of July 13, 2015.This information is current as

Effects in Alzheimer's DiseaseProtective and Pathogenic Cell Type-Specific Proteinase-Activated Receptor-2 Exerts

Arab, Richard H. Dyck and Christopher PowerPatricia Andrade-Gordon, Morley D. Hollenberg, HosseinaliNathalie Vergnolle, David Westaway, Jack H. Jhamandas, Amir Afkhami-Goli, Farshid Noorbakhsh, Avril J. Keller,

http://www.jimmunol.org/content/179/8/5493doi: 10.4049/jimmunol.179.8.5493

2007; 179:5493-5503; ;J Immunol 

Referenceshttp://www.jimmunol.org/content/179/8/5493.full#ref-list-1

, 27 of which you can access for free at: cites 80 articlesThis article

Subscriptionshttp://jimmunol.org/subscriptions

is online at: The Journal of ImmunologyInformation about subscribing to

Permissionshttp://www.aai.org/ji/copyright.htmlSubmit copyright permission requests at:

Email Alertshttp://jimmunol.org/cgi/alerts/etocReceive free email-alerts when new articles cite this article. Sign up at:

Print ISSN: 0022-1767 Online ISSN: 1550-6606. Immunologists All rights reserved.Copyright © 2007 by The American Association of9650 Rockville Pike, Bethesda, MD 20814-3994.The American Association of Immunologists, Inc.,

is published twice each month byThe Journal of Immunology

by guest on July 13, 2015http://w

ww

.jimm

unol.org/D

ownloaded from

by guest on July 13, 2015

http://ww

w.jim

munol.org/

Dow

nloaded from

Proteinase-Activated Receptor-2 Exerts Protective andPathogenic Cell Type-Specific Effects in Alzheimer’s Disease1

Amir Afkhami-Goli,*†**†† Farshid Noorbakhsh,*† Avril J. Keller,‡ Nathalie Vergnolle,§

David Westaway,¶�# Jack H. Jhamandas,* Patricia Andrade-Gordon,§§ Morley D. Hollenberg,§

Hosseinali Arab,** Richard H. Dyck,‡ and Christopher Power2*†

The proteinase-activated receptors (PARs) are a novel family of G protein-coupled receptors, and their effects in neurodegenerativediseases remain uncertain. Alzheimer’s disease (AD) is a neurodegenerative disorder defined by misfolded protein accumulation withconcurrent neuroinflammation and neuronal death. We report suppression of proteinase-activated receptor-2 (PAR2) expression inneurons of brains from AD patients, whereas PAR2 expression was increased in proximate glial cells, together with up-regulation ofproinflammatory cytokines and chemokines and reduced IL-4 expression (p < 0.05). Glial PAR2 activation increased expression offormyl peptide receptor-2 (p < 0.01), a cognate receptor for a fibrillar 42-aa form of �-amyloid (A�1–42), enhanced microglia-mediatedproinflammatory responses, and suppressed astrocytic IL-4 expression, resulting in neuronal death (p < 0.05). Conversely, neuronalPAR2 activation protected human neurons against the toxic effects of A�1–42 (p < 0.05), a key component of AD neuropathogenesis.Amyloid precursor protein-transgenic mice, displayed glial fibrillary acidic protein and IL-4 induction (p < 0.05) in the absence ofproinflammatory gene up-regulation and neuronal injury, whereas PAR2 was up-regulated at this early stage of disease progression.PAR2-deficient mice, after hippocampal A�1–42 implantation, exhibited enhanced IL-4 induction and less neuroinflammation (p < 0.05),together with improved neurobehavioral outcomes (p < 0.05). Thus, PAR2 exerted protective properties in neurons, but its activationin glia was pathogenic with secretion of neurotoxic factors and suppression of astrocytic anti-inflammatory mechanisms contributing toA�1–42-mediated neurodegeneration. The Journal of Immunology, 2007, 179: 5493–5503.

P roteinases comprise 2% of the human genome and exert awide variety of biological effects (1). Several serine pro-teases are signaling molecules acting through proteolytic

cleavage at specific sites within the extracellular N terminus ofseven transmembrane G protein-coupled receptors, proteinase-ac-tivated receptors (PAR),3 to unmask a tethered ligand domain (2).These ligands bind to conserved domains in extracellular loop II of

the receptor to initiate signaling. Among the four identified PARs,PAR1, PAR3, and PAR4 are targeted by thrombin whereas trypsinand mast cell tryptase activate PAR2 (3–6). In the absence ofproteolytic cleavage, various PARs can also be directly activatedby synthetic hexapeptides corresponding to the tethered ligands (7,8). All four PARs are expressed widely on neurons and glial cellsin the nervous system and regulate diverse cellular functions in-cluding gene transcription, neuronal cell proliferation, differenti-ation, and survival (2, 4, 9). In particular, PAR2 has been shownto have widespread effects in the peripheral nervous system, whereit plays important roles in inflammation, neuronal signaling, andnociception (3, 10–12). PAR2 is also expressed on neurons andglial cells in the CNS and is associated with the pathogenesis ofischemia, neurodegeneration, and neuroinflammation, dependingon the specific disease and experimental paradigm (13–16). Aswell, PAR2 can exert neuroprotective effects (17–19). Neverthe-less, the precise roles that PAR2 plays in different inflammatoryand degenerative brain diseases remain uncertain.

Alzheimer’s disease (AD) is a progressive and fatal neurode-generative disease characterized by irreversible cognitive decline,memory impairment, and behavioral changes. These clinical fea-tures are accompanied by specific pathological changes in thebrain, defined by extracellular deposition of a fibrillar 42-aa formof �-amyloid (A�1–42) peptide surrounded by dystrophic neurites,which constitute senile plaques. A�1–42 is one of the enzymaticcleavage fragments of the amyloid precursor protein (APP), whichexerts direct neurotoxic effects while also inducing endoplasmicreticulum (ER) stress response in neurons (20–24). Nevertheless,the notion that A� deposition is the direct cause of neurodegen-eration associated with AD does not appear to be supported bypathological examination of postmortem human brain tissues; neu-rons, and their processes can appear intact despite diffuse A� de-posits, which might represent early stages of the A� deposition

*Department of Medicine, University of Alberta, Edmonton, Alberta, Canada; †De-partments of Clinical Neurosciences, ‡Psychology, and §Pharmacology and Thera-peutics, University of Calgary, Calgary, Alberta, Canada; ¶Centre for Research inNeurodegenerative Diseases, �Department of Laboratory Medicine and Pathobiology,and #Department of Medical Biophysics, University of Toronto, Toronto, Ontario,Canada; **Department of Pharmacology, Faculty of Veterinary Medicine, Universityof Tehran, Tehran, Iran; ††Department of Pharmacology, Faculty of Veterinary Med-icine, Ferdowsi University of Mashhad, Mashhad, Iran; and §§Johnson & JohnsonPharmaceutical Research and Development, Spring House, PA 19477

Received for publication April 12, 2007. Accepted for publication July 25, 2007.

The costs of publication of this article were defrayed in part by the payment of pagecharges. This article must therefore be hereby marked advertisement in accordancewith 18 U.S.C. Section 1734 solely to indicate this fact.1 These studies were supported by the Canadian Institutes of Health Research (to C.P.,N.V., M.D.H., and R.H.D.) and the Strafford Foundation for Alzheimer’s Research (toR.H.D. and C.P.). N.V. is an Alberta Heritage Foundation for Medical Research(AHFMR) Scholar and a Canadian Institute of Health Research New Investigator, andC.P. holds a Canada Research Chair (T1) in Neurological Infection and Immunity andis an AHFMR Senior Scholar.2 Address correspondence and reprint requests to Dr. C. Power, Department of Med-icine (Neurology), 611 Heritage Medical Research Centre, University of Alberta,Edmonton, Alberta, Canada. E-mail address: chris.power@ualberta.ca3 Abbreviations used in this paper: AD, Alzheimer’s disease; A�1–42, fibrillar 42-aaform of �-amyloid peptide; APP, amyloid precursor protein; ER, endoplasmic retic-ulum; FPRL1, formyl peptide receptor-like-1; FPR2, formyl peptide receptor-2;GRP58, glucose-regulated protein 58; KO, knockout; WT, wild type; MDM, mono-cyte-derived macrophage; PAR, proteinase-activated receptor; RFN, rat fetal neuron;Tg, transgenic; UPR, unfolded protein response; NeuN, neuronal nuclear Ag; GFAP,glial fibrillary acidic protein.

Copyright © 2007 by The American Association of Immunologists, Inc. 0022-1767/07/$2.00

The Journal of Immunology

www.jimmunol.org

by guest on July 13, 2015http://w

ww

.jimm

unol.org/D

ownloaded from

(25). Dystrophic neurites in senile plaques associated with acti-vated glia point to the relevance of inflammatory responses asdeterminants of neuronal degeneration observed in AD. Moreover,the concept of neurodegeneration caused by A�-induced inflam-matory responses has received further impetus from the epidemi-ological and experimental studies, highlighting the effects of non-steroidal anti-inflammatory drugs in preventing or retarding theage of onset of AD (26–28). There is substantial evidence thatsustained neuroinflammation is present in senile plaques with ag-gregation of activated microglia in the center and reactive astro-cytes that marginate the A� deposits and extend their processestoward the center of plaques (25, 29–32). Both activated microgliaand astrocytes are known to secrete a wide variety of moleculesinvolved in neuroinflammation and are potential sources of proin-flammatory and neurotoxic agents in the brain (25, 33–36).

Considering the overall proinflammatory profile and deficientprotective mechanisms in AD brains, and the consistent observa-tion that PAR2 is widely expressed on neurons and glial cells inthe brain, we proposed that PAR2 might contribute to ADpathogenesis. We therefore investigated the effects of PAR2 onA�1– 42-mediated neurotoxicity in both neurons and glia includ-ing expression of the putative A�1– 42 receptor formyl peptidereceptor-2 (FPR2).

Materials and MethodsHuman brain tissues

Brain samples were obtained from the Laboratory for Neurological Infec-tion and Immunity Brain Bank, University of Alberta (Edmonton, Alberta,Canada). Frontal lobe tissues from Alzheimer’s (n � 6; mean age, 73 � 5years) and non-Alzheimer’s (non-AD; n � 6; mean age, 68 � 6 years;stroke, multiple sclerosis, sepsis, leukemia) patients were collected at au-topsy with consent and stored at �80°C, as previously described (37, 38).

Cell cultures and experimental treatments

Primary rat basal forebrain neurons were cultured from 16- to 17-day-oldembryos of pregnant rats, as previously described (39) and in accordancewith the protocol approved by the local Health Sciences Laboratory ofAnimal Policy and Welfare Committee of the University of Alberta.Briefly, septal regions containing the basal forebrain neurons were dis-sected in HBSS (Invitrogen Life Technologies) supplemented with 15 mMHEPES, 10 U/ml penicillin. and 10 mg/ml streptomycin, dissociated using0.05% trypsin, triturated, and then plated on poly-D-lysine-coated wells.Cultures were grown at 37°C with 5% CO2 in a humidified atmosphere inNeurobasal medium supplemented with N2 supplement (Invitrogen LifeTechnologies). Experiments were performed 7 days after cell plating for36 h using the fibrillar aggregated form of the �-amyloid peptide (A�1–42)prepared according to a modified protocol of Haughey et al. (40). Briefly,a 1 mM solution of A�1–42 (Bachem; H-1368) peptide was incubated in

PBS at 37°C for 2–3 days before the experiment. For neuronal PAR2activation, primary rat neurons were incubated for 36 h with 100 �MSLIGRL-NH2 as PAR2-activating peptide or mutant inactive peptideLSIGRL-NH2 (Peptide Synthesis Facility, University of Calgary, Calgary,Canada) in AIM-V serum-free medium (Invitrogen Life Technologies).

Mouse primary astrocyte cultures were established from CNS tissuefrom 2-day-old C57BL/6 PAR2 homozygous knockout (KO) (41) mice andlittermate homozygous wild-type (WT) mice as described previously (42).Cells were cultured in MEM (Invitrogen Life Technologies) containing10% FBS, 1 mM sodium pyruvate, and 2 mM L-glutamine. Mouse bonemarrow-derived macrophages were isolated from the pelvic and femoralbone marrow of adult PAR2 WT and KO mice as described previously(38). Bone marrow cells were cultured in DMEM containing 10% FBS,10% L929 cell-conditioned medium, and 2 mM L-glutamine (InvitrogenLife Technologies). Cells were incubated in 10% CO2 for 5 days beforeadditional treatments. Macrophages or astrocytes were treated with 100�M SLIGRL-NH2 or LSIGRL-NH2 for 4 h. For TNF-� treatments, mac-rophages or astrocytes were treated with TNF-� for 8 h before RNAextraction.

Human monocyte-derived-macrophage (MDM) cultures were preparedfrom healthy individuals as previously described (37). Macrophages andastrocytic U373 cells were incubated with fibrillar A�1–42, SLIGRL orLSIGRL prepared as described above in AIM-V serum-free medium for4 h. Media were then changed for fresh AIM-V medium without peptides,and supernatants were harvested 36 h later and stored at �80°C for sub-sequent neuronal toxicity experiment on human fetal neurons.

Human fetal neurons were cultured in MEM containing 10% FBS, 1%sodium pyruvate, 1% L-glutamine, 1% MEM nonessential amino acid so-lution, 1% dextrose, and 1% N2 supplement (Invitrogen Life Technologies)as described previously (43). Selection for nondifferentiated neurons wasperformed by a treatment with arabinofuranosylcytosine (25 �M; Sigma-Aldrich) for 2 wk. Twenty-four hours after being seeded, cells were incu-bated in MDM and U373 supernatants for 36 h. The neurotoxicity of thesesupernatants was assessed as described below.

Quantitative cellular immunoreactivity

The quantification of PAR2 and also GRP58 immunoreactivity was per-formed using In-cell Western analysis (ODYSSEY Infrared Imaging Sys-tem; LI-COR Biosciences) according to the manufacturer’s guidelines. Wealso used immunoreactivity of �-tubulin, a cell structural protein, for as-sessment of neurotoxicity, as well as normalyzing GRP58 and PAR2 im-munoreactivity to the number of the cells. Briefly, treated cells (in qua-druplicate) were fixed with 3.7% formaldehyde followed by washing withPBS. For tubulin and Grp58 immunoreactivity cells were washed with PBScontaining 0.1% Triton X-100 to permeabilize the cell membranes. Cellswere incubated with LI-COR Odyssey Blocking Buffer for 1.5 h before theaddition of a mouse monoclonal anti-�-tubulin isotype III (1/800; Sigma-Aldrich), a rabbit polyclonal Ab (B5) raised against rat PAR2 (1/500;30GPNSKGR2SLIGRLDT46P-YGGC, coupled to keyhole limpet hemo-cyanin; 2 � trypsin cleavage site, YGGC for conjugation) (8) or goatpolyclonal anti-GRP58 (1/50; Santa Cruz Biotechnology) Ab in blockingbuffer overnight at 4°C. After extensive washes in 0.1% Tween, cells wereincubated for 1 h with fluorescent-labeled secondary Abs goat anti-mouseAlexa Fluor-680 (1/200; Molecular Probes), goat anti-rabbit IRDye

Table I. Real-time RT-PCR primer list

Gene Species Sense Antisense

PAR2 Human CTGGCCATTGGGGTCTTTCTGTTC GGCCCTCTTCCTTTTCTTCTCTGATrypsinogen Human TCAGCGAACAGTGGGTGGTATCAG GAGGGGCGGTGGGCAGAGFPRL1 Human TTGGTTTCCCTTTCAACTGG ACTTAAAGCATGGGGTTGAGTNF-a Human ATTCAGGAATGTGTGGCCTGC GTTTGAATTCTTAGTGGTTGCCAGIL-10 Human CCTCTCACCGTCTTGCTTTC GCAGAGGTTGCTTGTTCTCCIL-8 Human CACCGGAAGGAACCATCTCAC TGGTCCACTCTCAATCACTCTCAGIL-4 Human GGCTGACTTAGGAGCTGGTG GTGTTCCCTGCCATACTCGTGRP58 Human, mouse TCAAGGGTTTTCCTACCATCTACTTC TTAATTCACGGCCACCTTCATGRP78 Human, mouse TCATCGGACGCACTTGGAA CAACCACCTTGAATGGCAAGAPAR2 Mouse TGGCCATTGGAGTCTTCCTGTT TAGCCCTCTGCCTTTTCTTCTCTrypsinogen Mouse ATCTCTGGCTGGGGCAACACTC CTAGGAAGCCAGCACAGACCATFPR2 Mouse CCTTATAGTCTTGAGAGAGCCCTGA TGCAGGAGGTGAAGTAGAACTGGMip-2 Mouse TGAGTGTGACGCCCCCAGGAC TCAGACAGCGAGGCACATCAGGTAIL-4 Mouse CGGCATTTTGAACGAGGTC CGAAAAGCCCGAAAGAGTCF4/80 Mouse GCCACCTGCACTGACACC GCTGCACTTGGCTCTCCGFAP Mouse GGACATCGAGATCGCCACCTACAG CTCACCATCCCGCATCTCCACAGT

5494 DIVERGENT ROLES OF PAR2 IN AD PATHOGENESIS

by guest on July 13, 2015http://w

ww

.jimm

unol.org/D

ownloaded from

800CW (1/800; Rockland), or donkey anti-goat IRDye 800 (1/100; Rock-land) Ab diluted in blocking buffer supplemented with 0.2% Tween 20 tolower the background. After a washing, plates were scanned simulta-neously at 700 and 800 nm using the Odyssey Infrared Imaging System.

Western blot analysis

Protein extracts were prepared from brain tissues samples with cell lysisbuffer (20 mM Tris, 1% Triton X-100, 0.05% SDS, 5 mg of sodium de-oxycholate, 150 mM NaCl, and 1 mM PMSF), and concentrations weredetermined by bicinchoninic acid assay (Pierce). Fifty micrograms of pro-tein were separated by 10% SDS-polyacrylamide and transferred onto ni-trocellulose membranes followed by blocking with 10% skimmed milk(38). Membranes were then probed with monoclonal antisera to MAP-2(1/500; Sigma-Aldrich), synaptophysin (/1000; Santa Cruz Biotechnology)or HRP-conjugated �-actin (1/200; Chemicon International) overnight at4°C followed by washing with TBS-Tween 20. Goat anti-mouse secondaryAb conjugated to HRP (1/2500; Chemicon International) was used to de-tect the primary Abs. After several washes, peroxidase activity on themembrane was detected by chemiluminescence (Roche Diagnostics, Laval,Quebec, Canada).

APP-transgenic mice

Transgenic (TgCRND8) mice encoding a double-mutated allele of the hu-man APP genes implicated in AD (Swedish, KM670/671NL; Indiana,V717F) under the control of hamster PrP gene promoter (44) were main-tained on a hybrid background (C57BL/6/C3H). To obtain mice for theexperiments, TgCRND8 males were crossed with C57BL/6 WT femalemice. Twenty-four-week-old gender- and weight-matched heterozygousTgCRND8 mice (n � 4) and non-Tg littermates (n � 3), were used in thepresent studies.

�-Amyloid implantation

Twelve-week-old male PAR2 homozygous KO mice and littermate ho-mozygous WT controls were anesthetized under isoflurane. Bilateral infu-sions of 1 mM fibrillar A�1–42 (40) (n � 14) or PBS (n � 12) were madestereotaxically into the dorsal hippocampus (2.5 mm posterior; �2 mmlateral; 1.4 mm ventral), using 31-gauage cannulae connected by PE tubingto 5-�l Hamilton syringes mounted on a Hamilton syringe drive. FibrillarA�1–42 or PBS was infused at a rate of 0.4 �l/min over a period of 5 min.The cannulae were left in place for 10 min before being slowly withdrawn.Animals were allowed to recover for 1 wk before behavioral testing. Im-plantation of oligomeric A�1–42 (45) did not cause neurobehavioral abnor-malities. All experiments followed Calgary Animal Care Committee guide-lines and were approved by the University of Calgary Animal CareCommittee.

Behavioral Testing

Acquisition of spatial learning and memory after drug infusion were as-sessed using the Morris water maze task (46). The apparatus was a circulartank 123 cm in diameter, 35 cm deep, raised 60 cm from the floor, andfilled to a height of �21.5 cm with 22°C water made opaque by the ad-dition of skim milk powder. A 10- � 10-cm escape platform was sub-merged 1.5 cm below the surface of the water, positioned in the middle ofthe northeast quadrant. All mice received two blocks of four swimmingtrials each day, for 4 consecutive days. For each trial block, animals werereleased from each of the four cardinal compass points (morth, east, south,and west) and allowed to swim freely until they climbed onto the platform,or after 60 s had elapsed. If the mouse found the platform, it was allowedto remain there for 10 s; if it failed to find the platform, it was placed onthe platform for 10 s. On the fifth day, the animals were subjected to asingle probe trial during which the platform was removed, and each animalwas allowed to swim freely for 60 s. Swim paths were recorded and ana-lyzed using the 2020 Plus tracking system for the Morris water maze (HVSImage). Data were analyzed on a Power Mac G5 (Apple) using a repeatedmeasures ANOVA (Statview 5; SAS Institute).

Real-time RT-PCR

Total RNAs from cultured cells and from human and mouse brain tissueswere prepared using Trizol (Invitrogen Life Technologies) according to themanufacturer’s guidelines. One microgram of total RNA was used forcDNA synthesis and subsequent PCR. Primer sequences are listed in TableI. Semiquantitative analysis was performed by monitoring in real time theincrease of fluorescence of the SYBR Green dye on a Bio-Rad-i-Cycler asdescribed previously (47). All data were normalized against the GAPDHexpression and reported relative to controls � SEM.

FIGURE 1. Neuroinflammation and PAR2 expression in AD brains.PAR2 transcript abundance (a) was decreased in brains from AD (n �6) compared with non-AD (n � 6) patients. TNF-� (b), IL-8 (c), andIL-10 (data not shown) mRNA levels were up-regulated, whereas IL-4transcript levels (d) were suppressed in AD brains. There was a down-regulation of the ER chaperone, GRP58, mRNA levels in AD brains (e).In contrast, FPRL1, a potential receptor for A�1– 42 in glial cells, wasup-regulated in AD brains compared with non-AD brains (f). In non-ADpatients, preactivated (g) and total (i) PAR2 immunoreactivity waschiefly present in cortical neurons (i, inset shows the staining with Ababsorbed with immunogen peptide), whereas in AD brains, preactivated(h) and total (j) PAR2 immunoreactivity was colocalized with CD45demonstrating its expression predominantly in monocytoid cells in thecortex. Original magnification, �200 for main panels; �1000 for h andj insets. Data are mean � SEM by Student’s t test; �, p � 0.05; ��, p �0.01; ���, p � 0.001; RFC, relative fold change.

5495The Journal of Immunology

by guest on July 13, 2015http://w

ww

.jimm

unol.org/D

ownloaded from

Immunohistochemistry

Immunohistochemical labeling was performed using 5-�m paraffin-em-bedded serial human brain sections prepared as previously described (38).Sections were incubated overnight at 4°C with rabbit polyclonal Ab raisedto a peptide corresponding to two noncontiguous epitopes (SLAWLLG;PNSKGR)intheratPAR2N-terminalsequence5SLAWLLG12G-31PNSKGR/GGYGGC to detect a preactivated form of PAR2 (SLAW-A; 1/200; Ref.48), or rabbit polyclonal anti-PAR2 (B5) Ab (1/500; Ref. 8), in PBS containing5% normal goat serum and 0.2% Triton X-100. Secondary alkaline phos-phatase-conjugated goat anti-rabbit Ab (1/500; Jackson ImmunoResearch Lab-oratories) followed by NBT-5-bromo-4-chloro-3-indolyl phosphate substrate(Vector Laboratories) were used to detect subsequent immunoreactivity.Mouse monoclonal anti-CD45 (1/200; Zymed Laboratories) and biotinylatedgoat anti-mouse Ab followed by avidin-biotin-peroxidase amplification (Vec-tor Laboratories) and 3,3�-diaminobenzidine tetrachloride staining (VectorLaboratories) were used for double labeling.

Immunofluorescence and confocal laser scanning microscopy

Paraffin-embedded mouse brain serial sections (5 �m) were double-immu-nolabeled for neuronal nuclear Ag (NeuN; 1/200; Chemicon International)and either glial fibrillary acidic protein (GFAP; 1/200; DAKO), ionizedcalcium binding adaptor molecule (Iba-1; 1/400; Wako) or cleavedcaspase-3 (Asp175, 1/100; Cell Signaling Technology) (38). Brain sectionswere also double-immunolabeled with antisera recognizing IL-4 (1/100;BD Pharmingen) and NeuN, GFAP, or Iba-1. Cy3-conjugated goat anti-

mouse or Alexa 488-conjugated goat anti-rabbit and goat anti-rat second-ary Abs (Molecular Probes) were used to detect Ag-specific binding. Im-ages were captured on a LSM510 META (Carl Zeiss MicroImaging)confocal laser scanning microscope and analyzed using LSM 5 ImageBrowser software (Carl Zeiss MicroImaging).

Statistical analysis

Statistical analyses were performed by ANOVA and Tukey-Kramer orDunnet as post hoc tests using GraphPad Instat version 3.0 (GraphPadSoftware). p values of �0.05 were considered significant.

ResultsPAR2 expression is selectively decreased in AD brains

The neuropathology of AD is defined by neuronal injury and losstogether with �-amyloid and tangle accumulation, in conjunctionwith neuroimmune activation (22, 25, 29–32). To investigatewhether PAR2 participated in these pathological aspects associ-ated with AD, we examined PAR2 transcript levels in frontocor-tical brain regions from AD and non-AD patients. This analysisrevealed a significant decrease in PAR2 mRNA levels in AD com-pared with non-AD patient brains (Fig. 1a), whereas expression oftrypsinogen was not changed (data not shown). TNF-� (Fig. 1b),IL-8 (Fig. 1c), and IL-10 (data not shown) transcript levels were

FIGURE 2. Neuronal PAR2 activation pro-tects neurons against A�1–42 toxicity. a, Humancholinergic (LAN-2) and RFN cells expressedPAR2. Background represents the same condi-tions without primary Ab. b, Fibrillar A�1–42 in-cubation for 36 h decreased the cytoskeletal iso-type III �-tubulin immunoreactivity as aneuronal viability marker in RFNs; c, decreasedPAR2 expression (normalized against �-tubulinimmunoreactivity) on LAN-2 cells in concentra-tion-dependent manners; d, PAR2 activationwith SLIGRL increased the neuronal viabilityand protected RFNs against A�1–42 toxicity,whereas the control peptide LSIGRL had no ef-fect; e, A�1–42 also induced the expression ofER stress protein, GRP58 (normalized against�-tubulin immunoreactivity) in RFNs; f, activa-tion of PAR2 with SLIGRL reversed A�1–42-induced GRP58 expression. Data are mean �SEM by Student’s t test (a), Dunnet (b, c, and e)and Tukey-Kramer multiple comparisons (d andf) tests; �, p � 0.05; ��, p � 0.01; ���, p �0.001. All experiments were performed in qua-druplicate and background subtracted averageintensities of fluorescence units (arbitrary) areused for quantification of immunoreactivity(IR).

5496 DIVERGENT ROLES OF PAR2 IN AD PATHOGENESIS

by guest on July 13, 2015http://w

ww

.jimm

unol.org/D

ownloaded from

up-regulated in AD brains, in contrast to the anti-inflammatorycytokine IL-4, which was significantly suppressed in AD com-pared with non-AD brains (Fig. 1d). There was no change in themRNA levels of ER stress gene, GRP78 (also known as BiP),between AD and non-AD brains (data not shown), whereas GRP58was significantly down-regulated in AD brains (Fig. 1e). It hasbeen shown that A�1–42 serves as a high affinity and specific ag-onist for formyl peptide receptor-like 1 (FPRL1) and its murinecounterpart FPR2, thereby activating microglia to produce a widevariety of proinflammatory cytokines and neurotoxins (49–52).There was a significant increase in mRNA levels of FPRL1 in ADbrains (Fig. 1f). Using previously reported antisera to PAR2, im-munohistochemical staining showed that preactivated PAR2 (Fig.1g) and also total PAR2 (Fig. 1i) immunoreactivity was chieflypresent in cortical neurons of non-AD brains. In contrast, in ADbrains, glial cells were the principal cells exhibiting preactivated(Fig. 1h) and total (Fig. 1j) PAR2 immunoreactivity, as there wasa profound neuronal loss in cortical regions. Indeed, each form ofPAR2 was colocalized with the microglial marker, CD45, in ADbrains (Fig. 1, h and j, inset). Although these data suggested thattotal PAR2 levels were reduced in AD brains, its immunoreactivityand activation were more prominent in glial cells of AD brainstogether with an up-regulation of several proinflammatory genesand suppression of the prototype anti-inflammatory gene, IL-4.

Neuronal PAR2 activation protects neurons againstA�1–42 toxicity

PAR2 has been shown to be expressed on neurons in CNS and playimportant roles in neuronal excitation and proliferation (2–4). Toassess the role of PAR2 on neurons, we investigated its expressionand effects in different neuronal cell lines. Both human cholinergicneuronal (LAN-2) cells and rat fetal neurons (RFN) displayedPAR2 immunoreactivity (Fig. 2a). Treatment of RFN with fibrillarA�1–42 induced neurotoxicity as shown by a concentration-depen-dent decrease in the immunoreactivity of neuron-specific cytoskel-etal protein, class III �-tubulin (Refs. 53 and 54 and Fig. 2b).Indeed, A�1–42 also suppressed neuronal PAR2 immunoreactivity

(Fig. 2c). Incubation of neurons with the PAR2 activating peptide,SLIGRL or the missense receptor-inactive peptide LSIGRL (55)indicated that PAR2 activation alone did not affect the �-tubulinreactivity, but it enhanced neuronal viability during A�1–42 neu-rotoxic treatments (Fig. 2d). Protein levels of the ER stress chap-erone protein GRP58 (normalized against �-tubulin immunoreac-tivity) showed a robust up-regulation with A�1–42 treatment,indicating that A�1–42 can enhance ER stress (Fig. 2e). Moreover,lower levels of GRP58 expression (normalized against �-tubulin)were observed after PAR2 activation in A�1–42-treated RFNs, sup-porting the notion of a protective role for PAR2 in neurons con-comitant with a reduction in neuronal ER stress (Fig. 2f).

Macrophage and astrocytic PAR2 activation increasesFPR-2 expression

In addition to its direct neurotoxicity, A�1–42 is a potent activatorof microglia and induces multiple proinflammatory cytokines andneurotoxins through its cognate receptor, FPR2, in murine macro-phages (49–52). A�1–42 can also stimulate astrocytes to releaseinflammatory cytokines and chemokines (25, 56). Given thatPAR2 is expressed on brain monocytoid cells (perivascular mac-rophages/microglia) and astrocytes, we investigated the potentialrole of PAR2 on indirect A�1–42 neurotoxicity. Murine macro-phages and astrocytes were treated with SLIGRL, disclosing sig-nificant up-regulation of FPR2 transcripts in macrophages (Fig.3a) and also astrocytes (Fig. 3b), compared with untreated orLSIGRL treated cells. It is also known that proinflammatory stimuli

FIGURE 3. PAR2 activation increases FPR2 expression on mouse glia.Activation of PAR2 with SLIGRL enhanced the expression of FPR2 inmouse primary macrophage (M�; a) and astrocytes (Astro; b). Induction ofFPR2 expression by TNF-� was significantly reduced in PAR2 KO mac-rophages (c) and astrocytes (d) compare with WT cells. Data are mean �SEM; Tukey-Kramer multiple comparisons test; ��, p � 0.01; ���, p �0.001; n � 5; RFC, relative fold change.

FIGURE 4. Macrophage and astrocytic (Astro) PAR2 activation in-creases A�1–42-induced neuroimmune activation and neurotoxicity. a, IL-8expression in human macrophages was increased during A�1–42 treatment,whereas PAR2 activation exerted an additive effect with A�1–42. b, Inhuman astrocytes, IL-8 expression is unchanged whereas PAR2 activationsuppressed IL-4 expression. c, Supernatants (S/N) from A�1–42-treatedmacrophages were toxic to human fetal neurons, whereas macrophagePAR2 activation augmented the toxicity. Astrocyte-derived supernatanthad no toxic effects on human fetal neurons. Data are mean � SEM; Dun-nett’s test; �, p � 0.05; ��, p � 0.01; ���, p � 0.001. Experiments per-formed in quadruplicate. (SLI, SLIGRL-NH2; LSI, LSIGRL-NH2).

5497The Journal of Immunology

by guest on July 13, 2015http://w

ww

.jimm

unol.org/D

ownloaded from

such as LPS and TNF-� can enhance the functional expression ofFPR2 in microglia (57, 58). To assess the potential effects of PAR2in TNF-� signaling leading to FPR2 induction, we treated macro-phages and astrocytes from PAR2 null (KO) (41) and WT litter-mates with this cytokine. In macrophages and astrocytes from WTmice, TNF-� caused a marked increase in the FPR2 mRNA levels,with a markedly lower response observed in macrophages (Fig. 3c)and astrocytes (Fig. 3d) from the KO animals. These results sug-gest that PAR2 is involved in AD neuropathogenesis by modulat-ing FPR2 expression in glial cells and also TNF-� inducing effectin terms of FPR2 expression.

Macrophage and astrocytic PAR2 activation increasesproinflammatory gene expression and enhances the neurotoxiceffects of A�1–42

Earlier studies have shown that A�1–42 induces the expression ofa range of proinflammatory cytokines and chemokines in humanmicroglia, notably IL-8, which by itself potentiates A�1–42 induc-

tion of other inflammatory cytokines and chemokines (59–61). Incontrast, IL-4 suppresses the expression and activity of microglialFPR2/FPRL1 (62, 63) and down-modulates the proinflammatoryresponses induced by A�1–42 (64). Several studies have also re-ported neuroprotective effects for IL-4 in different settings (65–67), including protection against �-amyloid-induced hippocampalinjury (68). In view of the ability of PAR2 activation to up-regulatea potential receptor for A�1–42 on microglia and astrocytes, wenext examined the impact of PAR2 activation on the inflammatoryprofile induced by A�1–42. The ability of fibrillar A�1–42 to induceIL-8 expression in human macrophages (MDM) was enhanced bythe concurrent activation of PAR2 (Fig. 4a). In contrast, in humanastrocytic (U373) cells, fibrillar A�1–42 did not induce an increasein IL-8 or IL-4 mRNA levels in either the absence or presence of

FIGURE 5. APP-Tg mice display early stages of neurodegenerative dis-ease. a, Western blot analysis showed no difference in the neuronal protein,MAP-2, or synaptophysin immunoreactivity between WT (n � 3) andAPP-Tg (n � 4) groups. Brain PAR2 (b) mRNA levels were up-regulatedin APP-Tg mice, without any change in trypsinogen (c) expression com-pared with WT controls. Transcript levels of the activated macrophage/microglial gene, F4/80 (d), in brain was unchanged, in contrast to astrocyticgene, GFAP (e), which was up-regulated in APP-Tg mice. MIP-2 (f), themurine homolog of human IL-8, remained unchanged, whereas IL-4 (g)was induced in the brains of the APP-Tg group. There were no differencesin FPR2 expression between groups (h). Data are mean � SEM; Student’st test; �, p � 0.05; RFC, relative fold change.

FIGURE 6. PAR2-deficient mice showed reduced neuroimmune re-sponses after A�1–42 implantation. a, Decreased transcript levels of PAR2were evident in A�1–42-implanted mice. b, There was no significant changein trypsinogen transcript levels. Up-regulation of F4/80 (c) and GFAP (d)was evident in A�1–42-implanted WT animals but not in implanted PAR2KO littermates or in PBS-implanted animals. MIP-2 (e) mRNA levels wereincreased in A�1–42-implanted WT animals, in contrast to IL-4 transcriptlevels, which were up-regulated in PAR2 KO animals receiving A�1–42

implants (f). mRNA levels of ER stress gene GRP58 were also increasedin A�1–42-implanted PAR2 KO animals (g). PAR2 KO animals, regardlessof whether they were A�1–42 implanted or not, showed lower levels ofFPR2 (h). Data are mean � SEM; Tukey-Kramer multiple comparisonstest; �, p � 0.05; ��, p � 0.01; ���, p � 0.001. n � 6 in all four groups.RFC, relative fold change.

5498 DIVERGENT ROLES OF PAR2 IN AD PATHOGENESIS

by guest on July 13, 2015http://w

ww

.jimm

unol.org/D

ownloaded from

PAR2 activation. Instead, PAR2 activation by SLIGRL (but notLSIGRL) selectively suppressed the expression of IL-4 in astro-cytes in the presence or absence of A�1–42 (Fig. 4b). IL-4 tran-scripts were not detectable in macrophages (data not shown).

To investigate the neurotoxic properties of macrophage and as-trocytic PAR2 activation, human fetal neurons were treated withsupernatants from the above macrophage and astrocytic cells afterPAR2 activation and/or A�1–42 treatment (Fig. 4c). Neurons in-cubated with supernatants from A�-treated macrophages revealedthat neuronal viability was diminished in an A�1–42 concentration-dependent manner. Moreover, activation of PAR2 on macrophageswith SLIGRL significantly reduced neuronal viability in an addi-tive manner, whereas LSIGRL had no effect. In contrast, superna-tants from astrocytes, regardless of the treatment protocol, exertedno neurotoxic effects (Fig. 4c). Thus, activation of PAR2 on mac-rophages with or without A�1–42 cotreatment, caused the releaseof soluble neurotoxins.

PAR2 is up-regulated in APP-Tg mice

Because postmortem AD brains principally show late stage pathol-ogy, we examined the early pathogenic features of AD using a

transgenic model that represented the similar levels of A� (mgequivalent) to sporadic AD brains and also displays many of theneuropathological and clinical aspects of AD, except for neuronaldeath (44). Supporting the absence of neuronal death in this model,human mutant APP-Yg (TgCRND8) mice showed no significantchanges in the neuronal marker MAP-2 or the synaptic marker,synaptophysin, compared with nontransgenic (non-Tg) littermatecontrols (Fig. 5a). However, a significant increase in PAR2 mRNAlevels was observed in TgCRND8 mice (Fig. 5b) compared withnon-Tg littermates, without significant changes in trypsinogen ex-pression (Fig. 5c). Given the role of inflammatory mediators inprogression of AD, we investigated the activation of different celltypes at this stage of the disease, revealing no significant changesin mRNA levels of the macrophage/microglia activation markerF4/80 (Fig. 5d), while the astrocytic marker, GFAP, was up-reg-ulated in TgCRND8 mice (Fig. 5e). MIP-2, the murine homolog ofhuman IL-8 did not differ in transcript levels between groups (Fig.5f). In contrast, IL-4 was significantly up-regulated in TgCRND8mice (Fig. 5g), whereas there were no significant differences intranscript levels of FPR2 (Fig. 5h), GRP78 or GRP58 (data notshown) between groups. Although neuronal loss was not a feature

FIGURE 7. PAR2 deficiency is neuroprotec-tive against A�1–42 implantation. Immunolabel-ing of PBS-implanted PAR2 WT (a and d),PBS-implanted PAR2 KO (data not shown),A�1–42-implanted PAR2 KO (b and e), andA�1–42-implanted PAR2 WT (c and f) mousebrains with anti-NeuN (green) and anti-Iba-1(red) (a–c) or anti-GFAP (red; d–f) Abs re-vealed more severe microglial and actrocytic ac-tivation in dorsal hippocampi of WT (c and f)animals implanted with A�1–42, as comparedwith A�1–42-implanted PAR2 KO (b and e) andPBS-implanted WT (a and d) animals. Colocal-ization of IL-4 with GFAP immunoreactivitywas evident (e, inset). Immunolabeling forcleaved caspase-3 showed higher immunoreac-tivity in A�1–42-implanted WT animals (i) com-pared with A�1–42-implanted PAR2 KO animals(h). Immunoreactivity for cleaved-caspase-3was absent in PBS-implanted WT animals (g).Insets in g, h, and i show colocaliztion with theneuronal marker, NeuN. Original magnification,630; 2 � 630 magnification for e, inset; j,A�1–42-implanted PAR2 WT animals exhibitedconsistently delayed neurobehavioral responsesduring the Morris water maze. Data are mean �SEM, Tukey-Kramer multiple comparisons test;�, p � 0.05; ��, p � 0.01. n � 6.

5499The Journal of Immunology

by guest on July 13, 2015http://w

ww

.jimm

unol.org/D

ownloaded from

of this AD model as is also the case for other Tg-APP695 mice(69) at this stage of the disease, PAR2 up-regulation in the Tg miceindicated that it might be an early marker of the disease process.

PAR2 deficiency affects the A�-induced inflammatory profile inmouse brains

To determine the direct in vivo effects of A�1–42, the fibrillar formof the peptide (40) was implanted into the dorsal hippocampus ofPAR2 WT and KO mice, and gene expression was subsequentlyexamined at 1 wk postimplantation. Recapitulating our findings inhuman AD brains (Fig. 1), PAR2 expression was significantly sup-pressed in WT mpise brains receiving A�1–42 (Fig. 6a). There wasno significant change in trypsinogen transcript levels (Fig. 6b), butmicrophage/microglial F4/80 (Fig. 6c) and astrocytic GFAP (Fig.6d) transcripts were up-regulated in WT animals receiving A�1–42

implants. In the A�1–42-implanted PAR2 KO or in PBS-implantedanimals, F4/80 and GFAP transcript levels were lower than in theA�1–42-treated WT animals, indicating a differential activation ofneuroglial cells in A�1–42-implanted PAR2 WT vs KO brains.MIP-2 transcript levels also were increased in A�1–42-implantedWT mice (Fig. 6e). In contrast, IL-4 was significantly up-regulatedin PAR2 KO compared with WT animals receiving A�1–42 im-plants and PBS-implanted animals (Fig. 6f). Unlike human ADbrains and WT mice receiving A�1–42, a robust GRP58 inductionwas also detectable in KO mice receiving A�1–42 (Fig. 6g),whereas GRP78 expression was unchanged (data not shown).Complementing these findings, PAR2 KO groups showed lowerlevels of FPR2 compared with the WT groups (Fig. 6h), underlin-ing the direct interactions between PAR2 and fibrillar A�1–42-mediated toxicity.

PAR2 deficiency is protective during A� toxicity

Consistent with the present differences in inflammatory and pro-tective gene expression, immunofluorescence studies revealed thatIba-1 (Fig. 7, a–c) and GFAP (Fig. 8, d–f) immunoreactivity weremarkedly enhanced in macrophage and astrocytes, respectively, inthe dorsal hippocampus of PAR2 WT (Fig. 7, c and f, respectively)compared with KO animals (Fig. 7, b and e, respectively) receivingA�1–42 implants. IL-4 immunoreactivity was colocalized withGFAP (Fig. 7e, inset) but not with Iba-1 (data not shown), dem-onstrating the cell specificity for IL-4 expression in the brain. Toinvestigate A�1–42-induced activation of cell death pathways inneurons, we performed immunolabeling studies for the detectionof activated form of caspase-3. As expected, cleaved caspase-3immunoreactivity was absent in the dorsal hippocampus of ani-mals implanted with PBS (Fig. 7g). However, cleaved caspase-3immunoreactivity was evident in the hippocampus of A�1–42-im-planted animals and WT animals (Fig. 7i) showed greater immu-noreactivities than did PAR2 KO littermates (Fig. 7h). Indeed,cleaved caspase-3 immunolabeling was colocalized with NeuNimmunoreactivity (Fig. 7, h and i, insets), underlying the relativevulnerability of neurons in this system. Moreover, we observed amore severe neurobehavioral phenotype in PAR2 WT animals af-ter fibrillar A�1–42 implantation compared with PAR2 KO litter-mates receiving A�1–42 and the PBS-implanted animals, as evi-denced by A�1–42-implanted WT animals showing a significantlylonger latency to find the submerged escape platform during Mor-ris water maze testing (Fig. 7j). Hence, our findings revealed thatintact PAR2 expression contributed to glial cell neuroimmune ac-tivation and worsened neurobehavioral outcomes after exposure tofibrillar A�1–42 with ensuing neuronal apoptosis (Fig. 8).

FIGURE 8. Divergent effects of PAR2 on AD patho-genesis. In addition to the protective properties of neu-ronal PAR2 in the context of A�1–42 neurotoxicity,A�1–42-induced microglial activation, mediated byFPR2/FPRL1, was amplified by PAR2 coactivation,leading to the release of neurotoxins, inflammatory cy-tokines, and chemokines such as IL-8, and subsequentlyinduces neuronal death. Although PAR2 mediated theseproinflammatory effects, it also suppressed an importantinhibitor of this cascade, astrocyte-derived IL-4. Theoverall consequence of PAR2 activation was to aug-ment the neuroinflammatory response, which over-whelmed the direct protective effects of neuronal PAR2.

5500 DIVERGENT ROLES OF PAR2 IN AD PATHOGENESIS

by guest on July 13, 2015http://w

ww

.jimm

unol.org/D

ownloaded from

DiscussionPAR2, which is widely expressed on different cell types in thenervous system, appears to exert both protective and pathogeniceffects depending on the specific neurological disorder (13–18).Although PAR2 can promote inflammation within the nervous sys-tem (10–16), it can also mediate protective neuronal responses(17–19). Herein, we investigated the direct contributions of PAR2to neuronal viability together with its indirect effects on neuronsthrough activation of proximate immune cells involved in thepathogenesis of AD (Fig. 8). Although fibrillar A�1–42 was di-rectly toxic to neurons and induced ER stress, concurrent activa-tion of PAR2 suppressed A�1–42 neurotoxicity, pointing to a pro-tective role for neuronally expressed PAR2 (Fig. 8). Of possiblemechanistic importance for AD, PAR2 activation on monocytoidcells (macrophages/microglia) and astrocytes was associated withup-regulation of FPR2, a putative receptor for A�1–42 and modu-lated TNF-� effects on FPR2 induction. Moreover, PAR2 activa-tion on macrophages exacerbated A�1–42-induced inflammatoryresponses, indirectly reducing neuronal viability through the re-lease of putative neurotoxins in variable amounts depending on theexperimental model (Fig. 8). In astrocytes, PAR2 activation re-sulted in the suppression of anti-inflammatory cytokine, IL-4, un-derscoring the pathogenic roles for PAR2 in immune cells. Toglean insight into the temporal aspects of PAR2 expression andfunction in different stages of AD pathogenesis, APP-Tg micewere used as an early stage model of AD, revealing elevated IL-4expression and astrocytic activation without evidence of proin-flammatory responses or neuronal injury. Of interest, induction ofPAR2 in this model seemed to be an early cellular response beforelater inflammation and neuronal death. Conversely, brain samplesfrom autopsied AD patients disclosed that in conjunction with pro-found neuronal loss in cortex, PAR2 immunoreactivity on neuronsand transcript abundance were diminished with concurrent proin-flammatory responses. Similarly, after fibrillar A�1–42 implanta-tion into the hippocampus, PAR2 expression was reduced in PAR2WT mice. This was associated with a proinflammatory responseand a neurobehavioral phenotype in conjunction with neuronal ap-optosis. In matched littermate KO animals, there were no A�1–42-induced proinflammatory effects although both IL-4 and GRP58expression were enhanced, together with reduced FPR2 expres-sion, emphasizing the complex roles of PAR2 in inducing neu-roinflammation and suppression of neuronal and astrocytic-medi-ated neuroprotective signals. Interestingly, neurobehavioral andneuropathological outcomes were also less severe in PAR2 KOanimals compared with the WT littermates. Although astrocytesare not considered a major source of IL-4, several studies haveshown that IL-4 expression is detectable and can be induced byproinflammatory cytokines in astrocytes (70–72). Considering thesuppressive effects of PAR2 activation on astrocytic IL-4 expres-sion, it is conceivable that fibrillar A�1–42 implantation in the ab-sence of PAR2 signaling drives the expression of IL-4 by thesecells, leading to a more neuroprotective phenotype.

Increased production and/or impaired clearance of aggregatedforms of �-amyloid peptides represent an established hallmark ofAD neuropathogenesis. Several lines of evidence indicate that A�peptides, most notably A�1–42, are toxic to neurons (20–22).Moreover, A� accumulation triggers an unfolded protein response(UPR) in affected cells following the accumulation of misfoldedproteins (23, 24) in the ER. Activation of the UPR results in anoverall decrease in translation, enhanced protein degradation, andincreased expression levels of ER chaperones such as GRP78 andGRP58, which subsequently increases the protein-folding capacityof the ER to protect cells against further injury. Here, we have

shown that fibrillar form of A�1–42 induces ER stress character-ized by induction of neuronal GRP58 expression in vitro and si-multaneous decreases in neuronal viability. This observation isconsistent with earlier reports describing the activation of UPRduring AD, usually with increased levels of GRP78 as anotherstress marker (23, 24). Importantly, GRP58 appears to wield neu-roprotective properties in other neurodegenerative diseases (73). Inour model, down-regulation of neuronal PAR2 by A�1–42 wasimportant in that PAR2 activation can decrease the neuronal sus-ceptibility to A�1–42 and ER stress, all pointing out to a protectiverole for neuronal PAR2. This result is in agreement with the pre-vious studies, which have shown the protective effects of PAR2 onneurons in the context of cerebral ischemia (17) and HIV-associ-ated dementia (18).

The pathogenic significance of inflammatory responses elicitedby brain glial cells during AD has drawn considerable attention inrecent years (29–32). A striking neuropathological feature of ADis the consistent appearance of activated microglia and astrocytesin proximity to amyloid plaques/deposition, indicating a process offocal recruitment and activation of these cells. Several in vitrostudies have shown that A�1–42 can directly activate macrophagesand astrocytes with the ensuing secretion of proinflammatory cy-tokines and chemokines through engagement of murine FPR2 orits human counterpart FPRL1 (49–52). We have extended thesestudies by demonstrating that PAR2 activation regulates the ex-pression of FPR2 in microglia and astrocytes, either directly orthrough interfering with TNF-� signaling. This last observationmight be reinforced by the fact that TNF-� and PAR2 share somecommon signaling pathways such as NF-�B activation (57, 58,74). It has been shown that IL-8 overexpression is a potentiallyimportant inflammatory response during A�1–42 toxicity (59, 61)which can play an important role in chemoattraction and potenti-ates A�1–42-induced production of other inflammatory cytokinesand chemokines (60). Indeed, our present studies implied that ac-tivation of PAR2 on monocytoid cells with A�1–42 applicationsynergistically augmented IL-8 expression (Fig. 8). Lymphocyteactivation and infiltration does not appear to participate in thispathogenic cascade, likely because PAR2 is not expressed on lym-phocytes (16). Taken together, these latter results are in accor-dance with the overexpression of TNF-�, IL-8, and FPRL1 in au-topsied AD brains coupled with microglial activation andoverexpression of MIP-2 in A�1–42-implanted WT mice. Althoughoverall PAR2 transcript abundance was suppressed in autopsiedAD brains, the residual expression was limited to glial cells. Thesedata support the notion that PAR2 can play an important role ininflammatory aspects of AD, thereby exacerbating the neuropatho-genic process through concurrent mechanisms.

Activation of PARs requires specific proteases and, for PAR2,trypsin and mast cell tryptase are established cognate proteases (2,4). Trypsinogen is expressed in the nervous system (16, 18), al-though its contribution to AD neuropathogenesis remains unclear.Herein, trypsinogen expression did not differ between AD andnon-AD brains; likewise, its expression was not altered in bothanimal models of AD used in the present study although it wasexpressed by both neurons and glia (data not shown). It is plausiblethat other proteases may activate individual PARs; indeed severalproteases implicated in neurodegenerative diseases, such as kal-likreins and matrix metalloproteinases, have recently been shownto activate different PARs (75–80). Aside from the broad range ofeffects that PAR2 exercises in neurons during development anddisease, a pivotal question to pursue will be to identify its putativecognate protease(s). Nonetheless, cell type-specific mechanismsby which PAR2 affects neuronal viability and fate lend themselves

5501The Journal of Immunology

by guest on July 13, 2015http://w

ww

.jimm

unol.org/D

ownloaded from

to pharmacological manipulation in future studies of therapeuticinterventions for neurodegenerative diseases.

AcknowledgmentsWe thank Dr. Arthur W. Clark for helpful discussions, Neda Shariat andDavid MacTavish for technical assistance, and Stephanie Skinner for as-sistance with manuscript preparation.

DisclosuresThe authors have no financial conflict of interest.

References1. Southan, C. 2001. A genomic perspective on human proteases. FEBS Lett. 498:

214–218.2. Noorbakhsh, F., N. Vergnolle, M. D. Hollenberg, and C. Power. 2003. Protein-

ase-activated receptors in the nervous system. Nat. Rev. Neurosci. 4: 981–990.3. Cottrell, G. S., S. Amadesi, F. Schmidlin, and N. Bunnett. 2003. Protease-acti-

vated receptor 2: activation, signalling and function. Biochem. Soc. Trans. 31:1191–1197.

4. Ossovskaya, V. S., and N. W. Bunnett. 2004. Protease-activated receptors: con-tribution to physiology and disease. Physiol. Rev. 84: 579–621.

5. Wang, Y., W. Luo, T. Wartmann, W. Halangk, M. Sahin-Toth, and G. Reiser.2006. Mesotrypsin, a brain trypsin, activates selectively proteinase-activated re-ceptor-1, but not proteinase-activated receptor-2, in rat astrocytes. J. Neurochem.99: 759–769.

6. Cottrell, G. S., S. Amadesi, E. F. Grady, and N. W. Bunnett. 2004. Trypsin IV,a novel agonist of protease-activated receptors 2 and 4. J. Biol. Chem. 279:13532–13539.

7. Hollenberg, M. D., M. Saifeddine, B. al-Ani, and A. Kawabata. 1997. Proteinase-activated receptors: structural requirements for activity, receptor cross-reactivity,and receptor selectivity of receptor-activating peptides. Can. J. Physiol. Phar-macol. 75: 832–841.

8. Al-Ani, B., M. Saifeddine, A. Kawabata, B. Renaux, S. Mokashi, andM. D. Hollenberg. 1999. Proteinase-activated receptor 2 (PAR2): development ofa ligand-binding assay correlating with activation of PAR2 by PAR1- and PAR2-derived peptide ligands. J. Pharmacol. Exp. Ther. 290: 753–760.

9. Macfarlane, S. R., M. J. Seatter, T. Kanke, G. D. Hunter, and R. Plevin. 2001.Proteinase-activated receptors. Pharmacol. Rev. 53: 245–282.

10. Steinhoff, M., N. Vergnolle, S. H. Young, M. Tognetto, S. Amadesi, H. S. Ennes,M. Trevisani, M. D. Hollenberg, J. L. Wallace, G. H. Caughey, et al. 2000.Agonists of proteinase-activated receptor 2 induce inflammation by a neurogenicmechanism. Nat. Med. 6: 151–158.

11. Vergnolle, N., J. L. Wallace, N. W. Bunnett, and M. D. Hollenberg. 2001. Pro-tease-activated receptors in inflammation, neuronal signaling and pain. TrendsPharmacol. Sci. 22: 146–152.

12. Vergnolle, N., M. Ferazzini, M. R. D’Andrea, J. Buddenkotte, and M. Steinhoff.2003. Proteinase-activated receptors: novel signals for peripheral nerves. TrendsNeurosci. 26: 496–500.

13. Smith-Swintosky, V. L., C. T. Cheo-Isaacs, M. R. D’Andrea, R. J. Santulli,A. L. Darrow, and P. Andrade-Gordon. 1997. Protease-activated receptor-2(PAR-2) is present in the rat hippocampus and is associated with neurodegen-eration. J. Neurochem. 69: 1890–1896.

14. Olejar, T., R. Matej, M. Zadinova, and P. Pouckova. 2002. Proteinase-activatedreceptor-2 expression on cerebral neurones after radiation damage: immunohis-tochemical observation in Wistar rats. Int. J. Tissue React. 24: 81–88.

15. Rohatgi, T., P. Henrich-Noack, F. Sedehizade, M. Goertler, C. W. Wallesch,K. G. Reymann, and G. Reiser. 2004. Transient focal ischemia in rat brain dif-ferentially regulates mRNA expression of protease-activated receptors 1 to 4.J. Neurosci. Res. 75: 273–279.

16. Noorbakhsh, F., S. Tsutsui, N. Vergnolle, L. A. Boven, N. Shariat, M. Vodjgani,K. G. Warren, P. Andrade-Gordon, M. D. Hollenberg, and C. Power. 2006. Pro-teinase-activated receptor 2 modulates neuroinflammation in experimental auto-immune encephalomyelitis and multiple sclerosis. J. Exp. Med. 203: 425–435.

17. Jin, G., T. Hayashi, J. Kawagoe, T. Takizawa, T. Nagata, I. Nagano, M. Syoji,and K. Abe. 2005. Deficiency of PAR-2 gene increases acute focal ischemic braininjury. J. Cereb. Blood Flow Metab. 25: 302–313.

18. Noorbakhsh, F., N. Vergnolle, J. C. McArthur, C. Silva, M. Vodjgani,P. Andrade-Gordon, M. D. Hollenberg, and C. Power. 2005. Proteinase-activatedreceptor-2 induction by neuroinflammation prevents neuronal death during HIVinfection. J. Immunol. 174: 7320–7329.

19. Wang, Y., W. Luo, and G. Reiser. 2006. Proteinase-activated receptor-1-andproteinase-activated receptor-2 induce the release of chemokine GRO/CINC-1from rat astrocytes via differential activation of JNK isoforms, evoking multipleprotective pathways in brain. Biochem. J. 401: 65–78.

20. Fogarty, M. P., E. J. Downer, and V. Campbell. 2003. A role for c-Jun N-terminalkinase 1 (JNK1), but not JNK2, in the �-amyloid-mediated stabilization of pro-tein p53 and induction of the apoptotic cascade in cultured cortical neurons.Biochem. J. 371: 789–798.

21. Awasthi, A., Y. Matsunaga, and T. Yamada. 2005. Amyloid-� causes apoptosisof neuronal cells via caspase cascade, which can be prevented by amyloid-�-derived short peptides. Exp. Neurol. 196: 282–289.

22. Kadowaki, H., H. Nishitoh, F. Urano, C. Sadamitsu, A. Matsuzawa, K. Takeda,H. Masutani, J. Yodoi, Y. Urano, T. Nagano, and H. Ichijo. 2005. Amyloid �

induces neuronal cell death through ROS-mediated ASK1 activation. Cell DeathDiffer. 12: 19–24.

23. Hoozemans, J. J., R. Veerhuis, E. S. Van Haastert, J. M. Rozemuller, F. Baas,P. Eikelenboom, and W. Scheper. 2005. The unfolded protein response is acti-vated in Alzheimer’s disease. Acta Neuropathol. 110: 165–172.

24. Hoozemans, J. J., J. Stieler, E. S. van Haastert, R. Veerhuis, A. J. Rozemuller,F. Baas, P. Eikelenboom, T. Arendt, and W. Scheper. 2006. The unfolded proteinresponse affects neuronal cell cycle protein expression: implications for Alzhei-mer’s disease pathogenesis. Exp. Gerontol. 41: 380–386.

25. Akiyama, H., T. Arai, H. Kondo, E. Tanno, C. Haga, and K. Ikeda. 2000. Cellmediators of inflammation in the Alzheimer disease brain. Alzheimer Dis. Assoc.Disord. 14 (Suppl. 1): S47–S53.

26. Hirohata, M., K. Ono, H. Naiki, and M. Yamada. 2005. Non-steroidal anti-inflammatory drugs have anti-amyloidogenic effects for Alzheimer’s �-amyloidfibrils in vitro. Neuropharmacology 49: 1088–1099.

27. Townsend, K. P., and D. Pratico. 2005. Novel therapeutic opportunities for Alz-heimer’s disease: focus on nonsteroidal anti-inflammatory drugs. FASEB J. 19:1592–1601.

28. McGeer, P. L., and E. G. McGeer. 2006. NSAIDs and Alzheimer disease: epi-demiological, animal model and clinical studies. Neurobiol. Aging 28: 629–647.

29. McGeer, P. L., and E. G. McGeer. 2002. Local neuroinflammation and the pro-gression of Alzheimer’s disease. J. Neurovirol. 8: 529–538.

30. Rosenberg, P. B. 2005. Clinical aspects of inflammation in Alzheimer’s disease.Int. Rev. Psychiatry 17: 503–514.

31. Tuppo, E. E., and H. R. Arias. 2005. The role of inflammation in Alzheimer’sdisease. Int. J. Biochem. Cell Biol. 37: 289–305.

32. Sastre, M., T. Klockgether, and M. T. Heneka. 2006. Contribution of inflamma-tory processes to Alzheimer’s disease: molecular mechanisms. Int. J. Dev. Neu-rosci. 24: 167–176.

33. Minagar, A., P. Shapshak, R. Fujimura, R. Ownby, M. Heyes, and C. Eisdorfer.2002. The role of macrophage/microglia and astrocytes in the pathogenesis ofthree neurologic disorders: HIV-associated dementia, Alzheimer disease, andmultiple sclerosis. J. Neurol. Sci. 202: 13–23.

34. Streit, W. J., R. E. Mrak, and W. S. Griffin. 2004. Microglia and neuroinflam-mation: a pathological perspective. J. Neuroinflamm. 1: 14.

35. Streit, W. J. 2004. Microglia and Alzheimer’s disease pathogenesis. J. Neurosci.Res. 77: 1–8.

36. Ralay Ranaivo, H., J. M. Craft, W. Hu, L. Guo, L. K. Wing, L. J. Van Eldik, andD. M. Watterson. 2006. Glia as a therapeutic target: selective suppression ofhuman amyloid-�-induced upregulation of brain proinflammatory cytokine pro-duction attenuates neurodegeneration. J. Neurosci. 26: 662–670.

37. Johnston, J. B., C. Silva, J. Holden, K. G. Warren, A. W. Clark, and C. Power.2001. Monocyte activation and differentiation augment human endogenous ret-rovirus expression: implications for inflammatory brain diseases. Ann. Neurol.50: 434–442.

38. Tsutsui, S., J. Schnermann, F. Noorbakhsh, S. Henry, V. W. Yong,B. W. Winston, K. Warren, and C. Power. 2004. A1 adenosine receptor upregu-lation and activation attenuates neuroinflammation and demyelination in a modelof multiple sclerosis. J. Neurosci. 24: 1521–1529.

39. Mennicken, F., and R. Quirion. 1997. Interleukin-2 increases choline acetyltrans-ferase activity in septal-cell cultures. Synapse 26: 175–183.

40. Haughey, N. J., A. Nath, S. L. Chan, A. C. Borchard, M. S. Rao, andM. P. Mattson. 2002. Disruption of neurogenesis by amyloid �-peptide, andperturbed neural progenitor cell homeostasis, in models of Alzheimer’s disease.J. Neurochem. 83: 1509–1524.

41. Damiano, B. P., W. M. Cheung, R. J. Santulli, W. P. Fung-Leung, K. Ngo,R. D. Ye, A. L. Darrow, C. K. Derian, L. de Garavilla, and P. Andrade-Gordon.1999. Cardiovascular responses mediated by protease-activated receptor-2(PAR-2) and thrombin receptor (PAR-1) are distinguished in mice deficient inPAR-2 or PAR-1. J. Pharmacol. Exp. Ther. 288: 671–678.

42. Corley, S. M., U. Ladiwala, A. Besson, and V. W. Yong. 2001. Astrocytes at-tenuate oligodendrocyte death in vitro through an �6 integrin-laminin-dependentmechanism. Glia 36: 281–294.

43. Power, C., J. C. McArthur, A. Nath, K. Wehrly, M. Mayne, J. Nishio,T. Langelier, R. T. Johnson, and B. Chesebro. 1998. Neuronal death induced bybrain-derived human immunodeficiency virus type 1 envelope genes differs be-tween demented and nondemented AIDS patients. J. Virol. 72: 9045–9053.

44. Chishti, M. A., D. S. Yang, C. Janus, A. L. Phinney, P. Horne, J. Pearson,R. Strome, N. Zuker, J. Loukides, J. French, et al. 2001. Early-onset amyloiddeposition and cognitive deficits in transgenic mice expressing a double mutantform of amyloid precursor protein 695. J. Biol. Chem. 276: 21562–21570.

45. Dahlgren, K. N., A. M. Manelli, W. B. Stine, Jr., L. K. Baker, G. A. Krafft, andM. J. LaDu. 2002. Oligomeric and fibrillar species of amyloid-� peptides differ-entially affect neuronal viability. J. Biol. Chem. 277: 32046–32053.

46. Morris, R. 1984. Developments of a water-maze procedure for studying spatiallearning in the rat. J. Neurosci. Methods 11: 47–60.

47. Power, C., S. Henry, M. R. Del Bigio, P. H. Larsen, D. Corbett, Y. Imai,V. W. Yong, and J. Peeling. 2003. Intracerebral hemorrhage induces macrophageactivation and matrix metalloproteinases. Ann. Neurol. 53: 731–742.

48. Wang, J., H. Zheng, M. D. Hollenberg, S. J. Wijesuriya, X. Ou, andM. Hauer-Jensen. 2003. Up-regulation and activation of proteinase-activated re-ceptor 2 in early and delayed radiation injury in the rat intestine: influence ofbiological activators of proteinase-activated receptor 2. Radiat. Res. 160:524–535.

49. Le, Y., W. Gong, H. L. Tiffany, A. Tumanov, S. Nedospasov, W. Shen,N. M. Dunlop, J. L. Gao, P. M. Murphy, J. J. Oppenheim, and J. M. Wang. 2001.

5502 DIVERGENT ROLES OF PAR2 IN AD PATHOGENESIS

by guest on July 13, 2015http://w

ww

.jimm

unol.org/D

ownloaded from

Amyloid �42 activates a G-protein-coupled chemoattractant receptor, FPR-like-1.J. Neurosci. 21: RC123.

50. Tiffany, H. L., M. C. Lavigne, Y. H. Cui, J. M. Wang, T. L. Leto, J. L. Gao, andP. M. Murphy. 2001. Amyloid-� induces chemotaxis and oxidant stress by actingat formylpeptide receptor 2, a G protein-coupled receptor expressed in phago-cytes and brain. J. Biol. Chem. 276: 23645–23652.

51. Cui, Y., Y. Le, H. Yazawa, W. Gong, and J. M. Wang. 2002. Potential role of theformyl peptide receptor-like 1 (FPRL1) in inflammatory aspects of Alzheimer’sdisease. J. Leukocyte Biol. 72: 628–635.

52. Iribarren, P., Y. Zhou, J. Hu, Y. Le, and J. M. Wang. 2005. Role of formyl peptidereceptor-like 1 (FPRL1/FPR2) in mononuclear phagocyte responses in Alzheimerdisease. Immunol. Res. 31: 165–176.

53. Jover, T., H. Tanaka, A. Calderone, K. Oguro, M. V. Bennett, A. M. Etgen, andR. S. Zukin. 2002. Estrogen protects against global ischemia-induced neuronaldeath and prevents activation of apoptotic signaling cascades in the hippocampalCA1. J. Neurosci. 22: 2115–2124.

54. Abrous, D. N., M. Koehl, and M. Le Moal. 2005. Adult neurogenesis: fromprecursors to network and physiology. Physiol. Rev. 85: 523–569.

55. Al-Ani, B., S. J. Wijesuriya, and M. D. Hollenberg. 2002. Proteinase-activatedreceptor 2: differential activation of the receptor by tethered ligand and solublepeptide analogs. J. Pharmacol. Exp. Ther. 302: 1046–1054.

56. Smits, H. A., A. Rijsmus, J. H. van Loon, J. W. Wat, J. Verhoef, L. A. Boven,and H. S. Nottet. 2002. Amyloid-�-induced chemokine production in primaryhuman macrophages and astrocytes. J. Neuroimmunol. 127: 160–168.

57. Cui, Y. H., Y. Le, W. Gong, P. Proost, J. Van Damme, W. J. Murphy, andJ. M. Wang. 2002. Bacterial lipopolysaccharide selectively up-regulates the func-tion of the chemotactic peptide receptor formyl peptide receptor 2 in murinemicroglial cells. J. Immunol. 168: 434–442.

58. Cui, Y. H., Y. Le, X. Zhang, W. Gong, K. Abe, R. Sun, J. Van Damme, P. Proost,and J. M. Wang. 2002. Up-regulation of FPR2, a chemotactic receptor for amy-loid �1–42 (A�1–42), in murine microglial cells by TNF �. Neurobiol. Dis. 10:366–377.

59. Walker, D. G., L. F. Lue, and T. G. Beach. 2001. Gene expression profiling ofamyloid � peptide-stimulated human post-mortem brain microglia. Neurobiol.Aging 22: 957–966.

60. Franciosi, S., H. B. Choi, S. U. Kim, and J. G. McLarnon. 2005. IL-8 enhance-ment of amyloid-� (A�1–42)-induced expression and production of pro-inflam-matory cytokines and COX-2 in cultured human microglia. J. Neuroimmunol.159: 66–74.

61. Walker, D. G., J. Link, L. F. Lue, J. E. Dalsing-Hernandez, and B. E. Boyes.2006. Gene expression changes by amyloid � peptide-stimulated human post-mortem brain microglia identify activation of multiple inflammatory processes.J. Leukocyte Biol. 79: 596–610.

62. Iribarren, P., Y. H. Cui, Y. Le, G. Ying, X. Zhang, W. Gong, and J. M. Wang.2003. IL-4 down-regulates lipopolysaccharide-induced formyl peptide receptor 2in murine microglial cells by inhibiting the activation of mitogen-activated pro-tein kinases. J. Immunol. 171: 5482–5488.

63. Iribarren, P., K. Chen, J. Hu, X. Zhang, W. Gong, and J. M. Wang. 2005. IL-4inhibits the expression of mouse formyl peptide receptor 2, a receptor for amyloid�1–42, in TNF-�-activated microglia. J. Immunol. 175: 6100–6106.

64. Szczepanik, A. M., S. Funes, W. Petko, and G. E. Ringheim. 2001. IL-4, IL-10and IL-13 modulate A �1–42-induced cytokine and chemokine production in pri-mary murine microglia and a human monocyte cell line. J. Neuroimmunol. 113:49–62.

65. Chao, C. C., T. W. Molitor, and S. Hu. 1993. Neuroprotective role of IL-4 againstactivated microglia. J. Immunol. 151: 1473–1481.

66. Park, K. W., D. Y. Lee, E. H. Joe, S. U. Kim, and B. K. Jin. 2005. Neuropro-tective role of microglia expressing interleukin-4. J. Neurosci. Res. 81: 397–402.

67. Zhao, W., W. Xie, Q. Xiao, D. R. Beers, and S. H. Appel. 2006. Protective effectsof an anti-inflammatory cytokine, interleukin-4, on motoneuron toxicity inducedby activated microglia. J. Neurochem. 99: 1176–1187.

68. Lynch, A. M., D. J. Loane, A. M. Minogue, R. M. Clarke, D. Kilroy, R. E. Nally,O. J. Roche, F. O’Connell, and M. A. Lynch. 2007. Eicosapentaenoic acid con-fers neuroprotection in the amyloid-� challenged aged hippocampus. Neurobiol.Aging 28: 845–855.

69. Phinney, A. L., P. Horne, J. Yang, C. Janus, C. Bergeron, and D. Westaway.2003. Mouse models of Alzheimer’s disease: the long and filamentous road.Neurol. Res. 25: 590–600.

70. Hulshof, S., L. Montagne, C. J. De Groot, and P. Van Der Valk. 2002. Cellularlocalization and expression patterns of interleukin-10, interleukin-4, and theirreceptors in multiple sclerosis lesions. Glia 38: 24–35.

71. Meeuwsen, S., C. Persoon-Deen, M. Bsibsi, R. Ravid, and J. M. van Noort. 2003.Cytokine, chemokine and growth factor gene profiling of cultured human astro-cytes after exposure to proinflammatory stimuli. Glia 43: 243–253.

72. Abbas, N., I. Bednar, E. Mix, S. Marie, D. Paterson, A. Ljungberg, C. Morris,B. Winblad, A. Nordberg, and J. Zhu. 2002. Up-regulation of the inflammatorycytokines IFN-� and IL-12 and down-regulation of IL-4 in cerebral cortex re-gions of APPSWE transgenic mice. J. Neuroimmunol. 126: 50–57.

73. Hetz, C., M. Russelakis-Carneiro, S. Walchli, S. Carboni, E. Vial-Knecht,K. Maundrell, J. Castilla, and C. Soto. 2005. The disulfide isomerase Grp58 is aprotective factor against prion neurotoxicity. J. Neurosci. 25: 2793–2802.

74. Macfarlane, S. R., C. M. Sloss, P. Cameron, T. Kanke, R. C. McKenzie, andR. Plevin. 2005. The role of intracellular Ca2� in the regulation of proteinase-activated receptor-2 mediated nuclear factor �B signalling in keratinocytes.Br. J. Pharmacol. 145: 535–544.

75. Rosenberg, G. A. 2002. Matrix metalloproteinases in neuroinflammation. Glia39: 279–291.

76. Oka, Y., A. Uchida, M. Aoyama, M. Fujita, N. Hotta, T. Tada, H. Katano,M. Mase, K. Asai, and K. Yamada. 2005. Expression of myelencephalon-specificprotease after cryogenic lesioning of the rat parietal cortex. J. Neurotrauma 22:501–510.

77. Angelo, P. F., A. R. Lima, F. M. Alves, S. I. Blaber, I. A. Scarisbrick, M. Blaber,L. Juliano, and M. A. Juliano. 2006. Substrate specificity of human kallikrein 6:salt and glycosaminoglycan activation effects. J. Biol. Chem. 281: 3116–3126.

78. Oikonomopoulou, K., K. K. Hansen, M. Saifeddine, I. Tea, M. Blaber,S. I. Blaber, I. Scarisbrick, P. Andrade-Gordon, G. S. Cottrell, N. W. Bunnett,E. P. Diamandis, and M. D. Hollenberg. 2006. Proteinase-activated receptors,targets for kallikrein signaling. J. Biol. Chem. 281: 32095–32112.

79. Oikonomopoulou, K., K. K. Hansen, M. Saifeddine, N. Vergnolle, I. Tea,M. Blaber, S. I. Blaber, I. Scarisbrick, E. P. Diamandis, and M. D. Hollenberg.2006. Kallikrein-mediated cell signalling: targeting proteinase-activated recep-tors (PARs). Biol. Chem. 387: 817–824.

80. Oikonomopoulou, K., K. K. Hansen, M. Saifeddine, N. Vergnolle, I. Tea,E. P. Diamandis, and M. D. Hollenberg. 2006. Proteinase-mediated cell signal-ling: targeting proteinase-activated receptors (PARs) by kallikreins and more.Biol. Chem. 387: 677–685.

5503The Journal of Immunology

by guest on July 13, 2015http://w

ww

.jimm

unol.org/D

ownloaded from