Journal of Insect Physiology 56 (2010) 575–585

Tritrophic interactions among Macrosiphum euphorbiae aphids, their host plantsand endosymbionts: Investigation by a proteomic approach

F. Francis a,*, F. Guillonneau b, P. Leprince c, E. De Pauw b, E. Haubruge a, L. Jia d, F.L. Goggin d

a Functional and Evolutionary Entomology, Gembloux Agro-Bio Tech, University of Liege, Liege, Belgiumb Laboratory of Mass Spectrometry, University of Liege, Liege, Belgiumc GIGA Neurosciences, University of Liege, Liege, Belgiumd Department of Entomology, University of Arkansas, Fayetteville, USA

A R T I C L E I N F O

Article history:

Received 13 November 2008

Received in revised form 30 November 2009

Accepted 1 December 2009

Keywords:

Aphid

Symbiosis

R gene

Metabolic pathways

2D-DIGE

A B S T R A C T

The Mi-1.2 gene in tomato confers resistance against certain clones of the potato aphid (Macrosiphum

euphorbiae). This study used 2D-DIGE coupled with protein identification by MALDI-TOF-MS to compare

the proteome patterns of avirulent and semivirulent potato aphids and their bacterial endosymbionts on

resistant (Mi-1.2+) and susceptible (Mi-1.2�) tomato lines. Avirulent aphids had low survival on resistant

plants, whereas the semivirulent clone could colonize these plants. Eighty-two protein spots showed

significant quantitative differences among the four treatment groups, and of these, 48 could be assigned

putative identities. Numerous structural proteins and enzymes associated with primary metabolism

were more abundant in the semivirulent than in the avirulent aphid clone. Several proteins were also up-

regulated in semivirulent aphids when they were transferred from susceptible to resistant plants. Nearly

25% of the differentially regulated proteins originated from aphid endosymbionts and not the aphid

itself. Six were assigned to the primary endosymbiont Buchnera aphidicola, and 5 appeared to be derived

from a Rickettsia-like secondary symbiont. These results indicate that symbiont expression patterns

differ between aphid clones with differing levels of virulence, and are influenced by the aphids’ host

plant. Potentially, symbionts may contribute to differential adaptation of aphids to host plant resistance.

� 2009 Elsevier Ltd. All rights reserved.

Contents lists available at ScienceDirect

Journal of Insect Physiology

journa l homepage: www.e lsev ier .com/ locate / j insphys

1. Introduction

Plants have evolved a wide range of biochemical defences todeter pests such as herbivorous insects and plant pathogens. Manypests in turn display adaptations that help them overcome thesebarriers. The interaction between tomato plants (Solanum lyco-

persicum synonym Lycopersicon esculentum) and the potato aphid(Macrosiphum euphorbiae) represents a fascinating system to studythe relationship between defence and counter-defence. Manycommercial tomato cultivars carry the Mi-1.2 gene that confersresistance against potato aphids as well as root-knot nematodes(Meloidogyne spp.) (Rossi et al., 1998; Milligan et al., 1998). Mi-mediated resistance inhibits feeding by both pests, therebylimiting their survival and reproduction (Kaloshian et al., 2000;Riggs and Winstead, 1959). Certain naturally occurring aphid andnematode populations have the ability to overcome resistance andproliferate on resistant plants, and these are termed virulent clones(Goggin et al., 2001; Riggs and Winstead, 1959). Because Mi-1.2 isnot effective against all pest clones, previous literature has

* Corresponding author. Tel.: +32 81 622283; fax: +32 81 622312.

E-mail address: Frederic.Francis@ulg.ac.be (F. Francis).

0022-1910/$ – see front matter � 2009 Elsevier Ltd. All rights reserved.

doi:10.1016/j.jinsphys.2009.12.001

suggested that Mi-mediated resistance may function in a gene-for-gene manner (Rossi et al., 1998). According to the gene-for-gene model that was originally developed to describe plant–pathogen interactions, a single dominant resistance gene (R gene)in the plant regulates a defence response that is triggered by theproduct of a single avirulence gene in the pest (Flor, 1955). Virulentpest populations may emerge through the loss or modification ofthe avirulence gene product, allowing the pest to evade the plant’sR gene-dependent surveillance system (Parker and Gilbert, 2004).This model has been validated for many plant disease resistancegenes with structural similarity to Mi-1.2. However, certainfeatures of the tomato/nematode or tomato/aphid interactionsuggest further complexities. Two different putative avirulencefactors have been identified in different root-knot nematodepopulations (Gleason et al., 2008; Semblat et al., 2001); therefore,Mi-1.2 could potentially be similar to the disease resistance geneRpm1, which participates in recognition of more than one differenteffector protein (Grant et al., 1995). In addition, artificial selectionexperiments with avirulent asexual root-knot nematode clonesdemonstrated that nematodes’ ability to reproduce on resistantplants could increase in a step-wise fashion over time, suggestingthat virulence in some populations might be a polygenic ratherthan a monogenic trait (Castagnone-Sereno et al., 1994). A

F. Francis et al. / Journal of Insect Physiology 56 (2010) 575–585576

comparison of the performance of different potato aphid clones onresistant tomato plants also revealed naturally occurring quanti-tative differences in aphid virulence against Mi-1.2, rather than aclear-cut qualitative distinction between avirulent and virulentgenotypes (Hebert et al., 2007). It is possible that the ability ofaphids and nematodes to survive and reproduce on plants thatcarry Mi-1.2 is influenced by quantitative traits such as the abilityto detoxify plant defensive compounds or to produce virulencefactors that overwhelm plant defences.

The quantitative variation in aphid and nematode virulenceagainst Mi-1.2 offers an intriguing system in which to study the basisof virulence in pests. Moreover, the tomato/aphid interaction isparticularly interesting because it involves multiple genomes(reviewed in Goggin, 2007). All aphids harbor a bacterial endosym-biont, Buchnera aphidicola that contributes to their ability to surviveon a nutritionally imbalanced diet of phloem sap by synthesizingamino acids that are deficient in the aphids’ diet (Douglas, 2006). Inaddition, many aphids harbor a variety of so-called secondary orfacultative symbiont species that are not uniformly distributedamong all populations of a particular aphid species. Some of thesesecondary endosymbionts have been shown to help aphids adjust toheat stress and ward off parasitoids and entomopathogenic fungi(Montllor et al., 2002; Oliver et al., 2005; Scarborough et al., 2005). Inthe case of the pea aphid, Acyrthosiphon pisum, it also appears thatthe range of plant species that a particular aphid clone can utilizemay be influenced by an interaction between the aphid genotypeand its complement of secondary symbionts (Ferrari et al., 2007 andcitations therein). Little if anything is known about the possibleindirect interactions between the host plants and endosymbionts ofherbivores, but these interactions could potentially have animportant role in determining herbivore performance.

In this study, a proteomic approach using 2D-DIGE analysiscoupled with mass spectrometry was performed to investigate theimpact of Mi-mediated resistance on the combined aphid/symbiont proteome, and to compare the proteomes of two aphidclones that differ in their response to Mi-1.2. This study utilized anavirulent clonal aphid population (clone WU11) that is stronglydeterred by Mi-mediated resistance, and a semivirulent clone(clone WU12) with decreased sensitivity to resistance. Both aphidclones feed on resistant plants when confined to them, but havedifficulty in establishing prolonged feeding bouts (Goggin,unpublished). Despite this, the population growth of the WU12aphid clone is not as strongly inhibited by resistance as theavirulent WU11 clone. Previous experiments showed that cloneWU12 had 10–30 times higher population growth than cloneWU11 on resistant plants, and compared to aphid numbers onsusceptible plants, Mi-mediated resistance reduced WU12 num-bers by only 15%, in contrast to a 95% reduction in WU11 aphids(Hebert et al., 2007). Based on this evidence, we have classified theWU12 aphid clone as semivirulent. Compared to clone WU11, theWU12 aphids also appeared to induce higher levels of necrosis inboth susceptible and resistant host plants (Hebert et al., 2007).

One goal of this study was to examine how exposure to resistantplants influences protein profiles in avirulent and semivirulentaphids. By identifying responses that are unique to semivirulentaphids, we sought to identify candidate proteins that mightcontribute to this clone’s ability to survive and reproduce onresistant plants. To this end, four treatment groups werecompared: WU11 and WU12 aphids fed on a susceptible tomatocultivar (lacking Mi-1.2), and WU11 and WU12 aphids that hadbeen exposed to an isogenic resistant line that carries Mi-1.2.Additional objectives of this study were to determine whetheraphid exposure to resistant plants influenced the profile of proteinsproduced by their symbionts, and whether symbionts contributedto differences in protein profiles between different aphid clones. Ifso, symbionts could potentially influence host adaptation in

different aphid clones. To address these questions, proteins thatwere differentially regulated between two or more treatmentgroups were classified by origin (insect- or symbiont-derived). Thisstudy identified several proteins whose abundance in thesemivirulent aphid varied in response to exposure to resistantplants. Furthermore, our data indicate that several of theseproteins are derived from endosynbionts, and that symbiontscontribute to proteomic differences between aphid clones.

2. Materials and methods

2.1. Plants and insect materials

This study utilized two previously described clones of thepotato aphid, M. euphorbiae, which were given the designationsWU11 and WU12 (Goggin et al., 2001; Hebert et al., 2007). Each ofthe clonal populations used for this study were established from asingle female. Clone WU11 derived from a laboratory colonycollected in France, while clone WU12 derived from a laboratorycolony originally collected in Germany. The two clones have beenreared on tomato under the same laboratory conditions for morethan six years. Aphids were maintained in Conviron growthchambers (Controlled Environments, Inc., Winnipeg, Canada)under optimum conditions for aphid growth and development(20 8C, 16:8 L:D photoperiod) on seedlings of a susceptible (Mi-

1.2�) tomato cultivar, S. lycopersicum cv. UC82. Voucher specimensof WU11 and WU12 aphid clones are located in the University ofArkansas Arthropod Museum (Fayetteville, AR).

Two isogenic tomato lines were used for this study: asusceptible tomato cultivar that lacks the Mi-1 locus (S. lycopersi-

cum cv. Moneymaker) and a transgenic tomato line with the samegenetic background that was transformed with Mi-1.2 (transgenicline 143-25) (Milligan et al., 1998). This transgenic line waspreviously confirmed to be resistant to the potato aphid (Goggin etal., 2006). Plants were grown under greenhouse conditions aspreviously described (Hebert et al., 2007).

Approximately six weeks after germination, susceptible andresistant tomato plants (cv. Moneymaker and transgenic line 143-25) were challenged with aphids. Each plant was inoculated witheither clone WU11 or clone WU12, and there were 3 replicateplants for each of the four combinations of aphid clone and plantgenotype. Three leaflets per plant were enclosed in individualsleeve cages, each containing 50 aphids of mixed life stages. Forty-eight hours after inoculation, live aphids were collected and flash-frozen in liquid nitrogen, and stored at �80 8C until use. Eachsample consisted of 100 mg of adult aphids.

2.2. 2D polyacrylamide gel electrophoresis

2.2.1. Analytical 2D gel electrophoresis

One hundred milligram of samples were crushed in a 7 M urea,2 M thiourea 20 mM Tris pH 8.5 buffer including 2% CHAPS,centrifuged at 15,000 � g, 4 8C for 15 min. Supernatants werecollected and proteins were precipitated using the 2D Clean Up Kitaccording to the manufacturer’s instructions (GE Healthcare).Quantification of the precipitated proteins was realised using theRCDC quantification kit from Biorad. The protein extracts (samplesof 25 mg) were labelled with one of three Cydyes (GE Healthcare)following standard DIGE protocol. Two samples corresponding totwo different treatment groups (WU11 or WU12 aphid clones onplants with or without Mi-1.2) labelled either with Cy3 or Cy5 weremixed with an internal reference standard protein mixture (pooledfrom equal aliquots from all of the experimental samples) labelledwith Cy2. A conventional dye swap for DIGE was performed bylabelling two replicates from each treatment group with one dye(Cy3 or Cy5) and the third replicate with the other of the two

F. Francis et al. / Journal of Insect Physiology 56 (2010) 575–585 577

Cydyes. This mix of labelled proteins was adjusted to a volume of450 ml that was used to rehydrate 24 cm IPG strips (pH 3–10 NL fromGE Healthcare) for 12 h at 20 8C and constant voltage of 50 V.Isoelectric focusing (IEF) was carried out at 200 V for 200 Vh, 500 Vfor 500 Vh, 1000 V for 1000 Vh and 8000 V for 60,000 Vh at 20 8C anda maximum current setting of 50 mA/strip in an isoelectric focusingunit from GE Healthcare. Following IEF, the IPG strips wereequilibrated for 15 min in 375 mM Tris (pH 8.8) containing 6 Murea, 20% (v/v) glycerol, 2% (w/v) SDS, and 130 mM DTT and then fora further 15 min in the same buffer except that DTT was replacedwith 135 mM iodoacetamide. The IPG strips were then sealed with0.5% agarose in SDS running buffer at the top of slab gels(240 mm� 200 mm� 1 mm) polymerized from 12% (w/v) acryl-amide and 0.1% N,N0-methylenebisacrylamide. The second-dimen-sional electrophoresis was performed at 20 8C in Ettan Dalt-sixelectrophoresis unit (GE Healthcare) at 25 W/gel for 5 h. Gels werescanned with a Typhoon fluorescence imager (Amersham) atwavelengths corresponding to each Cydye. Images were analysedwith DeCyder 2D software version 6.5 (GE Healthcare) according tothe manufacturer’s instructions. Each treatment was analysed inthree replicates.

2.2.2. Protein identifications

A non-labelled 400 mg sample of aphid protein mixture wasadded in one of the analytical gel and the protein spots were excisedfrom that gel using an Ettan spotpicker robot (GE Healthcare).Selected gel pieces were collected in 96-well plates designed for theProteineer dp automated Digester (Bruker, Bremen, Germany).Briefly: gels pieces were washed with 3 alternative soaking in 100%ammonium hydrogenocarbonate 50 mM, and a mix of 50%acetonitrile 50% ammonium hydrogenocarbonate 50 mM. Twoadditional washes were performed with 100% acetonitrile todehydrate the gel. 3 ml of freshly activated trypsin (Roche, porcine,proteomics grade) 10 ng/ml in ammonium hydrogenocarbonate wasused to rehydrate the gel pieces at 8 8C for 30 min. Trypsin digestionwas performed for 3 h at 30 8C. Peptides extraction was performedwith 10 ml of 1% formic acid for 30 min at 20 8C.

Protein digests (3 ml) were adsorbed for 3 min on prespottedanchorchips(R) using the Proteineer dp automaton. Spots werewashed ‘‘on-target’’ using 10 mM dihydrogeno-ammonium phos-phate in 0.1% TFA-MilliQ water to remove salts. High throughputspectra acquisition was performed using an Ultraflex II MALDI massspectrometer (Bruker) in positive reflectron mode, with closecalibration enabled, Smartbeam laser focus set to medium, and alaser fluency setting of 65–72% of the maximum. Delayed extractionis set to 30 ns. Steps of 100 spectra in the range of 860–3800 Da areacquired at a 200 Hz laser shot frequency with automatedevaluation of intensity, resolution and mass range. 600 successfulspectra per sample are summed, treated and de-isotoped in line withan automated SNAP algorithm using Flex Analysis 2.4 software(Bruker), and subsequently submitted in the batch mode of theBiotools 3.0 software suite (Bruker) with an in-house hosted Mascotsearch engine (MatrixScience.com) to the databases. The firstdatabase used was the public NCBI non-redundant database(released from 2008/06/20 including 6,515,383 sequences) andthe second was a homemade aphid database built using all availablepea aphid genome sequence data (built on 2008/07/02, including302,316 sequences) provided by Dr. D. Tagu (INRA Rennes, France)and corresponding to the today publicly available sequences fromthe Pea Aphid Consortium. A mass tolerance of 80 ppm with closecalibration and one missing cleavage site were allowed. Partialoxidation of methionine residues and complete carbamylation ofcystein residues are considered. The probability score calculated bythe software was used as one criterion for correct identification.Experimental and Mascot results molecular weights and pI were alsocompared. To categorize the identified proteins based on metabolic

function, searches were performed using the Kegg pathwaydatabase and Expasy Proteomic tools, in particular the Biochemi-cal–Metabolic pathway sections.

2.2.3. PCR-based detection of a secondary aphid symbiont

To test for the presence of a Rickettsial endosymbiont in ourpotato aphid clones, primers were designed to amplify a portion ofthe 16S rRNA gene from the Rickettsia-like endosymbiont of thepea aphid based on a published sequence for this symbiont(Genbank accession number AB196668). The primer sequenceswere as follows: Forward primer 50 ACGGAGGAAAGATTTATCGC 30,Reverse primer 50 CGAAACCGAGAGAAAATCTC 30. As a positivecontrol, whiteflies (Bemisia tabaci) that were previously confirmedto carry a Rickettsia symbiont were obtained from Dr. MarthaHunter, University of Arizona. DNA was extracted from aphidclones WU11 and WU12 and whiteflies using a Qiagen DNeasyTissue kit (QIAGEN Inc., Valencia, CA). One microgram of DNA persample was used as a template for PCR, and water was used as anegative control. PCR was performed using a PCT-200 Pelterthermal cycler (MJ Research Inc., Watertown, MA). 0.2 mM offorward and reverse primers was used with GoTaq Green PCRMaster Mix kit (Promega, Madison, WI). PCR conditions were asfollows: a 4 min denaturing step at 95 8C followed by 40 cycles of95 8C 30 s, 55 8C 30 s 72 8C 30 s. PCR products were visualized on1% agarose gels and were sequenced directly by the DNASequencing Core Facility of the Department of Microbiology andImmunology, University of Arkansas for Medical Sciences, in boththe forward and reverse directions after purification with aQIAquick PCR Purificaton Kit (QIAGEN Inc., Valencia, CA).

3. Results

3.1. Identification of differentially regulated proteins

More than 2000 spots stained with Cydyes were detected in theaphid samples separated on 2D gels (Fig. 1). Quantitativedifferences in spot intensity were observed among the fourtreatment groups. Student’s t-tests were performed to analyze thefollowing comparisons among the treatment groups: avirulentaphids on resistant (Mi-1.2+) versus susceptible (Mi-1.2�) plants;semivirulent aphids on resistant versus susceptible plants;semivirulent versus avirulent aphids on resistant plants; andsemivirulent (WU12) versus avirulent (WU11) aphids on suscep-tible plants. According to our statistical threshold (p < 0.05,Student’s t-test), a total of 82 proteins exhibited differences innormalized spot volume ratios exceeding 1.5 between two or moretreatment groups. From the varying 82 protein spots, only sixvaried in more than one comparison, and of these six, two wereunknown proteins (spots 952 and 1855) and four could beidentified (spots 779, 797, 1521, and 3074). Altogether, 45 of thedifferentially regulated proteins were identified (Tables 1 and 2).

3.2. Differences in protein profiles between aphids on resistant

and susceptible plants

No significant differences in protein profiles were observedbetween avirulent aphids exposed to resistant plants and avirulentaphids on susceptible plants. In contrast, 19 proteins showedsignificant differences (p < 0.05) in abundance in the semivirulentaphid on resistant versus susceptible plants. Among them, 16 wereidentified and are presented in Tables 1 and 2 and Fig. 2. Themajority of these proteins were up-regulated when aphids wereexposed to resistant plants (11/16). Eleven of the differentiallyregulated proteins appeared to be of insect origin, and fiveappeared to be derived from bacterial endosymbionts (spots 3074,867, 131, 2760, and 1521).

Fig. 1. A 2D-PAGE of Macrosiphum euphorbiae protein reference mixture labelled with Cydye 2 separated on a 12.5% acrylamide gel. Identified proteins showing significant

expression level were annotated on the gel, complete properties are given in Tables 1 and 2.

Fig. 2. Comparison of protein expression between semivirulent WU12 aphids

exposed to resistant transgenic plants (with Mi-1.2) versus susceptible tomato

plants (without Mi-1.2). Protein identification data for each particular spot number

is given in Table 1. Grey and black bars represented proteins identified from insect

and bacterial endosymbionts respectively. Labels on the right indicate the

functional categories to which the proteins are assigned. Proteins with a fold

change ratio of >1 were more abundant in WU12 aphids exposed to resistant

plants, whereas proteins with a fold change ratio of <1 were more abundant in

WU12 aphids exposed to susceptible plants.

F. Francis et al. / Journal of Insect Physiology 56 (2010) 575–585578

3.3. Differences in protein profiles between avirulent and

semivirulent aphids

To investigate the base-line differences in the proteomes ofour two aphid clones, we compared individuals that were fedonly on susceptible tomato plants. This situation revealeddifferences in the expression patterns of 14 protein spots, nineof which could be identified according to MS analysis (Fig. 3 and

Fig. 3. Comparison of protein expression between the semivirulent WU12 and

avirulent WU11 aphid clones exposed to susceptible tomato plants (without Mi-

1.2). Protein identifications data for each particular spot numbers are given in Table

1. Grey and black bars represent proteins identified from insect and bacterial

endosymbionts respectively. Labels on the right indicate the functional categories

to which the proteins are assigned. Proteins with a fold change ratio of >1 were

more abundant in clone WU12 than in clone WU11, whereas proteins with a fold

change ratio of <1 were more abundant in WU11 aphids.

Table 1A list of identified proteins and related metabolic pathways in aphids that differ in abundance between two or more treatment groups.a.

Spot number MW pI Score Coverage Peptide number Protein identification Accession Organism

Amino acid metabolism

2014 34,690 9.07 71 28 11 Arginine kinase ABC86902 Blattella germanica

Carbohydrate metabolism

184 88,526 9.26 80 16 12 Citrate synthase EAT36098.1 Aedes aegypti

384 99,362 5.87 69 20 16 Phosphoenolpyruvate carboxylase Q57H97 Drosophila melanogaster

509 83523 8.72 111 29 21 Mitochondrial aconitase EAT44980.1 Aedes aegypti

779 67,859 6.90 52 20 13 Transketolase ABD36172 Bombyx mori

827 73,024 6.38 146 39 12 Aconitase NP524708 Drosophila melanogaster

1114 52,307 7.22 157 41 18 Citrate synthase NP499264 Caenorhabditis elegans

1318 52,307 7.22 130 27 13 Citrate synthase AAR98859 Thunnus albacares

1334 56,880 7.91 52 24 10 Aldehyde dehydrogenase NP001022078 Caenorhabditis elegans

1891 36,081 8.57 70 33 11 Malate dehydrogenase AAY63978 Lysiphlebus testaceipes

Cell signaling

387 85,307 6.85 49 17 13 ADAM 17-like protease precursor ADA17_DROME Drosophila melanogaster

Co-factors and vitamins

2190 33,625 4.96 56 29 8 Ribosomal protein SA AAV34856 Bombyx mori

Cytoskeleton

261 73,900 6.12 81 22 19 b-Tubulin NP_001036964.1 Bombyx mori

797 59,531 5.91 222 49 11 Paramyosin CAA44475 Drosophila melanogaster

1145 50,654 4.76 219 59 19 b-1 Tubulin AAB84297 Manduca sexta

1335 42,047 7.96 158 52 19 Muscle LIM protein BAB33159 Drosophila melanogaster

1703 42,194 5.30 212 56 19 Actin-5C ACT1_DROME Drosophila melanogaster

1703 44,000 5.18 217 60 22 Paramyosin CAA44475 Drosophila melanogaster

2548 23,821 4.79 111 56 17 Tropomyosin isoform 5 ABF51445.1 Bombyx mori

2606 26,095 5.27 70 36 10 Paramyosin CAA41557.1 Drosophila melanogaster

2648 15,911 5.23 52 27 4 Cuticular protein AAL29466 Myzus persicae

Energy metabolism

832 59,918 9.06 62 27 10 ATP synthase AAU84946 Toxoptera citricida

1102 59,612 9.09 70 26 13 ATP synthase a chain ATPA_DROME Drosophila melanogaster

1144 50,907 4.80 229 65 20 ATP synthase NP726631 Drosophila melanogaster

1874 48,092 8.74 82 29 12 Ubiquinol-cytochrome c reductase AAU84932 Toxoptera citricida

2318 32,419 6.21 57 30 8 Ras suppressor-1 NP609665 Drosophila melanogaster

Exoskeleton

755 66,643 7.67 78 26 18 Glycine-rich protein BAE06190 Bombyx mori

1169 66,643 7.67 124 32 17 Glycine-rich protein BAE06190 Bombyx mori

Stress response

652 71,372 5.36 41 17 9 Heat shock 70 kDa protein HSP7D_DROME Drosophila melanogaster

1088 71,626 5.34 147 33 24 Heat shock cognate 70 protein AAF09496 Manduca sexta

1214 53,949 9.18 71 28 14 Hsc70/Hsp90 protein NP_001036957 Bombyx mori

1790 60,278 5.2 37 21 7 Hsp60 protein CAB58441 Myzus persicae

Xenobiotic degradation

638 82,652 7.43 84 10 4 Esterase E4 P35502 Myzus persicae

1220 58,570 9.10 38 20 11 Cytochrome P450 C4D21_DROME Drosophila melanogaster

MW, molecular weight; pI, isoelectric point; Score, Mowse score according to Mascot search; Coverage, percentage of the protein sequence identified; Peptide number,

number of peptide hits for each protein; Accession, accession number on NCBI; Organism, related original organism for the protein identification.a Proteins that significantly varied (p<0.05) between different aphid clones on the same plant or between aphids of a single clone reared on different plants are listed by

spot number according to the gel image analysis. The same spot identification numbers are used in Figs. 1–3.

F. Francis et al. / Journal of Insect Physiology 56 (2010) 575–585 579

Tables 1 and 2). The comparison between the proteomes of theavirulent and the semivirulent aphid clones when both wereexposed to resistant transgenic tomato plants revealed that30 protein spots varied between these aphid clones (Fig. 4).Twenty-five of the variable proteins were identified, includingsix related to bacterial endosymbionts (Tables 1 and 2). Of these25 proteins, only two also differed between clones when theywere exposed to susceptible plants (spots 797 and 779). Thus, wecould identify 23 proteins that significantly differed between thetwo aphid clones only when they were exposed to resistantplants.

3.4. Contribution of bacterial symbionts to the proteomic

differences among treatments

Eight proteins of putative bacterial origin differed in abun-dance between the two aphid clones examined in this study

(Figs. 3 and 4), and five bacterial proteins varied in abundance inresponse to the host plant genotype (Fig. 2). These differentiallyregulated proteins not only included proteins derived from theprimary symbiont B. aphidicola, but also included enzymes withhomology to sequences from several Rickettsia species (Table 2).Four of these proteins differed in abundance between the twoaphid clones (spots 1255, 1521, 1681, and 2518; Figs. 3 and 4), andtwo were up-regulated in the semivirulent aphid when it wastransferred from susceptible to resistant plants (spots 1521 and2760; Fig. 1). Using primers that target a portion of the 16S rRNAgene from pea aphid Rickettsia (PAR), we amplified a 630 bpsequence from M. euphorbiae clone WU12, which we sequencedand submitted to Genbank (accession number EU779951. Thissequence was 98% identical to the previously reported PARsequence (Genbank accession number AB196668), which provid-ed verification that a Rickettsia-like symbiont is present in M.

euphorbiae.

Table 2List of identified proteins and related metabolic pathways in bacterial endosymbionts that differed in abundance between two or more treatment groups.a.

Spot number MW pI Score Coverage Peptide number Protein identification Accession Organism

Carbohydrate metabolism

867 54,056 9.36 59 6 4 6-Phosphogluconate dehydrogenase 6PGD_BUCAP Buchnera aphidicola

3074 27,516 7.16 92 37 10 Glucose-6-phosphate isomerase NP_240377 Buchnera aphidicola

Energy metabolism

1152 52,030 9.05 44 17 8 ATP synthase FLII_BUCAI Buchnera aphidicola

2299 20,373 7.66 50 40 4 Inorganic pyrophosphatase IPYR_BUCBP Buchnera aphidicola

Genetic information

1681 52,283 5.67 47 22 7 RecN protein 13235419 Rickettsia rickettsii

2518 18,602 8.90 76 29 7 Methylated-DNA–protein-cysteine S-methyltransferase Q1RIP0 Rickettsia bellii

Membrane transport

786 70,861 5.26 82 23 15 ABC transporter NP_240120 Buchnera aphidicola

Nucleotide metabolism

2760 22,375 4.88 81 37 9 HD superfamily hydrolase NZ_AADJ01000001 Rickettsia rickettsii

Protein synthesis

1255 77,783 5.32 52 24 13 Elongation factor G (EF-G) EFG_RICBE Rickettsia bellii

Amino acid metabolism

1521 53,817 6.95 67 15 6 UDP-N-acetylmuramoylalanyl-D-glutamate-

2,6-diaminopimelate ligase

15620020 Rickettsia conorii

131 92,385 5.20 71 11 10 Carbamoylphosphate synthase NP_239976 Buchnera aphidicola

MW, molecular weight; pI, isoelectric point; Score, Mowse score according to Mascot search; Coverage, percentage of the protein sequence identified; Peptide number,

number of peptide hits for each protein.a Proteins that significantly varied (p<0.05) between different aphid clones on the same plant or between aphids of a single clone reared on different plants are listed by

spot number according to the gel image analysis. The same spot identification numbers are used in Figs. 1–3.

Fig. 4. Comparison of protein expression between semivirulent WU12 and avirulent

WU11 aphid clones exposed to resistant transgenic tomato plants (with Mi-1.2).

Protein identification data for each particular spot numbers are given in Table 1.

Grey and black bars represented proteins identified from insect and bacterial

endosymbionts respectively. Labels on the right indicate the functional categories

to which the proteins are assigned. Proteins with a fold change ratio of >1 were

more abundant in clone WU12 than in clone WU11, whereas proteins with a fold

change ratio of <1 were more abundant in WU11 aphids.

F. Francis et al. / Journal of Insect Physiology 56 (2010) 575–585580

3.5. Common protein classes that differed among treatment groups

3.5.1. Carbohydrate and energy metabolism

The most numerous of the differentially regulated proteinsobserved in this study were those associated with carbohydrateand energy metabolism (Figs. 2–4). Several enzymes required forglycolysis, the citric acid cycle, the pentose phosphate cycle, andenergy metabolism varied among our treatment groups (Fig. 5),and the majority of these differentially regulated proteins weremore abundant in the semivirulent aphid clone than in theavirulent clone (Figs. 2 and 3). Two exceptions to this were malatedehydrogenase (MDH) and ubiquinol cytochrome c reductase,which was more abundant in avirulent aphids than in semivirulentaphids when they were reared on resistant plants (Fig. 4). MDHcatalyzes the NAD/NADH-dependent interconversion of thesubstrates malate and oxaloacetate. This reaction plays a key partin the malate/aspartate shuttle across the mitochondrial mem-brane, and in the citric acid cycle (Minarik et al., 2002). The activityof malate dehydrogenase is also involved in the biosynthesis oflipids, and has been shown to be under hormonal regulation ininsects, particularly by the juvenile hormone (JH) and ecdysteroidtitre in the insect body (Farkas and Knopp, 1997). Ubiquinolcytochrome c reductase is part of the cytochrome bc(1) membranecomplex that serves as a hub in the vast majority of electrontransfer chains, and it oxidizes ubiquinol, resulting in the reductionof cytochrome c and an iron-sulfur Rieske protein (Fry andSaweikis, 2006).

Interestingly, we observed differential regulation not only ofcarbohydrate- and energy-related enzymes from the aphid itselfbut also from its endosymbionts (Tables 1 and 2). Compared to theavirulent WU11 aphid clone, the semivirulent WU12 aphid clonehad higher levels of ATP synthases from both the aphid itself and itsprimary endosymbiont B. aphidicola (spots 1102 and 1152,respectively), as well as a bacterial inorganic pyrophosphatase(spot 2299; Figs. 2 and 3). Expression of carbohydrate- and energy-related enzymes in aphids and symbionts were also influenced bythe host plant. Transferring the semivirulent clone from suscepti-ble to resistant plants altered expression of enzymes from the citricacid cycle in the aphid (phosphoenolpyruvate carboxylase [spot

Fig. 5. Scheme summarizing the role and location in the metabolic pathways of proteins that were differentially regulated between different aphid clones, or between aphids

reared on different host plants (with or without the Mi-1.2 resistance gene). Proteins in red are identified to originate from the aphid itself (due to high homology to other

insect species) and proteins in blue are derived from bacterial endosymbionts. (For interpretation of the references to color in this figure legend, the reader is referred to the

web version of the article.)

F. Francis et al. / Journal of Insect Physiology 56 (2010) 575–585 581

384] and citrate synthase [spots 114 and 184]) and the pentosephosphate cycle in the primary symbiont B. aphidicola (glucosephosphate isomerase [spots 3074] and 6-phosphogluconatedehydrogenase [spot 867]) (Fig. 2). It is worth noting that citratesynthase can display considerable diversity in its structure andcatalytic and regulatory functions (Weitzman, 1987); thus, the twocitrate synthases (spots 114 and 184) that were differentiallyregulated in semivirulent aphids could potentially differ instructure and function.

A subset of the differentially expressed proteins related toenergy generation were linked to GTPase activity. Compared toavirulent aphids, semivirulent aphids exposed to resistant plantshad higher levels of Elongation factor G (spot 1255, EF-G). ThisGTPase from Rickettsia promotes the directional movement ofmRNA and tRNAs on the ribosome in a GTP-dependent manner.Unlike other GTPases, but by analogy to the myosin motor, EF-Gperforms its function of powering translocation in the GDP-boundform by GTP hydrolysis on the ribosome (Wintermeyer andRodnina, 2000). On susceptible hosts, the semivirulent clone alsohad higher levels of an aphid Ras1 suppressor (spot 2318) thanavirulent aphids. Ras proteins are small GTPases involved incellular signal transduction, and the Ras suppressor-1 influencesnumerous biological processes, including MAP kinase cascades,defence responses, protein amino acid phosphorylation, andtransmembrane receptor protein serine/threonine kinase signalingpathways (Schnorr et al., 2001). Transferring semivirulent aphidsto resistant plants also up-regulated a helical domain (HD)superfamily hydrolase from Rickettsia (spot 2760). HD proteins

show a common divalent cation-dependant phosphohydrolaseactivity and their substrates are a wide variety of Ras-relatedmolecules that contain phosphoesterbonds (Jewess et al., 2002).

3.5.2. Cytoskeletal proteins

Another major class of proteins whose expression varied amongtreatment groups in this study was associated with the cytoskele-ton of insect cells (Table 1). b-Tubulin expressed in somatic andvisceral muscle (spots 1145 and 261) was differentially regulatedbetween the two aphid clones (Fig. 3), and between semivirulentaphids reared on resistant and susceptible host plants (Fig. 4).Several myofilaments were also differentially regulated amongtwo or more treatment groups, including the muscle structuralprotein paramyosin (797,1703), and tropomyosin (spot 2548) andactin (spot 1703), which make up the thin filaments of thesarcomere (Figs. 2–4). In general, these structural proteins weremore abundant in the semivirulent clone than in the avirulentclone (Figs. 2 and 3), and three out of four differentially regulatedcytoskeletal proteins were up-regulated in the semivirulent clonein response to exposure to resistant plants (Fig. 4).

3.5.3. Stress response

Another well-known protein family related to various stressresponses, namely the heat shock proteins (Hsps), was found tovary between the semivirulent and avirulent aphid clones (Figs. 2and 3). Here members of the Hsp60 and Hsp70 families were foundto be up-regulated in the semivirulent WU12 aphid clone (spots1790, 1088 and 1214; Figs. 1 and 2), whereas a Hsp90 was more

F. Francis et al. / Journal of Insect Physiology 56 (2010) 575–585582

abundant in avirulent aphids than in semivirulent aphids whenthey were exposed to resistant plants.

3.5.4. Amino acids

Several enzymes related to amino acid metabolism were alsoobserved to be differentially regulated in this study. Transferringsemivirulent aphids to resistant plants up-regulated expression ofan aphid arginine kinase (spot 2014), a carbamoyl phosphatesynthetase from B. aphidicola (spot 131), and a UDP-N-acetylmur-amoylalanyl-D-glutamate-2,6-diaminopimelate ligase (spot 1521)from a secondary symbiont. Carbamoyl phosphate synthetasecatalyzes the production of carbamoyl phosphate to be utilized inthe synthesis of arginine and pyrimidine nucleotides (Holden et al.,1999). UDP-N-acetylmuramoylalanyl-D-glutamate-2,6-diamino-pimelate ligase is involved in cell wall recycling, participating inthe biosynthetic pathway for synthesis of murein, a component ofbacterial cell walls (Uchara and Park, 2003).

4. Discussion

4.1. Identification of differentially regulated proteins

From the 82 proteins that were differentially regulated amongour four treatment groups, 45 were identified. Because a completegenome sequence is not available for M. euphorbiae or any otherhomopteran insect, this caused some difficulties in identifying theaphid proteins. As a result, most of the peptides that could beidentified were related to insects from other orders, and moreparticularly to Drosophila species. Nevertheless, the availability ofaphid sequences in databases has increased dramatically due tothe A. pisum aphid genome project and numerous studies on Myzus

persicae, and this increased the success of protein identification.Indeed, much higher numbers of protein matches were obtainedfor this study than in several previous proteomic studies we did onaphids (Francis et al., 2006).

4.2. Differences in protein profiles between aphids on resistant and

susceptible plants

This study identified 16 proteins that differed in abundancebetween semivirulent aphids on resistant versus susceptibleplants (Fig. 2). Expressions of these proteins in the avirulentaphid clone were not significantly affected by the type of hostplant; thus, they did not appear to be part of a generalized stressresponse common to both aphid clones. Potentially, some of theseproteins could contribute to adaptation of the semivirulent cloneto resistant plants. Three aphid cytoskeletal proteins were up-regulated in aphids exposed to resistant plants (Fig. 2). A previousstudy that examined the proteomic response of the green peachaphid to water-stressed plants also found that tropomyosin levelswere elevated in aphids reared on stressed plants (Nguyen et al.,2007). In addition, exposure to a carbamate insecticide increasedlevels of several structural proteins in the brown planthopper,including tropomyosin, b-tubulin, and actin (Sharma et al., 2004).Colinet et al. (2007) proposed that the rearrangement ofcytoskeletal components contributed to cold acclimation in theaphid parasitoid Aphidius colemani; thus, modifications of theinsect cytoskeleton may represent a generalized adaptation to avariety of stresses, including exposure to host plant defenses.Transferring the semivirulent clone from susceptible to resistantplants also up-regulated an ATP synthase (spot 832) and three outof five differentially regulated proteins associated with carbohy-drate metabolism (Fig. 2). In other proteomic studies of insects,ATP synthases were up-regulated in response to fluctuatingthermal regimes, bacterial challenge, and insecticide exposure(Sharma et al., 2004; Scharlaken et al., 2007). Colinet et al. (2007)

also observed an increase in several enzymes of the citric acid cycleand glycolysis during cold acclimation in the parasitoid wasp A.

colemani. These modifications could potentially help meet insects’increased energy demands under stress.

4.3. Differences in protein profiles between avirulent and

semivirulent aphids

The protein profiles of avirulent WU11 and semivirulent WU12aphid clones were compared on resistant plants to contrast theresponses of these two clones to resistance. In addition, theseclones were also compared on susceptible tomato plants lackingthe Mi-1.2 resistance gene in order to assess differences in theprotein profiles of these two clones that may arise from theirdifferent genetic backgrounds. Whereas we identified only 9proteins that differed between the two aphid clones on susceptiblehosts (Fig. 3), we found 25 proteins that differed between the twoclones on resistant plants (Fig. 4); furthermore, of these 25proteins, only 2 overlapped with the set of proteins that differedbetween the two clones on susceptible plants. Thus, we observed adifferential response of these two aphid clones to resistance, andwere able to identify 23 proteins that appeared to differ betweenthe two aphid clones only when they were exposed to resistanthosts. These 23 spots include a variety of structural proteins thatwere more abundant in the semivirulent aphid clone, such as LIMmuscle protein (spot 1335) and glycine-rich proteins (GRPs) (spots1169 and 755). GRPs contribute in insects to larval, pupal and adultcuticles together with other cuticle proteins, and their expressionis under hormonal control (Zhong et al., 2006). The enhanced levelsof these proteins in the semivirulent aphid compared to theavirulent aphid on resistant plants may reflect the semivirulentclone’s greater ability to grow and reproduce on these plants.Compared to the avirulent clone, semivirulent aphids also hadhigher levels of several proteins associated with carbohydratemetabolism, including aconitase (spots 827 and 509) and other keyenzymes associated with the citric acid cycle. The citric acidpathway has a dual role in cell metabolism, acting as a source ofboth energy and biosynthetic starting materials. Previous studieshave demonstrated that the loss of aconitase activity has a majorimpact on cellular functions and insect survival; for example,oxidative inactivation of aconitase was associated with decreasedlifespan in Drosophila (Das et al., 2001). Lower aconitase levels inthe avirulent aphid therefore may be symptomatic of their reducedperformance on resistant hosts. Another enzyme related to thecitric acid cycle that was more abundant in the semivirulent aphidclone than in the avirulent clone was aldehyde dehydrogenase(spot 1334). This enzyme is involved in the production of severalaldehyde derivatives from citric acid cycle and glycolysis, and isrequired for conversion of the highly toxic intermediate acetalde-hyde to acetate. In Drosophila, it was also shown to contribute todetoxification of ethanol (Fry and Saweikis, 2006). Thus, it plays arole in xenobiotic detoxification as well as primary metabolism,and could contribute to the semivirulent aphids’ enhanced abilityto tolerate resistant plants. Other common proteins involved inxenobiotic degradation and differential stress responses that weredifferentially expressed between the semivirulent and avirulentaphid clones on resistant plants included an E4 esterase and themore ubiquitous heat shock (Hsp) 70 and 90 proteins. Organismsexposed to several stress factors such as cold, heat, CO2, heavymetal, and various chemicals were found to synthesize a set ofHsps, which usually act as molecular chaperones, and play diverseroles in transporting, folding, and assembling of degraded ormisfolded proteins (Johnston et al., 1998). The roles of heat shockproteins in evolution and ecology of many organisms includinginsects were reviewed by Sorensen and colleagues (Sørensen et al.,2003). They play an important role in stabilizing the cytoskeleton

F. Francis et al. / Journal of Insect Physiology 56 (2010) 575–585 583

and preventing excessive levels of apoptosis in response toenvironmental stress. Interestingly, on resistant plants, oneHsp90 (spot 652) and an E4 esterase (spot 638) were moreabundant in the avirulent aphid clone than in the semivirulentclone. This may reflect higher stress levels in the avirulent aphidsdue to their greater sensitivity to defences in the host plant.

The two proteins whose expression differed between semi-virulent and avirulent aphids on both hosts were paramyosin (spot797) and transketolase (spot 779) (Figs. 3 and 4; Table 1). Thesepresumably reflect constitutive differences between the two aphidclones. The transketolase, which was more abundant in thesemivirulent than in the avirulent clone, occupies a pivotal place inmetabolic regulation, providing a link between the glycolytic andpentose phosphate pathways by controlling the supply of riboseunits for nucleotide biosynthesis (Turner, 2000). Changes in theoxidative pentose phosphate pathway in aphids would providereducing NADPH required for fatty acid synthesis and theassimilation of inorganic nitrogen, and would decrease the redoxpotential necessary to protect against oxidative stresses (Krugerand von Schaewen, 2003). Transketolase was also found to bedifferentially regulated in green peach aphids reared on differenthost plants, which supports the hypothesis that this protein mayplay a role in insect–plant interactions (Francis et al., 2006).

In addition, we identified a set of seven proteins thatsignificantly differed in abundance between semivirulent andavirulent aphids only when these clones were fed on susceptibleplants (Fig. 4). These may reflect differences that are only manifestwhen both aphid clones are on a suitable host. Alternatively, theymay be due to slight differences in the performance of these twoaphid clones on the susceptible tomato cultivar, because thesemivirulent clone has somewhat delayed feeding, slightly lowerfecundity and longer development time on this host than theavirulent clone (Defibaugh-Chavez, 2008; Goggin, unpublished)(Table 3).

4.4. Contribution of endosymbionts to the proteomic differences

among treatment groups

Nearly 25% of the proteins that were differentially expressedbetween two or more treatment groups were found to be proteinsequences derived from known bacterial symbionts. Some of theseproteins differed in abundance between semivirulent and aviru-lent aphids (Figs. 3 and 4). On susceptible plants for example, thesemivirulent clone was enriched in a methylated-DNA–protein-cysteine S-methyltransferase (MGMT) (spot 2518) that appears tobe derived from a Rickettsia-like symbiont. This ubiquitous proteinrepairs O6-alkylguanine and thereby renders cells much lesssusceptible to several cytotoxic effects (Kyoung et al., 2000).Expression of other proteins from primary and secondaryendosymbionts in the semivirulent aphid clone was also influ-enced by the genotype of the host plant (Fig. 2). This contrasts withprior genomic studies that indicated that the B. aphidicola

transcriptome is relatively unchanging in response to environ-mental changes such as heat stress or altered amino acid

Table 3List of some reference identified proteins not differing in abundance between treatme

Spot number MW pI Score Coverage Peptide number

1 16,265 10.20 58 46 7

2 25,245 6.16 71 41 9

3 37,159 5.40 56 11 5

4 49,500 4.74 64 20 10

5 57,989 5.06 74 24 17

6 55,245 8.76 123 26 19

MW, molecular weight; pI, isoelectric point; Score, Mowse score according to Mascot

number of peptide hits for each protein.

availability (Moran and Degnan, 2006). However, it is notsurprising in light of the symbionts’ importance in aphid biology,and their abundance within aphids. More than two million cells ofthe primary endosymbiont B. aphidicola are estimated to be housedwithin the bacteriocytes and embryos of a single pea aphid(Wilkinson and Douglas, 1998), a host similar in size to M.

euphorbiae. The finding that symbiont expression patterns varywith aphid host plants is also consistent with our previousproteomic study of the green peach aphid, M. persicae, in which wefound that a protein identified from B. aphidicola was up-regulatedwhen aphids were transferred from broad bean to rape (Francis etal., 2006).

This study also illustrates the close metabolic relationshipbetween aphids and their endosymbionts. For example, in thecomparison of semivirulent versus avirulent aphids on resistanthost plants (Fig. 3), the semivirulent aphid had higher levels ofaphid aconitase, a bacterial ATP-binding-cassette (ABC) transport-er, and ATP-synthases from both the symbiont and the aphid host.Aconitase was recently identified to be associated with theregulation of ABC transporters in bacteria (Nakano and Fukaya,2007). ABC transporters are responsible for transport of anenormous range of molecules from ions to large polypeptides(Cuthbertson et al., 2007), and are all powered by a conservedATPase using the same basic mechanism of action for thehydrolysis of ATP and its coupling to the transport process(Holland and Holland, 2005). A previous genomic study of B.

aphidicola in the greenbug Schizaphis graminum demonstrated thatthis bacterium has an ATP synthase and consequently couldsynthesize ATP from a proton motive force generated within theintracellular vesicles of host cells containing the endosymbionts(Clark and Baumann, 1993). Thus, the data suggests a linkagebetween energy generation and carbohydrate metabolism in theaphid with transport in the symbiont. Interestingly, in this samecomparison (semivirulent versus avirulent aphids on resistantplants), enzymes of the pentose phosphate pathway were found tobe differentially regulated in both the aphid and the primarysymbiont. However, whereas aphid-derived transketolase wasmore abundant in the semivirulent aphid, symbiont-derivedphosphoglucose isomerase was less abundant. The balance ofmetabolic activity between aphid and symbiont may potentiallyvary depending upon the degree to which the aphid is adapted toits host plant, and the resulting health of the aphid.

Lastly, this study established that a Rickettsia-like symbiontoccurs in the semivirulent clone of the potato aphid, and thatexpression of certain proteins from this symbiont are up-regulatedin response to exposure to resistant plants. Numerous arthropodsharbor Rickettsia, including certain clones of the pea aphid, A. pisum

(Perlman et al., 2006; Chen et al., 1996). The occurrence of thelatter bacteria in the WU12 clone of the potato aphid wasconfirmed by PCR using primers that target a portion of the 16SrRNA gene from pea aphid Rickettsia (PAR). Our primers did notgenerate a PCR product from aphid clone WU11. This may reflect alow abundance of the secondary symbiont in this clone, or asequence difference between symbionts of clones WU11 and

nt groups.

Protein identification Accession Organism

Multiprotein bridging factor gij66512104 Apis millifera

Peroxiredoxin gij60300018 Gryllotalpa orientalis

Cathepsin L-like proteinase gij45822207 Diabrotica virgifera

26 S Proteasome non-ATPase gij110764926 Apis millifera

Chaperonin gij15616648 Buchnera aphidicola

Protein disulfide isomerase gij157118649 Aedes aegypti

search; Coverage, percentage of the protein sequence identified; Peptide number,

F. Francis et al. / Journal of Insect Physiology 56 (2010) 575–585584

WU12. Rickettsia infection has been reported to decrease pea aphidfecundity (Chen et al., 1996; Sakurai et al., 2005), and high levels ofthis symbiont in the potato aphid clone WU12 could potentially berelated to previous observations that this clone had somewhatlower reproductive rates on susceptible tomato plants whencompared to the avirulent WU11 clone (Defibaugh-Chavez, 2008).However, the costs and benefits of Rickettsia infection may vary ondifferent hosts. In both the pea aphid and the whitefly B. tabaci, thecomplement of secondary symbiont species varies amongdifferent insect host races or biotypes, and there is data tosuggest that the community composition of symbionts mayinfluence insect adaptation to different host plants (Ferrari et al.,2007; Chandler et al., 2008; Chiel et al., 2007). Thus, secondarysymbionts could potentially contribute to adaptation of thesemivirulent clone to resistant hosts. It has also been noted that aRickettsia secondary symbiont proliferates in whiteflies (B. tabaci)when they are attacked by a parasitic wasp (Mahadav et al., 2008);thus, it is possible that other stresses such as exposure to resistantplants might also promote proliferation of secondary symbionts.The density of secondary symbionts is significant because it hasbeen shown to be positively correlated with pesticide resistancein whiteflies, and could potentially also influence the insects’ability to detoxify plant allelochemicals (Ghanim and Kontseda-lov, 2009). Further work is needed to quantify secondarysymbionts in potato aphids exposed to resistant plants, and todetermine if these symbionts influence aphid performance onthese plants.

5. Conclusions

Aphids’ associations with bacteria have been studied for manyyears (Buchner, 1965) but the identification of diverse aphidbacterial symbionts was realised only recently using molecularbiology techniques. Our study indicates that in addition to thewell-known primary symbiont B. aphidicola, a secondary Rickett-

sia-like symbiont is present in certain clones of the potato aphid M.

euphorbiae, and may contribute to interclonal variation in thisaphid’s responses host plant resistance. This proteomic study alsoillustrates the cross links in the metabolism of aphids and theirbacterial symbionts, and the responsiveness of endosymbionts tothe environment of their aphid hosts. For example, the fact thatproteins such as ATP synthases appeared to be co-regulated inaphids and their symbionts illustrates the close linkage betweenprimary metabolism in symbionts and their hosts. Furthermore,more than 30% of the proteome modifications observed insemivirulent aphids during their adaptation to a resistant plantoriginated from endosymbiotic bacteria. Thus, endosymbiontsrepresent an important but often-overlooked trophic level in theplant–aphid interaction that may influence insect adaptation tohost plant defenses.

Acknowledgements

The authors would like to thank Dr. Martha Hunter and Dr. KerryOliver for providing a positive control for detection of Rickettsia,Stephanie Defibaugh-Chavez for assistance with tissue collection,and two anonymous reviewers for their helpful suggestions on themanuscript. The authors also acknowledge the Fond National pour laRecherche Scienitifique (FNRS) and the National Research Initiativeof the USDA Cooperative State Research, Education and ExtensionService (CSREES) for their funding (FRFC project number 2.4561.06;CSREES grant 2004-03072).

References

Buchner, P., 1965. Endosymbiosis of Animals with Plant Microorganisms. Inter-science, New York, pp. 297–332.

Castagnone-Sereno, P., Wajnberg, E., Bongiovanni, M., Leroy, F., Dalmasso, A., 1994.Genetic variation in Meloidogyne incognita virulence against the tomato Miresistance gene: evidence from isofemale line selection studies. Theoretical andApplied Genetics 88, 749–753.

Chandler, S.M., Wilkinson, T.L., Douglas, A.E., 2008. Impact of plant nutrients on therelationship between a herbivorous insect and its symbiotic bacteria. Proceed-ings of the Royal Society B: Biological Sciences 275, 565–570.

Chen, D.Q., Campbell, B.C., Purcell, A.H., 1996. A new Rickettsia from a herbivorousinsect, the pea aphid Acyrthosiphon pisum (Harris). Current Microbiology 33,123–128.

Chiel, E., Gottlieb, Y., Zchori-Fein, E., Mozes-Daube, N., Katzir, N., Inbar, M., Ghanim,M., 2007. Biotype-dependent secondary symbiont communities in sympatricpopulations of Bemisia tabaci. Bulletin of Entomological Research 97, 407–413.

Clark, M.A., Baumann, P., 1993. Aspects of energy-yielding metabolism in the aphid,Schizaphis graminum, and its endosymbiont: detection of gene fragmentspotentially coding for the ATP synthase beta-subunit and glyceraldehyde-3-phosphate dehydrogenase. Current Microbiology 26, 233–237.

Colinet, H., Nguyen, T.T.A., Cloutier, C., Michaud, D., Hance, T., 2007. Proteomicprofiling of a parasitic wasp exposed to constant and fluctuating cold exposure.Insect Biochemistry and Molecular Biology 37, 1177–1188.

Cuthbertson, L., Kimber, M.S., Whitfield, C., 2007. Substrate binding by a bacterialABC transporter involved in polysaccharide export. Proceedings of the NaturalAcademy of Sciences 104, 19529–19534.

Das, N., Levine, R.L., Orr, W.C., Sohal, R.S., 2001. Selectivity of protein oxidativedamage during aging in Drosophila melanogaster. Biochemical Journal 360, 209–216.

Defibaugh-Chavez, S.L.H., 2008. Dissertation: Plant Defenses against Piercing-Suck-ing Insects and the Effect of Mi-mediated Resistance on Macrosiphum euphor-biae. University of Arkansas, Fayetteville.

Douglas, A.E., 2006. Phloem-sap feeding by animals: problems and solutions.Journal of Experimental Botany 57, 747–754.

Farkas, R., Knopp, J., 1997. Ecdysone-modulated response of Drosophila cytosolicmalate dehydrogenase to juvenile hormone. Archives of Insect Biochemistryand Physiology 35, 71–83.

Ferrari, J., Scarborough, C.L., Godfray, H.C.J., 2007. Genetic variation in the effect of afacultative symbiont on host-plant use by pea aphids. Oecologia 153, 323–329.

Flor, H.H., 1955. Host-parasite interaction in flax rust: its genetics and otherimplications. Phytopathology 45, 680–685.

Francis, F., Gerkens, P., Harmel, N., De Pauw, E., Haubruge, E., 2006. Proteomevariations of the Myzus persicae aphid according to host plant change. InsectBiochemistry and Molecular Physiology 36, 219–227.

Fry, J.D., Saweikis, M., 2006. Aldehyde dehydrogenase is essential for both adult andlarval ethanol resistance in Drosophila melanogaster. Genetics Research 87, 87–92.

Ghanim, M., Kontsedalov, S., 2009. Susceptibility to insecticides in the Q biotype ofBemisia tabaci is correlated with bacterial symbiont densities. Pest ManagementScience 65, 939–942.

Goggin, F.L., Williamson, V.M., Ullman, D.E., 2001. Variability in the response ofMacrosiphum euphorbiae and Myzus persicae (Hemiptera: Aphididae) to thetomato resistance gene Mi. Environmental Entomology 30, 101–106.

Goggin, F.L., Jia, L.L., Shah, G., Hebert, S., Williamson, V.M., Ullman, D.E., 2006.Heterologous expression of the Mi-1.2 gene from tomato confers resistanceagainst nematodes but not aphids in eggplant. Molecular Plant-Microbe Inter-actions 19, 383–388.

Goggin, F.L., 2007. Plant-aphid interactions: molecular and ecological perspectives.Current Opinion in Plant Biology 10, 399–408.

Gleason, C.A., Liu, Q.L., Williamson, V.M., 2008. Silencing a candidate nematodeeffector gene corresponding to the tomato resistance gene Mi-1 leads toacquisition of virulence. Molecular Plant-Microbe Interactions 21, 576–585.

Grant, M.R., Godiard, L., Straube, E., Ashfield, T., Lewald, J., Sattler, A., Innes, R.W.,Dangl, J.L., 1995. Structure of the Arabidopsis RPM1 gene enabling dual specific-ity disease resistance. Science 269, 843–846.

Hebert, S.L., Jia, L., Goggin, F.L., 2007. Quantitative differences in aphid virulence andfoliar symptom development on tomato plants carrying the Mi resistance gene.Environmental Entomology 36, 458–467.

Holden, H.M., Thoden, J.B., Raushel, F.M., 1999. Carbamoyl phosphate synthetase:an amazing biochemical odyssey from substrate to product. Cellular andMolecular Life Sciences 56, 507–522.

Holland, K.A., Holland, I.B., 2005. Adventures with ABC-proteins: highly conservedATP-dependent transporters. Acta Microbiologica et Immunologica Hungarica52, 309–322.

Jewess, P.J., Chamberlain, K., Boogaard, A.B., Devonshire, A.L., Khambay, B.P., 2002.Insecticidal 2-hydroxy-3-alkyl-1,4-naphthoquinones: correlation of inhibitionof ubiquinol cytochrome c oxidoreductase (complex III) with insecticidalactivity. Pest Management Science 58, 243–247.

Johnston, J.A., Ward, C.L., Kopito, R.R., 1998. Aggresomes: a cellular response tomisfolded proteins. Journal of Cell Biology 143, 1883–1898.

Kaloshian, I., Kinsey, M.G., Williamson, V.W., Ullman, D.E., 2000. Mi-mediatedresistance against the potato aphid Macrosiphum euphorbiae (Hemiptera: Aphi-didae) limits sieve element ingestion. Environmental Entomology 29, 690–695.

Kruger, N.J., von Schaewen, A., 2003. The oxidative pentose phosphate pathway:structure and organisation. Current Opinion in Plant Biology 6, 236–246.

Kyoung, L., Park, T.J., Woon, K.P., 2000. Phosphorylation of methylated-DNA–protein-cysteine S-methyltransferase at serine-204 significantly increases itsresistance to proteolytic digestion. Biochemical Journal 352, 801–808.

F. Francis et al. / Journal of Insect Physiology 56 (2010) 575–585 585

Mahadav, A., Gerling, D., Gottlieb, Y., Czosnek, H., Ghanim, M., 2008. Parasitizationby the wasp Eretmocerus mundus induces transcription of genes related toimmune response and symbiotic bacteria proliferation in the whitefly Bemisiatabaci. BMC Genomics 9, 342.

Milligan, S.B., Bordeau, J., Yaghoobi, J., Kaloshian, I., Zabel, P., Williamson, V.M.,1998. The root knot nematode resistance gene Mi from tomato is a member ofthe leucine zipper, nucleotide binding, leucine-rich repeat family of plant genes.Plant Cell 10, 1307–1320.

Minarik, P., Tomaskova, N., Kollarova, M., Antalık, M., 2002. Malate dehydrogenases:structure and function. General Physiology and Biophysics 21, 257–265.

Montllor, C.B., Maxmen, A., Purcell, A.H., 2002. Facultative bacterial endosymbiontsbenefit pea aphids Acythosiphon pisum under heat stress. Ecological Entomology27, 603–610.

Moran, N.A., Degnan, P.H., 2006. Functional genomics of Buchnera and the ecologyof aphid hosts. Molecular Ecology 15, 1251–1261.

Nakano, S., Fukaya, M., 2007. Analysis of proteins responsive to acetic acid inAcetobacter: molecular mechanisms conferring acetic acid resistance in aceticacid bacteria. International Journal of Food Microbiology 125, 54–59.

Nguyen, T.T.A., Michaud, D., Cloutier, C., 2007. Proteomic profiling of aphid Macro-siphum euphorbiae responses to host-plant-mediated stress induced by defoli-ation and water deficit. Journal of Insect Physiology 53, 601–611.

Oliver, K.M., Russell, J.A., Moran, N.A., Hunter, M.S., 2005. Facultative bacterialsymbionts in aphids confer resistance to parasitic wasps. Proceedings of theNational Academy of Sciences 100, 1803–1807.

Parker, I.M., Gilbert, G.S., 2004. The evolutionary ecology of novel plant–pathogeninteractions. Annual Review of Ecology, Evolution, and Systematics 35, 675–700.

Perlman, S.J., Hunter, M.S., Zchori-Fein, E., 2006. The emerging diversity of Rickett-sia. Proceedings of the Royal Society B: Biological Sciences 273, 2097–2106.

Riggs, R.D., Winstead, N.N., 1959. Studies on resistance in tomato to root-knotnematodes and on the occurrence of pathogenic biotypes. Phytopathology 49,716–724.

Rossi, M., Goggin, F.L., Milligan, S.B., Kaloshian, I., Ullman, D.E., Williamson, V.M.,1998. The nematode resistance gene Mi of tomato confers resistance against thepotato aphid. Proceedings of the National Academy of Sciences 95, 9750–9754.

Sakurai, M., Koga, R., Tsuchida, T., Meng, X., Fukatsu, T., 2005. Rickettsia symbiont inthe pea aphid Acyrthosiphon pisum: novel cellular tropism, effect on host fitness,

and interaction with the essential symbiont Buchnera. Applied and Environ-mental Microbiology 7, 4069–4075.

Scarborough, C.L., Ferrari, J., Godfray, H.C.J., 2005. Aphid protected from pathogen byendosymbiont. Science 310, 1781.

Scharlaken, B., de Graaf, D.C., Memmi, S., Devreese, B., Van Beeumen, J., Jacobs, F.J.,2007. Differential protein expression in the honeybee head afterbacterial challenge. Archives of Insect Biochemistry and Physiology 65,223–237.

Schnorr, J.D., Holdcraft, R., Chevalier, B., Berg, C.A., 2001. Ras1 interacts withmultiple new signaling and cytoskeletal loci in Drosophila eggshell patterningand morphogenesis. Genetics 159, 609–622.

Semblat, J.P., Rosso, M.N., Hussey, R.S., Abad, P., Castagnone-Sereno, P., 2001.Molecular cloning of a cDNA encoding an amphidsecreted putative avirulenceprotein from the root-knot nematode Meloidogyne incognita. Molecular Plant-Microbe Interactions 14, 72–79.

Sharma, R., Komatsu, S., Noda, H., 2004. Proteomic analysis of brown planthopper:application to the study of carbamate toxicity. Insect Biochemistry and Molec-ular Biology 34, 425–432.

Sørensen, J.G., Kristensen, T.N., Loeschcke, V., 2003. The evolutionary and ecologicalrole of heat shock proteins. Ecology Letters 6, 1025–1037.

Turner, J.T., 2000. Applications of transketolases in organic synthesis. CurrentOpinion in Biotechnology 11, 527–531.

Uchara, T., Park, J.T., 2003. Identification of MpaA, an amidase in Escherichia coli thathydrolyzes the gamma-D-glutamyl-meso-diaminopimelate bond in mureinpeptides. The Journal of Bacteriology 185, 679–682.

Weitzman, P.D., 1987. Patterns of diversity of citric acid cycle enzymes. BiochemicalSociety Symposia 54, 33–43.

Wilkinson, T.L., Douglas, A.E., 1998. Host cell allometry and regulation of thesymbiosis between pea aphids, Acyrthosiphon pisum, and bacteria, Buchnera.Journal of Insect Physiology 44, 629–635.

Wintermeyer, W., Rodnina, M.V., 2000. Translational elongation factor G: a GTP-driven motor of the ribosome. Essays in Biochemistry 35, 117–129.

Zhong, Y.S., Mita, K., Shimada, T., Kawasaki, H., 2006. Glycine-rich protein genes,which encode a major component of the cuticle, have different developmentalprofiles from other cuticle protein genes in Bombyx mori. Insect Biochemistryand Molecular Biology 36, 99–110.