The Probiotic Bifidobacterium breve B632 Inhibited the Growth of Enterobacteriaceae within Colicky Infant Microbiota Cultures

Research ArticleThe Probiotic Bifidobacterium breve B632Inhibited the Growth of Enterobacteriaceae withinColicky Infant Microbiota Cultures

Marta Simone1 Caterina Gozzoli1 Andrea Quartieri1 Giuseppe Mazzola2 Diana Di Gioia2

Alberto Amaretti1 Stefano Raimondi1 and Maddalena Rossi1

1 Dipartimento di Scienze della Vita Universita di Modena e Reggio Emilia Viale G Campi 183 41125 Modena Italy2 Dipartimento di Scienze Agrarie Universita di Bologna Viale Fanin 44 40127 Bologna Italy

Correspondence should be addressed to Maddalena Rossi maddalenarossiunimoreit

Received 20 June 2014 Revised 29 July 2014 Accepted 31 July 2014 Published 28 August 2014

Academic Editor Borja Sanchez

Copyright copy 2014 Marta Simone et al This is an open access article distributed under the Creative Commons Attribution Licensewhich permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited

Infant colic is a common gastrointestinal disorder of newborns mostly related to imbalances in the composition of gut microbiotaand particularly to the presence of gas-producing coliforms and to lower levels of Bifidobacteria and Lactobacilli Probioticscould help to contain this disturbance with formulations consisting of Lactobacillus strains being the most utilized In this workthe probiotic strain Bifidobacterium breve B632 that was specifically selected for its ability to inhibit gas-producing coliformswas challenged against the Enterobacteriaceae within continuous cultures of microbiota from a 2-month-old colicky infant Asconfirmed by RAPD-PCR fingerprinting B breve B632 persisted in probiotic-supplemented microbiota cultures accounting forthe 64 of Bifidobacteria at the steady state The probiotic succeeded in inhibiting coliforms since FISH and qPCR revealed thatthe amount of Enterobacteriaceae after 18 h of cultivation was 042 and 044 magnitude orders lower (119875 lt 005) in probiotic-supplemented microbiota cultures than in the control ones These results support the possibility to move to another level of studythat is the administration of B breve B632 to a cohort of colicky newborns in order to observe the behavior of this strain in vivoand to validate its effect in colic treatment

1 Introduction

In the first hours of life the germ-free gastrointestinal tract ofnewborns is colonized by microorganisms deriving from themother and from the environment with the establishmentof a microbial community that will evolve into one of themost complex microbial ecosystems [1] The maintenance ofa correct balance of gut bacterial population is extremelyimportant since microbiota performs a variety of activitiesand functions that deeply influence the health status of thehost such as the metabolism of nondigestible compoundswith supply of short chain fatty acids vitamin biosynthesisthe regulation of immune system and the prevention ofpathogen colonization [2 3]

Despite the fact that increasing information about micro-biota composition in adults is arising from metagenomicsand other culture-independent approaches the dynamics of

initial colonization and evolution of the bacterial communityduring the first days of life are poorly understood so far [4] Innewborns microbiota composition is variable and unstableand the establishment of the intestinal microbiota is highlydependent on many factors such as the mode of birth breastor formula feeding and antibiotic intake [5ndash7] Furthermorefactors affecting the tropism and host-microbe interactionssuch as intestinal pH body temperature bile acids peristalsismucosal immune response receptors and internal synergyexert a pivoting role in shaping the composition of bacte-rial population [8 9] Initially culturing studies indicatedthat the pioneer bacteria colonizing the digestive tract ofnewborns are Enterobacteriaceae and Gram-positive cocci(eg Streptococcus Staphylococcus) which lower the redoxpotential and generate an anoxic environment favorablefor the establishment of strictly anaerobic bacteria suchas Bacteroidetes Bifidobacterium and Clostridiales [8 10]

Hindawi Publishing CorporationBioMed Research InternationalVolume 2014 Article ID 301053 7 pageshttpdxdoiorg1011552014301053

2 BioMed Research International

Bifidobacteria are generally reported to prevail in the gutmicrobiota of naturally delivered breast-fed infants after a fewdays at the expenses of Enterobacteriaceae and facultativeaerobes [11] However culture independent investigationshave provided evidence that infant colonizationmay bemuchmore complex since it may be primed by anaerobes as well(eg Clostridiales) and Bifidobacteria may not be among thefirst colonizers or may remain a numerical minority [12]

Infant colic is a common functional gastrointestinal dis-order of newborns characterized by long bouts of crying andhard-to-relieve behavior [13] Crying peaks range between6 and 12 weeks of age and cause considerable concernand distress to parents The pathogenesis of infant colic isnot well understood and several underlying causes havebeen suggested [13] Among them the relationship betweencolonic microbiota and this disorder is emerging as a majordeterminant Culturing studies revealed higher counts ofGram-negative bacteria and a less numerous populationof Lactobacilli and Bifidobacteria in the feces of colickyinfants compared with healthy infants [14] Molecular globalinvestigation of the microbiota composition through phy-logenetic microarray analysis demonstrated that gut micro-biota differentiate much more slowly in colicky infants thanin healthy ones and that colic correlated positively withthe presence of specific genera of Gammaproteobacteria(such as Escherichia Klebsiella Serratia Vibrio Yersiniaand Pseudomonas) and negatively with bacteria belongingto the Bacteroidetes and Firmicutes [15 16] Consistently itis known that Enterobacteriaceae such as bacteria belong-ing to Escherichia and Klebsiella produce gas from mixedacid fermentation and proinflammatory lipopolysaccharidesboth these mechanisms being proposed to favor colic[17 18]

The microbiota of colicky infants also presents loweramounts of Bifidobacteria and Lactobacilli which are knownto be anti-inflammatory and to exert various healthy prop-erties [19ndash21] The intake of probiotic Lactobacilli duringthe first months of life can contribute to containing colic[22 23] On the contrary in vivo studies utilizing probioticBifidobacteria for the treatment of colic are lackingThe strainBifidobacterium breve B632 possesses antimicrobial activityagainst gas-producing coliforms isolated from the stools ofinfants suffering from colic [24]

In order to obtain preliminary results that could supportan in vivo trial the present study challenged B breve B632against the Enterobacteriaceae within cultures of microbiotafrom a 2-month-old colicky infant A continuous culturefermentation simulating the gutmicrobiota of a colicky infantwas performed to examine the time-course of E coli andEnterobacteriaceae populations

2 Methods

21 Chemicals and Bacterial Strain All the chemicals weresupplied by Sigma (Stenheim Germany) unless otherwisestated Bifidobacterium breve B632 was obtained from BUS-CoB strain collection (Scardovi Collection of BifidobacteriaDept of Agro-Environmental Science and Technology Uni-versity of Bologna Italy) The strain was accepted for deposit

by DSMZ for patent purposes and named B breve DSMZ24706 It was cultured anaerobically at 37∘C in LactobacilliMRS broth (BD Difco Sparks USA) containing 05 gL L-cysteine hydrochloride (hereinafter called MRS)

22 Cultures of Gut Microbiota The cultures of gut micro-biota were performed in a microbiota medium MM [25]where the carbon source was substituted with 60 gL ofa mixture of galactooligosaccharides (GOS Domo VivinalNeedseweg The Netherlands) and fructooligosaccharides(FOS Beneo-Orafti P95 Oreye Belgium) The mixture wascomposed of 90 GOS and 10 FOS (ww) in agree-ment with the composition of prebiotic infant formula [26]Oligosaccharideswere filter-sterilized (022120583m)and added tothe medium after autoclaving

Fresh feces from a breast-fed colicky infant born bynatural delivery and not treated with antibiotics or probi-otics were utilized to prepare the inoculum for single-stagecontinuous cultures Inoculum preparation was performedin anaerobic cabinet under an 85 N

2 10 CO

2 and 5

H2atmosphere Feces were diluted to the ratio of 1 10 (wv)

in MM supplemented with 10 glycerol (vv) and stored atminus80∘C until use

In control microbiota cultures (MC) 5mL of fecal sus-pension was thawed at 37∘C and utilized to inoculate bench-top bioreactors (Sixfors V301 Infors Bottmingen Swiss)containing 250mL of MM Fresh MMwas fed at the dilutionrate of 0042 hminus1 corresponding to one turnover per dayThemedium was flushed with CO

2to maintain anaerobiosis

The culture was kept in anaerobiosis at 37∘C under gentleagitation Automatic titration with 4M NaOH maintainedpH at 65

In probiotic-supplemented microbiota cultures (PMC)fecal cultures were supplemented with 50 E + 7 cfumL ofB breve B632 Concentrated stock cultures of B breve B632were supplementedwith glycerol (10 vv) enumerated ontoMRS-agar plates and stored at minus80∘C until an appropriatevolume was thawed and used for bioreactor inoculation

Samples from MC and PMC were periodically collectedto analyze fermentation products to examine the microbiotacomposition and to enumerate and isolate bifidobacteria

23 Fluorescent In Situ Hybridization (FISH) FISH enumer-ation of total bacteria bifidobacteria and Enterobacteriaceaewas based on the procedure of Harmsen et al [27] with slightmodifications Culture samples were diluted to the ratio of1 4 with 40 gL paraformaldehyde and incubated overnightat 4∘C Fixed cells were washed with PBS at pH 74 and thendehydrated with PBS-ethanol 1 1 solution for 1 h at 4∘C Theprobes Eub 338 Bif 164 and Enterobact D were used for totalbacteria bifidobacteria and Enterobacteriaceae respectively[28] To perform hybridization 10 120583L of cell suspension 1 120583Lof the specific FITC-labeled probe and 100 120583L of hybridiza-tion buffer (20mM TRIS-HCl 09M NaCl and 01 SDS)were mixed and incubated for 16 h at the temperature specificfor each probe [28]

A proper amount of the cell suspension was diluted in4mL of washing buffer (20mM TRIS-HCl 09M NaCl) and

BioMed Research International 3

maintained at hybridization temperature for 10min beforebeing filtered onto 02120583m polycarbonate filters (MilliporeEttenleur The Netherlands) Filters were mounted on micro-scope slides with Vectashield (Vector Labs BurlingameCalifornia) The slides were evaluated with a fluorescencemicroscope (Eclipse 80i Nikon Instruments) equipped withmercury arc lamp FITC specific filter and digital cameraDepending on the number of fluorescent cells 30 to 100microscopic fields were counted and averaged in each slideEach sample was enumerated in triplicate

24 qPCR Biomass samples from MC and PMC cultureswere collected by centrifugation suspended in PBS (pH 78)and extracted with QIAmp DNA Stool Mini Kit (QiagenHilden Germany) to obtain bacterial gDNA gDNA wasquantified with NanoPhotometer P-Class (Implen GmbHMunchen Germany) diluted to 25 ng120583L in TE buffer pH8 and subjected to qPCR analysis with primers targetingEnterobacteriaceae and Escherichia coli [29ndash31] The setof primers Eco-F (GTTAATACCTTTGCTCATTGA)Eco-R(ACCAGGGTATCAATCCTGTT) and Ent-F (ATGGCT-GTCGTCAGCTCGT)Ent-R (CCTACTTCTTTTGCAAC-CCACTC) were used for Enterobacteriaceae and Escherichiacoli respectively The mixture contained 10 120583L of SsoFastEvaGreen Supermix 4 120583L of each 2120583M primer and 2 120583L oftemplate qPCR reaction was carried out with the CFX96Real-Time System (Bio-Rad Laboratories Redmond WAUSA) according to the following protocol 98∘C for 2min45 cycles at 98∘C for 005min 60∘C for 005min and 95∘Cfor 1min 65∘C for 1min

25 RAPD-PCR Tracing of Bifidobacterium breve B632 Freshculture samples were serially diluted in Wilkins-Chalgrenanaerobe broth (Oxoid) in the anaerobic cabinet and platedon RB selective medium in order to count and isolateBifidobacteria [32] Genomic DNA was extracted from 200colonies isolated from the PMC processes using Instagenematrix (Bio-Rad) RAPD-PCR was carried out in a 15 120583Lreaction mixture 10X Dream Taq Buffer (including MgCl

2

2mM) 15 120583L dNTPs mixture 010mM 015 120583L 2 120583M M13primer (GAGGGTGGCGGTTCT) 375120583L genomic DNA3 120583L and PCR water 525 120583L DNA amplification was per-formed with the following protocol 94∘C for 4min (1 cycle)94∘C for 1min 34∘C for 1min 72∘C for 2min (45 cycles) 72∘Cfor 7min (1 cycle) The PCR products were electrophoresedin a 2 agarose gel (25 times 25 cm) for 4 h at a constant voltage(160V) in TAE buffer (40mMTris-acetate 1mM EDTA andpH 80) RAPD-PCR profiles were visualized under ultra-violet light after staining with ethidium bromide followedby digital image capturing The resulting fingerprints wereanalyzed by the Gene Directory 20 (Syngene UK) softwarepackage The similarity among digitalized profiles was calcu-lated and a dendrogramwas derivedwith an unweighted pair-group method using arithmetic means (UPGMA)

26 Analysis of Fermentation Products The samples wereclarified through centrifugation (13000timesg 5min 4∘C) andfiltration (022120583mcellulose acetate filter) and stored at minus20∘C

until analyzed Fermentation products (formic acetic lacticpropionic butyric and succinic acids and ethanol) wereanalyzed using a HPLC device (Agilent technologies Wald-bronn Germany) equipped with refractive index detectorand Aminex HPX-87 H ion exclusion column Isocraticelution was carried out with 0005M H

2SO4at 06mLmin

[33]

27 Statistical Analysis All values are means of four sepa-rate experiments Comparisons were carried out accordingto Studentrsquos 119905-test Differences were considered statisticallysignificant for 119875 lt 005

3 Results

31 Evolution of Fecal Microbial Groups and Fermenta-tion Products Single-stage continuous fermentation of thecolonic microbiota from a colicky newborn was carried outfor 24 h to study whether the addition of B breve B632could affect the growth of Enterobacteriaceae BifidobacteriaEnterobacteriaceae and total bacteria were enumerated inMC and in PMC the latter supplemented with 50 E +07 cfumL of B breve B632 (Figures 1(a) and 1(b)) After 18 hof cultivation FISH bacterial counts became steady in bothMC and PMC cultures Eubacteria increased up to 90ndash94 E+09 cfumL without statistically significant difference betweenPMCandMC (119875 gt 005) At all the time points bifidobacteriawere more abundant in PMC than in MC (119875 lt 005) Ente-robacteriaceae were negatively affected by the presence of Bbreve B632 and were always less numerous in PMC than inMC (119875 lt 005)

The evolution of Enterobacteriaceae and E coli wasdetermined also with q-PCR during the whole processEnterobacteriaceae were significantly lower in PMC than inMC (119875 lt 005) consistently with FISH results On the otherhand statistically significant difference was not observedin the levels of E coli (119875 gt 005) with the exception of18 h when E coli was less numerous in MC than in PMC(Figure 2)

The presence of B breve B632 in PMC cultures wastraced using RAPD-PCR fingerprinting at all the time pointsColonies were isolated using the Bifidobacterium selectivemedium RB and those positive to Bifidobacterium-specificPCRwere subjected to RAPD-PCR analysis At the beginningof the fermentation B breve B632 represented the 85 ofbifidobacterial isolates in PMC then decreased to 73 after6 h and stabilized at 64 at the steady state (119899 = 4 SDlt 34) The relative amount of B breve B632 tended todecrease albeit differences at the diverse time points werenot statistically significant Considering that at the steadystate Bifidobacteria accounted for approximately 38 oftotal eubacteria according to FISH enumeration B breveB632 can be estimated as approximately the 24 of totalbacterial population in PMC In these samples 2 biotypesof Bifidobacteria represented the autochthonous componentThe same two biotypes were identified also at the inoculumin MC cultures together with two other minor ones noneof them exhibiting a RAPD-PCR profile similar to that of Bbreve B632


60

65

70

75

80

85

90

95

0 6 12 18 24(h)

Log 1

0(cellsmL)

(a)

60

65

70

75

80

85

90

95

0 6 12 18 24(h)

Log 1

0(C

FUm

L)

(b)

Figure 1 Time-course of total bacteria bifidobacteria and Enterobacteriaceae in cultures of infant gut microbiota Eubacteria ()Bifidobacterium () and Enterobacteriaceae (◼) were quantified by FISH in control cultures (MC (a)) and in cultures supplemented with Bbreve B632 (PMC (b)) Data are means plusmn SD 119899 = 4

60

65

70

75

80

85

90

95

0 6 12 18 24(h)

Log 1

0(cellsmL)

lowastlowast

lowast

lowast

lowast

Figure 2 Time-course of E coli and Enterobacteriaceae in culturesof infant gutmicrobiotaE coli () andEnterobacteriaceae () werequantified by qPCR in control cultures (MC dashed line) and incultures supplementedwithB breveB632 (PMC solid line)Data aremeans plusmn SD 119899 = 4 Stars indicate statistically significant differencebetween MC and PMC cultures (119875 lt 005)

Formate acetate lactate propionate butyrate andethanol originated by microbiota metabolism during theprocesses (Figures 3(a) and 3(b)) Like the bacterial countsthe concentrations of microbial products became stationaryafter approximately 18 h Ethanol formate lactate andacetate were the first to increase at the beginning of thefermentation Propionate 23-butanediol and butyrateaccumulated later while lactate decreased as the steady statewas approached

During the growth phase the major differences betweenMC and PMC processes were acetate and ethanol accumu-lating at different levels during the first hours of the processafter 12 h in MC and PMC ethanol was 16 and 08 gLwhile acetate 08 and 24 gL respectively At the steady state(18 h) MC had higher levels of butyrate and ethanol thanPMC while acetate and lactate were higher in PMC (119875 lt005) The other metabolites exhibited similar steady-stateconcentrations in PMC and MC processes (119875 gt 005)

4 Discussion

Literature reports the use of Lactobacillus spp strains toalleviate the symptoms of infant colic [22 23] On the otherhand no information is available on this specific use ofbifidobacteria although in vitro results showed that strains ofBifidobacterium can exert antimicrobial activity against gasforming coliforms [24] Among a panel of Bifidobacteriumstrains that were selected as potential candidates for pro-biotic use against colic in infants B breve B632 appearedparticularly promising because of its strong antimicrobialactivity against coliforms coupled to the lack of transmis-sible antibiotic resistance traits and cytotoxicity for the gutepithelium Moreover the strain is capable of adhering togut epithelium cell lines and could stimulate gut healthby increasing metabolic activity and immune response ofepithelial cells [24]

In the present work the antagonistic effect of B breveB632 against coliforms was challenged within gut microbiotacultures of a colicky newborn simulating in vivo conditionsin order to propose its use as anticolic probiotic B breveB632 survived well within the fecal culture exhibiting a highviability during the process At all the time points Enterobac-teriaceae were significantly less numerous in presence of theprobiotic These results indicate that B breve B632 exerted


(h)

00

05

10

15

20

25

0 6 12 18 24

(gL)

(a)

(h)

00

05

10

15

20

25

0 6 12 18 24

(gL)

(b)

Figure 3 Time-course of fermentation products in cultures of infant gut microbiota Ethanol () lactate () acetate () formate (998771)propionate (◻) 23-butanediol (◼) and butyrate (22C4) were determined in control cultures (MC (a)) and in cultures supplemented with Bbreve B632 (PMC (b)) Data are means 119899 = 4 and SD always lt 025 gL

antimicrobial activity against coliforms in fecal cultures aswell consistently with previous observation with spot agartests and cocultures [24]

Unlike Enterobacteriaceae E coli counts were notaffected by the presence of the probiotic This observationcan be ascribed to the different specificity of the primersets utilized in qPCR quantification since the primers forEnterobacteriaceae recognize a broader spectrum of speciesthan the ones for E coli (Table 1)

Based on the list of species that align with qPCR primersand FISH probes it is likely that Gammaproteobacteria otherthanE coli are involved in infant colic For example the qPCRprimers for Enterobacteriaceae should recognize Yersiniawhereas the FISH probe for Enterobacteriaceae is expectedto miss it

Fecal samples have amicrobial composition that does notexactly correspond to that of the colonic content wheremajormicrobial-host interactions occur and richness and diversityseem underrepresented [34] However systems as the oneherein described are currently the best tools to investigate theexternal factors that could influence the intestinal microbialcomposition such as antibiotics or to test novel potentialprobiotics before carrying out expensive in vivo trials Thedata herein presented indicate that the potential probioticstrainB breveB632was able to survive in a complexmicrobialenvironment and restrained Enterobacteriaceae population

5 Conclusions

The present study demonstrated the ability of a properlyselected probiotic Bifidobacterium strain B breve B632 toinhibit the growth of Enterobacteriaceae in an in vitromodelsystem simulating the intestinal microbiota of a 2-month-oldcolicky infantThese results support the possibility tomove toanother level of study that is the administration of B breve

Table 1 Genera of human intestinal bacteria potentially recognizedby FISH probes and qPCR primers according to SILVA

Probe or primer set Genus

Enterobact D

CitrobacterCronobacterEdwardsiellaEnterobacterEscherichiaKlebsiellaKluyveraPantoeaRaoultellaSerratiaShigella

Ent-FEnt-R

EdwardsiellaEscherichiaKlebsiellaPantoeaProteus

ProvidenciaPseudomonas

ShigellaYersinia

Eco-FEco-RCronobacterEscherichiaShigella

B632 to a cohort of colicky newborns in order to observe thebehavior of this strain in vivo and to validate its effect in colictreatment


Conflict of Interests

The authors certify that there is no actual or potential conflictof interests in relation to this paper

References

[1] L Morelli ldquoPostnatal development of intestinal microflora asinfluenced by infant nutritionrdquo Journal of Nutrition vol 138 no9 pp 1791Sndash1795S 2008

[2] F Guarner and J R Malagelada ldquoGut flora in health anddiseaserdquoThe Lancet vol 361 no 9356 pp 512ndash519 2003

[3] I Sekirov S L Russell L CaetanoMAntunes and B B FinlayldquoGut microbiota in health and diseaserdquo Physiological Reviewsvol 90 no 3 pp 859ndash904 2010

[4] D di Gioia I Aloisio G Mazzola and B Biavati ldquoBifidobac-teria their impact on gut microbiota composition and theirapplications as probiotics in infantsrdquo Applied Microbiology andBiotechnology vol 98 no 2 pp 563ndash577 2014

[5] M G Dominguez-Bello E K Costello M Contreras et alldquoDelivery mode shapes the acquisition and structure of theinitial microbiota across multiple body habitats in newbornsrdquoProceedings of the National Academy of Sciences of the UnitedStates of America vol 107 no 26 pp 11971ndash11975 2010

[6] E Bezirtzoglou A Tsiotsias and G W Welling ldquoMicrobiotaprofile in feces of breast- and formula-fed newborns by usingfluorescence in situ hybridization (FISH)rdquoAnaerobe vol 17 no6 pp 478ndash482 2011

[7] F Fouhy R P Ross G F Fitzgerald C Stanton and P D CotterldquoComposition of the early intestinal microbiota knowledgeknowledge gaps and the use of high-throughput sequencing toaddress these gapsrdquo Gut Microbes vol 3 no 3 pp 203ndash2202012

[8] R I Mackie A Sghir and H R Gaskins ldquoDevelopmentalmicrobial ecology of the neonatal gastrointestinal tractrdquo TheAmerican Journal of Clinical Nutrition vol 69 no 5 pp 1035Sndash1045S 1999

[9] L VHooper D R Littman andA JMacpherson ldquoInteractionsbetween the microbiota and the immune systemrdquo Science vol336 no 6086 pp 1268ndash1273 2012

[10] C F Favier E E Vaughan W M de Vos and A D LAkkermans ldquoMolecular monitoring of succession of bacterialcommunities in human neonatesrdquo Applied and EnvironmentalMicrobiology vol 68 no 1 pp 219ndash226 2002

[11] K Orrhage and C E Nord ldquoFactors controlling the bacterialcolonization of the intestine in breastfed infantsrdquo Acta Paedi-atrica Supplement vol 88 no 430 pp 47ndash57 1999

[12] Y Valles M J Gosalbes L E de Vries J J Abellan andM P Francino ldquoMetagenomics and development of the gutmicrobiota in infantsrdquo Clinical Microbiology and Infection vol18 no 4 pp 21ndash26 2012

[13] M L Cirgin Ellett ldquoWhat is known about infant colicrdquoGastro-enterology Nursing vol 26 no 2 pp 60ndash65 2003

[14] F Savino F Cresi S Pautasso et al ldquoIntestinal microflora inbreastfed colicky and non-colicky infantsrdquoActa Paediatrica vol93 no 6 pp 825ndash829 2004

[15] C de Weerth S Fuentes and W M de Vos ldquoCrying in infantson the possible role of intestinal microbiota in the developmentof colicrdquo Gut Microbes vol 4 no 5 pp 416ndash421 2013

[16] C deWeerth S Fuentes P Puylaert andWM de Vos ldquoIntesti-nal microbiota of infants with colic development and specificsignaturesrdquo Pediatrics vol 131 no 2 pp e550ndashe558 2012

[17] F Savino L Cordisco V Tarasco R Calabrese E PalumeriandDMatteuzzi ldquoMolecular identification of coliform bacteriafrom colicky breastfed infantsrdquo Acta Paediatrica vol 98 no 10pp 1582ndash1588 2009

[18] F Savino L Cordisco V Tarasco et al ldquoAntagonistic effect ofLactobacillus strains against gas-producing coliforms isolatedfrom colicky infantsrdquoBMCMicrobiology vol 11 article 157 2011

[19] T A Oelschlaeger ldquoMechanisms of probiotic actionsmdashareviewrdquo International Journal of Medical Microbiology vol 300no 1 pp 57ndash62 2010

[20] M Rossi A Amaretti A Leonardi S Raimondi M Simoneand A Quartieri ldquoPotential impact of probiotic consumptionon the bioactivity of dietary phytochemicalsrdquo Journal of Agri-cultural and Food Chemistry vol 61 no 40 pp 9551ndash9558 2013

[21] M Rossi A Amaretti and S Raimondi ldquoFolate production byprobiotic bacteriardquo Nutrients vol 3 no 1 pp 118ndash134 2011

[22] F Savino L Cordisco V Tarasco et al ldquoLactobacillus reuteriDSM 17938 in infantile colic a randomized double-blindplacebo-controlled trialrdquo Pediatrics vol 126 no 3 pp e526ndashe533 2010

[23] J Anabrees F Indrio B Paes and K Alfaleh ldquoProbiotics forinfantile colic a systematic reviewrdquo BMC Pediatrics vol 13 p186 2013

[24] I Aloisio C Santini B Biavati et al ldquoCharacterization of Bifi-dobacterium spp strains for the treatment of enteric disordersin newbornsrdquo Applied Microbiology and Biotechnology vol 96no 6 pp 1561ndash1576 2012

[25] F Tomas-Barberan R Garcıa-Villalba A Quartieri et alldquoIn vitro transformation of chlorogenic acid by human gutmicrobiotardquoMolecular Nutrition and Food Research vol 58 no5 pp 1122ndash1131 2014

[26] E Bruzzese M Volpicelli V Squeglia et al ldquoA formula con-taining galacto- and fructo-oligosaccharides prevents intestinaland extra-intestinal infections an observational studyrdquo ClinicalNutrition vol 28 no 2 pp 156ndash161 2009

[27] H J M Harmsen P Elfferich F Schut and G W Welling ldquoA16S rRNA-targeted probe for detection of lactobacilli and ente-rococci in faecal samples by fluorescent in situ hybridizationrdquoMicrobial Ecology in Health and Disease vol 11 no 1 pp 3ndash121999

[28] A W Walker S H Duncan E C M Leitch M W Childand H J Flint ldquopH and peptide supply can radically alterbacterial populations and short-chain fatty acid ratios withinmicrobial communities from the human colonrdquo Applied andEnvironmental Microbiology vol 71 no 7 pp 3692ndash3700 2005

[29] T Rinttila A Kassinen E Malinen L Krogius and A PalvaldquoDevelopment of an extensive set of 16S rDNA-targeted primersfor quantification of pathogenic and indigenous bacteria in fae-cal samples by real-time PCRrdquo Journal of Applied Microbiologyvol 97 no 6 pp 1166ndash1177 2004

[30] E Malinen A Kassinen T Rinttila and A Palva ldquoComparisonof real-time PCR with SYBR green I or 51015840-nuclease assaysand dot-blot hybridizationwith rDNA-targeted oligonucleotideprobes in quantification of selected faecal bacteriardquo Microbiol-ogy vol 149 no 1 pp 269ndash277 2003

[31] M Castillo S M Martın-Orue E G Manzanilla I BadiolaM Martın and J Gasa ldquoQuantification of total bacteriaenterobacteria and lactobacilli populations in pig digesta byreal-time PCRrdquo Veterinary Microbiology vol 114 no 1-2 pp165ndash170 2006

[32] R Hartemink B J Kok G H Weenk and F M RomboutsldquoRaffinose-Bifidobacterium (RB) agar a new selective medium


for bifidobacteriardquo Journal of Microbiological Methods vol 27no 1 pp 33ndash43 1996

[33] A Amaretti T Bernardi A Leonardi S Raimondi S Zanoniand M Rossi ldquoFermentation of xylo-oligosaccharides by Bifi-dobacterium adolescentis DSMZ 18350 kinetics metabolismand 120573-xylosidase activitiesrdquo Applied Microbiology and Biotech-nology vol 97 no 7 pp 3109ndash3117 2013

[34] ADurban J J AbellanN Jimenez-Hernandez et al ldquoAssessinggut microbial diversity from feces and rectal mucosardquoMicrobialEcology vol 61 no 1 pp 123ndash133 2011

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of


Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology


Molecular Biology International

GenomicsInternational Journal of


The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014


BioinformaticsAdvances in

Marine BiologyJournal of



Signal TransductionJournal of


BioMed Research International

Evolutionary BiologyInternational Journal of



Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014


Genetics Research International


Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational



Enzyme Research



Microbiology


Bifidobacteria are generally reported to prevail in the gutmicrobiota of naturally delivered breast-fed infants after a fewdays at the expenses of Enterobacteriaceae and facultativeaerobes [11] However culture independent investigationshave provided evidence that infant colonizationmay bemuchmore complex since it may be primed by anaerobes as well(eg Clostridiales) and Bifidobacteria may not be among thefirst colonizers or may remain a numerical minority [12]

Infant colic is a common functional gastrointestinal dis-order of newborns characterized by long bouts of crying andhard-to-relieve behavior [13] Crying peaks range between6 and 12 weeks of age and cause considerable concernand distress to parents The pathogenesis of infant colic isnot well understood and several underlying causes havebeen suggested [13] Among them the relationship betweencolonic microbiota and this disorder is emerging as a majordeterminant Culturing studies revealed higher counts ofGram-negative bacteria and a less numerous populationof Lactobacilli and Bifidobacteria in the feces of colickyinfants compared with healthy infants [14] Molecular globalinvestigation of the microbiota composition through phy-logenetic microarray analysis demonstrated that gut micro-biota differentiate much more slowly in colicky infants thanin healthy ones and that colic correlated positively withthe presence of specific genera of Gammaproteobacteria(such as Escherichia Klebsiella Serratia Vibrio Yersiniaand Pseudomonas) and negatively with bacteria belongingto the Bacteroidetes and Firmicutes [15 16] Consistently itis known that Enterobacteriaceae such as bacteria belong-ing to Escherichia and Klebsiella produce gas from mixedacid fermentation and proinflammatory lipopolysaccharidesboth these mechanisms being proposed to favor colic[17 18]

The microbiota of colicky infants also presents loweramounts of Bifidobacteria and Lactobacilli which are knownto be anti-inflammatory and to exert various healthy prop-erties [19ndash21] The intake of probiotic Lactobacilli duringthe first months of life can contribute to containing colic[22 23] On the contrary in vivo studies utilizing probioticBifidobacteria for the treatment of colic are lackingThe strainBifidobacterium breve B632 possesses antimicrobial activityagainst gas-producing coliforms isolated from the stools ofinfants suffering from colic [24]

In order to obtain preliminary results that could supportan in vivo trial the present study challenged B breve B632against the Enterobacteriaceae within cultures of microbiotafrom a 2-month-old colicky infant A continuous culturefermentation simulating the gutmicrobiota of a colicky infantwas performed to examine the time-course of E coli andEnterobacteriaceae populations

2 Methods

21 Chemicals and Bacterial Strain All the chemicals weresupplied by Sigma (Stenheim Germany) unless otherwisestated Bifidobacterium breve B632 was obtained from BUS-CoB strain collection (Scardovi Collection of BifidobacteriaDept of Agro-Environmental Science and Technology Uni-versity of Bologna Italy) The strain was accepted for deposit

by DSMZ for patent purposes and named B breve DSMZ24706 It was cultured anaerobically at 37∘C in LactobacilliMRS broth (BD Difco Sparks USA) containing 05 gL L-cysteine hydrochloride (hereinafter called MRS)

22 Cultures of Gut Microbiota The cultures of gut micro-biota were performed in a microbiota medium MM [25]where the carbon source was substituted with 60 gL ofa mixture of galactooligosaccharides (GOS Domo VivinalNeedseweg The Netherlands) and fructooligosaccharides(FOS Beneo-Orafti P95 Oreye Belgium) The mixture wascomposed of 90 GOS and 10 FOS (ww) in agree-ment with the composition of prebiotic infant formula [26]Oligosaccharideswere filter-sterilized (022120583m)and added tothe medium after autoclaving

Fresh feces from a breast-fed colicky infant born bynatural delivery and not treated with antibiotics or probi-otics were utilized to prepare the inoculum for single-stagecontinuous cultures Inoculum preparation was performedin anaerobic cabinet under an 85 N

2 10 CO

2 and 5

H2atmosphere Feces were diluted to the ratio of 1 10 (wv)

in MM supplemented with 10 glycerol (vv) and stored atminus80∘C until use

In control microbiota cultures (MC) 5mL of fecal sus-pension was thawed at 37∘C and utilized to inoculate bench-top bioreactors (Sixfors V301 Infors Bottmingen Swiss)containing 250mL of MM Fresh MMwas fed at the dilutionrate of 0042 hminus1 corresponding to one turnover per dayThemedium was flushed with CO

2to maintain anaerobiosis

The culture was kept in anaerobiosis at 37∘C under gentleagitation Automatic titration with 4M NaOH maintainedpH at 65

In probiotic-supplemented microbiota cultures (PMC)fecal cultures were supplemented with 50 E + 7 cfumL ofB breve B632 Concentrated stock cultures of B breve B632were supplementedwith glycerol (10 vv) enumerated ontoMRS-agar plates and stored at minus80∘C until an appropriatevolume was thawed and used for bioreactor inoculation

Samples from MC and PMC were periodically collectedto analyze fermentation products to examine the microbiotacomposition and to enumerate and isolate bifidobacteria

23 Fluorescent In Situ Hybridization (FISH) FISH enumer-ation of total bacteria bifidobacteria and Enterobacteriaceaewas based on the procedure of Harmsen et al [27] with slightmodifications Culture samples were diluted to the ratio of1 4 with 40 gL paraformaldehyde and incubated overnightat 4∘C Fixed cells were washed with PBS at pH 74 and thendehydrated with PBS-ethanol 1 1 solution for 1 h at 4∘C Theprobes Eub 338 Bif 164 and Enterobact D were used for totalbacteria bifidobacteria and Enterobacteriaceae respectively[28] To perform hybridization 10 120583L of cell suspension 1 120583Lof the specific FITC-labeled probe and 100 120583L of hybridiza-tion buffer (20mM TRIS-HCl 09M NaCl and 01 SDS)were mixed and incubated for 16 h at the temperature specificfor each probe [28]

A proper amount of the cell suspension was diluted in4mL of washing buffer (20mM TRIS-HCl 09M NaCl) and





2




2SO4at 06mLmin

[33]


3 Results





60

65

70

75

80

85

90

95

0 6 12 18 24(h)

Log 1

0(cellsmL)

(a)

60

65

70

75

80

85

90

95

0 6 12 18 24(h)

Log 1

0(C

FUm

L)

(b)


60

65

70

75

80

85

90

95

0 6 12 18 24(h)

Log 1

0(cellsmL)

lowastlowast

lowast

lowast

lowast




4 Discussion




(h)

00

05

10

15

20

25

0 6 12 18 24

(gL)

(a)

(h)

00

05

10

15

20

25

0 6 12 18 24

(gL)

(b)






5 Conclusions




Enterobact D


Ent-FEnt-R



ShigellaYersinia






References












































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology





2




2SO4at 06mLmin

[33]


3 Results





60

65

70

75

80

85

90

95

0 6 12 18 24(h)

Log 1

0(cellsmL)

(a)

60

65

70

75

80

85

90

95

0 6 12 18 24(h)

Log 1

0(C

FUm

L)

(b)


60

65

70

75

80

85

90

95

0 6 12 18 24(h)

Log 1

0(cellsmL)

lowastlowast

lowast

lowast

lowast




4 Discussion




(h)

00

05

10

15

20

25

0 6 12 18 24

(gL)

(a)

(h)

00

05

10

15

20

25

0 6 12 18 24

(gL)

(b)






5 Conclusions




Enterobact D


Ent-FEnt-R



ShigellaYersinia






References












































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology


60

65

70

75

80

85

90

95

0 6 12 18 24(h)

Log 1

0(cellsmL)

(a)

60

65

70

75

80

85

90

95

0 6 12 18 24(h)

Log 1

0(C

FUm

L)

(b)


60

65

70

75

80

85

90

95

0 6 12 18 24(h)

Log 1

0(cellsmL)

lowastlowast

lowast

lowast

lowast




4 Discussion




(h)

00

05

10

15

20

25

0 6 12 18 24

(gL)

(a)

(h)

00

05

10

15

20

25

0 6 12 18 24

(gL)

(b)






5 Conclusions




Enterobact D


Ent-FEnt-R



ShigellaYersinia






References












































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology


(h)

00

05

10

15

20

25

0 6 12 18 24

(gL)

(a)

(h)

00

05

10

15

20

25

0 6 12 18 24

(gL)

(b)






5 Conclusions




Enterobact D


Ent-FEnt-R



ShigellaYersinia






References












































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology




References












































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology












Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology








Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology

Documents

The Probiotic Bifidobacterium breve B632 Inhibited the Growth of Enterobacteriaceae within Colicky Infant Microbiota Cultures