilus Portevin (1914) [N. concolor Kraatz, 1877], Necrocleptes[N. humator, N. tenuipes Lewis, 1887], Nicrophorus [presumably allremaining species and equivalent to an enlarged version ofSemenov-Tian-Shanskij’s (1933) Necropter]) and Neonicrophorus

Table 5Tests of prior taxonomic hypotheses within the Nicrophorinae, based on the Bayesiananalysis (Fig. 2) listed in chronological order. sg = informal species group, subg = sub-genus, g = genus, � = untested group due to monotypy. Groups that fail tests ofmonophyly are indicated with an asterisk if the group was found to be polyphyletic,and a + if paraphyletic. See Sikes (2003) for descriptions of Madge’s unpublishedspecies groups.

Hypothesis Citation Posteriorprobability

Nicrophorus g Fabricius (1775) 1.0Cyrtoscelis g Hope (1840) <0.0002⁄

Ptomascopus g Kraatz (1876) 1.0Acanthopsilus g Portevin (1914) <0.0002Necrocharis g Portevin (1923) <0.0002orbicollis sg Hatch (1928) <0.0002⁄

nepalensis sg Hatch (1928) <0.0002+humator sg Hatch (1928) <0.0002⁄

germanicus sg Hatch (1928) <0.0002⁄

vespilloides sg Hatch (1928) <0.0002⁄

pustulatus sg Hatch (1928) <0.0002+marginatus sg Hatch (1928) <0.0002⁄

vespillo sg Hatch (1928) <0.0002⁄

Necroxenus g Semenov-Tian-Shanskij(1933)

1.0

Eunecrophorus subg Semenov-Tian-Shanskij(1933)

–

Necrophoriscus subg Semenov-Tian-Shanskij(1933)

–

Necrocleptes subg Semenov-Tian-Shanskij(1933)

<0.0002⁄

Necrophorus subg Semenov-Tian-Shanskij(1933)

1.0

=Neonicrophorussubg

Hatch (1946)

Necrophorindus subg Semenov-Tian-Shanskij(1933)

–

Nesonecrophorussubg

Semenov-Tian-Shanskij(1933)

<0.0002+

Necropter subg Semenov-Tian-Shanskij(1933)

<0.0002+

Nesonecropter subg Semenov-Tian-Shanskij(1933)

–

Stictonecropter subg Semenov-Tian-Shanskij(1933)

–

orbicollis sg Peck and Anderson (1985) <0.0002⁄

defodiens sg Peck and Anderson (1985) <0.0002⁄

investigator sg Peck and Anderson (1985) 1.0marginatus sg Peck and Anderson (1985) 1.0distinctus sg Madge unpublished –americanus sg Madge unpublished –orbicollis sg Madge unpublished –concolor sg Madge unpublished –lunatus sg Madge unpublished –oberthuri sg Madge unpublished –chilensis sg Madge unpublished –quadraticollis sg Madge unpublished –kieticus sg Madge unpublished –humator sg Madge unpublished 0.06+nepalensis sg Madge unpublished <0.0002+didymus sg Madge unpublished 1.0vestigator sg Madge unpublished 0.69vespillo sg Madge unpublished 1.0germanicus sg Madge unpublished 1.0vespilloides sg Madge unpublished 0.96pustulatus sg Madge unpublished 1.0marginatus sg Madge unpublished 0.96investigator sg Madge unpublished 1.0Nicrophorus subg Khatchikov and Popov (2006) <0.0002+



[N. germanicus, N. morio, N. satanas Reitter, 1893], – the first isuntestable due to monotypy, the second is polyphyletic, and thethird is paraphyletic in our analysis (Fig. 2). Only Hatch’s (1946)Neonicrophorus, equivalent to our germanicus species group, ismonophyletic. However, we prefer informal species groups toadditional formal subgeneric names and return these names tosynonymy under Nicrophorus as listed in the catalog of Sikeset al. (2002).

Results of the relaxed molecular clock analysis suggest thegenus Nicrophorus originated in the Cretaceous between 127 and99 million years ago. This greatly predates the oldest fossils iden-tifiable to the genus Nicrophorus, of which there are six known col-lections. These date to Pliocene (Gersdorf, 1969) or younger strata,i.e. less than 5.3 Ma, with most less than 2.5 Ma (Coope and Angus,1975; Pearson, 1962; Pierce, 1949; Osborne, 1969). This suggeststhat either the molecular clock is overestimating the age of thegenus or older fossils of the genus, if present, have yet to be found.

Nicrophorus beetles specialize on small vertebrate carcasses,primarily rodents and birds. Although many of the major lineagesof rodents and birds were present during the Cretaceous, explosiveradiations of these small bodied vertebrates did not take place un-til 60–40 Ma (Fabre et al., 2012; Pacheco et al., 2011), coincidingwith much of the speciation in the genus Nicrophorus. These diver-gence date estimates can help us understand the group’s biogeo-graphic history.

Hatch (1927) proposed the more primitive members of thegenus Nicrophorus were Asian. Peck and Anderson (1985) sug-gested the genus Nicrophorus was Eurasian in origin because thegenus Ptomascopus is Asian and because more species of Nicropho-rus occur in Eurasia than in the New World. Our results stronglysupport this Asian origin hypothesis. The two species of the subge-nus Necroxenus occur in China and the basal-most species in thesubgenus Nicrophorus, N. distinctus, occurs on Sulawesi only. Addi-tionally, the monotypic, and presumed sister, genus to Nicrophorus,

Fig. 3. Phylogeny of subfamily Nicrophorinae inferred using maximum likelihood bootstrapping. 50% Majority rule consensus cladogram of 212 bootstrap replicate best treesfrom 10 parition GTR + I + G model in Garli 2.0 with default 2 searches per replicate.



Eonecrophorus Kurosawa, 1985, is known only from the holotypecollected on the eastern border of Nepal (Sikes, 2003).

Peck and Anderson’s (1985) cladistic analysis of the New Worldfauna resulted in four species groups and two unplaced species.They hypothesized at least six ancestral dispersal events fromthe Old World to the New, one for each of the four species groupsand two for each of the unplaced species. All but two of these weresuggested to have occurred during the late Cretaceous or early Ter-tiary. Although some of their species groups were rejected asimprobable (Table 5), this timing is in perfect accordance withour estimated divergence dates for most of the New World clades.Our reconstruction suggests the three oldest New World clades

date to 85–38 Ma with one younger dispersal event by N. investiga-tor occurring within the last 10 Ma (Fig. 4 and 5).

The oldest divergence for a New World species, that of N. sayi,85–60 Ma, is interesting because it may represent an example ofthe well studied eastern North American – East Asian disjunct pat-tern seen in plants (Gray, 1846; Li, 1952; Wen, 2001). Nicrophorussayi appears to be the sister lineage to the European species N. huma-tor + the large radiation of the Asian/Southeast Asian nepalensisgroup. In any case, given these estimated dates, dispersal betweenthe Old World and the New is a more likely explanation for Nicropho-rus in both hemispheres, than vicariance due to breakup of Laurasia,because Laurasia fragmented prior to 100 Ma (Scotese, 2004).

Fig. 4. Nicrophorinae chronogram dated using a Bayesian relaxed lognormal clock in BEAST with biogeographic ancestral character state reconstruction. Branches areproportional to time in millions of years (scale bar = 175 Ma–0 Ma). 95% highest posterior density intervals for the ages of nodes are indicated with blue bars. Circles marknodes calibrated by fossils. Black branches indicate Old World (OW) species, orange branches indicate New World (NW) species. Note that the two Holarctic species,N. vespilloides and N. investigator, are represented by Old World samples only but each represent additional (unmapped) transitions from Old World to New (see Fig. 5).



Given the weak branch support holding N. semenowi in place(Fig. 2) we suspect our reconstruction of four dispersal events fromthe Old to the New, rather than five events, is more probable. It ismore likely that the common ancestor of N. nigrita + N. mexicanusdid not disperse to the New World from the old, but rather

speciated within the New World from ancestors shared by N.tomentosus Weber, 1801, and N. hybridus Hatch and Angell, 1925.The clade holding N. semenowi with the remaining investigatorgroup, exclusive of N. nigrita + N. mexicanus, was found in almosta quarter (24%) of the posterior trees sampled.

Fig. 5. Biogeographic ancestral character state reconstruction using maximum likelihood. Black = New World, white = Old World, pie charts indicate proportional likelihoods.Topology from Fig. 4 with duplicate taxa removed and two branches added to represent both Old and New World populations of the Holarctic species N. investigator and N.vespilloides. Nodes A–D discussed in the text.



Peck and Anderson (1985) hypothesized that the two Holarcticspecies, N. vespilloides and N. investigator, were likely recent andindependent colonists of North America via the Bering Land Bridgeduring the Pleistocene. Our reconstruction agrees with this sce-nario for N. investigator but not for N. vespilloides. The latter specieswe inferred to have split from its sister, N. defodiens, much earlier�20 Ma (Fig. 4) and within the New World (Fig. 5). The Old Worldpopulation of N. vespilloides resulted from later dispersal from theNew to the Old rather than the reverse (Fig. 5). However, this prob-lem would benefit from a widespread phylogeographic analysis ofthese two species.

If our analyses are correct, then, contrary to Peck and Ander-son’s (1985) hypothesis of six colonization events, there were onlyfour colonizations of the New World from the Old. The four eventsbeing: three old colonizations 85–38 Ma and one Pleistocene colo-nization by the Holarctic species N. investigator. The Old World re-ceived three or four colonization from the New (Fig. 5), one ofwhich resulted in the majority of the investigator group species(most of which were unsampled in this study). The biogeographichistory of the investigator group was examined in greater detail bySikes et al. (2008) but remains complex and would benefit fromgreatly increased taxon and population sampling.

We hope that, although still tentative, the phylogeny of theNicrophorinae we present here, which includes 79% of the known,extant species of Nicrophorus, will prove useful to those studyingthese fascinating beetles.

Acknowledgments

We thank our collaborators on nicrophorine systematics: Ron-ald Madge, Alfred Newton, Tonya Mousseau, Stewart Peck, Jan Ru-zicka and Stephen Trumbo. Some of the DNA voucher specimenswere collected by a number of collaborators whom we heartilythank: W. Barries, A. Barsevskis, J. Beley, M. Brandley, R. Enser, J.Hajek, T. Hironaga, M.D. Hocking, C. Huerta, M. Kozlov, D. Kral, G.Marrone, M. Nagano, P. Naskrecki, M. Nishikawa, S.B. Peck, C. Rai-thel, J. Rom, J. Ruzicka, A. Seago, J. Smiley, R. Smith, S. Suzuki, N.Wood, and J. Valcarcel. We thank Susanne Dobler for providing se-quences of Ptomaphila lacrymosa. Expeditions to Nepal, Japan, andIndonesia were wonderfully successful thanks to the generosityand assistance of D. Manandhar (Nepal), M. Bos (Indonesia), andM. Kon, S. Suzuki, M. Ôhara, T. Nisimura, M. Maruyama, and M.Nagano (Japan). The data for the map in Fig. 1 were derived frommany generous loans of specimens from museums around theworld. We list these depositories in the specimen datafile andReadMe file archived in the Dryad repository (http://dx.doi.org/10.5061/dryad.mr221) and graciously thank the curators who as-sisted with these loans. We also thank Melissa, Kaley, Nina, andAmelia Sikes for their assistance in collecting samples for thisstudy. Lab work, both databasing and molecular, was assisted byL. Carubia, S. Luider, M. Ricketts, C. Simon, E. Wong, and M. Yu. Ear-lier versions of the ms were improved by feedback from, P. Lewis,A. Russell, C. Schaefer, C. Simon, and D. Wagner. This project wassupported in part by an MCZ Ernst Mayr grant, and a NSERC Dis-covery grant to D.S.S., in addition to a National Science FoundationGrant (DEB-9981381), a University of Connecticut Research Coun-cil grant, and a National Geographic Society grant to S. T. Trumbo.

References

Anderson, R.S., 1982. Resource partitioning in the carrion beetle (Coleoptera:Silphidae) fauna of southern Ontario: ecological and evolutionaryconsiderations. Can. J. Zool. 60, 1314–1325.

Anderson, R.S., Peck, S.B. 1985. The Carrion Beetles of Canada and Alaska(Coleoptera: Silphidae and Agyrtidae). The Insects and Arachnids of Canada,Part 13. Publication 1778, Research Branch Agriculture Canada, Ottawa. p. 121.

Anduaga, S., 2009. Reproductive biology of Nicrophorus mexicanus Matthews(Coleoptera: Silphidae). Coleopt. Bull. 63 (2), 173–178.

Arce, A.N., Johnston, P.R., Smiseth, P.T., Rozen, D.E., 2012. Mechanisms and fitnesseffects of antibacterial defences in a carrion beetle. J. Evol. Bio. 25 (5), 930–937.

Bedick, J.C., Ratcliffe, B.C., Hoback, W.W., Higley, L.G., 1999. Distribution, ecologyand population dynamics of the American Burying Beetle Nicrophorusamericanus Olivier (Coleoptera: Silphidae) in south-central Nebraska. J. Ins.Cons. 3 (3), 171–181.

Boncoraglio, G., Kilner, R.M., 2012. Female burying beetles benefit from maledesertion: sexual conflict and counter-adaptation over parental investment.PLoS ONE 7(2), e31713; p. 4. doi: 10.1371/journal.pone.0031713.

Brandly, M.C., Warren, D.L., Leache, A.D., McGuire, J.A., 2009. Homoplasy and cladesupport. Syst. Biol. 58, 184–198.

Cai, C.-Y., Thayer, M.K., Engel, M.S., Newton, A.F., Ortega-Blanco, J., Wang, B., Wang,X.-D., Huang. D.-Y., in preparation. Early origin of parental care in Mesozoiccarrion beetles.

Cho, Y.B., Park, H.C., Lee, C.E., 1988. A cladistic analysis of genus Necrophorus(Coleoptera: Silphidae). Nature and Life (Kyungpook J. Bio. Sci.) 18(1), 9–13.

Coope, G.R., Angus, R.B., 1975. An ecological study of a temperate interlude in themiddle of the last glaciation, based on fossil Coleoptera from Isleworth,Middlesex. J. Anim. Ecol. 44 (2), 365–391.

Dobler, S., Müller, J.K., 2000. Resolving phylogeny at the family level byMitochondrial Cytochrome Oxidase sequences: Phylogeny of carrion beetles(Coleoptera: Silphidae). Mol. Phylogenet. Evol. 15 (3), 390–402.

Drummond, A.J., Suchard, M.A., Xie, D., Rambaut, A., 2012. Bayesian phylogeneticswith BEAUti and the BEAST 1.7. Mol. Bio. Evol. doi: 10.1093/molbev/mss075.

Eggert, A.-K., Müller, J.K., 1997. Biparental care and social evolution in buryingbeetles: Lessons from the larder. In: Choe, J.C., Crespi B.J. (Eds.), Social Behaviorin Insects and Arachnids. Cambridge University Press, Cambridge, New York &Oakleigh, v–xiii, 1–541, pp. 216–236.

Erixon, P., Svennblad, B., Britton, T., Oxelman, B., 2003. Reliability of Bayesianposterior probabilities and bootstrap frequencies in phylogenetics. Syst. Biol.52, 665–673.

Fabre, P.-H., Hautier, L., Dimitrov, D., Douzery, E.J.P., 2012. A glimpse on the patternof rodent diversification: a phylogenetic approach. BMS Evolutionary Biology12, 88 <http://www.biomedcentral.com/1471-2148/12/88>.

Fabricius, J.C., 1775. Systema entomologiae, sistens insectorum classes, ordines,genera, species, adiectis synonymis, locis, descriptionibus, observationibus.Libraria Kortii, Flensburgi et Lipsiae. 30 + 832pp.

Flach, C., 1890. Ueber zwei fossile Silphiden (Coleoptera) aus den Phosphoriten vonCaylux. Dtsch. Entomol. Z. 1890, 105–109.

Gelman, A., Rubin, D.B., 1992a. Inference from iterative simulation using multiplesequences. Stat. Sci. 7, 457–472.

Gelman, A., Rubin, D.B., 1992b. A single sequence from the Gibbs sampler gives afalse sense of security. In: Bernardo, J.M., Berger, J.O., Dawid, A.P., Smith, A.F.M.(Eds.), Bayesian Statistics, vol. 4. Oxford University Press, Oxford, pp. 625–631.

Gersdorf, E., 1969. Käfer (Coleoptera) aus dem Jungtertiär Norddeutschlands. Geol.Jahrb. 87, 295–331.

Gray, A., 1846. Analogy between the flora of Japan and that of the United States. Am.J. Sci. Arts. 2, 135–136.

Grebennikov, V.V., Newton, A.F., 2012. Detecting the basal dichotomies in themonophylum of carrion and rove beetles (Insecta: Coleoptera: Silphidae andStaphylinidae) with emphasis on the Oxyteline group of subfamilies. Arthr. Syst.Phylo. 70, 133–165.

Hatch, M.H., 1927. Studies on the Silphinae. J. N. Y. Ent. Soc. 35, 331–370.Hatch, M.H., 1928. Silphidae II. In: Schenkling, S. (Ed.), Coleopterorum Catalogus,

Pars 95. W. Junk, Berlin. pp. 63–244.Hatch, M.H., 1946. Mr. Ross H. Arnett’s ‘‘Revision of the Nearctic Silphini and

Nicrophorini’’. J. N. Y. Ent. Soc. 54, 99–103.Heinrich, B., 2012. A heretofore unreported instant color change in a beetle,

Nicrophorus tomentosus Weber (Coleoptera: Silphidae). Northeast. Nat. 19 (2),345–352.

Hocking, M.D., Darimont, C.T., Christie, K.S., Reimchen, T.E., 2007. Niche variation inburying beetles (Nicrophorus spp.) associated with marine and terrestrialcarrion. Can. J. Zool. 85 (3), 437–442.

Holloway, A.K., Schnell, G.D., 1997. Relationship between numbers of theendangered American burying beetle Nicrophorus americanus Olivier(Coleoptera: Silphidae) and available food resources. Biol. Conserv. 81 (1–2),145–152.

Hope, F.W., 1840. The Coleopterist’s Manual, Part the Third, containing variousFamilies, Genera, and Species of Beetles, recorded by Linnaeus and Fabricius.Also, Descriptions of Newly Discovered and Unpublished Insects. J. C.Bridgewater, and Bowdery and Kerby, London. p. 191, pls. 1–3.

Huang, D., Nel, A., Shen, Y.-B., Selden, P.A., Lin, Q.-B., 2006. Discussions on the age ofthe Daohugou fauna – evidence from invertebrates. Prog. Nat. Sci. 16 (13), 308–312.

Huelsenbeck, J., Rannala, B., 2004. Frequentist properties of Bayesian posteriorprobabilities of phylogenetic trees under simple and complex substitutionmodels. Syst. Biol. 53, 904–913.

Hwang, W., Shiao, S.-F., 2011. Dormancy and the influence of photoperiod andtemperature on sexual maturity in Nicrophorus nepalensis (Coleoptera:Silphidae). Insect Sci. 18 (2), 225–233.

Ikeda, H., Kubota, K., Kagaya, T., Abe, T., 2006. Niche differentiation of buryingbeetles (Coleoptera: Silphidae: Nicrophorinae) in carcass use in relation to bodysize: estimation from stable isotope analysis. Appl. Entomol. Zool. 41 (4), 561–564.



Kass, R.E., Rafterty, A.E., 1995. BayesFactors. J. Am. Stat. Assoc. 90 (430), 773–795.Khatchikov, E.A., Popov, D.S., 2006. New data on morphology and taxonomy of some

species of the genus Nicrophorus Fabricius, 1775 (Coleoptera: Silphidae).Caucasian Entomol. Bull. 2 (1), 27–40.

Kishida, R., Suzuki, N., 2010. Effect of carcass size on feeding modes of larvae ofNicrophorus quadripunctatus Kraatz (Coleoptera: Silphidae). Psyche 2010(Article ID 206318), 1–5. doi: 10.1155/2010/206318.

Knee, W., Beaulieu, F., Skevington, J.H., Kelso, S., Forbes, M.R., 2012. Cryptic speciesof mites (Uropodoidea: Uroobovella spp.) associated with burying beetles(Silphidae: Nicrophorus): The collapse of a host generalist revealed by molecularand morphological analyses. Mol. Phylogenet. Evol. 65 (1), 276–286.

Kraatz, G., 1876. Uebersicht über die südamerikanischen Arten der Silphiden-Gattung Hyponecrodes Kraatz. Dtsch. Entomol. Z. 20, 375–376.

Leasure, D.R., Rupe, D.M., Phillips, E.A., Opine, D.R., Huxel, G.R., 2012. Efficient newabove-ground bucket traps produce comparable data to that of standardtransects for the endangered American burying beetle, Nicrophorus americanusOlivier (Coleoptera: Silphidae). Coleopt. Bull. 66 (3), 209–218.

Lewis, P.O., 2001. A likelihood approach to estimating phylogeny from discretemorphological character data. Syst. Biol. 50, 913–925. http://dx.doi.org/10.1080/106351501753462876.

Li, H.-L., 1952. Floristic relationships between Eastern Asia and eastern NorthAmerica. Trans. Am. Philos. Soc. 42, 371–429.

Liu, H., Beckenbach, A.T., 1992. Evolution of the mitochondrial cytochrome oxidaseII gene among 10 orders of insects. Mol. Phylogenet. Evol. 1, 41–52. http://dx.doi.org/10.1016/1055-7903(92) 90034-E.

Lomolino, M.V., Creighton, J.C., Schnell, G.D., Certain, D.L., 1995. Ecology andconservation of the endangered American burying beetle (Nicrophorusamericanus). Conserv. Biol. 9 (3), 605–614.

Lunt, D.H., Zhang, D.-X., Szymura, J.M., Hewitt, G.M., 1996. The insect cytochromeoxidase I gene: evolutionary patterns and conserved primers for phylogeneticstudies. Insect Mol. Biol. 5, 153–165.

Maddison, W.P., Maddison, D.R., 2011. Mesquite: a Modular System forEvolutionary Analysis. Version 2.75 <http://mesquiteproject.org.>.

Madge, R.B., 1958. A taxonomic study of the genus Necrophorus in America north ofMexico (Coleoptera, Silphidae). M.S. Thesis, University of Illinois, Urbana,Illinois. iii + 77pp, 7 pls.

Miller, R.E., Buckley, T.R., Manos, P.S., 2002. An examination of the monophyly ofmorning glory taxa using Bayesian phylogenetic inference. Syst. Biol. 51 (5),740–7533.

Moulton, J.K., Wiegmann, B.M., 2004. Evolution and phylogenetic utility of CAD(rudimentary) among Mesozoic- aged Eremoneuran diptera (Insecta). Mol. Phyl.Evol. 31, 363–378.

Mousseau, T., 2011. Systematics and biogeography of the nepalensis species group(Nicrophorus: Silphidae: Coleoptera) of Southeast Asia. Ph.D. Dissertation.University of Calgary. p. 347.

Mousseau, T., Sikes, D.S., 2011. Almost but not quite a subspecies: a case of geneticbut not morphological diagnosibility in Nicrophorus (Coleoptera: Silphidae).Biol. J. Linn. Soc. 102, 311–333. http://dx.doi.org/10.1111/j.1095-8312.2010.01568.x.

Nisimura, T., Numata, H., Yoshioka, E., 2005. Effect of temperature on circadianrhythm controlling the crepuscular activity of the burying beetle Nicrophorusquadripunctatus Kraatz (Coleoptera: Silphidae). Ent. Sci. 8 (4), 331–338.

Nylander, J.A.A., 2004. MrModeltest v2. Program distributed by the author.Evolutionary Biology Centre, Uppsala University.

Osborne, P.J., 1969. An insect fauna of late Bronze Age date from Wilsford, Wiltshire.J. Anim. Ecol. 38 (3), 555–566.

Pacheco, M.A., Battistuzzi, F.U., Lentino, M., Aguilar, R.F., Kumar, S., Escalante, A.A.,2011. Evolution of modern birds revealed by mitogenomics: Timing theradiation and origin of major orders. Mol. Biol. Evol. 28(6), 1927–1942. doi:10.1093/molbev/msr014.

Palestrini, C., Barbero, E., Luzzatto, M., Zucchelli, M., 1996. Nicrophorus mexicanus(Coleoptera: Silphidae: Nicrophorinae): larval morphology and phylogeneticconsiderations on the N. investigator group. Acta Soc. Zool. Bohemos. 60, 435–445.

Pearson, R.G., 1962. The Coleoptera from a late-glacial deposit at St. Bees, WestCumberland. J. Anim. Ecol. 31 (1), 129–150.

Peck, S.B., Anderson, R.S., 1985. Taxonomy, phylogeny and biogeography of thecarrion beetles of Latin America (Coleoptera: Silphidae). Quaest. Entomol. 21,247–317.

Pierce, W.D., 1949. Fossil arthropods of California, 17. The silphid burying beetles inthe asphalt deposits. Bull. S. Cal. Acad. Sci. 48, 55–70.

Portevin, G., 1914. Révision des silphides, liodides et clambides du japon. Annal. Soc.Ent. Belg. 58, 212–236.

Portevin, G., 1923. Revision des Necrophorini du globe. Bull. Mus. Nat. d’Hist. Nat.29, 64–71, 141–146, 226–233, 303–309.

Portevin, G., 1926. Les Grands Nécrophages du Globe. Silphini – Necrodini –Necrophorini. Encyclopédie Entomologique (A), vol. 6, Lechevalier, Paris, 270p.

Pukowski, E., 1933. Ökologische Untersuchungen an Necrophorus. F. Z. Ökol. Morph.Tier. 27, 518–586.

Rambaut, A., Drummond, A.J., 2003. Tracer v1.5. <http://tree.bio.ed.ac.uk/software/tracer/> (accessed April 2013).

Ratcliffe, B.C., 1996. The carrion beetles (Coleoptera: Silphidae) of Nebraska. Bull. U.Nebr. St. Mus. 13, 1–100.

Ronquist, F., Huelsenbeck, J.P., 2003. Mrbayes 3: Bayesian phylogenetic inferenceunder mixed models. Bioinformatics 19, 1572–1574.

Ruzicka, J., 1992. The immature stages of central European species of Nicrophorus(Coleoptera, Silphidae). Acta Entomol. Bohemos. 89 (2), 113–135.

Scotese, C.R., 2004. Cenozoic and Mesozoic paleogeography: Changing terrestrialbiogeographic pathways. In: Lomolino, M.V., Heaney, L.R. (Eds.), Frontiers ofBiogeography, New Directions in the Geography of Nature. Sinauer Assoc. Inc. xi+ 436, pp. 9–20.

Scott, M.P., 1998. The ecology and behavior of burying beetles. Ann. Rev. Entomol.43, 595–618.

Semenov-Tian-Shanskij, A., 1933. De tribu Necrophorini (Coleoptera, Silphidae)classificanda et de ejus distributione geographica. Trudy Zoolog. Inst. Akad.Nauk SSSR 1, 149–160.

Sequeira, A.S., Normark, B.B., Farrell, B.D., 2000. Evolutionary assembly of theconifer fauna: distinguishing ancient from recent associations in bark beetles.Proc. Roy. Soc. L. (B) 267, 2359–2366.

Sikes, D.S., 2003. Systematic revision of the subfamily Nicrophorinae (Coleoptera:Silphidae). Ph.D. Dissertation, University of Connecticut. xxiv + 938pp.

Sikes, D.S., 2005. Silphidae. In: Kristensen, N.P., Beutel, R.G. (Eds.), Handbook ofZoology, Volume IV Arthropoda: Insecta Part 38 (), Coleoptera, Beetles VolumeI: Morphology and Systematics (Archostemmata, Adephaga, Myxophaga,Polyphaga partim). Waler de Gruyter, Berlin, New York xi + 567pp, pp. 288–296.

Sikes, D.S., 2008. Carrion Beetles (Coleoptera: Silphidae). Capinera, J.L. (Ed.)Encyclopedia of Entomology, second ed. Springer Press, pp 749–758.

Sikes, D.S., Mousseau, T., 2013. Description of Nicrophorus efferens, new species,from Bougainville Island (Coleoptera, Silphidae, Nicrophorinae). ZooKeys 311:83-93.

Sikes, D.S., Peck, S.B., 2000. Description of Nicrophorus hispaniola, new species, fromHispaniola (Coleoptera: Silphidae) and a key to the species of Nicrophorus of theNew World. Ann. Entomol. Soc. Am. 93, 391–397. <http://dx.doi.org/10.1603/0013-8746(2000)093[0391:DONHNS]2.0.CO;2>.

Sikes, D.S., Raithel, C., 2002. A review of hypotheses of decline of the endangeredAmerican burying beetle (Silphidae: Nicrophorus americanus Olivier). J. InsectConserv. 6, 103–113.

Sikes, D.S., Madge, R.B., Newton, A.F., 2002. A catalog of the Nicrophorinae(Coleoptera: Silphidae) of the world. Zootaxa 65, 1–304.

Sikes, D.S., Madge, R.B., Trumbo, S.T., 2006. Revision of Nicrophorus in part: Newspecies and inferred phylogeny of the nepalensis group based on evidence frommorphology and mitochondrial DNA (Coleoptera: Silphidae: Nicrophorinae).Invert. Syst. 20, 305–365.

Sikes, D.S., Vamosi, S.M., Trumbo, S.T., Ricketts, M., Venables, C., 2008. Molecularsystematics and biogeography of Nicrophorus in part – the investigator speciesgroup (Coleoptera: Silphidae) using mixture model MCMC. Mol. Phylogenet.Evol. 48, 646–666. http://dx.doi.org/10.1016/j.ympev.2008.04.034.

Simon, C., Frati F., Beckenbach, A., Crespi, B., Liu, H., Flook, P. 1994. Evolution,weighting and phylogenetic utility of Mitochondrial gene sequences and acompilation of conserved polymerase chain reaction primers. Ann. Entomol. Soc.Am. 87: 651-701.

Smith, G., Trumbo, S.T., Sikes, D.S., Scott, M.P., Smith, R.L., 2007. Host shift by theburying beetle, Nicrophorus pustulatus, a parasitoid of snake eggs. J. Evol. Biol. 20(6), 2389–2399.

Swisher III C.C., Wang, Y.-Q., Wang, X.-L., Xu, X., Wang, Y., 1999. Cretaceous age forthe feathered dinosaurs of Liaoning, China. Nature 400, 58–61.

Swofford, D.L., 2001. PAUP⁄. Phylogenetic Analysis Using Parsimony (⁄and OtherMethods), version 4. Sinauer, Sunderland, Massachusetts.

Szalanski, A.L., Sikes, D.S., Bischof, R., Fritz, M., 2000. Population genetics andphylogenetics of the endangered American burying beetle, Nicrophorusamericanus (Coleoptera: Silphidae). Ann. Entomol. Soc. Am. 93 (3), 589–594.

Thayer, M., Cai C., Pardo, F., 2011. Fossil carrion feeders. Field Museum of NaturalHistory, Chicago. Video only. <http://fieldmuseum.org/explore/multimedia/video-fossil-carrion-feeders>; online and downloadable in multiple formatsfrom Vimeo: <http://www.vimeo.com/27216645> (both accessed 11 April2013).

Trumbo, S.T., Robinson, G.E., 2008. Social and nonsocial stimuli and juvenilehormone titer in a male burying beetle. Nicrophorus orbicollis. J. Insect Phys. 54(3), 630–635.

Venables, C., 2007. Do molecular data support a rapid radiation of the genusNicrophorus (Coleoptera: Silphidae)? MSc Thesis, University of Calgary. xiv +144.

Wen, J., 2001. Evolution of Eastern Asian–Eastern North American biogeographicdisjunctions: a few additional issues. Int. J. Plant Sci. 162 (S6), S117–S122.

Whiting, M.F., Carpenter, J.C., Wheeler, Q.D., Wheeler, W.C., 1997. The Strepsipteraproblem: phylogeny of the holometabolous insect orders inferred from 18S and28S ribosomal DNA sequences and morphology. Syst. Biol. 46, 1–68.

Zwickl, D.J., 2006. Genetic algorithm approaches for the phylogenetic analysis oflarge biological sequence datasets under the maximum likelihood criterion.Ph.D. dissertation. The University of Texas at Austin. <http://garli.googlecode.com>.


Documents

Molecular phylogeny of the burying beetles (Coleoptera: Silphidae: Nicrophorinae)