Prevention and Treatment of Colitis With Lactococcus lactis Secreting the Immunomodulatory Yersinia LcrV Protein

B

Pt

BB

*a

B(ghtatfLsptc[tadlpLotcIttpainnpvd

Cmti

BA

SIC–

ALIM

ENTA

RY

TRA

CT

GASTROENTEROLOGY 2007;133:862–874

ASIC–ALIMENTARY TRACT

revention and Treatment of Colitis With Lactococcus lactis Secretinghe Immunomodulatory Yersinia LcrV Protein

ENOIT FOLIGNE,*,‡ RODRIGUE DESSEIN,‡ MICHAEL MARCEAU,‡ SABINE POIRET,* MATHIAS CHAMAILLARD,§

RUNO POT,* MICHEL SIMONET,‡ and CATHERINE DANIEL*‡
Laboratoire des Bactéries Lactiques et Immunité des Muqueuses, Institut Pasteur de Lille, Lille; INSERM Unité 801-Université de Lille II-Institut Pasteur de Lille, Lille;
nd §INSERM Unité 795, Lille, France

sbpalaptot

eiHsncaTasOi(as(hpd

Ecclspf

ackground & Aims: The low calcium response VLcrV) protein synthesized by gram-negative, patho-enic yersiniae participates in bacterial evasion of theost’s innate immune response by stimulating syn-

hesis of the anti-inflammatory interleukin (IL)-10nd preventing the activation of proinflammatory cy-okines. Methods: We genetically engineered theood-grade bacterium Lactococcus lactis to secrete thecrV protein from the enteropathogenic species Yer-

inia pseudotuberculosis. The protective and therapeuticotential of orally administered LcrV-secreting L lac-

is was evaluated in 2 models of acute experimentalolitis (induced by trinitrobenzene sulfonic acidTNBS] and dextran sodium sulfate [DSS], respec-ively) in wild-type and knockout mice. Results: Oraldministration of LcrV-secreting L lactis led to activeelivery of LcrV and induction of IL-10 (via a Toll-

ike receptor 2– dependent pathway) in the colon andrevented TNBS-induced colitis, in contrast to thelactis control not producing LcrV. Down-regulation

f tissue inflammatory markers correlated well withhe reduction in damage to the colonic mucosa. Inontrast, TNBS-induced colitis was not prevented inL-10�/� mice pretreated with LcrV-secreting L lactis,hus showing that IL-10 is required for LcrV protec-ion. Administration of LcrV-secreting L lactis alsoroved to be very effective in preventing and treatingcute DSS-induced colitis. Conclusions: LcrV-secret-ng L lactis decreased experimentally induced intesti-al inflammation in 2 murine models of colitis. Thisovel approach highlights the potential of usingathogen-derived immunomodulating molecules inivo as novel therapeutics for inflammatory boweliseases.

hronic inflammatory bowel diseases (includingCrohn’s disease and ulcerative colitis) have become a

ajor public health concern in Western countries.1,2 Al-hough the etiology of these conditions remains unclear,
t is believed that dysregulation of the immune respon-
iveness of the intestinal mucosa to commensal entericacteria plays an important role in the induction anderpetuation of digestive tract inflammation. Reductionnd prevention of mucosal inflammation by aminosalicy-ates, corticosteroids, immunosuppressive compounds,nd antibiotics are the primary goals in the treatment ofatients with inflammatory bowel disease; however, givenhat the aforementioned therapeutic agents fail to inducer maintain illness remission in about 30% of all pa-ients,2,3 there is a need for new anti-inflammatory drugs.

The coevolution of humans and infectious agents hasxerted selective pressure on the immune system so thatt maintains its control over potentially lethal infections.

owever, microbial pathogens have developed varioustrategies for modulating and/or circumventing host in-ate and adaptive immune responses. This suggests thatertain virulence factors can be viewed as potential ther-peutic agents against human inflammatory diseases.4 –10

his is especially true for enteropathogenic yersiniae thatre able to evade the host innate immune response, ashown by the pioneering work of Brubaker’s group.11,12

ne of the bacterial components involved in this inhib-tory effect is a soluble 37-kilodalton protein termed LcrVlow calcium response V antigen, reviewed by Brubaker13

nd Heesemann et al14). LcrV injection in mice inhibitsynthesis of proinflammatory tumor necrosis factorTNF)-� and the interferon gamma cytokine and en-ances anti-inflammatory interleukin (IL)-10 cytokineroduction in the spleen following infection with LcrV-eficient Yersinia pestis. Recent studies have shown that

Abbreviations used in this paper: DSS, dextran sodium sulfate;LISA, enzyme-linked immunosorbent assay; IL, interleukin; LcrV, lowalcium response V antigen; Ll, Lactococcus lactis; Ll-IL-10, Lactococ-us lactis strain secreting murine interleukin-10; Ll-LcrV, Lactococcusactis strain secreting low calcium response V antigen; LPS, lipopoly-accharide; PCR, polymerase chain reaction; SAA, serum amyloidrotein A; TNBS, trinitrobenzene sulfonic acid; TNF, tumor necrosisactor; Yop, Yersinia outer protein.

© 2007 by the AGA Institute0016-5085/07/$32.00

doi:10.1053/j.gastro.2007.06.018

Lw

eawcig2taroactwcaweisip

EL

lDcls�s

cDsTApLvstiidcTqoit

pttrsCAlSvHpt

tCtpcstu(

T

S

P

C

BA

SIC–

ALI

MEN

TARY

TRA

CT

September 2007 YERSINIA LcrV PREVENTS AND TREATS COLITIS 863

crV acts through the Toll-like receptor 2 signaling path-ay to stimulate IL-10 synthesis in macrophages.15–17

In the present study, we hypothesized that LcrV deliv-red to the intestinal mucosa could protect the tissuegainst an inflammatory process. To test this hypothesis,e genetically engineered a food-grade strain of Lactococ-

us lactis (a nonpathogenic, noninvasive, and noncoloniz-ng gram-positive bacterium) to produce the heterolo-ous Yersinia pseudotuberculosis LcrV protein. We then usedmurine models of acute colitis to assess the ability of

he orally administered recombinant strain to preventnd treat mucosal inflammation caused by either intra-ectal instillation of trinitrobenzene sulfonic acid (TNBS)r administration of dextran sulfate sodium (DSS) in thenimals’ drinking water. The TNBS hapten induces acuteolitis displaying Crohn’s disease–like features, notablyransmural inflammatory cellular infiltration associatedith a Th1-dominated cytokine profile.18 DSS-induced

olitis is an extensively studied model for murine ulcer-tive colitis, which causes injury to the base of the cryptsith subsequent inflammation, apoptosis, and ultimately

pithelial ulceration.19,20 Inasmuch as the LcrV proteinnduces anti-inflammatory IL-10 biogenesis, we also con-tructed an IL-10 –secreting lactococcal strain to concom-tantly compare its protective effect with that of LcrV-roducing L lactis.

Materials and MethodsBacterial Strains, Plasmids, and GrowthConditionsBacterial strains and plasmids are listed in Table 1.

scherichia coli and Y pseudotuberculosis were cultured inuria–Bertani broth at optimal growth temperatures. L

able 1. Bacterial Strains and Plasmids

Strains and plasmids Relevant characteristics Source

trainsL lactis MG1363 (Ll) L lactis subsp cremoris,

plasmid-freeWells et al22

E coli MC1061 Cloning host Sambrook et al23

Y pseudotuberculosisIP32777

Template for lcrVamplification

Sebbane et al56

lasmidspZero-2 Cloning vector InvitrogenpNZYR L lactis pSH71 replicon,

allows translationalfusion to the usp45signal sequencedownstream of theusp45 promoter, Cmr

Daniel et al57

pMEC237 lcrV gene fused tousp45 signalsequence in pNZYR

This study

pMEC243 mIL-10 (murine) fusedto usp45 signalsequence in pNZYR

This study

gmr, chloramphenicol resistance.

actis was grown at 30°C in M17 medium (Difco; Bectonickinson, Sparks, MD) supplemented with 0.5% of glu-

ose. Chloramphenicol (Sigma-Aldrich, St Quentin Fal-avier, France) was added to culture media for bacterialelection when necessary, at a final concentration of 20g/mL for Escherichia coli and 10 �g/mL for L lactis

trains.

Plasmid ConstructionTo generate plasmid pMEC237, a polymerase

hain reaction (PCR) was performed on total genomicNA from Y pseudotuberculosis strain 32777 using the

pecific OMEC268 (5=CAGTTGACATGATTAGAGCC-ACGAAC3=) sense primer and OMEC269 (5=CCC-AGCTTTCATTTACCAGACGTGTCATC3=) antisenserimer, which hybridize with the 5= and 3= ends of thecrV-encoding region, respectively. The forward and re-erse primers contained HincII and HindIII restrictionites, respectively (underlined in the previously men-ioned sequences). The resulting amplicon was subclonednto the pZero-2 plasmid, and the construction was ver-fied by DNA sequencing. Subsequently, the insert wasigested with the HincII/HindIII endonucleases and sub-loned into the HincII/HindIII-digested plasmid pNZYR.he resulting construct (bearing the LcrV-coding se-uence fused to the Usp45 secretion signal downstreamf the lactococcal Usp45 promoter21) was subsequently

ntroduced into L lactis MG1363 by electrotransforma-ion, as described elsewhere.22

A similar strategy was used to construct plasmidMEC243. Mature murine IL-10 – encoding complemen-ary DNA (cDNA) was generated and amplified fromotal RNA isolated from stimulated murine bone mar-ow–derived dendritic cells, using reverse PCR with thepecific OMEC286 (5=GCGTCGACAGCAGGGGCCAGTA-AGC3=) sense primer and OMEC287 (5=CCCAAGCTTGCTTTTCATTTTGATC3=) antisense primer. Molecu-

ar biology procedures were performed as described byambrook et al.23 L lactis MG1363 containing the emptyector pNZYR (referred to as “Ll”) served as a control.ence, lactococcal strains harboring pMEC237 andMEC243 were designated Ll-LcrV and Ll-IL-10, respec-ively.

Protein Separation and ImmunoblottingBacterial culture supernatants were filtered

hrough 0.22-�m Millex HA membranes (Millipore,ork, Ireland), and proteins were precipitated with 100%

richloracetic acid. After washing with ice-cold ethanol,ellets were solubilized in Laemmli buffer with �-mer-aptoethanol. Proteins were separated by sodium dodecylulfate/polyacrylamide gel electrophoresis and electro-ransferred to nitrocellulose blots. LcrV was detected bysing a mouse monoclonal specific anti-LcrV antibody

1:50,000)24 and then a horseradish peroxidase– conju-
ated rabbit anti-mouse immunoglobulin G (1:100,000;

SSRat

Dmwdpjwth1

tPrR5vf2bhcew1pLa

Ifapntm(rp

b

dAi5sCmiimtllSTTcpGacnqp

(lSCtbqtp

iNwHuCGdrCTNAm5

BA

SIC–

ALIM

ENTA

RY

TRA

CT

864 FOLIGNE ET AL GASTROENTEROLOGY Vol. 133, No. 3

igma-Aldrich). Immune complexes were revealed usinguperSignal West Pico Chemiluminescent Substrate (Pierce,ockford, IL). Purified recombinant Y pestis LcrV25 was useds a reference for quantifying lactococcal LcrV produc-ion.

LcrV QuantificationMicrotiter plates (Nunc-Immuno Plate, Roskilde,

enmark) were coated with a specific mouse anti-LcrVonoclonal antibody (1:10,000) and thereafter incubatedith increasing concentrations of purified LcrV or serialilutions of crude L lactis supernatants. Rabbit anti-LcrVolyclonal serum26 (1:10,000) and then peroxidase-con-

ugated goat anti-rabbit immunoglobulin G (1:50,000)ere used for detection. For quantification of LcrV secre-

ion in vivo, the entire mouse colon (9 cm long) wasomogenized in phosphate-buffered saline containing% bovine serum albumin and then sonicated.

Macrophage CulturePeritoneal cells were collected by washing the peri-

oneal cavity with ice-cold RPMI 1640 (Life Technologies,aisley, Scotland). After centrifugation, pelleted cells wereesuspended at a final concentration of 2 � 106/mL inPMI 1640 supplemented with 2 mmol/L L-glutamine,0 �mol/L �-mercaptoethanol, 1 mmol/L sodium pyru-ate, 150 �g/mL gentamycin, and 10% heat-inactivatedetal bovine serum. Subsequently, cells were plated in4-well tissue culture dishes (Corning, NY) and incu-ated at 37°C in a humidified 5% CO2 atmosphere for 24ours. Nonadherent cells were removed by washing theell culture with sterile, endotoxin-free phosphate-buff-red saline. E coli lipopolysaccharide (LPS; Sigma-Aldrich)as used for macrophage stimulation. Macrophages (2 �06 cells/well) were incubated for 3 hours with phos-hate-buffered saline containing either stationary-phaselactis (106 colony-forming units/well) or no bacteria at

ll, before a 24-hour contact period with 2.5 �g/mL LPS.

MiceSeven- to 9-week-old female BALB/c, C57BL/6,

L-10�/� (C57BL/6 background) mice were purchasedrom Charles River (St Germain sur l’Arbresle, France),nd TLR2�/� mice (C57BL/6 background) were kindlyrovided by Dr S. Akira (University of Tokyo).27 We didot observe any spontaneous signs of inflammation inhe colons of both IL-10�/� and TLR2�/� mice. Experi-

ents were performed in an accredited establishmentno. A59107; Institut Pasteur de Lille) according to Eu-opean guidelines (number 86/609/CEE), and animalrotocols were approved by the local ethics committee.

TNBS-Induced Colitis and InflammationScoringGroups of 10 mice were given either carbonate

uffer (control mice) or 2 � 108 live L lactis (treated mice) C

aily for 5 consecutive days via the intragastric route.cute colitis was triggered on day 5 by intrarectal admin-

stration of a 50-�L solution of TNBS (Sigma-Aldrich) in0% ethanol; 100 mg/kg and 150 mg/kg yielded similareverities of intestinal inflammation in BALB/c and57BL/6 mice, respectively.28 Animals were subsequentlyonitored daily for loss of body weight. Three days after

nduction of colitis, mice were killed; blood samples weremmediately taken and stored in heparinized tubes. After

ouse dissection, 2 independent observers blindly scoredhe macroscopic inflammation of the colon on the Wal-ace scale.29 The percent relative protection was calcu-ated as described previously: 100 � (Average Wallacecore of Control Mice � Average Wallace Score ofreated Mice)/Average Wallace Score of Control Mice.28

wo-centimeter-long fragments of the distal colon wereollected and frozen at �80°C for histologic analysis;araffin-embedded 5-�m sections stained with May–rünwald–Giemsa were examined under the microscope,

nd tissue lesions were scored according to the Amehoriteria.30 Additionally, the degree of polymorphonucleareutrophil infiltration in the distal colon was assessed byuantifying myeloperoxidase (a granule enzyme), as re-orted previously.31

Cytokine and Serum Amyloid Protein AAssaysMurine IL-6, IL-10, and serum amyloid protein A

SAA) levels were measured using commercial enzyme-inked immunosorbent assay (ELISA) kits from R&Dystems (Minneapolis, MN), BD Pharmingen (San Diego,A), and Biosource International (Camarillo, CA), respec-

ively, with a lower limit of sensitivity of 15 pg/mL foroth IL-6 and IL-10 and of 30 ng/mL for SAA. Foruantification of colonic murine IL-10 and IL-6 levels,he entire mouse colon was homogenized, as describedreviously.

Real-Time Quantitative PCRTotal RNA from colonic biopsy specimens was

solated with the Nucleospin II Extraction Kit (Macherayagel, Duren, Germany). Messenger RNAs (mRNAs)ere retrotranscribed from 1 �g nucleic acid by using theigh-Capacity cDNA Archive Kit according to the man-facturer’s instructions (Applied Biosystems, Foster City,A). The resulting cDNA was amplified by the SYBRreen Real-Time PCR Kit and detected on a Prism 7000etection system (Applied Biosystems). The forward andeverse primers used were as follows: 5=GACCCTCA-ACTCAGATCATCTTCT3= and 5=CCACTTGGTGGT-TGCTACGA3= for murine tnf-� (GenBank accession no.M_013693.1), 5=AATCTATACCTGTCCTGTGTAATG-AAGAC3= and 5=TGGGTATTGCTTGGGATCCA3= forurine il-1� (GenBank accession no. NM_008361.2),

=CATTTGAATTCCCTGGGTGAGA3= and 5=TGCTC-
ACTGCCTTGCTCTT3= for murine il-10 (GenBank

aTTNCfnmDtlPaaie

mmdhdtascpwd

ncw

i(Yomecobaifig

tbaTtbg3b(iL2

iIpcitpso

BLLIc

FhcansaL B

ASI

C–

ALI

MEN

TARY

TRA

CT


ccession no. NM_010548.1), 5=AGTTTGTTGAGTCAT-CACCAGACA3= and 5=CCACTGCTTGTACAGCAAT-GG3= for murine cox-2 (GenBank accession no.M_011198.2), and 5=GAATGGGTCAGAAGGACTC-TATGT3= and 5=CCATGTCGTCCCAGTTGGTAA3=

or the �-actin– encoding gene actb (GenBank accessiono. NM_007393.1). �-actin mRNA was used for nor-alization. On completion of the PCR amplification, aNA melting curve analysis was performed to confirm

he presence of a single amplicon. Relative mRNAevels (2��C) were determined by comparing (1) theCR cycle thresholds (Ct) for the gene of interest andctb (�C) and (2) �C values for treated and untreatednimal groups (��C), as described previously.32 Onlyncreases in RNA levels by a factor of �3 were consid-red to be significant.

DSS-Induced Colitis and Assessment ofInflammationAcute colitis was induced in BALB/c mice by ad-

inistration of DSS (mol wt, 36,000 –50,000; MP Bio-edicals, Illkirch, France) dissolved in the animals’

rinking water. Groups of 10 mice were used, and aealthy control group (ie, not exposed to DSS) was givenistilled water. Animals were weighed daily throughouthe experiment. After the mice were killed, colon lengthsnd weights were scored before processing for micro-copic analysis. Briefly, cross-sectional rings of the mid-olon were fixed in 4% formaldehyde and embedded inaraffin. Sections (4 �m) were stained with May–Grün-ald–Giemsa, and histologic scoring was performed asescribed by Hartmann et al.33

Statistical AnalysisStatistical analysis was performed using the

onparametric Mann–Whitney U test. Differences wereonsidered to be statistically significant when the P valueas �.05.

ResultsRecombinant L lactis Releases High Levels ofFunctional LcrV ProteinIn a first step, we transformed plasmid pMEC237

nto L lactis MG1363. This recombinant expression vectorderived from plasmid pNZYR) bears the PCR-generated

pseudotuberculosis lcrV gene fused to the secretion signalf the lactococcal Usp45 protein. Because the secretionechanism of Y pseudotuberculosis LcrV has not yet been

lucidated,34 we decided to clone the whole protein-en-oding region. The segregational and structural stabilityf pMEC237 in L lactis MG1363 was verified by growingacteria in broth in the presence and absence of chlor-mphenicol, because this plasmid bears a chloramphen-col acetylase– encoding gene (see Table 1).35 We con-rmed that pMEC237 (like pNZYR) was stable after 100
enerations of bacteria in the absence of antibiotic selec- n
ive pressure (data not shown). LcrV release by the recom-inant L lactis (Ll-LcrV) was assessed by Western blotnalysis of the microbial culture supernatants (Figure 1).he secreted LcrV protein was detected in the early bac-

erial growth phase, and its concentration (as quantifiedy ELISA) in the cell supernatant from stationary phaserown cells was 28 � 8 �g/mL (mean level � SEM fromindependent cultures). Constitutive secretion of recom-

inant LcrV had no impact on the growth rate of Ll-LcrVdata not shown). ELISA quantification of secreted LcrVn the entire colon of mice fed daily with 2 � 108 livel-LcrV for 5 consecutive days gave a per-colon value of24 � 30 ng of LcrV protein.

The next step consisted in evaluating the in vitro andn vivo functionality of recombinant LcrV. InflammatoryL-6 production by LPS-induced, BALB/c-derived macro-hages was significantly lower when the cells were prein-ubated with L lactis Ll or Ll-LcrV, although the latternduced a stronger protective effect (Figure 2). In con-rast, under the same experimental conditions, cellularroduction of the anti-inflammatory cytokine IL-10 wasignificantly enhanced by the LcrV-secreting L lactis strainnly (a 5-fold increase).

Quantification of IL-10 in the entire colon fromALB/c mice fed daily for 5 consecutive days with L lactisl, Ll-LcrV or buffer indicated that when compared withl or buffer, oral administration of Ll-LcrV enhancedL-10 intestinal production whereas the colonic IL-6 con-entration did not change (Figure 3). However, there were

igure 1. In vitro production of LcrV by recombinant L lactis. Oneundred microliters of supernatants from stationary-phase lactococcalells (OD600 � 2) were separated by sodium dodecyl sulfate/polyacryl-mide gel electrophoresis and proteins were electrotransferred on aitrocellulose membrane. LcrV was detected by immunoblotting using apecific mouse monoclonal antibody. Y pseudotuberculosis was useds a positive control for LcrV production, as described elsewhere.54

crV migrated as a mixture of dimeric and multimeric species.55

o significant differences in blood IL-6 or IL-10 levels

ws(ldStL

ncitm

i(gfnata(psmwt

ccctcts

Fs2cdB

Ftcclbimpcn

BA

SIC–

ALIM

ENTA

RY

TRA

CT


hen comparing the various groups of mice (data nothown). Similar findings were obtained in C57BL/6 micedata not shown). In contrast, we found that the IL-10evel in the colon of TLR2�/� mice fed with Ll-LcrV or Llid not significantly differ (mean value of 5 animals �EM, 365 � 100 vs 382 � 101 pg per colon, respectively),hus showing that IL-10 induction by LcrV-secreting

lactis is indeed TLR2 mediated.

LcrV-Secreting L lactis Reduces the Severityof TNBS-Induced Colitis in MiceWe then investigated the ability of the recombi-

ant Lactococcus strain to prevent acute TNBS-inducedolitis in BALB/c mice (Figures 4 and 5). Intrarectalnstillation of TNBS triggered intense inflammation ofhe distal colon, which was highly infiltrated by poly-

igure 2. Cytokine production by LPS-stimulated macrophages pre-reated with L lactis strains. BALB/c peritoneal macrophages (2 � 106

ells/well) were incubated for 3 hours with phosphate-buffered salineontaining stationary-phase L lactis (106 colony-forming units/well, Ll), L

actis producing LcrV (106 CFU/well, Ll-LcrV), or no bacteria at all (non-Ll)efore a 24-hour contact period with 2.5 �g/mL LPS. IL-6 and IL-10 levels

n the cell culture supernatants were measured by ELISA. Bars representean values � SEM of 3 independent assays. Baseline levels of cytokineroduction by untreated cells in the absence of any stimulation are indi-ated by the dashed lines. *.01� P � .05; **.001� P � .01; ***P � .001;s, not significant (P � .05).

orphonuclear neutrophils. Daily intragastric admin- s

stration of 2 � 108 non–LcrV-producing L lactis (Ll)resuspended in 0.2 mol/L NaHCO3 buffer plus 1%lucose to protect the bacteria against digestive acidity)or 5 consecutive days before TNBS administration didot influence the intensity of colitis. In contrast, Ll-LcrVdministration resulted in a significant reduction in in-estinal damage, including decreased loss of goblet cellsnd crypts and a reduction in inflammatory infiltratesmainly neutrophils) and colon wall thickness. The 50%rotection against colitis (calculated from the Wallacecore; see Materials and Methods) conferred by this treat-

ent decreased to values of 35% and 20% when the miceere fed with 10-fold and 100-fold less Ll-LcrV, respec-

ively.Inasmuch as LcrV has IL-10 –inducing capacity, we also

onstructed an IL-10 –secreting lactococcal strain to con-omitantly compare its protective effect in the TNBSolitis model with that of the LcrV producing strain. Weherefore cloned the mature murine IL-10 – encodingDNA (fused to the secretion signal of the Usp45 pro-ein) into plasmid pNZYR and introduced the latter intotrain L lactis MG1363. ELISA of culture supernatants

igure 3. Colonic IL-10 and IL-6 levels in BALB/c mice fed with L lactistrains. Three groups of mice were fed for 5 days with either buffer or� 108 live Ll, Ll-LcrV. IL-10 and IL-6 levels in the entire homogenized

olon of each individual mouse were measured by ELISA. Three indepen-ent assays were performed, and a representative experiment is depicted.ars represent mean values from 5 animals � SEM. *.01� P � .05; ns, not
ignificant (P � .05).

FTlcbdarfm*pu

Fust(ctptlgotca

BA

SIC–

ALI

MEN

TARY

TRA

CT


igure 4. Preventive effects of recombinant L lactis strains againstNBS-induced acute colitis in BALB/c mice. Loss of body weight, co-

onic inflammation (macroscopically and microscopically scored ac-ording to the Wallace and Ameho criteria, respectively), and infiltrationy polymorphonuclear neutrophils (estimated by tissue myeloperoxi-ase [MPO] activity) on day 3 after intrarectal administration of TNBSre shown. Mice were pretreated (or not, as the case may be) withecombinant lactococcal strains. Three independent assays were per-ormed, and a representative experiment is depicted. Bars represent

ean values of 10 animals � SEM. *.01� P � .05; **.001� P � .01;**P � .001; ns, not significant (P � .05). Myeloperoxidase from humanolymorphonuclear neutrophils was used for calibration; one enzyme
nit degrades 1 �mol hydrogen peroxide · min�1 · mL�1 at 25°C. c
igure 5. Histologic features of LcrV-mediated protection. The fig-re shows representative May–Grünwald–Giemsa—stained colonections on day 3 after instillation of TNBS in BALB/c mice pre-reated with lactococcal strains (A) Ll or (B) Ll-LcrV as compared withC) healthy mice not given TNBS (original magnification 40�). Aorresponds to an Ameho score of 5, showing transmural inflamma-ion and important thickening of the colon wall, characterized byrominent inflammatory infiltrates of mononuclear cells (mainly neu-rophils) in the lamina propria, extensive ulceration, and focal epithe-ial necrosis extending into the muscle layers, in addition to massiveoblet cell depletion. B yields a score of 2, with only slight thickeningf the submucosa, mild, localized submucosal inflammatory infil-rates, moderate superficial erosions, and the presence of a fewrypts with minor hyperplasia, resulting in a well-conserved mucosalrchitecture more similar to the normal appearance of healthy mice
olons (C).

frlspoldm

Pmmai1

tgto1p

ibi

FlwLtapph*

Fiwt(iwahza

BA

SIC–

ALIM

ENTA

RY

TRA

CT


rom stationary-phase Ll-IL-10 bacteria confirmed theelease of substantial amounts of IL-10 (mean cytokineevel from 3 separate experiments, 3.45 � 2.1 �g/mL). Ashown in Figure 4, the oral feeding of mice with Llroducing either IL-10 or LcrV conferred similar degreesf protection against TNBS-induced colitis, with equiva-

ent reductions in body weight loss and macroscopicisease activity scores and similar histologic improve-ents and reductions in tissue myeloperoxidase activity.

A Decreased Host Inflammatory ResponseCorrelates With the Protective Effects of LcrVAt day 3 after TNBS instillation, we used real-time

CR to quantify colonic transcription of the proinflam-atory il-1�, cox-2, and tnf-� genes and the anti-inflam-atory il-10 gene in all mice. Compared with healthy

nimals, TNBS-treated mice showed very strong colonicnduction of il-1�, cox-2 (with approximately 100-fold and0-fold increases, respectively), and, to a lesser extent,

igure 6. Blood and colon markers of inflammation in TNBS-inocu-ated BALB/c mice pretreated with recombinant lactococci. Samples

ere collected on day 3 after instillation of TNBS after pretreatment withl, Ll-LcrV, and Ll-IL-10. (A) Quantification (using real-time PCR) ofnf-�, cox-2, il-1�, and il-10 transcripts in colon extracts. (B) Blood IL-6nd SAA levels, measured by ELISA. Two independent assays wereerformed, and a representative experiment is shown. Values are ex-ressed as the relative increase in specific mRNA levels compared withealthy colons. Bars represent mean values of 10 animals � SEM.

m.01� P � .05; **.001� P � .01; ns, not significant (P � .05); #P � .075.

nf-� and il-10 (Figure 6A). Transcription of most of theseenes was significantly reduced when animals received in-ragastric doses of L lactis secreting LcrV or IL-10. Inhibitionf proinflammatory (il-1�, tnf-�) and anti-inflammatory (il-0) gene expression in the colon of treated mice was moreronounced with the IL-10 –secreting strain.To assess whether the protective effect observed locally

n the colon could also be found systemically, we assessedlood levels of the proinflammatory IL-6 and the anti-

nflammatory IL-10 cytokines at the same time point in

igure 7. Preventive effects of LcrV-secreting L lactis against TNBS-nduced colitis in C57BL/6 wild-type and IL-10�/� mice. Data for bodyeight loss, colonic inflammation (scored macroscopically according to

he Wallace criteria), and infiltration by polymorphonuclear neutrophilsestimated by tissue myeloperoxidase [MPO] activity) on day 3 afterntrarectal administration of TNBS are shown. Mice were pretreatedith recombinant lactococcal strains. Bars represent mean values of 10nimals � SEM. *.01� P � .05; not significant (P � .05). MPO fromuman polymorphonuclear neutrophils was used for calibration; 1 en-yme unit degrades 1 �mol hydrogen peroxide · min�1 · mL�1

t 25°C.

ice pretreated with the Ll, Ll-LcrV, or Ll-IL-10 strains.

IrsfdtLse

citctsidpchsLlts

tma9

4FLltefcm(dfGms(stscc.

BA

SIC–

ALI

MEN

TARY

TRA

CT


n fact, one of the most intensively studied systemicesponses to an inflammatory stimulus is the hepaticynthesis of acute phase proteins, including the SAAamily involved in inflammation-induced damage.36 Asepicted in Figure 6B, IL-6 and SAA serum concentra-ions were significantly lowered by both Ll-LcrV andl-IL-10 treatment. In contrast, there were no statisticallyignificant changes in IL-10 blood titers in any of thexperimental groups (data not shown).

LcrV-Mediated Protection Is IL-10 DependentGiven that enhanced synthesis of IL-10 in the

olon of Ll-LcrV–treated mice was already detected beforenstillation of TNBS, we investigated the protective po-ential of Ll-LcrV in IL-10 – deficient mice to firmly con-lude as to whether or not LcrV-mediated colitis protec-ion was IL-10 dependent. IL-10�/� mice develop colitispontaneously but slowly, with interindividual variationsn the time course of the condition.37 To circumvent thisrawback and, above all, adopt the previously used ex-erimental design, we decided to purposely induce TNBSolitis in 7- to 9-week-old IL-10�/� mice for which noistologic signs of spontaneous inflammation were ob-erved. Oral administration of Ll-LcrV (compared withl) resulted in significantly lower body weight loss, Wal-

ace scores, and tissue myeloperoxidase activity in wild-ype C57/BL6 mice. In contrast, no such effect was ob-erved in IL-10 – deficient counterparts (Figure 7).

LcrV-Secreting L lactis Also Prevents andTreats DSS-Induced Acute Colitis in MiceLastly, we evaluated the protective and therapeu-

ic effects of LcrV-secreting L lactis in a second murineodel of acute colitis triggered by addition of DSS to the

nimals’ drinking water. Administration of 6% DSS for a-day period (from day 0 to day 8) caused significant

™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™igure 8. The preventive potential of orally administered recombinantlactis strains in DSS-induced colitis in BALB/c mice. A total of 2 � 108

ive lactococci were administered orally 2 days before and then duringhe 9-day 6% DSS regimen. (A) Mice were weighed daily throughout thexperiment. Each time point represents the mean percentage changerom day 0 for 10 mice: open squares, healthy mice not given DSS;losed circles, non–Ll-treated mice with DSS; gray circles, Ll-treatedice receiving DSS; open circles, Ll-LcrV–treated mice receiving DSS.

B) Colon length and histologic scores were measured at necropsy onay 8; bars represent mean values of 10 animals � SEM. (C) Histologic

eatures on day 8. The panels show representative May–Grünwald–iemsa—stained middle-colon sections of (a) non–DSS-challengedice, (b) DSS-challenged mice treated with buffer, and (c) lactococcal

trains Ll and (d) Ll-LcrV, respectively (original magnification 10�).a) corresponds to a histologic score of 0. (b) and (c) correspond tocores of 4 and 3, respectively, showing marked numbers of inflamma-ory cells, including neutrophils in the lamina propria extending into theubmucosa, together with mucosal erosion/ulceration and disruption ofrypt architecture. (d) has a score of 1, exhibiting a few inflammatory

05; **.001� P � .01; ***P � .001; ns, not significant (P � .05).
ells in the lamina propria and discrete focal epithelial lesions. *.01� P �

cbdcdtd

swnnstaanttwfac1pwprc

galdrlewe

mpimbi

4Fa5TeefctirGwt

BA

SIC–

ALIM

ENTA

RY

TRA

CT


linical changes, including diarrhea, the presence oflood in the feces, body weight loss, and, ultimately,eath (2 of the 10 mice in the non-Ll group died) whenompared with healthy control mice receiving DSS-freerinking water (Figure 8). Daily intragastric administra-ion of 2 � 108 live Ll and Ll-LcrV 2 days before anduring the 9-day DSS regimen resulted by day 8 in

s

urvival of all mice, a significant reduction in bodyeight loss, and colon shortening (with a more pro-ounced effect on colon length for Ll-LcrV). Both theontreated and Ll-treated mice had high histologiccores, indicating edema, epithelial destruction, infiltra-ion of inflammatory cells into the mucosa/submucosa,nd mucosal thickening. In contrast, the colon mucosand submucosa of mice treated with Ll-LcrV were almostormal, with only slight infiltration of a few inflamma-ory cells. Similar findings were observed after adminis-ration of 5% DSS to mice (data not shown). In addition,hen these mice were returned to normal drinking water

or the following 5 days (while maintaining daily oraldministration of Ll-LcrV), we noticed a significant de-rease in body weight loss and colon shortening on day2 (Figure 9A and B). Moreover, re-epithelialization andronounced cryptal regeneration of the colonic mucosaere observed, although leukocyte infiltrates were stillresent (Figure 9C). These results thus show that LcrVeduces intestinal damage and accelerates restoration ofolon homeostasis.

To study the therapeutic potential of LcrV, mice wereiven a 5% DSS solution for a 9-day period (day 0 to day 8)nd were fed daily with carbonate buffer or 2 � 108 live L

actis strains after the onset of colitis, that is, from day 4 toay 8 (Figure 10). Oral administration of Ll and Ll-LcrVesulted (by day 8) in a significant reduction in body weightoss and colon shortening (again, with a more pronouncedffect on colon length for Ll-LcrV). In Ll-LcrV–treated mice,e observed a limited amount of cellular infiltration and

dema in the lamina propria and submucosa.

DiscussionIn the present study, we show that the food-grade

icroorganism L lactis is able to efficiently deliver the Yseudotuberculosis LcrV protein to the murine colon, whichn turn enhances IL-10 production (in a TLR2-dependent

anner) in situ but not systemically (ie, not in thelood). The effect is abrogated as soon as the bacterium

s eliminated from the digestive tract (ie, 3 days after oral

™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™igure 9. Preventive properties and accelerated epithelium-healingbilities of recombinant L lactis in DSS-induced colitis. Mice were given% DSS for 8 days and then normal drinking water for the next 5 days.he animals were fed daily with 2 � 108 live lactococci throughout thexperimental procedure. (A) Mice were weighed daily throughout thexperiment. Each time point represents the mean percentage changerom day 0 for 10 mice: open squares, healthy mice not given DSS;losed circles, non–Ll-treated mice receiving DSS; gray circles, Ll-reated mice receiving DSS; open circles, Ll-LcrV–treated mice receiv-ng DSS. (B) Colon length was measured at necropsy on day 12; barsepresent mean values of 10 animals � SEM. (C) May–Grünwald–iemsa—stained middle-colon section of DSS-challenged mice treatedith Ll-LcrV (original magnification 20�). The photograph shows re-epi-

helialization and cryptal regeneration of colonic mucosa. *P � .001; ns, not
ignificant (P � .05).

argtiu

ssSYctbistltebbgrf(tbototms

dLiiltmTflmtaanwTsm(aT

Fcdwssmctm***P � .001; ns, not significant (P � .05); #P � .07.

BA

SIC–

ALI

MEN

TARY

TRA

CT


dministration). The LcrV-secreting L lactis significantlyeduces inducible colitis in different mouse lineages andiven that the nonproducing L lactis control was unableo modify the course of the disease, the decrease inntestinal mucosa damage can thus be intrinsically attrib-ted to the locally secreted LcrV protein.These results extended our previous study in which we

howed that oral administration of live Y pseudotuberculo-is inhibits the onset of TNBS-induced colitis in mice.38

tarting from this observation, we hypothesized thatersinia outer proteins (Yops) and LcrV, all known toounteract signaling pathways in host cells,14,39 were po-entially involved in this inhibitory effect. However, to beiologically active, the Yops need to be injected directly

nto the eukaryotic cell cytosol via a specific type IIIecretion system.40 This route of administration mayherefore be more difficult to achieve through the use ofactic acid bacteria, which lack such a specialized secre-ion apparatus. In contrast, LcrV can be secreted moreasily by these safe microorganisms, because it is releasedy yersiniae into the environment as a hydrophilic solu-le protein that can act on host cells by inhibiting theeneration of proinflammatory cytokines via IL-10 up-egulation.13 L lactis MG1363 is one of the best candidatesor investigating this heterologous expression, because1) it has been shown to have “neutral” intrinsic proper-ies against inflammation, (2) it was found to be unabley itself to reduce inflammation in experimental modelsf colitis,28,41,42 and (3) it has been used successfully forhe secretion of high levels of biologically active heterol-gous proteins.41– 43 Moreover, this approach is a realisticherapeutic option in human medicine, because oral ad-

inistration of genetically modified L lactis is clinicallyafe in humans.44

Using the TNBS-induced murine colitis model, weemonstrated a protective effect of orally administrated,crV-releasing L lactis that was as efficient as the one

nduced by L lactis secreting IL-10. The observed decreasen intestinal damage was associated with a drop in bloodevels of inflammatory markers and reduced transcrip-ion of the proinflammatory il-1� and cox-2 genes in the

ouse colon on day 3 after intrarectal administration ofNBS. It is noteworthy that the magnitude of the proin-ammatory tnf-� down-regulation appeared to be quiteoderate when compared with those for il-1� and cox-2;

his observation confirms the findings of Abad et al, wholso observed weak colonic expression of the tnf-� gene in

similar experimental model of colitis.45 More pro-ounced inhibition of tnf-� and il-1� gene transcriptionas noted in the colon of mice pretreated with Ll-IL-10.his result indicates that direct IL-10 release may be

lightly more effective or that the Ll-IL-10 – and Ll-LcrV–ediated anti-inflammatory mechanisms may be distinct

eg, in terms of their kinetics or signaling pathway),lthough the resulting degrees of protection against

igure 10. Therapeutic potential of L lactis strains in DSS-inducedolitis. Mice were given a 5% DSS solution for a 9-day period and fedaily with 2 � 108 lactococci from day 4 to day 8. (A) Mice wereeighed daily throughout the experiment. Each time point repre-ents the mean percentage change from day 0 for 10 mice: openquares, healthy mice not given DSS; closed circles, non–Ll-treatedice receiving DSS; gray circles, Ll-treated mice receiving DSS; open

ircles, Ll-LcrV–treated mice receiving DSS. (B) Colon length and his-ologic scores were measured at necropsy on day 8; bars representean values of 10 animals � SEM. *.01� P � .05; **.001� P � .01;

NBS-induced colonic lesions afforded by either recom-

bpwmdme

mpetpfiTmwScwtotfodhsrcomotelcastsi

touadLatLpcms

opkYrlgcplisttec

1

1

1

1

1

1

BA

SIC–

ALIM

ENTA

RY

TRA

CT


inant strain did not differ statistically. The beneficialroperties of LcrV-secreting L lactis with respect to colitisere also observed in another murine model of experi-ental colitis, where DSS is dissolved in the animals’

rinking water. This strain not only prevented colitis andaintained mucosal integrity but also healed mucosal

pithelium that had already been damaged by the disease.At day 3 after TNBS inoculation in Ll-LcrV pretreatedice, we found no direct evidence for IL-10 signaling

athway activation in the colon of these animals; how-ver, this cytokine is undeniably necessary for the protec-ive effect of LcrV, because Ll-LcrV pretreatment did notrotect against colitis in IL-10 – deficient mice. This resultts with previous reports of the successful reduction ofNBS-triggered murine colitis by anti-inflammatoryolecules without up-regulation (and indeed often evenith down-regulation) of the IL-10 – encoding gene.46 – 49

trangely enough, the production of IL-10, a pivotalytokine in gut self-repair, can sometimes be correlatedith the severity of the mucosal inflammation, rather

han the anticipated degree of protection.50,51 Indeed, webserved the highest level of colonic il-10 transcription inhe nonprotected group of mice, pretreated with Ll be-ore TNBS administration. Because enhanced synthesisf IL-10 in the colon of Ll-LcrV–treated mice was alreadyetected before instillation of TNBS, the most plausibleypothesis to explain our findings is a “no need to help”tatus of the gut mucosa, related to its low inflammationate at this stage of the experiment. In vivo, a majorellular source of IL-10 is the macrophage; on the basis ofur in vitro experiments on Ll-LcrV–treated stimulatedacrophages (the results of which are in agreement with

ther reports16,17), we believe that this cell may be essen-ial for the protective role of LcrV against colitis. How-ver, immunomodulation of LcrV in vivo could also beinked to recruitment and stimulation of other immuno-ompetent cells (such as dendritic cells and neutrophils)nd epithelial cell activation in the gut mucosa. Futuretudies should be able to delineate such specific implica-ions and define the regulatory effects of TLR2-mediatedignals on mucosal homeostasis, as recently emphasizedn an inflammatory context.52

In summary, the present demonstration of the protec-ive and therapeutic effect of in situ lactococcal secretionf Y pseudotuberculosis LcrV highlights the potential ofsing pathogen-derived immunomodulating moleculess novel therapeutics for human inflammatory bowelisease. However, we will first need to identify an optimalcrV immunomodulatory formulation that maximizesnti-inflammatory efficacy while minimizing the poten-ial induction of protective antibodies against particularcrV epitopes. Following our previous observation thatrior intestinal Y pseudotuberculosis infection can reduceolitis,38 we can now safely state that LcrV is one of theain anti-inflammatory effectors in this process. At this

tage, however, we cannot exclude the possibility that

ther Yersinia proteins could also have anti-inflammatoryotential. For example, the mitogen-activated proteininase and nuclear factor �B signaling pathway inhibitoropJ might be another good candidate for further explo-ation, although this molecule would require intracellu-ar delivery to be active.13 YopJ and LcrV may act syner-istically to prevent inflammatory bowel disease. In thisontext, one could very sensibly consider future thera-eutic strategies that use L lactis (or any other food-grade

actic bacterium or indeed an adenoviral construct) tonvade the gut and deliver in situ a single protein orelected mix of pathogen-derived anti-inflammatory pro-eins. The fact that some of these lactic acid bacteriahemselves may have significant anti-inflammatory prop-rties53 may considerably reinforce the therapeutic effi-acy of such an approach.

References

1. Podolsky DK. Inflammatory bowel disease. N Engl J Med 2002;347:417–429.

2. Korzenik JR, Podolsky DK. Evolving knowledge and therapy ofinflammatory bowel disease. Nat Rev Drug Discov 2006;5:197–209.

3. Isaacs KL, Lewis JD, Sandborn WJ, et al. State of the art: IBDtherapy and clinical trials in IBD. Inflamm Bowel Dis 2005;11(Suppl 1):S3–S12.

4. Smith P, Fallon RE, Mangan NE, et al. Schistosoma mansonisecretes a chemokine binding protein with antiinflammatory ac-tivity. J Exp Med 2005;202:1319–1325.

5. Goodridge HS, Marshall FA, Else KJ, et al. Immunomodulation vianovel use of TLR4 by the filarial nematode phosphorylcholine-con-taining secreted product, ES-62. J Immunol 2005;174:284–293.

6. Coombes BK, Valdez Y, Finlay BB. Evasive maneuvers by se-creted bacterial proteins to avoid innate immune responses. CurrBiol 2004;14:R856–R867.

7. Fallon PG, Alcami A. Pathogen-derived immunomodulatory mole-cules: future immunotherapeutics? Trends Immunol 2006;27:470–476.

8. Wahl-Jensen VM, Afanasieva TA, Seebach J, et al. Effects ofEbola virus glycoproteins on endothelial cell activation and barrierfunction. J Virol 2005;79:10442–10450.

9. Collier-Hyams LS, Zeng H, Sun J, et al. Cutting edge: SalmonellaAvrA effector inhibits the key proinflammatory, anti-apoptotic NK-�B pathway. J Immunol 2002;169:2846–2850.

0. Braat H, McGuirk P, Ten Kate FJ, et al. Prevention of experimentalcolitis by parenteral administration of a pathogen-derived immu-nomodulatory molecule. Gut 2007;56:351–357.

1. Nakajima R, Motin VL, Brubaker RR. Suppression of cytokines inmice by protein A-V antigen fusion peptide and restoration ofsynthesis by active immunization. Infect Immun 1995;63:3021–3029.

2. Nedialkov YA, Motin VL, Brubaker RR. Resistance to lipopolysac-charide mediated by the Yersinia pestis V antigen-polyhistidinefusion peptide: amplification of interleukin-10. Infect Immun1997;65:1196–1203.

3. Brubaker RR. Interleukin-10 and inhibition of innate immunity toyersiniae: roles of Yops and LcrV (V antigen). Infect Immun2003;71:3673–3681.

4. Heesemann J, Sing A, Trulzsch K. Yersinia’s stratagem: targetinginnate and adaptive immune defense. Curr Opin Microbiol 2006;9:55–61.

5. Sing A, Roggenkamp A, Geiger AM, et al. Yersinia enterocolitica
evasion of the host innate immune response by V antigen-in-

1

1

1

1

2

2

2

2

2

2

2

2

2

2

3

3

3

3

3

3

3

3

3

3

4

4

4

4

4

4

4

4

4

4

5

5

5

5

5

5

5

BA

SIC–

ALI

MEN

TARY

TRA

CT


duced IL-10 production of macrophages is abrogated inIL-10-deficient mice. J Immunol 2002;168:1315–1321.

6. Sing A, Rost D, Tvardovskaia N, et al. Yersinia V-antigen exploitstoll-like receptor 2 and CD14 for interleukin 10-mediated immu-nosuppression. J Exp Med 2002;196:1017–1024.

7. Sing A, Reithmeier-Rost D, Granfors K, et al. A hypervariableN-terminal region of Yersinia LcrV determines Toll-like receptor2-mediated IL-10 induction and mouse virulence. Proc Natl AcadSci U S A 2005;102:16049–16054.

8. Neurath M, Fuss I, Strober W. TNBS-colitis. Int Rev Immunol2000;19:51–62.

9. Okayasu I, Hatakeyama S, Yamada M, et al. A novel method inthe induction of reliable experimental acute and chronic ulcer-ative colitis in mice. Gastroenterology 1990;98:694–702.

0. Vetuschi A, Latella G, Sferra R, et al. Increased proliferation andapoptosis of colonic epithelial cells in dextran sulfate sodium-induced colitis in rats. Dig Dis Sci 2002;47:1447–1457.

1. van Asseldonk M, Rutten G, Oteman M, et al. Cloning of usp45,a gene encoding a secreted protein from Lactococcus lactissubsp. lactis MG1363. Gene 1990;95:155–160.

2. Wells JM, Wilson PW, Le Page RW. Improved cloning vectors andtransformation procedure for Lactococcus lactis. J Appl Bacteriol1993;74:629–636.

3. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a labora-tory manual. 2nd ed. New York, NY: Cold Spring Harbor Labora-tory, 1989.

4. Motin VL, Nakajima R, Smirnov GB, et al. Passive immunity toyersiniae mediated by anti-recombinant V antigen and protein A-Vantigen fusion peptide. Infect Immun 1994;62:4192–4201.

5. Gomes-Solecki MJ, Savitt AG, Rowehl R, et al. LcrV capture enzyme-linked immunosorbent assay for detection of Yersinia pestis fromhuman samples. Clin Diagn Lab Immunol 2005;12:339–346.

6. Nilles ML, Williams AW, Skrzypek E, et al. Yersinia pestis LcrVforms a stable complex with LcrG and may have a secretion-related regulatory role in the low-Ca2 response. J Bacteriol1997;179:1307–1316.

7. Takeuchi O, Hoshino K, Kawai T, et al. Differential roles of TLR2and TLR4 in recognition of Gram-negative and Gram-positive bac-terial cell wall components. Immunity 1999;11:443–451.

8. Foligne B, Nutten S, Steidler L, et al. Recommendations for im-proved use of the murine TNBS-induced colitis model in evaluatinganti-inflammatory properties of lactic acid bacteria: technical andmicrobiological aspects. Dig Dis Sci 2006;51:390–400.

9. Wallace JL, MacNaughton WK, Morris GP, et al. Inhibition ofleukotriene synthesis markedly accelerates healing in a ratmodel of inflammatory bowel disease. Gastroenterology 1989;96:29–36.

0. Ameho CK, Adjei AA, Harrison EK, et al. Prophylactic effect ofdietary glutamine supplementation on interleukin 8 and tumournecrosis factor alpha production in trinitrobenzene sulphonic acidinduced colitis. Gut 1997;41:487–493.

1. Bradley PP, Priebat DA, Christensen RD, et al. Measurement ofcutaneous inflammation: estimation of neutrophil content with anenzyme marker. J Invest Dermatol 1982;78:206–209.

2. Sierro F, Dubois B, Coste A, et al. Flagellin stimulation of intes-tinal epithelial cells triggers CCL20-mediated migration of den-dritic cells. Proc Natl Acad Sci U S A 2001;98:13722–13727.

3. Hartmann G, Bidlingmaier C, Siegmund B, et al. Specific type IVphosphodiesterase inhibitor rolipram mitigates experimental co-litis in mice. J Pharmacol Exp Ther 2000;292:22–30.

4. Skrzypek E, Straley SC. Differential effects of deletions in lcrV onsecretion of V antigen, regulation of the low-Ca2 response, andvirulence of Yersinia pestis. J Bacteriol 1995;177:2530–2542.

5. Pavan S, Hols P, Delcour J, et al. Adaptation of the nisin-con-trolled expression system in Lactobacillus plantarum: a tool tostudy in vivo biological effects. Appl Environ Microbiol 2000;
66:4427–4432.
6. Uhlar CM, Whitehead AS. Serum amyloid A, the major vertebrateacute-phase reactant. Eur J Biochem 1999;265:501–523.

7. Berg DJ, Zhang J, Weinstock JV, et al. Rapid development ofcolitis in NSAID-treated IL-10 deficient mice. Gastroenterology2002;123:1527–1542.

8. Marceau M, Dubuquoy L, Caucheteux-Rousseaux C, et al. Yer-sinia pseudotuberculosis anti-inflammatory components reducetrinitrobenzene sulfonic acid-induced colitis in the mouse. InfectImmun 2004;72:2438–2441.

9. Viboud GI, Bliska JB. Yersinia outer proteins: role in modulationof host cell signaling responses and pathogenesis. Annu RevMicrobiol 2005;59:69–89.

0. Cornelis GR. The Yersinia Ysc-Yop ‘type III’ weaponry. Nat RevMol Cell Biol 2002;3:742–752.

1. Steidler L, Hans W, Schotte L, et al. Treatment of murine colitisby Lactococcus lactis secreting interleukin-10. Science 2000;289:1352–1355.

2. Vandenbroucke K, Hans W, Van Huysse J, et al. Active delivery oftrefoil factors by genetically modified Lactococcus lactis preventsand heals acute colitis in mice. Gastroenterology 2004;127:502–513.

3. Le Loir Y, Azevedo V, Oliveira SC, et al. Protein secretion inLactococcus lactis: an efficient way to increase the overall het-erologous protein production. Microb Cell Fact 2005;4:2.

4. Braat H, Rottiers P, Hommes DW, et al. A phase I Trial withtransgenic bacteria expressing interleukin-10 in Crohn’s disease.Clin Gastroenterol Hepatol 2006;4:754–759.

5. Abad C, Juarranz Y, Martinez C, et al. cDNA array analysis ofcytokines, chemokines, and receptors involved in the develop-ment of TNBS-induced colitis: homeostatic role of VIP. InflammBowel Dis 2005;11:674–684.

6. Fiorucci S, Wallace JL, Mencarelli A, et al. A beta-oxidation-resistant lipoxin A4 analog treats hapten-induced colitis by atten-uating inflammation and immune dysfunction. Proc Natl Acad SciU S A 2004;101:15736–15741.

7. Hollenbach E, Vieth M, Roessner A, et al. Inhibition of RICK/nuclear factor-�B and p38 signaling attenuates the inflammatoryresponse in a murine model of Crohn disease. J Biol Chem2005;280:14981–14988.

8. Arita M, Yoshida M, Hong S, et al. Resolvin E1, an endogenouslipid mediator derived from omega-3 eicosapentaenoic acid, pro-tects against 2,4,6-trinitrobenzene sulfonic acid-induced colitis.Proc Natl Acad Sci U S A 2005;102:7671–7676.

9. Glauben R, Batra A, Fedke I, et al. Histone hyperacetylation isassociated with amelioration of experimental colitis in mice.J Immunol 2006;176:5015–5022.

0. Murray PJ. Understanding and exploiting the endogenous inter-leukin-10/STAT3-mediated anti-inflammatory response. Curr OpinPharmacol 2006;6:379–386.

1. Du Z, Kelly E, Mecklenbrauker I, et al. Selective regulation ofIL-10 signaling and function by zymosan. J Immunol 2006;176:4785–4792.

2. Cario E, Gerken G, Podolsky DK. Toll-like receptor 2 controlsmucosal inflammation by regulating epithelial barrier function.Gastroenterology 2007;132:1359–1374.

3. Foligne B, Grangette C, Pot B. Probiotics in IBD: mucosal andsystemic routes of administration may promote similar effects.Gut 2005;54:727–728.

4. Bergman T, Hakansson S, Forsberg A, et al. Analysis of the Vantigen lcrGVH-yopBD operon of Yersinia pseudotuberculosis:evidence for a regulatory role of LcrH and LcrV. J Bacteriol 1991;173:1607–1616.

5. Tito MA, Miller J, Walker N, et al. Probing molecular interactions inintact antibody: antigen complexes, an electrospray time-of-flightmass spectrometry approach. Biophys J 2001;81:3503–3509.

6. Sebbane F, Devalckenaere A, Foulon J, et al. Silencing and
reactivation of urease in Yersinia pestis is determined by one G

5

LL

c

arLSJ

BA

SIC–

ALIM

ENTA

RY

TRA

CT


residue at a specific position in the ureD gene. Infect Immun2001;69:170–176.

7. Daniel C, Poiret S, Goudercourt D, et al. Selecting lactic acidbacteria for their safety and functionality by use of mouse colitismodel. Appl Environ Microbiol 2006;72:5799–5805.

Received December 6, 2006. Accepted May 31, 2007.Address requests for reprints to: Catherine Daniel, PhD, Bactéries

actiques et Immunité des Muqueuses, Institut Pasteur de Lille, F-59045
ille cedex, France. e-mail: [email protected]; fax: (33) 320 871192. r
Supported by the Institut Pasteur de Lille and the Institut de Re-herche des Maladies de l’Appareil Digestif.The authors have no conflict of interest to disclose.R.D. and M.M. contributed equally to this work.The authors thank Yvonne Roussel, Jim Bliska, Robert Brubaker,

nd Susan Straley for kindly providing plasmid pNZYR, LcrV purifiedecombinant protein (from Escherichia coli), mouse monoclonal anti-crV antibody, and rabbit polyclonal anti-LcrV antibody, respectively; Dr. Akira for the generous gift of TLR2-deficient mice; Magali Billet andoelle Dewulf for technical assistance; and Florent Sebbane for critical
eview of the manuscript.

Documents

Prevention and Treatment of Colitis With Lactococcus lactis Secreting the Immunomodulatory Yersinia LcrV Protein