1 23

Tumor BiologyTumor Markers, Tumor Targeting andTranslational Cancer Research ISSN 1010-4283 Tumor Biol.DOI 10.1007/s13277-012-0495-z

Progesterone receptor (PR) variants existin breast cancer cells characterised as PRnegative

David M. W. Cork, ThomasW. J. Lennard & Alison J. Tyson-Capper

1 23

Your article is protected by copyright and all

rights are held exclusively by International

Society of Oncology and BioMarkers (ISOBM).

This e-offprint is for personal use only

and shall not be self-archived in electronic

repositories. If you wish to self-archive your

work, please use the accepted author’s

version for posting to your own website or

your institution’s repository. You may further

deposit the accepted author’s version on

a funder’s repository at a funder’s request,

provided it is not made publicly available until

12 months after publication.

RESEARCH ARTICLE

Progesterone receptor (PR) variants exist in breast cancer cellscharacterised as PR negative

David M. W. Cork & Thomas W. J. Lennard &

Alison J. Tyson-Capper

Received: 2 July 2012 /Accepted: 16 August 2012# International Society of Oncology and BioMarkers (ISOBM) 2012

Abstract Progesterone receptor (PR) expression is measuredin breast cancer by immunohistochemistry using N-terminallytargeted antibodies and serves as a biomarker for endocrinetherapeutic decisions. Extensive PR alternative splicing hasbeen reported which may generate truncated PR variant pro-teins which are not detected by current breast cancer screeningor may alter the function of proteins detected in screening.However, the existence of such truncated PR variants remainscontroversial. We have characterised PR protein expression inbreast cancer cell lines using commercial PR antibodies tar-geting different epitopes. Truncated PR proteins are detectedin reportedly PR negative MDA-MB-231 cells using a C-terminally targeted antibody. Antibody specificity was con-firmed by immunoblotting following siRNA knockdown ofPR expression. We have further demonstrated that alternative-ly spliced PR mRNA is present in MDA-MB-231 cells and inreportedly PR-negative breast tumour tissue which could en-code the truncated PR proteins detected by the C-terminalantibody. The potential function of PR variant proteins presentin MDA-MB-231 cells was also assessed, indicating the abil-ity of these PR variants to bind progesterone, interact with anuclear PR co-factor and bind DNA. These findings suggestthat alternative splicing may generate functional truncated PRvariant proteins which are not detected by breast cancerscreening using N-terminally targeted antibodies leading tomisclassification as PR negative.

Keywords Progesterone receptor . Alternative splicing .

Breast cancer . Hormone receptors . Biomarkers

Introduction

Progesterone receptor (PR) exists as two main nuclear re-ceptor isoforms, full-length PR-B and N-terminally truncat-ed PR-A, which are encoded by the same gene through theuse of alternative oestrogen-responsive promoters withinexon 1. Each of the eight exons of the PR gene encodes aspecific functional domain [1]. The structure of the PR geneand encoded full-length isoforms is shown in Fig. 1. PR-Aand PR-B are identical except for an additional N-terminal164 amino acids specific to PR-B, termed the B-upstreamsegment (BUS). Both PR-A and PR-B function as ligandactivated nuclear transcription factors; progesterone bindingstimulates dissociation from chaperone complexes, dimer-isation, nuclear localisation, DNA binding to progesteroneresponse elements (PRE) in target promoters and interactionwith co-regulators to modulate gene expression [2]. BUScontains a PR-B-specific transactivation domain whichmediates enhanced co-regulator binding, and the presenceof BUS masks an inhibitory domain (ID) which is respon-sible for autoinhibition of PR-A function [3]. BUS thereforecontributes to making PR-B a more potent activator oftranscription than PR-A [3]. ID can also inhibit PR-B inheterodimers, making the ratio of PR isoform expressionand the combination of PR dimers determinants of proges-terone responsiveness [3, 4].

In addition to the described role of PR as a nucleartranscription factor, cross-talk of PR-B with cytoplasmicSrc tyrosine kinases has been reported to activate MAPKsignalling. Cytoplasmic PR can also activate PI3K signal-ling, interact with membrane-associated growth factorreceptors and activate other transcription factors [5–9]. Thisnon-genomic PR signalling facilitates rapid progesterone-

D. M. W. Cork :A. J. Tyson-Capper (*)Reproductive and Vascular Biology Research Group, Institute ofCellular Medicine, Medical School, Newcastle University,3rd Floor William Leech Building, Framlington Place,Newcastle-upon-Tyne, NE2 4HH, UKe-mail: alison.tyson-capper@ncl.ac.uk

T. W. J. LennardNorthern Institute for Cancer Research, Paul O’Gorman Building,Medical School, Framlington Place,Newcastle-upon-Tyne, NE2 4HH, UK

Tumor Biol.DOI 10.1007/s13277-012-0495-z

Author's personal copy

mediated responses without DNA binding and enables acti-vation by progesterone of genes that do not contain a PRE.

Alternative splicing is the differential removal or reten-tion of exons and introns from pre-mRNA during the gen-eration of the mature protein coding mRNA sequence [10].Alternative splicing events (ASEs) have been reported in-volving retention of intronic sequences within the PR mRNAwhich lead to the use of alternative translational initiation sitesandN-terminal protein truncation [11–13]. Exon deletions andintron retentions have also been described which delete func-tional domains or change the reading frame and cause C-terminal truncation of the protein (reviewed by Cork et al.[14]). Removal of functional domains or protein truncationdue to alternative splicing may generate proteins which arefunctionally distinct from full-length PR-A or PR-B. Forexample, exon-deleted PR variants have been reported toexhibit altered functions compared to wild-type PR whencloned into a PR-negative cell line [15].

PR expression is measured in breast cancer using N-terminal antibodies [16], and since PR is an oestrogen-responsive gene, PR expression is a biomarker for the pres-ence of a functional oestrogen signalling pathway which canbe targeted by endocrine therapeutics [17]. The ratio of PR-A/PR-B has been linked to breast cancer prognosis with apredominance of PR-A over PR-B associated with an in-creased rate of relapse after tamoxifen treatment [18]. Anti-bodies used in breast cancer PR screening do not distinguishbetween PR-A, PR-B or exon-deleted PR variants andwould be unable to detect any N-terminally truncated PRvariants that may be present.

The important roles of progesterone in breast cancer devel-opment [19–21], of PR as a prognostic and predictive markerin breast cancer [22–25], and the potential of PR as a thera-peutic target for breast cancer [26] highlight the need forinvestigation of the expression and function of alternativelyspliced PR variants in breast cancer. This study identifiesproteins using a non-N-terminal PR antibody in reportedlyPR-negative MDA-MB-231 cells and describes the pattern ofalternative splicing of PR mRNA in these cells. The potentialfunction of these truncated PR proteins in breast cancer cells isalso assessed. We further report the detection of alternativelyspliced PR mRNA in breast tumour tissues described as PRpositive and PR negative and discuss the potential impact ofthis alternative splicing on the detection of PR in breast cancer.

Materials and methods

Source of tissue

Frozen breast tumour tissue was obtained from a NewcastleUniversity/Gateshead Queen Elizabeth Hospital tissue bankand used in accordance with Gateshead Local ResearchEthics Committee approval Ref 52/02.

Cell culture

MDA-MB-231 and MCF-7 breast cancer cell lines wereobtained from the American Type Culture Collection(ATCC, LGC Standards) and maintained in Dulbecco’s

PR gene 2 3 4 5 6 7 1 8

PR-B PR-A

A mRNA

A protein

1 2 3 4 5 6 7 8

NTD DBD H LBD

DD AF2 NLS AF1 ID

S S S S S S S

B mRNA

B protein BUS NTD DBD H LBD

DD AF2 NLS AF1 AF3

1 2 3 4 5 6 7 8

S S S S S S S S S S S S S

Fig. 1 Diagrammatic representation of the eight exon PR gene; exonsare depicted relative to length in base pairs (bp) and separated by introns(not depicted by length). Exon 1 contains a long 5′UTR and exon 8 a long3′UTR indicated by the broken lines. The sites of transcriptional initiationresulting from promoter B (PR-B) and promoter A (PR-A) are indicatedby arrows. The mRNA structure for each isoform is depicted, with the

structure of the encoded proteins beneath. Structural domains are depictedrelative to their length in amino acids and positionwithin the protein.BUSB-upstream segment, NTD N-terminal domain, DBD DNA binding do-main, H hinge, LBD ligand binding domain, ID inhibitory domain, AFtransactivation domain, NLS nuclear location signal, DD dimerisationdomain, S serine phosphorylation domain

Tumor Biol.

Author's personal copy

modified Eagle’s medium without phenol red (DMEM;Sigma-Aldrich) supplemented with 10 % foetal bovine se-rum (FBS). Both cell lines were cultured on arrival andexpanded to provide frozen stocks. ATCC cell lines areauthenticated by short tandem repeat analysis.

Hormone treatment

MDA-MB-231 and MCF-7 cells were cultured to 50–60 %confluency, serum-starved for 24 hours and treated withcomplete growth media supplemented with increasing dosesof β-oestradiol (0.01–10 μM, Sigma-Aldrich) or an ethanolonly control. After 24 h, cells were harvested into lysisbuffer (0.125 M Tris–HCl pH6.8, 2 % SDS, 10 % glycerol,10 % β-mercaptoethanol, 0.1 % bromophenol blue). For cellfractionation, MDA-MB-231 and MCF-7 cells were stimu-lated with 1 μM β-oestradiol and cultured for 24 h.

Knockdown of PR expression by RNAi

siPORT NeoFX Transfection Agent and siRNA (AppliedBiosystems) were added to MCF-7 cells plated onto 12-well plates (1×105 cells per well). A positive transfectioncontrol GAPDH siRNA and untargeted negative controlsiRNA (both Applied Biosystems, sequences not provided)were included on each culture plate. Transfections wereperformed in DMEM supplemented with FBS in the ab-sence of antibiotic. Cells were harvested 72 h post-transfection by lysis as described above. siRNA knock-downs were performed in duplicate during each experimentand repeated in three independent experiments. The sequen-ces of the PR siRNA used are detailed below (5′–3′):

Sense: GGUUUUCGAAAGUUACAUAttAntisense: UAGUGUAAGUUUCGAAAACCtg

Immunoblotting

MDA-MB-231 and MCF-7 whole cell lysates were preparedfollowing routine culture, hormone stimulation or siRNAtransfection. Immunoblotting was performed as previouslydescribed [27]. The following antibodies were used: NCL-PgR-B and NCL-PgR-AB (Novocastra, Leica Microsystems);C19 (Santa Cruz Biotechnologies, sc-538); and GAPDH(Santa Cruz Biotechnologies, sc-25778). ECL or Super SignalFemto ECL (Pierce) were used for protein detection.

RNA extraction and RT-PCR

Total RNA was extracted from MDA-MB-231 and MCF-7breast cancer cell lines and frozen breast tumour tissue usingthe SV Total RNA Isolation Kit (Promega) as previouslydescribed [27]. One microgram of total RNA was reverse-

transcribed into cDNA and amplified using PCR Master Mix(Promega). PCR primers were designed to target each exon ofthe PR gene and used in combination to perform long-rangePCR and ‘walk’ the gene to assess exon inclusion/exclusionand potential intronic retention. PCR products were separatedand analysed by agarose gel electrophoresis and a QIAxcelBioanalyser (Qiagen). Primers targeted to intronic sequenceswere also used; a previously reported exon M sense primer[13] and exon i45b antisense primer [28] were used, andprimers were designed to target the previously reported exonS and T sequences [11, 12]. Nucleotide sequences of theprimers used for PCR (5′–3′):

Sense exon 1 (S1): ACGGTGATGGATTTCATCC; S2:GGATTCAGAAGCCAGCCA; S3: AGCACAACTACTTATGTGC; S4: AGTTCAATAAAGTCAGAGTTG; S5:GAAACTTACATATTGATGACC; S6: GCGGATGAAAGAATCATCA;S7:CCTTTGGAAGGGCTACGA;Antisenseexon 2 (A2): TGGCTGGCTTCTGAATCC; A3: CGGATTTTATCAACGATGC; A4: CACAACTCTGACTTTATTGAA;A5: GGTCATCAATATGTAAGTTTC; A6: TGATGATTCTTTCATCCGC; A7: TCGTAGCCCTTCCAAAGG;A8: AGAAGGGGTTTCACCATC; Exon M sense:GGGCTGGCAAACAGATG; Exon S sense: CAGGAGAGTGGGTGCTC; Exon T sense: TCTGCAGGTCATCCCAC; Exon i45b antisense: CTTCCTACTTTCCCACGGA.

Cloning of PCR products and DNA sequencing

PCR products were cloned into the pCR4-TOPO plasmidvector (Invitrogen, Life Technologies) for sequencing. DNAsequencing was undertaken by SourceBiosciences. Analysisof the nucleotide sequences was performed using ALIGN(http://xylian.igh.cnrs.fr/bin/align-guess.cgi) and predictionof the effect on encoded protein sequence was performedusing ExPASy Translate (http://web.expasy.org/translate).

Ligand blot assay

Cytosolic, membrane, nuclear and cytoskeletal fractionswere prepared from MDA-MB-231 cells (ProteoExtractkit, Calbiochem). Seven micrograms of each cell fractionwas separated by SDS-PAGE and transfered onto nitrocel-lulose membrane. Membranes were simultaneously used forimmunoblotting using C19 as described above and ligandblotting following the protocol of Jang and Yi [29] using1 μM HRP-conjugated progesterone (P-POD; Fitzgerald).The purity of cell fractions was confirmed by immunoblot-ting using the following primary antibodies: anti-α-tubulin(Sigma-Aldrich, T6074; cytosolic fraction), anti-c-jun(Santa Cruz Biotechnologies, sc-7481; nuclear fraction)and anti-vimentin (Santa Cruz Biotechnologies, sc-6260;cytoskeletal fraction).

Tumor Biol.

Author's personal copy

Co-immunoprecipitation (Co-IP)

Nuclear and cytoplasmic extracts were prepared fromMDA-MB-231 and MCF-7 cells using the Universal Mag-netic Co-IP Kit (Active Motif). Experiments were per-formed using 50 μg nuclear extract and 0.1 μg anti-PSFantibody (Sigma-Aldrich, P-2680) or control IgG (SantaCruz Biotechnologies) per reaction. Precipitated proteinswere analysed by immunoblotting using C19 as describedabove. Purity of cell fractions was confirmed by immuno-blotting using the following primary antibodies: anti-ERK-1(BD Transduction Labs, 610030; cytoplasmic fraction) andanti-c-jun (Santa Cruz, sc-7841; nuclear fraction).

DNA affinity precipitation assay (DAPA)

Biotinylated single-strand DNA oligonucleotides wereobtained from Invitrogen, Life Technologies and comple-mentary pairs combined by denaturation to generate double-stranded DNA oligonucleotides. Sequences for the sensestrands of the consensus PRE and mutated PRE (PREmut)oligonucleotides are shown below. Bases altered in themutated sequence are underlined in bold font:

PRE: GATCCTGTCACGGATGTTCTAGCTACAPREmut: GATCCTCAACAGGATCATCTAGCTACA

Nuclear and cytoplasmic fractions were isolated fromMDA-MB-231 cells as described for Co-IP. Fifty micro-grams of nuclear or cytoplasmic extract was incubated in400 μl DAPA binding buffer (12 mM HEPES pH7.9, 4 mMTris–HCl, 60 mM KCl, 5 % glycerol, 0.5 mM EDTA) with0.25 μg synthetic biotinylated double-stranded PRE orPREmut oligonucleotides. DNA/protein complexes were pre-cipitated using streptavidin magnetic beads (Active Motif),as previously described [27]. Precipitated proteins wereanalysed by immunoblotting using C19 as described above.

Results

Detection of truncated PR proteins in a reportedly PR-negative breast cancer cell line

To investigate the hypothesis that alternative splicing maygenerate truncate PR variants which would not be detectedby the N-terminally targeted antibodies used in breast cancerscreening, two different breast cancer cell lines werescreened using commercial PR antibodies targeted to differ-ent epitopes. MCF-7 breast cancer cells which are describedas PR positive, and MDA-MB-231 cells which are tradi-tionally described as PR negative [30] were assessed byimmunoblotting using an antibody targeted to BUS (NCL-PgR-B), an antibody targeted to NTD (NCL-PgR-AB) and

an antibody targeted to LBD (C19). Both of the N-terminally targeted antibodies detected protein specificallyin MCF-7 cells with immunoreactive bands seen at 120 kDa(PR-B) and 80 kDa (PR-A) (Fig. 2a). Since NCL-PgR-B istargeted to BUS, this antibody should not detect PR-A,suggesting non-specific binding. The specificity of this an-tibody is further evaluated below. In contrast to the N-terminally targeted antibodies, C19 detected protein in bothMCF-7 and MDA-MB-231 cells (Fig. 2b). The range ofprotein sizes detected in reportedly PR-negative breast can-cer cells may be indicative of expression of truncated pro-teins which result from alternative splicing of PR pre-mRNA. However, recent literature has questioned the spec-ificity of this and other non-N-terminally targeted PR anti-bodies [31–33]. Therefore, the specificity of the C19antibody was also further analysed.

PR is described as an oestrogen-responsive gene [1], andoestrogen has recently been linked to alternative splicing[34, 35]. Therefore, the effect of β-oestradiol stimulation onthe pattern of protein expression detected by C19 in thebreast cancer cell lines was assessed. Cells stimulated withincreasing concentrations of β-oestradiol (0–10 μM) werelysed and analysed by immunoblotting. Increased expres-sion of a range of proteins from 30 to 60 kDa was detectedusing C19 with increased β-oestradiol concentrations inMDA-MB-231 cells (Fig. 2c). In contrast, no stimulationof low molecular PR expression was observed in MCF-7cells treated with media supplemented with β-oestradiol(Fig. 2c).

As described above, detection of an 80-kDa protein bythe BUS targeted antibody NCL-PgR-B suggests non-specific binding (Fig. 2a). Furthermore, the specificity forPR of the C19 antibody, which we have suggested maydetect truncated PR proteins, has been disputed. In orderto assess the specificity of these antibodies, PR-positiveMCF-7 cells were transfected with PR targeted siRNA toknockdown expression. Cells were then lysed and PR ex-pression analysed by immunoblotting using NCL-PgR-Band C19. Almost complete knockdown of the 120-kDaprotein detected by NCL-PgR-B was observed followingsiRNA transfection, whereas no reduction in expression ofthe 80-kDa protein was observed demonstrating that thisantibody binds PR-B and a non-specific protein with asimilar molecular weight to PR-A (Fig. 2d). The reducedexpression of PR-B observed in Fig. 2d serves as a positivecontrol for successful PR knockdown by siRNA. Whole celllysates from these MCF-7 cells with confirmed PR knock-down were then analysed by immunoblotting using C19,demonstrating reduced expression of two proteins in therange 35–50 kDa and of an 80-kDa protein (Fig. 2e, high-lighted by red arrows). In contrast to recent reports [31–33],these results confirm that this antibody does detect PRproteins and further suggest that proteins detected by C19

Tumor Biol.

Author's personal copy

in MDA-MB-231 cells may be truncated PR variants. How-ever, as seen in Fig. 2e, C19 also detects proteins which arenot reduced in expression following PR siRNA treatmentdemonstrating that, as previously reported, this antibodyalso exhibits non-specific binding.

Identification of PR ASEs in MDA-MB-231 cells

Since truncated PR proteins were detected in reportedly PR-negative MDA-MB-231 cells, an RT-PCR-based gene walk-ing assay was undertaken to assess the expression andalternative splicing of PR mRNA in this cell line. MCF-7cells were analysed as a positive control for PR expressionto confirm that all primers generate PCR product (data notshown). Primers were designed to target each exon of thePR gene and used in combination to examine the inclusion/exclusion of each exon. The first observation is that PR

mRNA can be detected in MDA-MB-231 cells, supportingthe protein data described above. Figure 3 shows examplesof splicing patterns obtained from the PR gene walkingassay in MDA-MB-231 cells utilising long-range PCR withprimer pairs that span exon 1 through to exon 7 of the PRgene. A primer pair spanning exon 1 and exon 3 or exon 4detects a truncated PCR product suggesting deletion of exon2 (Fig. 3a). In Fig. 3b, primers pairs spanning exon 1through to exon 4 detect full-length PCR product; primersspanning exon 1 to exon 5 or 6 detect an additional truncat-ed band suggesting exon deletion. Primer pairs for exon 2through to exon 7 and exon 2 through to exon 6 providefurther evidence of exon skipping events within these down-stream exons (Fig. 3c). In addition to the gene walkingassay, RT-PCR was performed using primers directed tothe previously identified intronic regions S, T, M and i45bwhich have been reported to be retained in PR mRNA. All

Fig. 2 a Analysis of PR expression in MCF-7 and MDA-MB-231cells by immunoblotting using PR antibodies with N-terminal epitopes;NCL-PgR-B targeted to BUS and NCL-PgR-AB targeting BUS andNTD. b Analysis of PR expression in MCF-7 and MDA-MB-231 cellsby immunoblotting using the C19 antibody targeted to LBD. c MCF-7and MDA-MB-231 cells were lysed following stimulation with a rangeof concentrations of β-oestradiol (0.001–10 μM) or an ethanol onlycontrol (0 μM). Whole cell lysates were analysed by immunoblottingusing C19 to analyse the effect of β-oestradiol stimulation on PRprotein expression. Results are representative of two independent

experiments. d, e MCF-7 cells were transfected with siRNA targetingPR. MCF-7 cells were also transfected with a positive transfectioncontrol GAPDH siRNA (G) or an untargeted negative control siRNA(N). Whole cell lysates from cells 72 h after transfection were analysedby immunoblotting using commercial PR antibodies to validate anti-body specificity and PR protein expression. Reduced GAPDH expres-sion can be observed in each experiment in cells treated with thepositive control siRNA (G). d Immunoblotting using NCL-PgR-B. eImmunoblotting using C19

Tumor Biol.

Author's personal copy

four of these ASV mRNAs were detected in positive controlMCF-7 cells, and PR-M mRNAwas also detected in MDA-MB-231 cells (Fig. 3d).

The truncated PCR products generated by this genewalking assay were cloned and sequenced to confirm thedeleted region by comparison with the PR gene sequence(NCBI Accession NM_000926.4). mRNA structures result-ing from the deletions which were identified in MDA-MB-231 cells are illustrated in the schematic diagrams shown inFig. 3d. ASEs were termed Δ for deletion, followed by theexon number(s) which were deleted. Several novel deletionsof parts of exon 1 and spanning exon 1-exon 2, the previ-ously reported whole exon deletions of exon 2 and thecassette exons 3 and 4, and novel deletions involving partsof exon 4, exon 5 and exon 6, as well as spanning theseexons were identified in MDA-MB-231 cells. Figure 3d alsoindicates the presence of a premature termination codon(PTC) or alternative translational start site in mRNA result-ing from each ASE.

Identification of PR ASEs which may affect the reported PRstatus of breast tumours

Since alternatively spliced PR mRNA was detected in abreast cancer cell line characterised as PR negative, poten-tially encoding proteins which are not detected by N-terminal antibodies, we assessed the expression and splicingof PR mRNA in breast tumour tissues of differing reportedPR status and tumour grade as determined at the time ofdiagnosis. RT-PCR was performed to assess the inclusion/exclusion of PR exons 4 and 6 and for the retention of thePR-M intronic sequence. A primer pair spanning exon 3–exon 5 detected full-length PR mRNA and PRΔ4 mRNA inbreast tumours characterised as PR positive and PR negative(Fig. 4a). Interestingly, ductal carcinoma in situ (DCIS)(Fig. 4a; lanes 10, 12, 14) appear to predominantly expressPRΔ4, whereas most samples described as higher gradeinvasive tumours express more full-length mRNA. The rel-ative levels of PRΔ4 mRNA and full-length PR mRNA

500bp

PR-S PR-T PR-M PR-i45M M 1-3 1-4

100bp

1-4 1-5 1-6

500bp

M

1 4 5 6 7 83Δ2

1 2 4 5 6 7 8Δ3

1 2 5 6 7 83Δ4

1 2 4 5 6 7 83Δp4

1 2 4 6 7 83Δp4,5,p6

1 2 4 5 6 7 83Δp5,p6

1 2 4 5 6 7 83Δp6

PR-M 1 2 4 5 67 83 M

2 4 5 6 7 83

1 2 4 5 6 7 83Δp1a

1 2 4 5 6 7 83Δp1b

1 2 4 5 6 7 83Δ p1c

1 2 4 5 6 7 83Δp1,p2

1PR-B

e)

649bp within exon 1; PTC within exon 1

329bp within exon 1; PTC within exon 2

In frame: 669bp within exon 1

682bp of exon 1 and 27bp of exon 2; PTC within exon 1

Exon 2; PTC within exon 3

Cassette exon 3

Cassette exon 4

76bp within exon 4; PTC within exon 4

214bp of exon 4, exon 5 and 14bp of exon 6; PTC within exon 6

26bp of exon 5 and 105 bp of exon 6;PTC within exon 6

In frame: 96bp within exon 6

Retention of intronic ‘exon’ M

c)b) d)2-7 2-6 2-5M

500bp

a)

Fig. 3 RT-PCR was performed using RNA extracted from MDA-MB-231and MCF-7 breast cancer cells and primers directed to differentexons of the PR gene. a Results of 35 cycles of PCR using MDA-MB-231 cDNAwith a sense primer directed to exon 1 (S1) and an antisenseto exons 3 and 4. b Results of 45 cycles of PCR using MDA-MB-231cDNAwith S1 and an antisense primer to either exon 4, 5 or 6. c Senseprimer for exon 2 with antisense primers for either exon 7, 6 or 5. A no-template control (NTC) reaction was performed and was negative (datanot shown). d RT-PCR using primers specific to previously reportedintronic exon sequences. PR-S, PR-T and PR-M-specific sense primerswere used in combination with an exon 4 antisense primer and a PR-i45b-specific antisense primer in combination with an exon 4 senseprimer. PCR was performed for 35 cycles using MCF-7 and MDA-

MB-231 cDNA. e PR ASEs were identified by cloning and sequencingof PCR products generated by the PR gene walking assay and com-parison to the PR gene sequence (NCBI Accession: NM_000926.4)using ALIGN. ASEs are termed Δ (deletion) followed by the exonnumber(s) deleted. Partial exon deletions are indicated by ‘p’ beforethe exon number. Diagrammatic representations of the mRNA struc-tures resulting from each ASE affecting PR-B are shown, with adescription of each deletion/retention and the effect on translationalreading frame. Bold lines within an exon represent a premature termi-nation codon (PTC) introduced by the ASE. The exon M specifictranslational start site is indicated by the dotted line. Full-length PR-B mRNA structure is shown and each exon depicted relative to thelength in nucleotides

Tumor Biol.

Author's personal copy

were determined using a QIAxcel Bioanalyser (Fig. 4b).The data show that in some DCIS samples there can be upto a 3.9-fold difference in levels of PRΔ4 mRNA comparedto full-length PR mRNA (Fig. 4c, lane 3).

A primer pair spanning exon 5–exon 7 detected full-length mRNA and PRΔ6 mRNA (Fig. 4d). A sense primerdirected to the intronic PR-M sequence paired with a PRexon 5 antisense primer detected PR-M mRNA, predicted toencode an N-terminally truncated protein, in both PR-

positive and reportedly PR-negative breast tumour samples(Fig. 4e).

Truncated PR proteins in MDA-MB-231 cells possessfunctional characteristics similar to PR-A and PR-B

MDA-MB-231 cells were separated into cytosolic, mem-brane, nuclear and cytoskeletal fractions which were sepa-rated by SDS-PAGE before transfer to nitrocellulose

S3/A5

500bp

M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 100bp

1000bp

PR+ PR- MC

F-7

NT

C

M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16

500bp

100bp

1000bp

S5/A7

M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17

500bp

100bp

1000bp

PR+ PR- MC

F-7

NT

C

PR-M PR+ PR- MC

F-7

c)

a)

500bp

100bp

exon 4 inclusion

exon 4 deletion

1 2 3

b)

d)

e)

Fig. 4 RNA was extractedfrom breast tumour tissue andused for RT-PCR using specificPR primer pairs. MCF-7 RNAserved as a positive control anda no-template control reaction(NTC) was performed for eachprimer pair. PCR reactions wereperformed for 45 cycles. ThePR status of breast tumoursamples is indicated above eachpanel. a RT-PCR using primersspanning exon 3 (S3) to exon 5(A5). b PCR products separatedusing a QIAxcel Bioanalysershowing exon 4 inclusion andexon 4 deletion; c bar chartshowing relative ratios ofPRΔ4 mRNA compared to full-length PR mRNA using RNAfrom ductal carcinoma (lanes 1and 2) and DCIS tumours (lane3). d RT-PCR using primersspanning exon 5 (S5) to exon 7(A7). e RT-PCR using a PR-M-specific sense primer and anantisense primer targeted to ex-on 5

Tumor Biol.

Author's personal copy

membrane. Membranes were simultaneously used for aligand blot assay and immunoblotting using C19. Ligandblotting demonstrates the ability of proteins present inMDA-MB-231 cell fractions to bind HRP-conjugated pro-gesterone (Fig. 5a, left hand panel). A comparison of theseprogesterone binding proteins to the pattern of proteinsdetected in the same fractions by immunoblotting withC19 demonstrates that proteins of 100 kDa, 55 kDa, adoublet at 40–50 kDa and three proteins between 35 and

40 kDa were detected by both assays, suggesting that PRproteins with progesterone binding capability are present inMDA-MB-231 cells (Fig. 5a, highlighted with colouredboxes). The purity of cell fractions was confirmed by im-munoblotting for α-tubulin (cytosolic), c-jun (nuclear) andvimentin (cytoskeletal) (Fig. 5a, lower panel). Since a suit-able membrane control antibody was not available, thepurity of the membrane fraction was concluded based onthe purity of other fractions. Membrane proteins have not

35kDa

42kDa

55kDa

72kDa

100kDa

Cso

M N Csk

Cso

M N Csk

DOP-P91C

-tubulin

c-jun

vimentin

35kDa

42kDa

55kDa

72kDa

100kDa

a) b)

+ - + - N C

100kDa

72kDa

42kDa

35kDa

ERK-1 c-jun

N C d)

N C N C N C N C

PRE PREmut PRE PREmut

MCF-7 MDA-MB-231

120kDa

100kDa

35kDa

c)

PR-A

PR-B

Fig. 5 MDA-MB-231 cells were stimulated for 24 h with 1 μM β-oestradiol. Following stimulation, cells were separated into either fourfractions (cytosolic (Cso), membrane (M), nuclear (N) and cytoskeletal(Csk)) or two fractions (nuclear (N) and cytoplasmic (C)). Results arerepresentative of two independent experiments. a Upper left panelshows analysis of the presence of progesterone binding proteins byligand blotting. Upper right panel represents protein expression deter-mined by immunoblotting using C19. Coloured boxes highlight pro-teins detected by both assays. The purity of cell fractions isdemonstrated by immunoblotting for α-tubulin (cytosolic fraction), c-jun (nuclear fraction) and vimentin (cytoskeletal fraction). Membrane

fraction purity is assumed due to the purity of other fractions and thedistinct pattern of proteins observed in each fraction. b Analysis byimmunoblotting using C19 of proteins precipitated from MDA-MB-231 nuclear and cytoplasmic fractions by Co-IP using an antibodytargeting the PR nuclear co-factor PSF. c Analysis by immunoblottingwith C19 of PRE binding proteins precipitated by PRE or PREmut

during DAPA experiments using MDA-MB-231 nuclear and cytoplas-mic fractions. d The purity of nuclear and cytoplasmic fractions usedfor Co-IP and DAPA is demonstrated by immunoblotting for c-jun(nuclear fraction) and ERK-1 (cytoplasmic fraction)

Tumor Biol.

Author's personal copy

been analysed as part of this study since membrane-associated PR and progesterone receptor membrane compo-nent are well studied and unrelated to PR-A and PR-B [36].

PSF has previously been demonstrated to interact withPR-A and PR-B and to associate with PRE [27]. To assessthe ability of truncated PR proteins expressed in MDA-MB-231 cells to interact with this PR co-factor, nuclear andcytoplasmic extracts from MDA-MB-231 cells were usedfor Co-IP using an anti-PSF antibody or a control IgG.Proteins which were co-immunoprecipitated with PSF orIgG were analysed by immunoblotting using C19. A proteinof 80 kDa in both fractions and a doublet of proteins around35–40 kDa in the cytoplasmic fraction were detected by C19specifically in cell fractions incubated with the anti-PSFantibody (Fig. 5b).

MDA-MB-231 and MCF-7 nuclear and cytoplasmic frac-tions were also incubated with synthetic biotinylated PRE orPREmut oligonucleotides. Following precipitation withstreptavidin magnetic beads, immunoblotting using C19detected a protein of approximately 120 kDa in nuclearand cytoplasmic fractions of MDA-MB-231 cells. Similarto PR-A and PR-B detected in MCF-7 cells, this protein wasprecipitated with both PRE and PREmut. However, thisprotein was not the same as either PR isoform detected inthe MCF-7 cells (Fig. 5c, upper panel). A nuclear protein ofapproximately 35 kDa was detected by immunoblotting ofprecipitated proteins with C19, and this protein appeared tobind preferentially to the consensus PRE oligonucleotide(Fig. 5c, lower panel). The purity of the nuclear and cyto-plasmic fractions used for Co-IP and DAPA experimentswas confirmed by immunoblotting for c-jun (nuclear) andERK-1 (cytoplasmic) (Fig. 5d).

Discussion

We report that the LBD targeted PR antibody C19 detectsprotein in the reportedly PR-negative MDA-MB-231 breastcancer cell line. However, recent literature has disputed thespecificity of this antibody [31–33]. Reducing levels of PRin MCF-7 cells by RNAi indicate that this antibody doesexhibit some non-specific binding, and in agreement withMadsen et al. [31], we demonstrate that the 60-kDa bandpreviously described as PR-C does not represent a PRprotein. However, we also demonstrate that C19 detects arange of proteins which are reduced in expression by PRtargeted siRNA and thus conclude that this antibody iscapable of detecting PR proteins in the MDA-MB-231 cells.

PR is described as an oestrogen-responsive gene, con-taining an oestrogen response element half-site in both PR-A and PR-B promoters [1]. The expression of truncated PRproteins detected in MDA-MB-231 cells by C19 is respon-sive to β-oestradiol stimulation. MDA-MB-231 cells are

commonly described as oestrogen receptor (ER) negative,suggesting that such a response would not be predicted.However, a recent study has identified the alternativelyspliced ERα36 variant in MDA-MB-231 cells and reportedthat expression of ERα36 was necessary for an observedmitogenic effect of oestrogen on this cell line [37]. Ourobservations support this report of oestrogen responsivenessin MDA-MB-231 cells which we suggest also express trun-cated PR variants as a result of alternative splicing.

Several previous studies have identified alternativelyspliced PR variant mRNA in a range of human cell linesand tissues; these splicing events involve deletion of whole,partial and multiple exons, as well as retention of intronicsequences [15, 38–40]. However, until recently, no studieshad reported PR mRNA in MDA-MB-231 cells; Springwaldet al. identified exon 6 and exon 6+7 deleted PR mRNA inMDA-MB-231 cells using splice-specific primers for real-time qPCR [41]. Our study represents a more comprehen-sive study of PR ASEs in MDA-MB-231 cells, using pri-mers to analyse each exon of the PR gene, thus ‘walking’along the gene and analysing the inclusion/exclusion of eachexon as well as any potential intron retentions. We have, forthe first time, identified the previously reported Δ2, Δ3 andΔ4 exon deletions and PR-M intron retention in MDA-MB-231 cells. We have also identified several novel PR ASEsinvolving partial exon deletions or deletions spanning morethan one exon in this cell line. Analysis of these alternative-ly spliced mRNA sequences predicts that many of the dele-tions would cause a change in the translational readingframe generating a PTC (as indicated in Fig. 3d). Thepresence of a PTC targets mRNA transcripts for degradationby the nonsense-mediated decay (NMD) pathway [42, 43],indicating that coupling of splicing and NMD contributes tothe regulation of the PR gene in these breast cancer cells.Our study also suggests that ASE produce mRNA tran-scripts in MDA-MB-231 cells that translate into PR proteinsthat may function differently compared to nuclear PR-A orPR-B due to deletion of functional domains. The predictedprotein structures resulting from each ASE affecting PR-BmRNA are represented in Fig. 6.

Exon 4 encodes the hinge region which contains a nu-clear location signal and a region described as the C-terminal extension of the DBD [44]. Deletion of exon 4would therefore be predicted to reduce nuclear localisationand reduce the strength of DNA interactions, thus having anegative effect on the ability of the PRΔ4 protein to act as atranscriptional regulator. Indeed, a previous study hasreported that when overexpressed in a PR-negative cell line,PRΔ4 was unable to bind DNA [15]. However, this latterstudy was published before the recent description of non-genomic PR signalling mechanisms through which this var-iant protein could function if it were segregated from thenucleus [5, 6]; a Δ4 variant of PR-B would still possess the

Tumor Biol.

Author's personal copy

N-terminal proline-rich domain which mediates interactionwith c-Src [6]. Deletion of exon 3 could result in a proteinlacking DNA binding ability since this exon encodes thesecond zinc finger of the DBD [45]. However, this proteinmay also be able to function non-genomically, as describedfor PRΔ4. The novel PRΔp1c mRNA could encode aprotein lacking a portion of the NTD proximal to theDBD, including the AF1 domain. Whilst this protein maystill function as a nuclear PR, interaction with co-regulatorsmay be altered compared to PR-A or PR-B. The novelPRΔp6mRNA would encode a protein lacking 32 aminoacids from the LBD. This protein may therefore lack, orpossess altered, ligand binding capability but still be func-tional since ligand-independent activation of PR has beendescribed through phosphorylation via cross-talk with othersignalling pathways [46, 47]. PR-M mRNA was alsodetected in MDA-MB-231 cells; PR-M mRNA encodes a38-kDa protein containing an isoform-specific N-terminalsequence, the hinge region, LBD, DD and AF2 [13]. Thisisoform lacks DNA binding capability but would still beable to bind hormone as well as interact with PR co-regulators and other PR isoforms.

The N-terminally truncated PR-M protein may be one ofthe PR proteins detected in MDA-MB-231 cells. However,since truncated PR proteins were detected specifically by anLBD targeted antibody suggesting that they lack the NTDregion targeted by the other antibodies used, these proteinsare unlikely to be exon-deleted variants of either PR-A orPR-B. It is possible that the exon deletion ASEs detected inMDA-MB-231 cells affect mRNA with altered exon 1 ex-pression as described for other hormone receptors. Thehuman glucocorticoid receptor has multiple non-coding

exons 1 which are differentially spliced onto exon 2 leadingto alternative patterns of downstream exon inclusion [48].Similarly, leader exons within the ERα 5′ UTR are differ-entially spliced onto exon 2, leading to skipping of exon 1and differential patterns of downstream splicing to generatethe ERα36 and ERα46 spliced variants [49, 50]. It is there-fore plausible that a similar relationship between exon 1inclusion and downstream ASEs exists for PR to generateexon-deleted mRNA which encodes the N-terminally trun-cated proteins detected in MDA-MB-231 cells.

Our PR gene walking assay has also detected alternative-ly spliced PR mRNA, including that encoding the N-terminally truncated PR-M isoform, in breast tumour tissueswhich are characterised as being PR negative. Expression ofPR-M protein would not be detected by current breastcancer screening techniques. Similarly, N-terminally trun-cated ERα spliced variants would be undetectable in breastcancer screening. Further to the detection of ERα36 inMDA-MB-231 cells, an isoform-specific antibody has re-cently been used to detect this alternatively spliced variantprotein in breast tumour samples which are described as ERnegative following screening using N-terminally targetedERα antibodies [37]. Together, these results suggest thatalternative splicing may generate hormone receptor iso-forms that are not detected by traditional breast cancerscreening which impact upon therapeutic options. Interest-ingly, in this small sample size, we observe a switch frompredominant expression of PRΔ4 in DCIS to predominantinclusion of exon 4 in higher grade invasive tumours; theseDCIS patients were disease-free after 5 years. Although thisinitial observation warrants further investigation, using alarger cohort of breast tumours, it is interesting to speculate

Fig. 6 The structure of full-length PR-B protein is shown(a), representing each function-al domain encoded by the eightexon PR gene. Amino acidsequences encoded by each al-ternatively spliced PR mRNAidentified in MDA-MB-231cells were predicted usingExPASy Translate. The pre-dicted protein structuresencoded by each mRNA result-ing from ASEs which do notgenerate a PTC are depicted,illustrating deletion/truncationof functional domains relativeto PR-B (b–f)

Tumor Biol.

Author's personal copy

that a potential change in alternative splicing events occursduring cancer development which may affect protein ex-pression and function.

For the expression of these alternatively spliced PR var-iants to be clinically relevant to the management and treatmentof breast cancer patients, it is important to identify whether ornot they are functional. We have assessed the ability of trun-cated PR proteins detected by C19 in MDA-MB-231 cells toundergo key aspects of PR nuclear function. Our resultssuggest that a PR protein of approximately 35 kDa is capableof binding progesterone, interacting with the PR co-factor PSFand binding to PRE, therefore potentially functioning as anuclear PR protein. We also demonstrate that other proteinsdetected by C19, and demonstrated to be PR by RNAi, exhibitsome of the characteristics of nuclear PR. These proteins maytherefore be able to illicit some form of progestin response,possibly through non-genomic signalling, or by modulatingPR-A and PR-B function via competition for ligand or heter-odimerisation. Therefore, PR proteins which are not detectedby current screening could be functional, suggesting a poten-tial for therapeutic response in some reportedly PR-negativepatients. Alternatively, the expression of ASV proteins mayalter the function of PR-A and PR-B, thus affecting the pre-dicted therapeutic response in PR-positive patients.

Acknowledgments The authors wish to thank Mr. David Browell,Gateshead Queen Elizabeth Hospital, for providing access to the frozenbreast tumour tissue used in this study. The authors wish to thankProfessor David Elliott (Institute of Genetic Medicine) for the use ofhis QIAxcel Bioanalyser. This work was supported by a PhD student-ship awarded from the RVI Breast Cancer Research Appeal and sup-plementary funding from the Newcastle Healthcare Charity (RVI/NGH) and Newcastle-upon-Tyne Hospitals NHS Charity (FH).

Conflicts of interest None.

References

1. Kastner P, et al. Two distinct estrogen-regulated promoters gener-ate transcripts encoding the two functionally different human pro-gesterone receptor forms A and B. EMBO J. 1990;9(5):1603–14.

2. Li X, Lonard DM, O'Malley BW. A contemporary understandingof progesterone receptor function. Mech Ageing Dev. 2004;125(10–11):669–78.

3. Giangrande PH, Pollio G, McDonnell DP. Mapping and character-ization of the functional domains responsible for the differentialactivity of the A and B isoforms of the human progesteronereceptor. J Biol Chem. 1997;272(52):32889–900.

4. Abdel-Hafiz H, et al. The inhibitory function in human progesteronereceptor N termini binds SUMO-1 protein to regulate autoinhibitionand transrepression. J Biol Chem. 2002;277(37):33950–6.

5. Boonyaratanakornkit V, et al. The role of extranuclear signalingactions of progesterone receptor in mediating progesterone regu-lation of gene expression and the cell cycle. Mol Endocrinol.2007;21(2):359–75.

6. Boonyaratanakornkit V, et al. Progesterone receptor contains aproline-rich motif that directly interacts with SH3 domains andactivates c-Src family tyrosine kinases. Mol Cell. 2001;8(2):269–80.

7. Carnevale RP, et al. Progestin effects on breast cancer cell proliferation,proteases activation, and in vivo development of metastatic phenotypeall depend on progesterone receptor capacity to activate cytoplasmicsignaling pathways. Mol Endocrinol. 2007;21(6):1335–58.

8. Faivre EJ, et al. Progesterone receptor rapid signaling mediatesserine 345 phosphorylation and tethering to specificity protein 1transcription factors. Mol Endocrinol. 2008;22(4):823–37.

9. Proietti CJ, et al. Activation of Stat3 by heregulin/ErbB-2 throughthe co-option of progesterone receptor signaling drives breastcancer growth. Mol Cell Biol. 2009;29(5):1249–65.

10. Matlin AJ, Clark F, Smith CW. Understanding alternative splicing:towards a cellular code. Nat Rev Mol Cell Biol. 2005;6(5):386–98.

11. Hirata S, et al. The novel isoform of the progesterone receptorcDNA in the human testis and detection of its mRNA in the humanuterine endometrium. Oncology. 2000;59 Suppl 1:39–44.

12. Hirata S, et al. The novel exon, exon T, of the human progesteronereceptor gene and the genomic organization of the gene. J SteroidBiochem Mol Biol. 2002;80(3):365–7.

13. Saner KJ, et al. Cloning and expression of a novel, truncated, pro-gesterone receptor. Mol Cell Endocrinol. 2003;200(1–2):155–63.

14. Cork DM, Lennard TW, Tyson-Capper AJ. Alternative splicingand the progesterone receptor in breast cancer. Breast Cancer Res.2008;10(3):207.

15. Richer JK, et al. Progesterone receptor variants found in breastcells repress transcription by wild-type receptors. Breast CancerRes Treat. 1998;48(3):231–41.

16. Hanley KZ, et al. Evaluation of new monoclonal antibodies indetection of estrogen receptor, progesterone receptor, and Her2protein expression in breast carcinoma cell block sections usingconventional microscopy and quantitative image analysis. DiagnCytopathol. 2009;37(4):251–7.

17. Cui X, et al. Biology of progesterone receptor loss in breast cancerand its implications for endocrine therapy. J Clin Oncol. 2005;23(30):7721–35.

18. Hopp TA, et al. Breast cancer patients with progesterone receptorPR-A-rich tumors have poorer disease-free survival rates. ClinCancer Res. 2004;10(8):2751–60.

19. Beral V. Breast cancer and hormone-replacement therapy in theMillion Women Study. Lancet. 2003;362(9382):419–27.

20. Persson I, et al. Risks of breast and endometrial cancer afterestrogen and estrogen–progestin replacement. Cancer Causes Con-trol. 1999;10(4):253–60.

21. Rossouw JE, et al. Risks and benefits of estrogen plus progestin inhealthy postmenopausal women: principal results from the Wom-en's Health Initiative randomized controlled trial. JAMA. 2002;288(3):321–33.

22. Anderson H, et al. Relationship between estrogen receptor, pro-gesterone receptor, HER-2 and Ki67 expression and efficacy ofaromatase inhibitors in advanced breast cancer. Ann Oncol.2011;22(8):1770–6.

23. Balleine RL, et al. Absence of progesterone receptor associatedwith secondary breast cancer in postmenopausal women. Br JCancer. 1999;79(9–10):1564–71.

24. Bardou VJ, et al. Progesterone receptor status significantlyimproves outcome prediction over estrogen receptor status alonefor adjuvant endocrine therapy in two large breast cancer data-bases. J Clin Oncol. 2003;21(10):1973–9.

25. Coyle YM, et al. Progesterone receptor expression is a marker forearly stage breast cancer: implications for progesterone receptor asa therapeutic tool and target. Cancer Lett. 2007;258(2):253–61.

26. Im A, Appleman LJ. Mifepristone: pharmacology and clinicalimpact in reproductive medicine, endocrinology and oncology.Expert Opin Pharmacother. 2010;11(3):481–8.

Tumor Biol.

Author's personal copy

27. Tyson-Capper AJ, Shiells EA, Robson SC. Interplay between polypyr-imidine tract binding protein-associated splicing factor and human myo-metrial progesterone receptors. J Mol Endocrinol. 2009;43(1):29–41.

28. Yamanaka T, et al. Progesterone receptor mRNA variant contain-ing novel exon insertions between exon 4 and exon 5 in humanuterine endometrium. Endocr J. 2002;49(4):473–82.

29. Jang S, Yi LS. Identification of a 71 kDa protein as a putative non-genomic membrane progesterone receptor in boar spermatozoa. JEndocrinol. 2005;184(2):417–25.

30. Neve RM, et al. A collection of breast cancer cell lines for thestudy of functionally distinct cancer subtypes. Cancer Cell.2006;10(6):515–27.

31. Madsen G, et al. Progesterone receptor or cytoskeletal protein?Reprod Sci. 2007;14(3):217–22.

32. Pang Y, and Thomas P. Progesterone signals through membraneprogesterone receptors (mPRs) in MDA-MB-468 and mPR-transfected MDA-MB-231 breast cancer cells which lack full-length and N-terminally truncated isoforms of the nuclear proges-terone receptor. Steroids. 2011;76(9):921–8.

33. Samalecos A, Gellersen B. Systematic expression analysis andantibody screening do not support the existence of naturally occur-ring progesterone receptor (PR)-C, PR-M, or other truncated PRisoforms. Endocrinology. 2008;149(11):5872–87.

34. Zhang X, et al. Regulation of alternative splicing of liver scavengerreceptor class B gene by estrogen and the involved regulatorysplicing factors. Endocrinology. 2007;148(11):5295–304.

35. Zhu N, et al. Alternative splicing of Slo channel gene programmedby estrogen, progesterone and pregnancy. FEBS Lett. 2005;579(21):4856–60.

36. Thomas P. Characteristics of membrane progestin receptor alpha(mPRalpha) and progesterone membrane receptor component 1(PGMRC1) and their roles in mediating rapid progestin actions.Front Neuroendocrinol. 2008;29(2):292–312.

37. Zhang XT, et al. A positive feedback loop of ER-alpha36/EGFRpromotes malignant growth of ER-negative breast cancer cells.Oncogene. 2011;30(7):770–80.

38. Balleine RL, Hunt SM, Clarke CL. Coexpression of alternativelyspliced estrogen and progesterone receptor transcripts in humanbreast cancer. J Clin Endocrinol Metab. 1999;84(4):1370–7.

39. Leygue E, et al. Identification of novel exon-deleted progesteronereceptor variant mRNAs in human breast tissue. Biochem BiophysRes Commun. 1996;228(1):63–8.

40. Misao R, et al. Identification of various exon-deleted proges-terone receptor mRNAs in human endometrium and ovarianendometriosis. Biochem Biophys Res Commun. 1998;252(2):302–6.

41. Springwald A, et al. Identification of novel transcript variants ofestrogen receptor alpha, beta and progesterone receptor gene inhuman endometrium. Endocrine. 2010;37(3):415–24.

42. Nicholson P, Muhlemann O. Cutting the nonsense: the degradationof PTC-containing mRNAs. Biochem Soc Trans. 2010;38(6):1615–20.

43. McGlincy NJ, Smith CW. Alternative splicing resulting innonsense-mediated mRNA decay: what is the meaning of non-sense? Trends Biochem Sci. 2008;33(8):385–93.

44. Hill KK, et al. Structural and functional analysis of domains of theprogesterone receptor. Mol Cell Endocrinol. 2012;348(2):418–29.

45. Misrahi M, et al. Structure of the human progesterone receptorgene. Biochim Biophys Acta. 1993;1216(2):289–92.

46. Hagan CR, et al. ck2-Dependent phosphorylation of progesteronereceptors (PR) on Ser81 regulates PR-B isoform-specific targetgene expression in breast cancer cells. Mol Cell Biol. 2011;31(12):2439–52.

47. Pierson-Mullany LK, Lange CA. Phosphorylation of progesteronereceptor serine 400 mediates ligand-independent transcriptionalactivity in response to activation of cyclin-dependent protein ki-nase 2. Mol Cell Biol. 2004;24(24):10542–57.

48. Russcher H, et al. Associations between promoter usage and alter-native splicing of the glucocorticoid receptor gene. J Mol Endo-crinol. 2007;38(1–2):91–8.

49. Flouriot G, et al. Identification of a new isoform of the humanestrogen receptor-alpha (hER-alpha) that is encoded by distincttranscripts and that is able to repress hER-alpha activation function1. EMBO J. 2000;19(17):4688–700.

50. Wang Z, et al. Identification, cloning, and expression of humanestrogen receptor-alpha36, a novel variant of human estrogenreceptor-alpha66. Biochem Biophys Res Commun. 2005;336(4):1023–7.

Tumor Biol.

Author's personal copy