Embed Size (px)
Citation preview
EXPRESSION AND ACTION OF SELECTIVE FIBROBLAST GROWTH FACTORS DURING PRE-ATTACHMENT BOVINE CONCEPTUS DEVELOPMENT
By
FLAVIA NESTI TAYAR COOKE
A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE
UNIVERSITY OF FLORIDA
2008
1
© 2008 Flavia Nesti Tayar Cooke
2
To my husband Reinaldo, for his love and support.
3
ACKNOWLEDGMENTS
First and foremost I thank my advisor Dr. Alan Ealy, for giving me the opportunity of
working in his lab. I feel forever grateful for everything he taught me; his guidance, dedication,
and support; and in particular, his never-ending patience. I will carry for the rest of my life the
experiences I acquired while working with him, which also contributed to my personal growth.
I would like to thank Dr. Peter Hansen and Dr. Karen Moore for serving on my committee.
I am greatly thankful their assistance throughout these years. I thank everyone in Dr. Hansen’s
lab for all the help with IVF whenever I needed it. I also would like to thank Mr. William
Rembert. Without him there would be no means of conducting my research.
I cannot forget to acknowledge Dr. John Arthington and Dr. William Thatcher, who gave
me internship opportunities back in 2005 and 2006 at the Department of Animal Sciences. These
amazing experiences instigated my passion for research.
I thank Idania Alvarez for her precious guidance, which also helped me in becoming a
better scientist. I also thank my lab members, Kathleen Pennington and Qien Yang, as well as
former lab members (Teresa Rodina, Claudia Klein, Krista DeRespino, Michelle Eroh and
Jessica Van Syoc) for their help and friendship.
I feel very privileged to have worked at the Department of Animal Sciences for the past
few years. One way or another, their help made the transition to graduate school much more
enjoyable.
Finally, I want to thank my husband Reinaldo. I do not have words to express my
appreciation for everything he has done for me. The least I can do is to thank him for being part
of my life. I also thank all my family and friends in Brazil, especially my parents Roberto and
Sonia, and my sister Luiza. I know they wish to be present in this important step in my life, but
they are in my heart, and I thank them all for their support, encouragement and love.
4
TABLE OF CONTENTS
Page
ACKNOWLEDGMENTS ...............................................................................................................4
LIST OF TABLES ...........................................................................................................................7
LIST OF FIGURES .........................................................................................................................8
ABSTRACT .....................................................................................................................................9
CHAPTER
1 INTRODUCTION ..................................................................................................................11
2 LITERATURE REVIEW .......................................................................................................13
Early Conceptus Development in Ruminants .........................................................................13 Germ Layer Differentiation .............................................................................................14 Conceptus Elongation ......................................................................................................15 Implantation and Placenta Development .........................................................................16
Maternal Recognition of Pregnancy in Ruminants .................................................................19 Discovery of IFNT ..........................................................................................................19 Biological Roles of IFNT ................................................................................................20 Interferon-tau Gene Expression .......................................................................................24
Uterine Factors Affecting Conceptus Development in Mammals ..........................................25 Fibroblast Growth Factors ......................................................................................................31
Discovery and Identification of FGFs .............................................................................31 Fibroblast Growth Factor Receptors ...............................................................................32
Roles of FGFs During Early Conceptus Development ...........................................................35 Fibroblast Growth Factor 2 .............................................................................................35 Fibroblast Growth Factor 1 .............................................................................................37 Fibroblast Growth Factors 7 and 10 ................................................................................38 Fibroblast Growth Factor 4 .............................................................................................40
Synopsis ..................................................................................................................................41
3 SEVERAL FIBROBLAST GROWTH FACTORS ARE EXPRESSED DURING PRE-ATTACHMENT BOVINE CONCEPTUS DEVELOPMENT AND REGULATE IFNT EXPRESSION FROM TROPHECTODERM ........................................................................43
Introduction .............................................................................................................................43 Results .....................................................................................................................................45
Expression of FGFR Subtype in Bovine Conceptuses ....................................................45 Expression and Abundance of FGF1, 2, 7 and 10 in Bovine Conceptuses .....................46 Biological Activity of FGF1, 2 and 10 on Bovine Trophectoderm and In Vitro Produced Blastocysts ......................................................................................................47
Discussion ...............................................................................................................................55
5
Materials and Methods ...........................................................................................................60 Animal Use and Tissue Collection ..................................................................................60 Bovine in Vitro Embryo Production ................................................................................61 End-Point RT-PCR ..........................................................................................................63 Quantitative (q), Real-Time RT-PCR ..............................................................................64 Statistical Analyses ..........................................................................................................65
4 CONCLUSION .......................................................................................................................67
APPENDIX
A QUANTITATIVE REAL TIME RT-PCR PROTOCOL .......................................................72
B RELATIVE STANDARD CURVE METHOD FOR ANALYZING qRT-PCR DATA .......76
LIST OF REFERENCES ...............................................................................................................84
BIOGRAPHICAL SKETCH .......................................................................................................113
6
LIST OF TABLES
Table Page 2-1 Specificity of the FGFs ligands for specific FGFRs isoforms ...........................................34
3-1 Relative concentrations of FGF and IFNT mRNA in bovine conceptus at different stages of development ........................................................................................................53
3-2 End-point RT-PCR primer sets used for discovery of FGFR subtypes and FGFs expressed during early bovine conceptus development .....................................................69
3-3 Primer sets used for SybrGreen qRT-PCR ........................................................................70
3-4 Primer/probe sets used for TaqMan qRT-PCR ..................................................................71
7
LIST OF FIGURES
Figure Page 3-1 Expression of FGFR subtypes in d 17 bovine conceptuses and CT-1 cells ......................49
3-2 Expression of FGFR subtypes in bovine in vitro produced blastocysts. ...........................50
3-3 Expression of FGF1, 2, 7 and 10 mRNA in d 17 bovine conceptuses ..............................51
3-4 Expression profiles of FGF1, FGF2 and FGF10 during bovine conceptus development .......................................................................................................................52
3-5 Effect of FGF1, FGF2, or FGF10 supplementation on IFNT mRNA concentrations and blastomere numbers in cultured bovine blastocysts ....................................................54
4-1 Proposed model of expression and action of selective FGF during pre-attachment bovine conceptus development. .........................................................................................68
8
Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Master of Science
EXPRESSION AND ACTION OF SELECTIVE FIBROBLAST GROWTH FACTORS DURING PRE-ATTACHMENT BOVINE CONCEPTUS DEVELOPMENT
By
Flavia Nesti Tayar Cooke
December 2008 Chair: Alan D. Ealy Major: Animal Molecular and Cellular Biology
The trophectoderm-derived factor interferon tau (IFNT) maintains the uterus in a
pregnancy-receptive state during the early stages of pregnancy in cattle and sheep. Fibroblast
growth factors (FGFs) are implicated in regulating IFNT expression and potentially other critical
events associated with early conceptus development in cattle. Our overall objectives were to
identify FGFs and FGF receptors (FGFRs) expressed in elongating, pre-attachment bovine
conceptuses and determine if these FGFs regulate conceptus development and mediate IFNT
production. In vitro-derived bovine blastocysts and in vivo-derived elongated conceptuses
collected at d 17 of pregnancy express at least four FGFR subtypes (FGFR1c, FGFR2b,
FGFR3c, and FGFR4). In addition, transcripts for FGF1, FGF2 and FGF10, but not FGF7 are
present in elongated bovine conceptuses. The expression pattern of FGF10 most closely
resembled that of IFNT, with both transcripts remaining low in d 8 and d 11 conceptuses and
increasing substantially in d 14 and d 17 conceptuses. Supplementation with recombinant FGF1,
FGF2 or FGF10 increased IFNT mRNA levels in bovine blastocysts. Blastocyst cell numbers
were not affected by exposure of blastocysts to any of the FGFs. In summary, at least four
FGFRs preside in pre- and peri-attachment bovine conceptuses. Moreover, conceptuses express
9
10
at least three candidate FGFs during elongation, the time of peak IFNT expression. These
findings provide new insight for how conceptus-derived factors such as FGF1, FGF2 and FGF10
may control IFNT production during early pregnancy in cattle.
CHAPTER 1 INTRODUCTION
Several crucial developmental events must occur during the early phases of conceptus
growth and proliferation in order for the pregnancy to survive to term. Embryonic cells begin to
divide right after fertilization and the continuous proliferation and differentiation of these cells
generates the embryonic and extraembryonic tissues that form the fetus and placenta. During the
initial phases of development, the conceptus announces its presence to the maternal reproductive
system and initiates physiological modifications that maintain a pregnancy-receptive uterus [1].
In cattle and sheep, sustaining a uterine-receptive state, which is a progesterone-dominated
environment, occurs because of placental production of a Type I interferon, termed interferon-tau
(IFNT). Ideal development of the initial placental tissue lineage (trophectoderm cells) and
sufficient production of IFNT are, therefore, essential for pregnancy success in cattle and
presumably other ruminants. Approximately 57% of all failed pregnancies in cattle occur due to
early conceptus mortality, which typically happens between d 3 to 21 of gestation [1]. Problems
associated with reproduction in beef and dairy cattle result in extended calving intervals,
decreased lifetime milk production, and increased number of artificial inseminations required to
produce one live calf [2]. These issues typically result in significant economical loss, especially
for dairy producers, which can lose an average of $550 in lifetime milk potential with each
reproductive cycle that fails to produce a calf [3].
Researchers are beginning to uncover uterine- and/or conceptus-derived factors expressed
during early conceptus development that may be associated with pre-attachment conceptus
development and IFNT production in cattle and other ruminants. The focus of this thesis is to
discuss how conceptus development normally occurs in cattle, explain some of the basic
concepts of maternal recognition of pregnancy in cattle, describe how uterine-derived factors
11
may impact pre- and peri-attachment conceptus development, and evaluate a group of factors,
termed fibroblast growth factors (FGFs), that appear to be playing active roles in conceptus
development by regulating IFNT expression during early pregnancy in bovids.
12
CHAPTER 2 LITERATURE REVIEW
Early Conceptus Development in Ruminants
Conceptus development begins right after fertilization, when embryonic cells start to
divide. Fertilization is the process in which male and female pronuclei fuse to result in the
creation of a new diploid organism [4]. Once syngamy occurs, the zygote undergoes mitosis and
these cleavage divisions generate embryonic cells termed blastomeres. This newly formed
structure is generally classified as a conceptus because it contains the cells that eventually will
form both the embryonic and extraembryonic components of a fetal/placental unit. The first few
cell divisions occur within the oviduct and during the 8 to 16-cell stage of development, or
approximately 96 hour post fertilization, the bovine conceptus enters the uterine body. As the
conceptus undergoes further mitotic divisions cells can no longer be visualized and the resulting
mass of cells is classified as morula.
The first differentiation step in conceptus development forms a structure that contains
both embryonic and extraembryonic cells. This structure, referred to as a blastocyst, contains
flattened outer trophoblast cells and pluripotent inner cell mass cells. Fluid accumulation in the
center of the conceptus forms a cavity named the blastocoele [5, 6]. Tight-junction formation is a
prerequisite for blastocoele formation and expansion of the blastocyst. The timing of blastocoele
formation varies among individual conceptuses and depends on the amount of fluid entering the
cavity and the rate of tight junction formation among blastomeres [5, 7, 8]. The formation of the
blastocoele usually occurs between d 7 and 9 post-fertilization in cattle. The blastocyst is now
composed of two distinct cell populations: 1) inner cell mass (ICM) and 2) trophectoderm. The
latter will give rise to the outer layer of the placenta, whereas the ICM, also termed embryonic
13
disc or epiblast [5], will provide the cells that eventually develop into the three germ layers of the
conceptus and extraembryonic membranes [9].
Germ Layer Differentiation
During the first mitotic divisions, from 2 to 8-cell stages, blastomeres are considered
totipotent, which is a term used to describe cells containing the potential to develop into all the
cell and tissue types needed to form an individual [10]. As conceptus development advances,
this characteristic remains in some blastomeres, but not others. The ICM and trophectoderm are
sources of embryonic stem cells and trophoblastic stem cells, respectively; however, some
differences exist between these two cell populations. The ICM contains factors detected in
embryonic stem cells (OCT4, SOX2 and NANOG [11-13]) that appear to be crucial for
totipotency. In contrast, the trophectoderm does not produce these factors [14]. Rather
trophectoderm cells produce their own set of factors thought to be involved with trophectoderm
formation and maintenance (examples include CDX2, DLX3 and EOMES [15-17]).
Following the first mitotic divisions, subsequent conceptus development depends on
shedding of the zona pellucida, which occurs at approximately d 9 to 10 of development. The
pressure promoted by the growing and fluid-filled blastocyst induces a small tear in the zona
pellucida, which allows the blastocyst to escape from the zona pellucida in a process termed
hatching [18, 19]. Once hatched, the ICM becomes more prominent (now termed epiblast) and is
overlaid by a thin layer of trophectoderm cells, referred to as Rauber’s layer [18]. As conceptus
development progresses, the trophoblastic cells forming the Rauber’s layer degenerate [18, 20].
Through this process, the epiblast becomes exposed to the external environment and the
embryonic disc is established.
During the following several days of development, the growing bovine and ovine
conceptus remains free floating in the uterine lumen, while embryonic and extraembryonic
14
development continues [5]. Several placental tissues form during the second week of pregnancy.
Extraembryonic endoderm emerges from the ICM between d 8 and 10 and underlies the
trophectoderm. These cells will eventually designate the inner-most layer of the yolk sac. On d
12 to 14 post-fertilization, the outer cells of the ICM begin to polarize and will form the
embryonic ectoderm [5]. Between d 14 and 16, an extraembryonic mesoderm migrates from the
ICM between the trophectoderm and endoderm and separates the yolk and amniotic sacs. It
eventually will form the inner border of the chorion and outer-most layer of the umbilical cord
[21].
Gastrulation is a process involving complex cellular migrations that occur to form the
primitive streak. In cattle, the initial formation of precursor cells for the primitive streak begins
on d 14 of development, when the invagination of cells from the internal surface of the epiblast
takes place. Brachyury, a marker for mesoderm formation, is expressed in bovine conceptuses at
this developmental period [22]. Between days 14 and 21 of development, a series of additional
developmental events occurs within the epiblast. These events include the completion of
gastrulation, neurulation and eventual formation of somites [20, 22]. A second extraembryonic
mesoderm, termed the allantois, also emerges around this period of development [5, 20, 23].
Lastly, the encroachment of mesoderm and inversion of the trophectoderm causes the aminiotic
cavity to form. Finally, between d 20 and 22 of development, a heartbeat is detectable by
ultrasonography [24].
Conceptus Elongation
After hatching from the zona pellucida between d 8 and 10 post-fertilization, the
conceptus undergoes a dramatic physical transformation and progresses from a spherical to a
tubular shape over the course of just a few days. This process happens concurrently with the rise
of embryonic cell layers, usually between d 14 and 16 of pregnancy in cattle [5, 21]. Around d
15
12-13 of development, bovine conceptuses usually are spherical in shape, measuring about 0.5
mm in diameter, and between d 14 and 16 the conceptuses become more tubular and
filamentous, though a wide range of shapes and lengths have been described [5, 20, 25]. At
approximately d 17 to 18 of development, the conceptus may inhabit two-thirds of the uterine
horn ipsilateral to the ovary containing the corpus luteum, sometimes reaching more than 160
mm [26]. As trophectoderm cell proliferation continues, by d 18 to 21 the conceptus reaches a
significant length. Typically, the conceptus occupies the entire length of the uterine horn, as well
as part of the contralateral horn, and most viable pregnancies usually will be comprised of
embryonic disks that are at least 2.86 cm in length and trophectoderm that span 30 cm in length
[20].
Implantation and Placenta Development
The extensive trophectoderm growth and remodeling that occurs during the second and
third weeks of pregnancy are thought to be a prequel for two upcoming events: 1) the
communication between conceptus and the maternal system that is commonly referred to as
maternal recognition of pregnancy, and 2) apposition, adhesion and implantation processes that
eventually form the placenta. Maternal recognition of pregnancy will be described later in this
review, whereas a discussion on implantation will follow. Implantation is the term used to
describe the transitional stage of pregnancy, when the conceptus attaches to the endometrium and
begins to exchange substances with the uterus [27, 28]. The timing of implantation varies among
species. In mice and humans implantation begins at d 4 and 9 post-fertilization, respectively, but
in sheep and cattle, apposition and adhesion events that initiate the implantation process are not
initiated until around d 15 and 19, respectively [29].
Apposition of the conceptus involves the trophectoderm becoming closely associated
with the endometrial luminal epithelium followed by unstable adhesion [30]. The apposition of
16
the blastocyst is ensured by interdigitation of cytoplasmic projections of the trophectoderm cells
and uterine epithelial microvilli [31, 32]. In sheep, apposition occurs first in the surrounding area
of the inner cell mass, and spreads toward the extremity of the elongated conceptus [30]. On d 16
of development, the trophoblast begins to adhere firmly to the endometrial luminal epithelium.
Uterine flushing to recover the conceptus causes superficial structural damage at this time [30].
Adhesion of the trophectoderm to the endometrial luminal epithelium progresses along the
uterine horn and appears to be completed around d 22 in the sheep [32]. In ruminants, the uterine
glands are also sites of apposition [32, 33]. Between the caruncles, the trophoblast develops
finger-like papillae, which penetrate into the mouths of the superficial ducts of the uterine glands
between d 15 and 18 in sheep [32, 34]. Similar features were described in the cow conceptus
from d 15 of pregnancy, but, curiously, the goat conceptus lacked trophoblast papillae [30].
Some mechanisms for apposition and adhesion have been described in a number of
mammalian uteri. Progesterone receptors (PR) are expressed in the endometrial epithelia and
stroma during the early to midluteal phase, but its expression decreases immediately before
implantation [35, 36]. Therefore, regulation of endometrial epithelial function during the peri-
implantation period may be dependent on loss of epithelial cell PR and/or be directed by specific
factors produced by PR-positive stromal cells [35, 36]. The loss of the PR by the endometrial
epithelium can be directly correlated with reduced expression of certain genes, such as the anti-
adhesive protein MUC1. Furthermore, PR loss in the endometrial glandular epithelium appears to
be required for the onset of expression of other genes during pregnancy, such as galectin-15,
osteopontin and ovine uterine serpins (or uterine milk proteins) [30].
The degree of separation between fetal and maternal blood supplies differs among
mammals. In general, placentae can be classified into one of two major groups: superficial or
17
invasive [37]. In rodents and primates a hemochorial placentation occurs. During this type of
invasive implantation, trophoblast cells build a highly conductive stream bed for maternal blood,
which allows for adequate maternal blood flow at low placental blood pressure forms [38]. In
ruminants, a superficial implantation occurs, but unlike the superficial placenta formed in other
mammals such as the pig, ruminants posses a limited amount of placental invasion that forms a
cotyledonary, synepitheliochorial placentation [39]. Synepitheliochorial placentation involves
the fusion of placental cotyledons with endometrial caruncles to form structures known as
placentomes, which serve a primary role in fetal–maternal gas exchange and derivation of
nutrients by the placenta [21, 33, 37, 39]. Placentome formation begins approximately at d 21 in
cattle and attachment is normally completed by d 40 of pregnancy [40]. Placentomes grow
throughout gestation, and the increase in their surface area promotes nutrient, gas and waste
exchange between the mother and the fetus, and functions as a barrier by preventing the
migration of non-placental cells across the two individuals [41]. Cattle have anywhere from 70 to
120 placentomes that are spread across the uterine surface [39]. These placentomes are found in
both uterine horns, but are larger in the horn that contains the fetus. Towards the end of gestation
in cattle, placentomes can reach 10-12 cm of length and 1-3 cm of thickness [21, 39].
An interesting feature of bovine and ovine placentae is the presence of binucleate cells
(BNC), which represent trophectodermal cells that migrate from the trophoblast to the maternal
epithelium and promote endometrial invasion in ruminants [39, 42-44]. The BNC have at least
two main functions: 1) to form a hybrid feto-maternal syncytium essential for successful
implantation and subsequent placentomal growth, and 2) to synthesize and secrete protein and
steroid hormones, such as placental lactogen and progesterone, that regulate maternal physiology
[30, 35, 39, 45]. These cells are derived from mononucleate trophectoderm cells and experience
18
a process termed acytokinesis, in which nuclear division occurs without cytoplasmic division.
Once they become binucleate, the cells migrate to the maternal epithelium and fuse with
maternal epithelial cells to form trinucleate hybrid cells. The lyses of these giant placental-
uterine cells generate the syncytium during early pregnancy [39, 43, 44]. In cows, these cells are
first detected around d 16 to 17 of pregnancy, and represent about 20% of all the trophectoderm
cells by d 25 of pregnancy. A few days before parturition there is a significant decrease in BNC
number [39, 46, 47]. The presence of BNC throughout gestation likely assists with uterine-
placental communication and promotes nutrient and gas exchange [39]. The secretory capacity of
BNC is attributed to their large secretory organelles, which compose about 50% of their volume
[39, 42].
Maternal Recognition of Pregnancy in Ruminants
In most mammals, critical biochemical events must take place during early pregnancy in
order for the newly formed conceptus to develop beyond the length of a normal estrous or
menstrual cycle. In many mammals, a conceptus-derived signal prompts continued corpus
luteum (CL) function and its production of progesterone sustains a pregnant-receptive state in the
uterus for either a portion or the entire pregnancy depending on whether placental sources of
progesterone eventually take over as the primary progesterone source. If the conceptus fails to
initiate this procedure, the mother returns to estrus and the pregnancy is lost. In cattle, sheep and
presumably other ruminants, the key factor involved with this process is a protein termed
interferon-tau (IFNT).
Discovery of IFNT
The first descriptions of maternal recognition of pregnancy in ruminants were studied in
sheep and cattle by Drs. Moor and Rowson. Through conceptus transfer and removal
experiments, they determined that the presence of a viable embryo on d 12 in ewes and on d 16
19
in cows was required for maintenance of the CL [48-53]. In related work, they used conceptus-
derived products to artificially lengthen the lifespan of the CL [48]. In 1979, Martal et al. [53]
determined that injections of homogenates or protein extracts from d 14 to 16 ovine conceptuses
effectively extended the life of the CL beyond the time of a normal estrous cycle, whereas
homogenates from d 21 to 23 ovine embryos did not have this effect [53]. This conceptus-
derived substance was termed trophoblastin. In subsequent work at the University of Florida, a
series of low molecular weight proteins (19 to 26 kDa) produced by ovine and bovine
conceptuses was identified during this time when conceptuses are able to produce a substance to
sustain CL function [54-57]. A purified preparation of these proteins, termed ovine trophoblast
protein-1 (oTP-1), prolonged luteal actions after injection into the uterine lumen of non-pregnant
ewes [57]. Soon thereafter, putative oTP-1 cDNA was identified from an ovine conceptus cDNA
expression library by screening with antiserum directed against oTP-1. Sequencing determined
that the cDNA was structurally similar to Type I IFNs, a family of proteins that include the alpha
(α), beta (β), omega (ω), and delta (δ) IFNs [58]. Consequently, oTP-1 and bTP-1 (the bovine
counterpart) have since been referred to as IFNT to reflect their designation as a trophectoderm-
derived IFN.
Biological Roles of IFNT
The estrous cycle in ruminants is a uterine-dependent system that promotes spontaneous
ovulation. The basic events of CL regression are well described [59, 60]. In brief, during late
diestrus (between d 13 and 15 post-estrus in the sheep and d 17 and 20 post-estrus in the cow),
oxytocin-dependent pulses of prostaglandin F2α (PGF2α) are released from the endometrium and
reach the ovaries to induce the functional and structural regression of the CL [61]. The CL
produces and stores oxytocin, which is then released in response to PGF2α stimulation and causes
subsequent pulses of uterine PGF2α release. The luminal and superficial glandular epithelium are
20
primary sources of PGF2α during luteolysis, and oxytocin acts on these target tissues by binding
to its plasma membrane-associated receptor, which is expressed late in diestrus during the
initiation of the regression of CL [62, 63].
The primary function of IFNT during early pregnancy is to extend the lifespan of CL by
preventing oxytocin-mediated release of endometrial PGF2α during late diestrus [64-66]. In a
pregnant animal, oxytocin receptors are not expressed on the luminal and glandular epithelial
endometrium at the time of normal luteolysis [62, 63], and the amount and frequency of PGF2α
pulses is decreased and usually totally abolished. In the sheep, IFNT controls oxytocin receptor
expression indirectly by limiting the expression of estrogen receptors [60]. A similar event
occurs in cattle, although the antiluteolytic mechanism seems to be more complex. In pregnant
cows, IFNT induces down-regulation of the oxytocin receptor before any changes in estrogen
receptor abundance is noted [67-69]. Therefore, it appears that IFNT is able to affect estrogen
receptor activity prior to its down-regulation in the bovine endometrium [70, 71].
The extension of luteal activity and the duration of estrous cycle can be manipulated in
non-pregnant sheep and cattle by providing exogenous IFNT into the uterine lumen, and thus
creating a pseudopregnancy to assess how IFNT acts to prevent CL regression [57, 72-75]. This
approach was also used to describe differences in antiluteolytic activity of specific IFNT
isoforms [73, 76].
The suppression of oxytocin-induced PGF2α release may not be the only way IFNT
prevents luteolysis. It also appears to modify prostaglandin metabolism in the endometrium early
in gestation, and this may represent a second way by which IFNT extends luteal activity in
ruminants. The synthesis of endometrial-derived prostaglandins is mediated by several enzymes.
Phospholipase A2 (PLA2) cleaves membrane-bound phospholipids to generate arachidonic acid
21
[77]. This acid is then converted to prostaglandin-H2 (PGH2) by cyclooxygenase-1 and -2, which
are also known as prostaglandin endoperoxide H synthases 1 and 2 (PGHS1 and PGHS2). PGH2
is then converted to several other PGs by specific enzymes, including PGE and PGF synthases
(PTGES and PTGFS, respectively), which generate PGE2 and PGF2α respectively. Recombinant
bovine IFNT is able to stimulate the secretion of PGE2, thus enhancing the PGE2/PGF2α ratio
[78]. A biphasic prostaglandin response to IFNT treatment has been described by several
authors. Lower levels of IFNT similar to levels found during early conceptus development at the
time of maternal recognition of pregnancy suppress PGHS2 expression in primary bovine
endometrial cells or a bovine endometrial cell line (BEND cells) [79-81]. Conversely, exposure
to high concentrations of IFNT in these cell types, similar to the levels found in the uterus after
pregnancy recognition, stimulates PGHS2 expression [79, 81]. In conclusion, IFNT appears to
shift prostaglandin synthesis away from PGF2α and towards PGE2, consequently allowing the
putative luteotrophic activity of this prostaglandin to support CL maintenance [82-85].
Type I IFNs also contain immunosuppressive, antiviral and antiproliferative activities,
and it is possible that these actions play a role during pregnancy maintenance in cattle, sheep and
other ruminants. IFNT inhibits the proliferation of cultured lymphocytes [86, 87], and reduces
the production of mitogen-stimulated or certain mixed subpopulation of lymphocytes [86, 88-
91]. IFNT also increases granulocyte chemotactic protein-2 synthesis in the endometrium, which
in turn stimulates natural killer cells [92, 93]. Moreover, IFNT controls the expression of major
histocompatibility complex (MHC) class I molecules in the luminal epithelium during
placentation [94]. These activities may be critical for the newly formed conceptus to not be
mistaken as a foreign structure, while in the maternal environment.
22
It also is evident that IFNT mediates the expression of several uterine-derived factors that
may play facilitative roles during early pregnancy. One factor of key interest is ubiquitin cross
reactive protein (UCRP), also known as IFN-stimulated gene-15 or -17 (ISG15 or ISG17) [95-
97]. Bovine UCRP conjugates to endometrial cytosolic proteins, and it has been proposed that
the regulation and/or degradation of endometrial proteins by UCRP support the establishment and
maintenance of pregnancy in ruminants [98]. IFNT also induces the expression of granulocyte
chemotactic protein-2, also known as chemokine ligand 6 (CXCL6), which plays an important
role in chemotaxis and immune responses to stimulants [93]. There are many others IFNT-
induced uterine proteins, including MX proteins [99-101], 2’5’-oligoadenylate synthetase [102],
β2-microglobulin [103], signal-transducer and activator of transcript (STAT) -1 and -2, interferon
regulatory factors (IRF) -1 and -9 [104], and a member of the 1-8 family known as Leu13 [105].
MX proteins are recognized for their part in the antiviral response, but whether they have a
critical activity during early pregnancy it is not known [100, 101, 106]. 2’5’-oligoadenylate
synthetase activates ribonuclease L (RNAse L), which is a constitutively expressed latent
endonuclease. RNAse L cleaves viral and cellular RNA and reduces viral replication and
initiation of apoptosis in some cell types [102, 107, 108]. However, like MX proteins, its role
during maternal recognition of pregnancy remains unclear. Βeta-2-microglobulin recognizes
foreign antigens and targets them for elimination from the endometrium [94]. The simultaneous
induction of STAT-1 and STAT-2 and IRF-1and IRF-9 gene expression by IFNT may regulate
endometrial estrogen receptor and, perhaps, oxytocin receptor expression during pregnancy
recognition in ewes [104]. Leu13, which is known for its involvement in adhesion, wound
healing and inflammatory responses, is localized primarily in the glandular epithelium and
therefore is proposed to be important during placental adhesion [105, 109-111].
23
Interferon-tau Gene Expression
Type I IFN are expressed by a variety of cell types, however the expression of the IFNT
gene is unique in at least a few aspects. Firstly, IFNT expression is not induced by viral stimuli.
The majority of Type I and Type II (IFNγ) IFNs are stimulated during a virus or pathogen
challenge, whereas IFNT mRNA expression is not detected under such circumstances [112, 113].
In addition, transcripts for IFNT are localized exclusively in the trophectoderm [56], and IFNT
expression is sustained for several days prior to implantation [114-116]. Also, constitutive
expression of IFNT is limited to a short period of time that coincides with the timing of maternal
recognition of pregnancy. IFNT protein levels can be assessed in conditioned medium as early as
the late morula or early blastocyst stage (d 6 and 7 of development) [117, 118]. The abundance
of IFNT mRNA peaks at d 13 and 14 post-fertilization in cattle conceptuses, whereas the
synthesis of IFNT protein continues to increase between d 13 and 19 of development [54, 73,
115, 119, 120]. The extensive protein production that occurs during this period is due mainly to
the significant elongation of the trophectoderm occurring at this time [54, 55, 121, 122]. High
levels of IFNT mRNA can be detected until approximately d 19 to 21 post-fertilization in cattle,
and only low levels exist by d 25 [73, 115, 119]. It has been proposed that the contact between
the trophectoderm and the epithelial endometrium sets the end of IFNT expression [116]. It is
known that trophectoderm cells in direct contact with endometrium cease to produce IFNT, but
the mechanism behind this phenomenon remains speculative [123].
The necessity for IFNs as pregnancy recognition factors likely is limited to cattle, sheep
and presumably other ruminants. However, several IFNs are expressed by placental tissues in
other mammals. Antiviral activity associated with IFN production is present in the mouse
placenta [124]. In the human and mouse, IFNα is expressed by the placenta throughout
pregnancy, and it is thought that this IFN regulates uterine gene expression and immune
24
responses to pathogens [125-128]. In the pig, IFNδ and Type II IFN, or IFNγ, is produced by the
trophectoderm during the peri-implantation period [129-131]. Neither IFN has been found to
sustain CL function beyond the length of a normal estrous cycle when provided into the uterine
lumen of non-pregnant gilts [132]. Therefore, it appears that a facilitative IFN system present in
several mammals was converted into a required component of pregnancy recognition in an
ancestor to present day ruminants shortly after they diverged from other Artiodactyls. It is
proposed that the unique IFNT expression pattern likely was acquired as the ancestral IFNT gene
was created in percoran ruminant ancestors by duplication of the IFNω gene, in which the
promoter region of the new IFNT gene was substituted by sequences that allowed placental-
specific gene expression [114, 133, 134]. Transcripts for IFNT have been identified in the
Bovidae, Cervidae and Giraffidae families by Southern Blot analysis, but comparable genes
could not be found in other mammalian species [133, 135].
To summarize, it is clear that IFNT is critical for the establishment and maintenance of
pregnancy in sheep, cattle and likely other ruminants due to its ability to extend the lifespan of
CL when the maternal environment is responsive to IFNT. In this scenario, oxytocin-mediated
release of endometrial PGF2α during late diestrus is prevented and the conceptus has a chance to
survive and the pregnancy be sustained to term.
Uterine Factors Affecting Conceptus Development in Mammals
The maternal uterus provides a variety of nutrients, enzymes, growth factors, cytokines,
lymphokines, hormones, transport proteins, and other substances crucial for conceptus growth
[136]. Although early-stage conceptuses can develop in simple culture media in vitro in the
absence of exogenous growth factors during the first few days of development, there is
increasing evidence that essential autocrine and paracrine factors are required for sustaining
blastomere cell survival and differentiation [137, 138]. Moreover, histotrophic secretions from
25
the endometrial epithelia are required for peri-implantation blastocyst survival and elongation in
sheep. This hypothesis is supported by results from studies of the uterine gland knockout
(UGKO) ewe [139, 140]. The UGKO ewe model is produced by continuous administration of a
synthetic progestin to neonatal ewes from birth to postnatal d 56 [141]. This treatment ablates
differentiation and development of the glandular epithelia without altering development of the
stromal endometrium, myometrium, and other reproductive tract structures. It also does not
appear to have any adverse effects on the hypothalamic–pituitary–ovarian axis [139, 141].
UGKO ewes experience early pregnancy loss in which the blastocyst fails to elongate. Transfer
of blastocysts from normal fertile ewes into the uteri of timed recipient UGKO ewes produced
the same outcome [139]. Morphologically normal blastocysts are present in uterine flushes of
bred UGKO ewes on d 6 and 9 after mating, but not on d 14 [139, 140]. On d 14, uterine flushes
of mated UGKO ewes contain either no conceptus or a severely growth-retarded tubular
conceptus.
Several hormones have been implicated as embryotrophic, or more precisely as
conceptus-tropic agents during pre- and peri-attachment development in cattle and sheep. One of
the best studied factors in this regard is insulin-like growth factor 1 (IGF1) [142-145]. It is
present in the uterus and placenta of several species, including rats [146], humans [146, 147],
pigs [148], sheep [149, 150] and cows [151, 152]. Many studies have associated IGF1 as an
embryotrophic factor in porcine, murine, human and bovine conceptus development [153, 154].
One apparently important action of IGF1 during initial cleavage stage development is as a cell
survival agent, where it can decrease the rate of apoptosis during in vitro culture [155, 156]. In
addition, IGF1 restricts the detrimental effects of heat shock in bovine conceptus culture [157],
and supplementation with IGF1 prior to conceptus transfer increases pregnancy rates of in vitro
26
produced bovine conceptus transferred into recipients maintained under heat stress conditions
[158, 159].
Several uterine-derived factors are critical for conceptus development in mice. Included
among factors that promote early in vitro conceptus development are transforming growth factor
beta (TGFB), platelet-derived growth factor (PDGF), insulin growth factor 2 (IGF2), and
epithelial growth factor (EGF) [160-162]. Transcripts for these putative embryotrophic factors
are detectable throughout pre-implantation development in cattle, suggesting their potential for
facilitating conceptus development in this species [161, 163, 164]. Certainly a subset of these
factors impact early cleavage development in culture. Supplementation with PDGF from the one-
cell to blastocyst stage increased bovine conceptus growth beyond the 16-cell stage, but did not
increase blastocyst rate [163, 164]. By contrast, transforming growth factor alpha (TGFA) was
able to raise the percentage of blastocyst in this study.
The endometrial-derived factor granulocyte-macrophage colony stimulating factor (GM-
CSF) also is implicated as a regulator of the growth and development of the pre-implantation
embryo. It is secreted into the oviduct and uterus during the period following conception and
promotes blastocyst development in vitro in porcine [165] and bovine conceptuses [166-168].
Also, there is some exciting new evidence from work completed at the University of Florida that
GM-CSF enhances embryo survival after transfer into recipient cows (Loureiro and Hansen,
unpublished observations). Therefore, current findings suggest the use of GM-CSF as an
embryotrophic factor during early conceptus development in vitro.
Another endometrial-derived factor associated with conceptus development in some
species is leukemia inhibitory factor (LIF) [169]. Transcripts and/or protein of maternal LIF were
found in the uterus of mice [170, 171], human [172, 173], ewes [174] and cows [175] around the
27
time of implantation and placental attachment. The benefits of LIF during later stages of
embryogenesis and placental attachment/migration are well understood in mice [169, 176]. LIF
primarily controls proliferation in the pre-implantation blastocyst [177], and enhances pre-
implantation embryo development including blastocyst, expanded blastocyst, and hatching
blastocyst stages in mice [169]. In culture, LIF improves blastocyst development and conceptus
growth in mice [178, 179]. LIF also is implicated in controlling early conceptus development in
sheep and cows. In sheep, LIF increases the percentage of in vitro blastocyst hatching and
increases pregnancy rates for in vitro cultured embryos transferred back into recipient ewes
[180]. The presence of bovine LIF in the culture medium between d 5 and 10 improved hatching
rate and increased trophectoderm cell numbers of bovine in vitro produced conceptus [181]. In
cattle, embryonic stem-like cells have been cultured both with [182] and without [183] LIF
added to the culture medium, suggesting that, like their human counterparts [184-186],
differentiation of bovine embryonic stem-like cells is not suppressed by LIF [187-189]. More
recently, the effects of LIF on in vitro produced bovine embryos and their outgrowth colonies
were studied. Addition of LIF to the culture medium was not beneficial for bovine in vitro
embryonic development based on several measures such as growth kinetics, morphology, cell
count, expression of OCT4, and expression of laminin, a matrix protein that plays an important
role in hypoblast and epiblast formation [190]. Moreover, LIF had no apparent effect on the
subsequent formation of putative embryonic stem-like cell outgrowth colonies from such
embryos when added to the culture medium [190]. Therefore, it remains unclear whether LIF
contains an activity that is essential for early bovine conceptus development.
Hormones not normally associated with reproductive processes also may be important for
early conceptus development. In rats, the calcium-sequestering hormone, calcitonin (CT),
28
represents one such factor [191]. Prior the onset of implantation, CT is up-regulated by
progesterone in rat and mice uterine epithelial cells between d 3 and 4 of pregnancy [192-194].
Moreover, limiting CT production with RNA-interference restricts blastocyst implantation in rats
[195]. In rodents, the temporal expression pattern of CT mRNA in the pregnant uterus coincides
with the appearance of immunoreactive CT in the uterine glands [192]. Calcitonin appears to
accelerate blastocyst differentiation by altering the developmental program of the embryo.
Binding of CT to its receptor activates adenylate cyclase and induces intracellular Ca2+ signaling
[196-199]. Therefore, CT may reset the developmental ‘clock’ through Ca2+ signaling and
influence events that occur much later. Ca2+ signaling rapidly alters gene expression at the
blastocyst stage [200]. The cell cycle is also influenced by Ca2+ signaling [201], and cell
numbers are increased in pre-implantation conceptuses exposed to pharmacological agents that
raise the levels of intracellular Ca2+ [202, 203]. To summarize, it is obvious that the mouse
conceptus expresses CT and it may play a role during conceptus development. However, the
exact function of CT in promoting embryo-uterine interactions is not clearly understood.
Uterine Factors and IFNT Production
The maternal system plays an active role in modulating IFNT production during early
gestation, and several uterine-derived factors have been implicated in controlling trophectoderm
proliferation and IFNT secretion in cattle and sheep. In vitro produced bovine blastocysts contain
IFNT mRNA and protein at d 7 of development [117, 204], indicating that IFNT expression can
be initiated during in vitro development. However, up-regulation in IFNT expression around the
time of conceptus elongation cannot be replicated in culture either because uterine-derived
factors that control this event are absent from these cultures or because conceptus gene
29
expression is globally affected by the lack of uterine-derived factors controlling normal
conceptus development.
Several uterine factors have been implicated as regulators of IFNT production in ewes
and cows. Treatment with a combination of IGF1 and IGF2 in cultured ovine conceptuses
increase IFNT production than their control counterparts and conceptuses treated with IGF1 or
IGF2 separately [205]. It remains unclear whether the combinatorial actions of IGF1 and IGF2
are directly affecting IFNT expression or if they are acting indirectly by encouraging
trophectoderm proliferation and survival in culture. Also, the beneficial effects of IGF1 at least
are restricted to the ICM since IGF receptors are found exclusively in the ICM in cattle [206].
Supplementation with GM-CSF induces bovine conceptus development [166-168]; however it is
unclear whether GM-CSF and/or IL3 have the ability to stimulate both IFNT mRNA and protein
synthesis in ruminants. GM-CSF increases the secretion of IFNT in ovine conceptuses [207] but
not in bovine conceptuses [208]. This difference could be related to the concentration of GM-
CSF tested in those studies.
Interestingly, the expression of GM-CSF may be regulated by IFNT. Current evidence
suggests that trophectoderm-derived IFNT regulates uterine expression of GM-CSF in the bovine
immune and reproductive systems [209, 210]. However, one can speculate that this effect would
be indirect because it may be caused by the IFNT stimulation of PGE2 production in the
endometrium. This event in turn stimulates GM-CSF expression in uterine lymphocytes and
endometrium [211]. Nevertheless, other reports suggest that, in ruminants, the conceptus has the
ability for local modulation of the production of cytokines and growth factors such as GM-CSF
that, in turn, may sustain development and maintain pregnancy [209, 210].
30
In conclusion, a select few autocrine and paracrine factors originally studied for their
ability to promote blastomere cell survival and differentiation may also be playing a vital role
during conceptus development by mediating IFNT production. Recently, this laboratory
discovered a new uterine-derived product that controls IFNT expression [212, 213]. This factor,
termed fibroblast growth factor 2 (FGF2), is part of a larger family of fibroblast growth factors
(FGFs) that have been well studied for their roles in conceptus, fetal and placental development
in several species.
Fibroblast Growth Factors
Fibroblast growth factors (FGFs) are paracrine and autocrine peptide growth factors [214,
215]. There are at least twenty-two FGFs in mammals, and these FGFs can be sub-divided into
seven subfamilies based on phylogenetic analysis [216]. The protein products of this diverse
gene family contain a variety of biological activities in many tissues and organs, such as cell
migration, cell differentiation, cell survival, mitogenesis, and tumorigenesis [216-219]. In
addition, FGFs are homeostatic factors in adults and function in various capacities, including
tissue repair and wound healing, in tumor angiogenesis, and in the control of nervous system
development (as neurotrophic factors) [220, 221].
Discovery and Identification of FGFs
In the late 1970’s, the first members of the FGF family were purified from the bovine
pituitary [222, 223]. Fibroblast growth factor 1 (FGF1; also known as acidic FGF) and FGF2
(also known as basic FGF) were isolated and characterized for their capacity to stimulate 3T3
fibroblast proliferation [218, 224, 225]. The highly purified preparations of FGFs were submitted
for amino acid sequencing, and thus it was possible to clone cDNAs of both FGF1 and FGF2
[226-228]. Subsequently discovered FGFs were classified with a numeric designation based on
the order they were identified [229]. Biological activities for many FGFs have been determined
31
using various techniques, including utilizing homologous recombination technology in mice.
This technique provided initial evidence that selective FGFs are involved with embryonic,
extraembryonic, and fetal development in mammals [220, 221]. Moreover, these studies showed
that certain members of the FGF family have specialized biological roles that result in specific
phenotypes (i.e., Angora mutant of FGF5 –/– mice), whereas other FGFs have no apparent
phenotype following their loss of activity either because they are not required for specific
activities or they can be compensated for by other FGFs [221, 230, 231].
Fibroblast Growth Factor Receptors
Fibroblast growth factors mediate their cellular function by binding and activating a
group of tyrosine kinase receptors known as FGF receptors (FGFRs). At least five distinct genes
encode FGFRs (designated as FGFR1 to FGFR5) [214, 216, 218, 232-234]. Functional FGFRs
are transmembrane proteins composed of an extracellular ligand-binding domain and a
cytoplasmic domain containing the catalytic protein tyrosine kinase core [226, 234, 235]. Each
receptor type contains two to three immunoglobulin-like (Ig-like) extracellular domains and a
single transmembrane spanning region [218]. Intracellular tyrosine kinase activation domains are
present in four receptor types, FGFR1 to FGFR4 [218]. The most recently discovered receptor,
FGFR5, differs from other FGFRs because it contains no apparent intracellular activation
regions, and its function in the various organs where this receptor is found remains unknown
(such as pancreas, liver, kidney, brain, and lung) [232, 236].
Fibroblast growth factor receptors binding to ligands has an added complexity due to
spliced variant modifications in ligand binding domains. Several types of alternative splicing
events are observed in various FGFRs, but one of the most well studied splicing events occurs
within the Ig-like regions and generates a distinct variety of receptor subtypes for FGFR1,
FGFR2 and FGFR3 [218, 237]. FGFR4 does not undergo alternative splicing [238]. One critical
32
splicing event occurs within the third Ig-like domain (IgIII), where splicing one or two exons
from the coding transcript generates two main receptor subtypes: IgIIIb and IgIIIc, respectively
[218, 239, 240]. Non-spliced IgIII regions, such as IgIIIa, do not exist as functional receptors
because in-frame stop codons generate soluble proteins [218, 239, 240]. These alternative
splicing events specify FGF binding. Some FGFs bind to multiple receptor subtypes whereas
other FGFs prefer specific receptor subtypes [216, 218]. For example, FGF1 binds all FGFR
subtypes whereas FGF7 associates exclusively with a single receptor subtype (FGFR2b). [216,
218]. Table 2-1 summarizes the specificity of the FGFs ligands for specific FGFRs isoforms.
Heparin and heparan sulfate glucosaminoglycans (HSGAGs) function as accessory
molecules that regulate FGF-binding and activation of FGFRs [241-244]. More specifically,
HSGAG induces FGFR dimerization, an essential step for subsequent receptor activation and
stimulation of downstream intracellular signaling events [218, 226, 237, 245]. Heparin is
required for FGF to activate the FGFR in cells that are deficient or unable to synthesize
HSGAGs, or in cells pretreated with heparin/heparan sulfate (HS)-degrading enzymes or
sulfation inhibitors [242]. The addition of HS can increase the activity of specific FGFs
depending on the structure of their sulfated domains and the abundance of HS in target cells
[246].
33
Table 2-1. Specificity of the FGFs ligands for specific FGFRs isoforms
Data collected from [218, 220, 221, 226, 239, 240, 247]. ? Unknown; a Have yet to identify FGFR isoform (IIIb or IIIc).
FGF (ligand) Interaction with receptors
FGFR1 FGFR2 FGFR3 FGFR4 FGF1 IIIb and IIIc IIIb and IIIc IIIb and IIIc FGFR4 FGF2 IIIb and IIIc IIIc IIIc FGFR4 FGF3 IIIb IIIb FGF4 IIIc IIIc IIIc FGFR4 FGF5 IIIc IIIc FGFR4 FGF6 IIIc IIIc FGF7 IIIb FGFR4 FGF8 FGFR1a IIIc IIIc FGFR4 FGF9 IIIc IIIb and IIIc FGFR4 FGF10 IIIb IIIb FGF11to 14 ? FGF15 ? FGF16, 18 ? FGF17 IIIc IIIc FGFR4 FGF19, 21, 23 IIIc IIIc FGFR4 FGF20, 22, 24, 25 ?
34
Roles of FGFs during Early Conceptus Development
The actions of FGFs are not restricted to the adult animal, where FGFs are homeostatic
factors associated with tissue repair, wound healing, angiogenesis, and in controlling the nervous
system development (as neurotrophic factors) [220, 221]. Rather, several FGFs also play a vital
role during conceptus development, not only in regulating cell growth and differentiation, but
also in controlling several developmental events in the conceptus, fetus, and placenta [214, 218].
To elucidate these events, the effects and expression patterns of individuals FGFs will be
discussed in the subsequent sections.
Fibroblast Growth Factor 2
There is substantial evidence that FGF2 plays an important role in early conceptus and
placental development. Fibroblast growth factor 2 is produced by the uterus of several species.
Transcripts for FGF2 were identified in pigs, rodents, rabbit, primate and human endometrium
[248-255]. In these species, FGF2 mRNA is primarily localized in the luminal epithelial layer of
the endometrium during diestrus and early pregnancy [248, 255, 256]. Moreover, FGF2 mRNA
is localized within the luminal and glandular epithelium of cows and ewes and FGF2 protein is
detected in the uterine lumen throughout the estrous cycle and early pregnancy in ewes and cows
[212, 257]. The localization of FGF2 in the epithelial layer of the endometrium during early
gestation in rodents, rabbit, primate and human implicates that FGF2 may play a role during
trophoblast invasion and blastocyst implantation [248-254]. In cattle and sheep, the levels of
endometrial FGF2 mRNA and protein are not different between pregnant and cyclic ewes and
cows; however, the amount of FGF2 in the uterine lumen increases between d 12 and 13 post-
estrus in both pregnant and cyclic ewes [257]. The occurrence of this event coincides with the
timing of IFNT production by the trophectoderm and the maternal recognition of pregnancy in
this species [59, 60, 258].
35
Several reports propose that the uterine epithelium is not the major site of FGF2
production in cattle; rather, the bovine conceptus also expresses FGF2 [257, 259, 260].
Transcripts for FGF2 are detected at the morula and blastocyst stages [259, 260], and
unpublished observations from this laboratory indicate that FGF2 mRNA abundance increases at
the timing of conceptus elongation (between d 14 and 17 of development). In conclusion, the fact
that FGF2 is expressed by both the endometrium and the conceptus during early pregnancy
implicates that this FGF may play a critical role during conceptus development and placentation.
One of the best studied activities attributed to FGF2 during pregnancy is its role in
mediating cell proliferation and differentiation [261, 262]. Supplementation with FGF2 to
cultured rabbit blastocysts promotes gastrulation, stimulates embryonic development and the
formation of all three germ layers [263]. Fibroblast growth factor 2 plays a critical role in
placentation. Addition of FGF2 to mouse trophectoderm outgrowths enhances their proliferation
in vitro [264]. Moreover, FGF2 supplementation significantly promotes the rate of mouse
blastocyst attachment and spreading, and significantly increases the surface area of
trophectoderm outgrowths [265]. In the presence of transforming growth factor beta 1 (TGFB1),
addition of FGF2 increases the number of in vitro produced bovine embryos developing past the
8-cell and 16-cell stages when compared to controls [266]
Vascular endothelial growth factors (VEGF) and FGFs are implicated as two of the most
important promoters of angiogenesis that have been identified thus far [267-270]. Fibroblast
growth factor 1 and FGF2 are well-known for angiogenic effects in various organisms [271], and
both FGF1 and FGF2 are potent inducers of endothelial cell migration, proliferation, and tube
formation in vitro and are highly angiogenic in a number of tissues in vivo. It is thought that
FGF1 and FGF2 may participate in angiogenesis in two primary ways: by modulating
36
endothelial cell activity [272] and by regulating VEGF expression in proliferative cells [273-
275]. Moreover, both factors are well-established mitogens and chemo-attractants for endothelial
cells [276-278].
Some actions for distinct FGFs have been proposed for ruminants during conceptus
development. Maybe the most exciting one is the ability of FGF2 to control trophectoderm
development and IFNT production during peri-attachment conceptus development. A bovine
trophectoderm cell line, termed CT-1 cells [279], significantly enhances trophectoderm
proliferation, IFNT mRNA abundance and IFNT protein secretion in response to FGF2
supplementation [212]. The mutual ability of FGF2 increasing trophectoderm proliferation and
amplifying IFNT production implicates this FGF as a vital factor during the timing of maternal
recognition of pregnancy in ruminants. Furthermore, blastocysts produce more IFNT in response
to FGF2 supplementation than non-supplemented controls [212].
Fibroblast Growth Factor 1
Fibroblast growth factor 1 appears to contain biological activities that facilitate the
establishment and maintenance of pregnancy in some mammals. The uterine and conceptus
expression patterns for FGF1 are not as well defined as for FGF2. FGF1-like activity can be
isolated from porcine uterus [280]. In pigs, FGF1 mRNA is localized to the stromal cells of the
uterus, whereas FGF2 mRNA is detected in uterine luminal and glandular epithelium for
pregnant, but not cycling, gilts [255]. The expression of FGF1 and FGF2 during early gestation
suggests roles for both factors at the timing of the non-invasive embryo implantation of this
species [255], though the localization of FGF1 and FGF2 in different tissue layers implies that
different modes of action are utilized [255]. Fibroblast growth factor 1 is also produced by
bovine conceptuses, where FGF1 mRNA is detected at the morula and blastocyst stages [259,
260]. Also, at least two of the major receptor partners for FGF1 and FGF2, FGFR1c and
37
FGFR3c, and an additional receptor subtype FGFR2b, which is used by FGF1 but not FGF2, are
present in ovine conceptuses [218, 257, 281, 282].
Fibroblast Growth Factors 7 and 10
Fibroblast growth factor 7 and FGF10 are true mesenchymal factors that are important
for establishing and maintaining stromal and epithelial integrity and function in various organs.
[283, 284]. Fibroblast growth factor 10 was originally isolated from rat lung mesenchyme and
identified as a mesenchymal-derived growth factor that is essential for patterning the early
branching and morphogenic events in rodents, including embryonic lung and limb bud formation
[285-290]. Fibroblast growth factor 7 is an established paracrine growth factor of mesenchymal
origin unique to epithelial cell proliferation and differentiation [291], and also mediates the
effects of progesterone in primate endometrium [292]. Both FGF7 and FGF10 are epithelial cell
mitogens [283, 289]. The primary receptor partner for FGF7, FGFR2b, is also the high-affinity
receptor for FGF10 [283]. Both FGF10 and FGF7 have the same binding affinity to FGFR2b
[289].
Transcripts for FGF10 are localized in the uterus in sheep. Ovine endometrial stromal
cells express FGF10 mRNA, whereas its receptor FGFR2b is localized to epithelial cells in the
uterus of ewes. The particular location of expression suggests that FGF10 is a paracrine mediator
of uterine mesenchymal-epithelial interactions [281]. Transcripts for FGF10 and its receptor are
also found in neonatal ovine uterus during endometrial gland development [141], and because
FGF10 plays an active role in mediating stromal-epithelial borders in various organs it is likely it
is plays an active role in postnatal uterine gland morphogenesis. Interestingly, it appears that
stromal-derived FGF10, but not FGF7, is regulated by progesterone. Studies inhibiting the
effects of progesterone by using a progesterone-receptor inhibitor RU486 reported a decreased
FGF10 mRNA in the endometrium of sheep; however, FGF7 mRNA was relatively unaffected
38
by RU486 treatment [293]. These results provide evidence that stromal-derived FGF10 is a
genuine progestamedin in the endometrium of the ovine uterus.
In the pig, FGF7 mRNA is expressed by the endometrial epithelium during a critical
period of conceptus development, and FGF7 protein can be detected in the uterine lumen during
early pregnancy [294]. In this species, which presents an epitheliochorial-type placenta, FGF7
plays a role in epithelial-epithelial interactions between the uterus and the conceptus. Transcripts
for FGF7 and its primary receptor partner FGFR2b are both found in the endometrial epithelium
and the trophectoderm [294, 295]. The endometrial epithelium secretes FGF7 into the lumen,
which promotes a rapidly stimulation of trophectoderm proliferation in this species [294]. In
contrast, FGF7 expression is much different in other species. In the sheep, FGF7 mRNA is
localized to the tunica muscularis of blood vessels in neonatal ovine and primate endometrium
and myometrium [281, 296]. The restricted expression of FGF7 to the tunica muscularis does
not exclude a potential role as a paracrine growth factor for glandular epithelia, given that FGF7
is also expressed near deep in glandular epithelium [281].
The post-attachment placenta is a rich source for FGF7 and 10 in sheep and cattle [257,
281, 297]. FGF7 and FGF10 are both expressed by cells of mesenchymal origin [298], while
their common receptor, FGFR2b, is found exclusively in epithelial cells, which implicates
independent roles for both factors [281]. Their actions may be restricted to mediate the limited
attachment of trophoblast cells [281], and to stimulate the proliferation of epithelial cells [218]. It
is unlikely that FGF7 and FGF10 can traverse the uterine layers and achieve the lumen to be
available for the bovine conceptus during early development. Moreover, the specific receptor
FGFR2b appears to be responsible for FGF actions on bovine trophectoderm due to its ability of
increasing IFNT mRNA levels in CT-1 cells (Ealy and Pennington, unpublished observations).
39
Fibroblast Growth Factor 4
Current evidence implicates that FGF4 plays a critical role in mouse development, but it
is still unclear if FGF4 is essential for bovine conceptus development. The FGF4 gene is
expressed in the mouse conceptus at several stages: the morula, the blastocyst (where it is
localized to the inner cell mass), and the embryonic ectoderm of the post-implantation egg
cylinder [299, 300]. Currently, it is established that FGF4 derived from the inner cell mass at the
blastocyst stage and later in the corresponding epiblast binds to and activates its specific receptor
FGFR2c to act as a paracrine factor to prevent neighboring trophectoderm (mural trophoblast)
from differentiating whereas trophectoderm not in close proximity to the epiblast (polar
trophoblast) undergo terminal differentiation into other placental cell types [301-304]. Functional
loss of FGF4, or its receptor FGFR2c, is lethal early in embryogenesis [301, 305].
Trophectoderm formation is complete, but placenta fails to develop properly.
It remains uncertain if FGF4 serves an essential function during early conceptus
development in ruminant species. Supplementation of FGF4 is necessary to maintain a
proliferating population of mouse trophectoderm cells in culture [301, 306], but FGF4
supplementation is not required for bovine trophectoderm development. Cultured bovine
trophectoderm proliferate for extended periods without exposure to FGF4 or other epiblast- and
uterine-derived factors [279, 307-309]. However, IFNT production from trophectoderm
outgrowths fail to reach levels observed in normally developing bovine conceptuses, perhaps
because they lack critical epiblast- and/or uterine-derived factors that normally influence IFNT
production. They continue to proliferate without differentiating for extensive periods in culture
[279, 307-309].
40
Synopsis
Conceptus development in cattle includes a series of cell proliferation and differentiation
that ultimately result, between d 7 and 9 post-fertilization, in a blastocyst. The blastocyst is
composed of inner cell mass (embryonic cells) and trophectoderm (extraembryonic cells). As
conceptus development progresses and trophectoderm cells proliferate, the blastocyst hatches
from the zona pellucida, between d 7 and 10 post-fertilization, and becomes a filamentous
structure between d 14 and 16 of development. Throughout this period, the trophectoderm
secretes IFNT, which is the signal for pregnancy maintenance in cattle and other ruminants. In
these species, IFNT extends corpus luteum lifespan by preventing oxytocin-mediated release of
endometrial PGF2α during late diestrus, and thus sustains the production of progesterone by
luteal cells. In this scenario, a pregnant-receptive state in the uterus is maintained by the corpus
luteum, until placental sources of progesterone eventually take over as the primary progesterone
source. If the conceptus fails to initiate this event, or the maternal environment does not respond
to this signal, the mother returns to estrus and the pregnancy is lost.
Several uterine derived factors are required during conceptus development, and are
presumably essential for the production of IFNT in cattle and sheep. This hypothesis is supported
by results from studies using a uterine gland knockout (UGKO) ewe. In such animals, early
pregnancy loss is observed and the blastocyst fails to elongate. Some endometrial-derived factor
implicated as embryotrophic include IGF1 and IGF2, GM-CSF, LIF and calcitonin. Recently,
this laboratory discovered a new uterine-derived product that controls IFNT expression. This
factor, termed FGF2, is part of a larger family of FGFs that have been well studied for their roles
in conceptus, fetal and placental development in many species, including bovine. The
endometrial and conceptus localization of FGF1 and FGF2, and the distribution pattern of FGF1
and FGF2 proteins in the lumen indicate that these FGFs may play a general role in the bovine
41
placenta. These include maintenance of placental structure and function, angiogenesis, and
mitogenic activity for both fetal and maternal components. As mentioned, an exciting attribute of
FGF2 is its ability to regulate IFNT production in bovine trophectoderm [212]. Other FGFs are
also associated with conceptus development in some mammals. Stromal-derived FGF7 and
FGF10 functions may be associated specifically with the proliferation of epithelial cells [218]
and mediation of the limited invasion of trophoblast giant cells [281] in sows and ewes, given
that FGF7 and FGF10 are unlikely able to traverse the endometrial layers and reach the lumen.
In addition, FGF4 plays a critical role in mouse embryonic development [301-304], but it
remains unclear if this FGF is essential during early conceptus development in bovine.
42
CHAPTER 3 SEVERAL FIBROBLAST GROWTH FACTORS ARE EXPRESSED DURING PRE-
ATTACHMENT BOVINE CONCEPTUS DEVELOPMENT AND REGULATE INTERFERON-TAU EXPRESSION FROM TROPHECTODERM
Introduction
In cattle, sheep and presumably other ruminants, the trophectoderm-derived factor,
interferon-tau (IFNT), is responsible for sustaining a pregnant state by restricting the pulsatile
release of prostaglandin F2α from the endometrial epithelium and thereby preventing regression
of corpus luteum and return to estrus [59, 60]. Interferon-tau also controls the expression of
several uterine-derived factors that prepare the uterus for placental attachment, modifies the
uterine immune system, and regulates early conceptus development [71, 97, 100, 105, 310-312].
It is not surprising, therefore, that insufficient production of IFNT or failure of the maternal
system to recognize this signal leads to pregnancy failures in cattle [1, 313-315].
Bovine embryo production of IFNT begins at the late morula and early blastocyst stage as
the trophoblast cell lineage first develops (d 6-7 of pregnancy) [117, 316]. In cattle, IFNT
mRNA levels peak around d 14-16 of pregnancy and remain elevated until implantation occurs
around d 19-21 of pregnancy [317-319]. A few selective uterine- and conceptus-derived factors
are known regulators of IFNT expression [320, 321]. One of these is fibroblast growth factor 2
(FGF2). Transcripts for FGF2 are expressed by the luminal and glandular epithelium and
detected in the uterine lumen of cows and ewes throughout the estrous cycle and early pregnancy
[212, 257]. Studies using a bovine trophectoderm cell line (CT-1) and in vitro-produced bovine
blastocysts reveal that supplementation with FGF2 increases IFNT mRNA and protein levels
[212, 213].
Fibroblast growth factor 2, also known as basic FGF, was the first identified member of
what is now a large family of FGFs. At least twenty-two genes encode multiple FGFs in the
43
human and mouse, and their protein products contain a variety of biological activities in tissues
and organs [216-218]. These FGFs interact with a group of tyrosine kinase receptors known as
FGF receptors, or FGFRs. Four genes encode these receptors (FGFR1-FGFR4), and alternative
splicing in extracellular regions generate a variety of receptor isotypes [214, 218, 232, 236]. One
of these splicing events occurs within the third immunoglobulin (Ig)-like domains of FGFR1-
FGFR3, where splicing one or two exons from the coding transcript generates receptors subtypes
termed IgIIIb and IgIIIc respectively. These spliced variants recognize different ligands [218,
239, 240]. For example, the IgIIIb form of FGFR2 (R2b) interacts primarily with FGF1, 3, 7, 10
and 22, whereas the IgIIIc form (FGFR2c) interacts with FGF1, 2, 4, 6 and 9 [216, 218].
Several FGFs and FGFRs are associated with early conceptus development in mammals.
Fibroblast growth factor 2 increases trophectoderm outgrowth size in mice and stimulates
gastrulation in rabbit conceptuses [263, 265, 322]. In the pig, uterine-derived FGF7 acting
through its receptor, FGFR2b, stimulates trophectoderm proliferation [294]. In mice, FGF4-
induced activation of its receptor partner, FGFR2c, is critical for maintaining a trophoblast stem
cell lineage that supports normal placental development [301, 305]. FGF4 supplementation is
required to prevent mouse trophoblast cell differentiation during culture [323, 324]. However,
this type of supplementation is not needed to maintain bovine trophectoderm in culture. They
continue to proliferate without differentiating for extensive periods in culture [279, 307-309].
Bovine and ovine conceptuses produce multiple FGFs. Transcripts for FGF2 and several
FGFR spliced variants are detected in elongated ovine conceptuses [257]. Also, transcripts for
FGF1, 2, 7 and 10 and several FGFRs exist in post-attachment stage placentae in sheep and
cattle [281, 297]. These FGFs likely facilitate placental development in a variety of ways
throughout gestation. This laboratory is specifically interested in uncovering actions of these
44
FGFs as bovine conceptuses develop and begin to attach to the uterine lining early in pregnancy.
The overall objectives of this work were to identify the various FGFs and FGFRs expressed in
elongating, pre-attachment bovine conceptuses and determine if these FGFs have the ability to
regulate conceptus development and/or mediate IFNT production during pre-attachment
development.
Results
Expression of FGFR Subtype in Bovine Conceptuses
End-point RT-PCR was used to detect the FGFR isotypes expressed during early
conceptus development in cattle. FGFR1, FGFR2, FGFR3, and FGFR4 mRNA were detected in
bovine conceptuses collected at d 17 post-insemination (Fig. 3-1 and 3-2) and in vitro produced
blastocysts (Fig. 3-2). Each FGFR also was detected in CT-1 cells (Fig. 3-1), a bovine
trophectoderm cell line derived from a bovine blastocyst that produces IFNT [212, 279].
Amplified products of the correct size were detected in all samples with the exception of one d
17 conceptus sample that consistently lacked an FGFR1 amplicon (see Fig. 3-1).
Primers used to amplify each FGFR spanned the sequence encoding their third Ig-like
domains, and the specific splice variant forms of FGFR1, FGFR2 and FGFR3 expressed by
conceptuses and CT-1 cells were determined by sequencing amplified products [257]. All of the
FGFR1 cDNAs derived from blastocysts and d 17 conceptuses (n=8 clones sequenced) had the
same sequence and comparative sequence analysis indicated that this sequence encoded FGFR1c
[239, 257] (GeneID: 281768; GenBank #NP_001103677). All blastocyst- and conceptus-derived
FGFR2 cDNAs (n=10 clones sequenced) were identical and their translated product represented
FGFR2b, which also is known as keratinocyte growth factor (KGF)/FGF7 receptor [239, 257]
(GeneID: 404193; GenBank #XP_001789758). For FGFR3, translated products for all cDNAs
(n=10 clones sequenced) matched the inferred amino acid sequence of FGFR3c (GeneID:
45
281769; GenBank #AAK54132) [257]. FGFR4 amplicons of the correct anticipated size (n=4
cDNAs sequenced) were identical to FGFR4 (GeneID: 317696). The less abundant amplicons
seen in some of the FGFR4 reactions were not sequenced (see Fig. 3-1 and 3-2). DNA
sequencing also confirmed that CT-1 cells express FGFR1c, FGFR2b, FGFR3c, and FGFR4.
Expression and Abundance of FGF1, 2, 7 and 10 in Bovine Conceptuses
End-point RT-PCR also was used to determine if FGF1, 2, 7 and 10 are expressed in d 17
bovine conceptuses (Fig. 3-3). Transcripts for FGF1, 2 and 10 were detected in all three d 17
bovine conceptus RNA samples examined. Transcripts for FGF1 and FGF2, but not FGF10,
also were detected in CT-1 cell RNA. FGF7 was not amplified in d 17 conceptus and CT-1
samples, but was detected in control samples (endometrium and lung). Bovine endometrium was
included as a positive control based on previous work describing endometrial FGF1, 2, 7 and 10
expression in cyclic and pregnant cows and ewes [212, 257, 281, 297]. DNA sequencing
verified that each PCR product represented the FGFs of interest (data not shown). Smaller, less
intense PCR products were observed in some of the FGF1 reactions (see Fig. 3-3). These
products were not sequenced, and this secondary product was not detected when new primers
were designed and used for qRT-PCR (see below).
The relative abundance of FGF1, 2 and 10 mRNA populations throughout pre- and peri-
attachment conceptus development was determined with qRT-PCR. The internal RNA loading
control, 18S RNA, could not be used to normalize FGF mRNA in this study since its
concentrations varied depending on stage of conceptus development (Table 3-1). More
specifically, concentrations of 18S RNA in tcRNA increased (P<0.05) as conceptuses progressed
from blastocysts to elongated, filamentous conceptuses. Due to this outcome, the amount of
tcRNA in each reaction was used to adjust FGF values across these developmental stages (Table
3-1). FGF1 mRNA was not detected in in vitro produced blastocysts. Its relative abundance
46
remained low in conceptuses collected on d 11 and 14 of pregnancy and increased (P<0.05) in d
17 conceptuses. FGF2 mRNA was detected at all stages of conceptus development, and
concentrations were greater (P<0.05) in d 14 and 17 conceptuses than in d 8 in vitro produced
blastocysts. Day 11 conceptuses contained intermediate amounts of FGF2 mRNA. FGF10
mRNA was not detected in in vitro produced blastocysts and low levels were detected in d 11
conceptuses. The relative abundance of FGF10 mRNA was substantially greater (P<0.05) in d
14 and 17 conceptuses. As anticipated, concentrations of IFNT mRNA were low in in vitro
produced blastocysts and d 11 conceptuses and then increased (P<0.05) in d 14 conceptuses and
then again in d 17 conceptuses (P<0.05).
A separate analysis was used to describe the relative abundance of FGF1, FGF2 and
FGF10 mRNA within each stage of bovine conceptus development (Fig. 3-4). Relative
abundance of 18S RNA was used to normalize FGF values within each stage of pregnancy
examined. FGF2 was the only transcript identified in in vitro produced blastocysts. It also was
the most abundant FGF transcript in d 11 conceptuses. In d 14 conceptuses, FGF2 and FGF10
mRNA were present at similar levels. By comparison, FGF1 mRNA abundance was low
(P<0.05) in d 11 and 14 conceptuses. FGF10 was the most prevalent transcript in d 17
conceptuses, where it represented ~85% of the FGF transcripts among the three specific FGFs
examined in these conceptuses.
Biological Activity of FGF1, 2 and 10 on Bovine Trophectoderm and in vitro produced
Blastocysts
The ability of these conceptus-derived FGFs to stimulate IFNT production was examined
in in vitro produced bovine conceptuses. A study was completed to determine if FGF1, 2 and 10
supplementation influences development and IFNT expression in bovine blastocysts (Fig. 3-5).
47
Individual in vitro produced blastocysts were placed in medium drops containing 50 ng/ml of
rbFGF1 or rbFGF2, 50 or 500 ng/ml of rhFGF10, or no FGF treatment (control) and IFNT
mRNA abundance (Fig 3-5A) and blastomere numbers (Fig. 3-5B) were determined after 24 and
48 h, respectively. Incubation with medium containing 50 ng/ml rbFGF1 or -2 increased
(P<0.05) IFNT mRNA abundance compared to the control. Blastocysts required 500 ng/ml
rhFGF10 to observe this effect. Blastomere numbers, as determined by quantifying numbers of
stained nuclei in blastocysts after 48 h exposure to FGF treatment, were not affected by any of
the FGF proteins at any of the doses examined.
48
Figure 3-1. Expression of FGFR subtypes in d 17 bovine conceptuses and CT-1 cells. RT-PCR
was completed on tcRNA samples derived from three pools of d 17 bovine conceptuses (n=3-5 conceptuses/pool) and one CT-1 sample using primers specific for the third Ig-like extracellular domain of bovine FGFR1, FGFR2, FGFR3, and FGFR4 (Table 3-2). Products were electrophoresed and visualized with ethidium bromide and UV light. TcRNA derived from bovine lung was included as a positive tissue control. Primers for β-actin (ACTB) were used as a positive RT-PCR control. TcRNA not exposed to reverse transcriptase (-RT samples) was included to verify that amplified products did not result from genomic contamination. Amplified products were sequenced to verify that they represent specific FGFRs.
49
Figure 3-2. Expression of FGFR subtypes in bovine in vitro produced blastocysts. RT-PCR was completed on tcRNA samples derived from three pools of in vitro produced blastocysts (n=10-18 blastocysts/pool) using primers specific for the third Ig-like extracellular domain of bovine FGFR1, FGFR2, FGFR3, and FGFR4 (Table 3-2). Products were electrophoresed and visualized with ethidium bromide and UV light. TcRNA derived from a pooled d 17 bovine conceptus preparation was included as a positive tissue control. Primers for ACTB were used as a positive RT-PCR control. TcRNA not exposed to reverse transcriptase (-RT samples) was included to verify that amplified products did not result from genomic contamination.
50
Figure 3-3. Expression of FGF1, 2, 7 and 10 mRNA in d 17 bovine conceptuses. RT-PCR was completed on tcRNA from three pools of d 17 bovine conceptuses (n=3-5 conceptuses/pool) and one CT-1 sample with primers specific for bovine FGF1, FGF2, FGF7 and FGF10 (Table 3-2). Products were electrophoresed and visualized with ethidium bromide and UV light. TcRNA from bovine endometrium and lung were included as positive controls. Primers for ACTB were used as a positive RT-PCR control. TcRNA not exposed to reverse transcriptase (-RT samples) was included to verify that amplified products did not result from genomic contamination. Amplified products were sequenced to verify specificity of amplification
51
Figure 3-4. Expression profiles of FGF1, FGF2 and FGF10 during bovine conceptus development. TcRNA was extracted from bovine conceptuses collected on d 11, 14 and 17 post-insemination (n=5 pools/stage of development; 2-5 conceptuses/pool). TaqMan qRT-PCR was completed using primers/probes specific for boFGF1, FGF2 and FGF10 (Table 3-4). Abundance of 18S mRNA was used as an internal control to normalize FGF values within each stage of development. ∆CT values were used to analyze the data within each stage of development and data are presented as mean fold-differences ± SEM from the lowest expression value within each stage. Different superscripts represent treatment differences within each stage of development (P<0.05).
52
Table 3-1. Relative concentrations of FGF and IFNT mRNA in bovine conceptus at different stages of development
Conceptus Stage FGF1 FGF2 FGF10 IFNT 18S
Blastocyst - 0.037 ± 0.024a - 0.008 ± 0.009a 0.04 ± 0.02a d11 0.008 ± 0.004a 0.074 ± 0.024ab 0.122 ± 0.054a 0.010 ± 0.005a 0.33 ± 0.15b d14 0.003 ± 0.001a 0.158 ± 0.055b 1.02 ± 0.37ab 0.93 ± 0.36b 3.73 ± 1.32c d17 0.94 ± 0.34b 0.096 ± 0.023b 2.61 ± 0.87b 3.93 ± 1.26c 5.09 ± 1.81c Different superscripts represent differences in relative abundance of mRNA species within each column (P<0.05).
53
Figure 3-5. Effect of FGF1, FGF2, or FGF10 supplementation on IFNT mRNA concentrations and blastomere numbers in cultured bovine blastocysts. Individual in vitro produced blastocysts were placed in 30 µl drops of medium containing rbFGF1 (50 ng/ml), rbFGF2 (50 ng/ml), rhFGF10 (50 or 500 ng/ml), or vehicle only (50 µg/ml BSA) and incubated at 38.5ºC for 24 or 48 h. Panel A: After 24 h, tcRNA was extracted and qRT-PCR was performed to determine the relative abundance of IFNT mRNA (n=14-22 blastocysts/treatment spread over 4 replicate experiments). Abundance of 18S mRNA was used as an internal control to normalize IFNT mRNA values. ∆CT values were used to analyze the data and mean fold-differences ± SEM from the lowest expression value are presented. Panel B: After 48 h, number of nuclei per blastocyst was determined after Hoechst 33342 staining and epifluorescence microscopy (n=22-25 blastocysts/treatment spread over 4 replicate experiments). Different superscripts represent treatment differences within panels (P<0.05).
54
Discussion
This laboratory previously described a role for FGF2 in stimulating IFNT production in
bovine conceptuses [212, 213]. Initially, the uterine epithelium was proposed as the primary site
of FGF2 production in cattle [212], but work contained herein and other findings [257, 259, 260]
establish that bovine conceptuses also produce FGF2. Transcripts for FGF2 are detected at the
morula/blastocyst stage in this and other studies [259, 260], and transcript abundance increases
in conceptuses undergoing elongation (d 14 and 17). Also, at least two of the primary receptor
partners for FGF2, FGFR1c and FGFR3c, preside in ovine conceptuses [218, 257, 282]. An
additional receptor subtype, FGFR2b, also is produced by ovine conceptuses [257, 281].
Fibroblast growth factor 2 interacts with FGFR2b with a lower affinity than FGFR1c and
FGFR3c [218, 282], thereby suggesting that additional FGFs may impact conceptus development
by acting through FGFR2b.
Bovine conceptuses contain the same FGFRs as elongating ovine conceptuses [257]. In
addition, this work identified the expression of FGFR4 in bovine in vitro produced blastocysts
and elongated conceptuses. Amplifying the IgIII region for each FGFR permitted the
identification of specific FGFR splice variants (FGFR1c, FGFR2b, and FGFR3c). It remains
possible that additional variant forms for FGFR1, FGFR2 and FGFR3 exist in bovine
conceptuses and perhaps these subtypes could have been identified if additional cloned products
were sequenced or if receptor subtype-specific primer sets were employed. That being said,
verifying the presence of FGFR2b throughout early bovine conceptus development provided the
impetus for focusing on ligands that interact with this receptor subtype. Investigating this
receptor isoform was of particular interest because the FGFR2b and FGFR2c subtypes are
implicated in regulating trophectoderm development in other species [294, 301, 305].
55
The primary ligands for FGFR2b are FGF1, 3, 7, 10 and 22 [218, 282]. In this work,
transcripts for FGF1 and FGF10 were detected whereas FGF7 transcripts were absent in bovine
conceptuses. Tissue-specific expression of FGF3 and FGF22 is highly restrictive in other
species (e.g., cerebellum, retina and inner ear for FGF3; cerebellum and skin for FGF22) [325-
327]. Therefore, these FGFs were not examined in this work. Transcript levels of FGF1 were
low throughout bovine conceptus development whereas FGF10 mRNA concentrations were low
or nonexistence on or before d 11, but were readily apparent in d 14 and 17 conceptuses. The
relative amount of FGF10 mRNA rivaled that of FGF2 in d 14 conceptuses and represented the
predominant FGF transcript in d 17 conceptuses. Chen et al [281] identified that the
extraembryonic mesoderm is the primary site of FGF10 expression in ovine conceptuses. The
extraembryonic mesoderm emerges from the epiblast (i.e. the gastrulating inner cell mass)
around d 14 and16 of pregnancy in cattle and soon thereafter extends between the trophectoderm
and endoderm to establish the inner chorionic layer and the outer yolk sac layer [5, 20, 22, 317,
328]. Although localization studies were not completed herein to verify the sources of FGF10
expression during conceptus elongation, our assessment of FGF10 mRNA abundance is
supportive of the concept that the profound rise in FGF10 expression in d 14 and 17 conceptuses
stems from the formation and expansion of extraembryonic mesoderm.
It is interesting that the ontogeny of conceptus-derived FGF10 expression resembled that
of IFNT. Relative abundances for both transcripts were low in d 11 conceptuses and increased
profoundly at d 14 and 17 of pregnancy. Since mesoderm formation occurs around the same
time as conceptus elongation and maximal IFNT expression [317-319], it is possible that a
product of this tissue, such as FGF10, could be required for maximal IFNT expression, as well as
other aspects of early conceptus development and elongation. Timely epiblast development
56
certainly is linked to conceptus elongation and survival. Bovine embryos derived from in vitro
fertilization and nuclear transfer (NT) usually have lower survival rates than their in vivo-
generated counterparts after transfer, and fewer in vitro produced and NT embryos contain
epiblasts at d 14 of pregnancy [25, 329]. Also, fewer pregnancies resulted from transfer of d 14
bovine conceptuses containing either non-intact or undetectable epiblasts as compared with
transfer of conceptuses containing intact epiblasts [330]. Further work is needed to determine if
paracrine-acting factors produced by the epiblast, and more specifically by the newly formed
mesoderm, promote trophectoderm proliferation and gene expression.
Tissue localization studies were not completed in this work, but the trophectoderm likely
is one site of FGF1 and FGF2 production in elongating conceptuses. FGF1 and FGF2 mRNA
are detected in CT-1 cells and localized to the trophectoderm of mid-gestation bovine placentae
[297]. Likewise, each of the four FGFR subtypes identified in bovine blastocysts and elongating
conceptuses probably are expressed in trophectoderm since they were detected in CT-1 cells.
This certainly is the case for the FGFR2b subtype. Its transcripts localize to ovine and bovine
trophectoderm during peri- and post-attachment development [281, 297]. In ewes, FGFR2b also
is expressed by the uterine epithelium where it appears to play a central role in regulating uterine
activity during pregnancy by interacting with stromal-derived FGF10 [281]. It is possible, but
unlikely, that this uterine source for FGF10 is released into the uterine lumen. Most FGFs,
including FGF10, contain high affinities for heparan sulfate proteoglycans and remain
sequestered within the extracellular matrix of tissues rather than being released into the blood or
luminal cavities [218, 282]. Very little to no FGF10 is produced by luminal and glandular
epithelium. Cell lines developed from ovine endometrial epithelium contain FGF10 mRNA
[331], but in situ studies did not detect FGF10 transcripts in luminal or glandular epithelium
57
during diestrus and early pregnancy [281]. By contrast, FGF2 is produced by the endometrial
epithelium and can be found in the uterine lumen during early pregnancy [212, 257]. It remains
unknown if uterine-derived FGF1 is released into the uterine lumen. FGF1 is produced by
bovine luminal epithelium during mid-gestation [297] and, therefore, may have a similar uterine
expression pattern as FGF2 prior to placental attachment.
All of the recombinant FGF preparations were able to stimulate IFNT mRNA in in vitro
produced blastocysts. Fibroblast growth factor 1 and FGF2 proteins were similar in their ability
to stimulate IFNT mRNA, whereas as much as 10-fold more FGF10 was required in some cases
to elicit biological responses on blastocysts. It is unclear why FGF10 contained slightly lower
biological activity than other FGFs. Perhaps using a human recombinant FGF10 protein that
contains a good, but not great sequence identity to its bovine homolog caused this effect (91.6%
identical amino acid sequence identity to bovine FGF10). Alternatively, issues with
freeze/thawing the recombinant preparation, post-thawing handling, and/or protein degradation
rate during culture could have contributed to this outcome. Regardless of the reason, rhFGF10
did contain biological activity on in vitro produced blastocysts. Therefore, its bovine homolog
probably also is capable of stimulating IFNT expression by the bovine trophectoderm.
None of the FGF proteins examined affected trophectoderm and blastomere cell numbers.
Previous work consistently observed little to no mitogenic effect of boFGF2 [212, 213]. One
interpretation of these findings is that the FGFs under investigation likely are not serving an
active role in regulating cell proliferation rate early in conceptus development. However, the
ability of selective FGFs to influence early bovine embryo development (i.e. blastocyst
formation, blastocyst quality, and ratio of trophoblast/inner cell mass cells) have yet to be fully
explored.
58
It still remains unclear whether one or multiple FGFR subtypes dictate FGF responses in
bovine trophectoderm. Fibroblast growth factor 1 associates equally well with each of the FGFR
variants expressed in bovine conceptuses, and FGF2 has a high affinity for FGFR1c and FGFR3c
and a moderate affinity for FGFR2b [216, 218, 282]. Fibroblast growth factor 10 is more
selective in its receptor partner binding interactions and generally acts through either FGFR2b or
FGFR1b [218, 289]. The latter receptor subtype was not detected in conceptus and CT-1
screens. Recombinant FGF7 was included in one CT-1 study to determine if its interaction with
FGFR2b was sufficient to induce an IFNT mRNA response (Pennington and Ealy, unpublished
observations). FGF7 is not expressed in pre- and peri-attachment bovine conceptuses and
endometrial sources of FGF7 are localized too deep within the stromal region to permit FGF7
from being secreted into the uterine lumen [281]. However, FGF7 acts exclusively through
FGFR2b [218, 289], and its ability to increase IFNT mRNA levels in CT-1 cells implicates
FGFR2b as one of the receptor subtypes responsible for FGF actions on trophectoderm
(Pennington and Ealy, unpublished observations). This observation does not exclude the
possibility that other FGFRs also may participate in directing the biological activities of other
FGFs on bovine trophectoderm, but the relative importance of other FGFRs in regulating IFNT
expression and other critical actions during conceptus development remains to be fully explored.
In conclusion, current findings provide new insight for how conceptus-derived factors
may control IFNT expression during early pregnancy in cattle. Multiple FGFRs are expressed by
elongating bovine conceptuses, and at least one of these receptor subtypes, FGFR2b, is involved
with mediating FGF induced increases in IFNT mRNA and protein production in bovine
trophectoderm. Also, several FGFs are expressed by bovine conceptuses. Of particular note is
FGF10, a ligand for FGFR2b whose expression increases in d 14 and 17 conceptuses coincident
59
with peak IFNT expression. This and potentially other conceptus-derived FGFs, as well as
uterine-derived FGFs likely are acting in concert to impact IFNT production from bovine
trophectoderm. This could well be an essential component for the establishment and
maintenance of pregnancy in cattle and sheep.
Materials and Methods
Animal Use and Tissue Collection
All animal experimentation was completed in accordance with Institutional Animal Care
and Use Guidelines and with the approval of the Institutional Animal Care and Use Committee at
the University of Florida. Healthy, non-lactating Holstein cows (n=21) were housed at the
University of Florida Dairy Unit (Hague, FL) and fed a maintenance diet. Conceptuses were
harvested on d 11, 14 and 17 post-insemination after superovulation. In brief, growth of a new
wave of follicles was induced by ablating large follicles (>10 mm diameter) on ovaries with an
ultrasound-guided follicle aspiration device [332]. A controlled drug intravaginal device
containing progesterone (1.38 g; Eazi-BreedTM CIDR®; Pfizer Corp.) was inserted after follicle
ablation. Cows were provided a 4 day regiment of FSH treatment (Folltropin-V; AgTech; 400
mg total) beginning 2 days after follicle ablation, CIDRs were removed on the third day of FSH
treatment and cows were injected with LutalyseTM (25 mg each time; Pfizer Corp.) twice on the
third day of FSH treatment [333]. Superovulated cows were inseminated with Holstein semen
(Genex Cooperative Inc.) at 12 and 24 h after first detection of standing estrus.
Conceptuses at d 11 and 14 post-insemination were collected non-surgically after
providing an epidural injection of 2% (wt/vol) lidocaine (Sparhawk Laboratories, Inc.) by
inserting a latex Foley catheter (Agtech Inc., Manhattan, KS) through the cervix and flushing
each horn with 250–500ml flush solution (Dulbecco’s phosphate-buffered saline [DPBS;
Invitrogen Corp.] with 0.04% bovine serum albumin [BSA]). Conceptuses at d 17 post-
60
insemination were collected during slaughter at the University of Florida Meats Laboratory by
excising reproductive tracts, injecting flush solution into the anterior tip of one uterine horn and
collecting fluid and conceptuses from an excised anterior portion of the other uterine horn. Flush
solutions were examined macroscopically and microscopically, if needed (d 11) to collect
conceptuses. All d 11 conceptuses were ovoid in shape and most could be detected in the petri
dish with the naked eye. Approximately half of the d 14 conceptuses collected were ovoid, but
readily visible in the petri dish with the naked eye. The remaining d 14 conceptuses were in the
initial stages of elongation and ranged from 0.5 to 3 cm in length. All of the d 17 conceptuses
were elongated and filamentous, ranging from 5 to 45 cm in length. Conceptuses were pooled
together in small groups (n=3-5/pool) and snap-frozen in liquid nitrogen and stored at -80ºC.
Each pool of the d 14 samples contained a mixture of ovoid and elongating conceptuses.
Additional tissues, including endometrium, lung, and brain (hippocampus and cerebrum), were
collected from cows during slaughter, snap-frozen in liquid nitrogen and stored at -80ºC until use
as positive control samples.
Total cellular (tc) RNA was extracted from d 11 and d 14 conceptus pools using the
RNeasy Micro kit (Qiagen Inc). The RNAqueous®-Midi RNA Isolation Kit (Applied
Biosystems/Ambion) was used to extract tcRNA from d17 conceptuses. The PureLink Micro-to-
Midi Total RNA Purification System with Trizol (Invitrogen Corp.) was used to extract tcRNA
from other tissues. Concentration and quality of isolated tcRNA was assessed by using a
NanoDrop™8000 spectrophotometer (Thermo Scientific).
Bovine in Vitro Embryo Production
In vitro maturation, fertilization and culture procedures were used to generate bovine
blastocysts [334-336]. Briefly, oocytes from slaughterhouse ovaries were matured and fertilized
in vitro with Holstein semen (Genex Cooperative, Inc). After fertilization, presumptive zygotes
61
were placed in groups of 25-30 and incubated in 5% CO2/5%O2/90%N2 at 38.5ºC in 50µl drops
of either Synthetic Oviduct Fluid (SOF; Chemicon International/Millipore, Billerica, MA) or
modified Potassium simplex optimized medium (mKSOM; Caisson Laboratories) [335],
depending on the study. Both media were supplemented with 0.3% [w/v] essentially fatty acid
free BSA (Sigma Chemical Co.). In one study, expanded and hatched blastocysts formed on d 8
post-fertilization after culture in mKSOM were placed in groups (n=10-18), snap-frozen in liquid
nitrogen and stored at -80ºC. TcRNA was extracted using the RNeasy Micro kit (Qiagen Inc.)
and quantified by using a NanoDrop™8000 spectrophotometer (Thermo Scientific).
In a second set of studies, blastocysts identified on d 8 post-fertilization were collected
and washed in DPBS containing 1 mg/ml polyvinyl pyrolidone (PVP; Fisher Scientific).
Individual blastocysts were placed in 30 µl drops of Medium 199 (M199) containing 2.5% [v/v]
fetal bovine serum (FBS; Invitrogen Corp.) and 10 µM Gentamycin (Sigma Chemical Co.)
[213]. The stage of blastocyst development (non-expanded or expanded) was used to balance
treatment combinations. Medium was supplemented with 50 ng/ml recombinant (r) bovine (b)
FGF1 (R&D Systems), 50 ng/ml rbFGF2 (R&D Systems), 50 or 500 ng/ml r human (h) FGF10
(Invitrogen Corp.) or carrier only (M199 containing 1% [w/v] BSA). In one study, blastocysts
were incubated at 38.5ºC in 5% CO2/5%O2/90%N2 for 24 h, then washed once in PBS/PVP,
snap-frozen in liquid nitrogen and stored at -80ºC. In a companion study, blastocysts were
incubated at the aforementioned condition for 48 h then washed once in PBS/PVP and fixed by
incubation in 4% [w/v] paraformaldehyde (Polysciences Inc.) for 10 min and processed for
determining blastomere numbers with Hoechst 33342 staining and epifluorescence microscopy
[213]. Number of Hoechst-positive nuclei was quantified with NIS-Elements software (Nikon
Instruments Inc.).
62
End-Point RT-PCR
All samples were incubated with RNase-free DNase (Ambion, Inc.) for 30 min at 37ºC then
heat-denatured at 75ºC for 10 min immediately before reverse transcription. The SuperScript®
III First-Strand Synthesis System Kit (Invitrogen Corp.) and random hexamers were used for
reverse transcription of tcRNA. Non-reverse transcribed DNase-treated RNA was included as a
negative control for each sample. Gene-specific primer sets were used to amplify products for
FGFR1, 2, 3, or 4 and FGF1, 2, 7 or 10 (see Table 3-2). A primer pair specific for β-actin
(ACTB) cDNA was included as a positive control in these reactions (Table 3-2). PCR
amplification was performed using either PfuUltra™ High-Fidelity DNA Polymerase
(Stratagene) or ThermalAce™ DNA Polymerase (Invitrogen Corp.). From 30 to 45 cycles of
denaturation (95°C for 1 min), annealing (55–62°C for 1 min; depending on the primer set) and
DNA synthesis (72 or 74°C for 1 min; depending on the polymerase) followed by a DNA
polishing stage (72-74°C for 10 min) were completed. The presence and approximate size of
amplified products were determined by electrophoresis in an agarose gel (1.2% [w/v]) containing
ethidium bromide (100ng/mL) and visualized on an UV light box.
Amplicons of the desired size were excised from gels and ligated into the pCR4-Blunt TOPO
vector (Invitrogen Corp.). Ligation reactions were used to transform chemically competent
TOP10 E. coli (Invitrogen Corp.). Selected colonies were propagated and purified clones were
sequenced in both directions using vector primer sets at the University of Florida DNA Core
Facility. Multiple clones from at least three different conceptuses were sequenced to verify that
amplified products represented the transcript of interest. Also, DNA sequencing was used to
identify specific splice variant forms of FGFR1 to FGFR3 in bovine conceptuses and CT-1 cells.
63
Quantitative (q), Real-Time RT-PCR
The abundance of FGF and IFNT transcripts in bovine conceptuses was determined by
qRT-PCR. All samples were incubated with RNase-free DNase (Ambion Inc.) as described
previously before reverse transcription with the High Capacity cDNA Archive Kit and random
hexamers (Applied Biosystems Inc.).
For one study with in vitro produced blastocysts, primers specific for boIFNT and 18S
(internal control) (Table 3-3) were used in combination with a SybrGreen detector system
(Applied Biosystems Inc.) and a 7300 Real-Time PCR System (Applied Biosystems Inc.) to
quantify IFNT mRNA concentrations. After an initial activation/denaturation step (50ºC for 2
min; 95ºC for 10 min), 40 cycles of a two-step amplification protocol (60ºC for 1 min; 95ºC for
15 sec) were completed. A dissociation curve analysis (60-95ºC) was used to verify the
amplification of a single product. Each blastocyst sample was run in duplicate reactions and a
third reaction lacking exposure to reverse transcriptase was included for each sample to verify
they were free of genomic contamination. The comparative threshold cycle (CT) method was
used to quantify the abundance of IFNT mRNA relative to that of 18S [212]. In brief, the
average ∆CT value for each sample was calculated (IFNT CT - 18S CT) and used to calculate the
fold-change in the relative abundance of IFNT mRNA.
A TaqMan-based qRT-PCR approach was used to quantify the abundance of FGF1,
FGF2, FGF10, IFNT, and 18S RNA (internal RNA loading control) in other studies. Primers
and probes specific for each FGF transcript and IFNT mRNA were synthesized (Applied
Biosystems Inc.; Table 3-4) and labeled with a fluorescent 5' 6-FAM reporter dye and 3'
TAMRA quencher. The IFNT primer/probe set was developed to recognize every known bovine
and ovine IFNT isoform [212]. After an initial activation/denaturation step (50ºC for 2 min;
95ºC for 10 min), 50 cycles of a two-step amplification protocol (60ºC for 1 min; 95ºC for 15
64
sec) was used with TaqMan reagent (Applied Biosystems Inc.) and a 7300 Real-Time PCR
System to quantify transcript levels. Abundance of 18S RNA was determined using the 18S
RNA Control Reagent Kit (Applied Biosystems Inc.) containing a 5'-VIC-labelled probe with a
3'-6-carboxy-tetramethylrhodamine quencher. Each RNA sample was analyzed in duplicate
reactions (10-50 ng tcRNA for blastocysts and d 11 conceptuses; 50 ng tcRNA for d 14 and 17
conceptuses). An additional reaction lacking exposure to the reverse transcriptase was included
for each sample to verify they were free of genomic DNA contamination.
The ∆CT method was used to contrast abundance of transcripts for FGFs and IFNT
relative to 18S RNA in all but one study. In one study, relative amounts of 18S RNA changed
across stages of conceptus development, so a relative standard curve approach was used in
combination with the amount of tcRNA used in qRT-PCR reactions to describe relative
abundances for individual FGFs and IFNT during conceptus development [337, 338] (ABI Prism
Sequence Detection System User Bulletin No. 2; Applied Biosystems Inc.). One of the d 17
conceptus RNA samples was used as a standard sample, and four doses of this preparation (2, 10,
50, 250 ng tcRNA/reaction) was included in each real-time run. The slope and intercept for each
FGF, IFNT, and 18S curve was used to convert raw CT values into values that represented the ng
of control tcRNA required to equal that detected in each sample by solving the formula: (10[(CT
value-y intercept)/slope] / sample tcRNA).
Statistical Analyses
All analyses were completed by analysis of variance (ANOVA) using the General Linear
Model (GLM) of the Statistical Analysis System (SAS Institute Inc.). Differences in individual
means were partitioned further by completing pair-wise comparisons (probably of difference
analysis [PDIFF]). When analyzing qRT-PCR data transformed using the ∆CT method, the ∆CT
65
values were used for the statistical analyses, but data are presented as fold differences from
control values. Results are presented as arithmetic means ± SEMs.
66
CHAPTER 4 CONCLUSION
Various FGFs produced by both the bovine endometrium and conceptus bind to and
activate FGFRs expressed by the trophectoderm to stimulate IFNT mRNA and protein
production in the bovine trophectoderm during early pregnancy (Figure 4-1). Our findings show
FGF2 to be one of them. This FGF is released into the lumen throughout the estrous cycle and
early pregnancy and is available to the bovine trophectoderm to stimulate IFNT production
[212]. Other uterine-derived FGF, such as FGF7 and FGF10, are expressed in the stromal
endometrium, and it is unlikely they can traverse the uterine layers and reach the lumen [298].
Therefore, their actions may be restricted to mediate the attachment of trophoblast cells [281],
and to stimulate the proliferation of epithelial cells [218].
Our results also identified various FGFs produced by the bovine conceptus. Fibroblast
growth factor 1 and FGF2, as well as their FGFRs isoforms, are produced by the trophectoderm
during early pregnancy. Once activated, they have an autocrine effect to enhance IFNT
production by the trophectoderm.
Maybe the most exciting FGF of all, FGF10 represents the primary transcript in d17
conceptus and has similar expression pattern as IFNT. Fibroblast growth factor 10 is localized to
the mesoderm, and because is the predominant FGF in peri-attachment conceptuses, it is
proposed that FGF10 interacts with its specific trophectoderm-derived receptor, FGFR2b, during
conceptus elongation to maximize IFNT expression in early pregnancy.
67
Figure 4-1. Proposed model of expression and action of selective FGF during pre-attachment bovine conceptus development.
68
Table 3-2. End-point RT-PCR primer sets used for discovery of FGFR subtypes and FGFs expressed during early bovine conceptus development
Gene of Interest Primer* Product
Size Sequence (5'-3') Annealing Temp (oC)
Gene Bank
ID
FGFR1 Forward Reverse 574 ATCGTGGAGAACGAATACGGC
GGATGCTCTTGGCCAGCTTGT 58 281768
FGFR2
Forward Reverse
596
GGTCCCGTCTGACAAAGGAAA GTCAGCTTGTGCACAGCCG
58 404193
FGFR3
Forward Reverse
574
GGCAGAATCCAGCAGACCTAC CAAGGACACCTGTCGCTTGAG
58 281769
FGFR4
Forward Reverse
427
AAGGCAGGTACACGGACATC TAAGCATCTTGACAGCCACG
58 317696
FGF1
Forward Reverse
322
TTCCTGAGAATCCTCCCAGA CTTTCTGGCCGAAGTGAGTC
57 281160
FGF2
Forward Reverse
281
CAAGCGGCTGTACTGCAAGA TCGTTTCAGTGCCACATACCA
57 281161
FGF7
Forward Reverse
432
GCTTGCAATGACATGACTCC TGCCATAGGAAGAAAGTGGG
55 616885
FGF10
Forward Reverse
361
GTTCTTGGTGTCTTCCGTCC CTCCTTTTCCATTCAATGCC
55 326285
ACTB
Forward Reverse
362
CTGTCCCTGTATGCCTCTGG AGGAAGGAAGGCTGGAAGAG
57 280979
* Forward=sense (5') primer; Reverse=antisense (3') primer.
69
Table 3-3. Primer sets used for SybrGreen qRT-PCR Gene of Interest Primer* Sequence (5'-3') Gene Bank ID
IFNT Forward GATCCTTCTGGAGCTGGYTG
317698 Reverse
GCCCGAATGAACAGACTCYC
18S Forward GCCTGAGAAACGGCTACCAC 493779 Reverse CACCAGACTTGCCCTCCAAT
*Forward=sense (5') primer; Reverse=antisense (3') primer. Y= insertion of C or T nucleotide
70
Table 3-4. Primer/probe sets used for TaqMan qRT-PCR Gene of Interest
Primer/ Probe* Sequence (5'-3')**
Reference/ Gene Bank
ID
FGF1
Forward Reverse Probe
ACAGTGGATGGGACGAAGGA CCCTATGCTTTCCGCACAGA
AGCGACCAGCACATTCAGCTGCAG
281160
FGF2
Forward Reverse Probe
ACCGGTCAAGGAAATACTCCAG CAGGTCCTGTTTTGGGTCCA
TGGTATGTGGCACTGAAACGAACTGGG
[212]
FGF10
Forward Reverse Probe
AGAGGACAGAAAACACGAAGGAAA GGTTATACTGCATCTGCAATCATTG
CCTCAGCTCATTTTCTTCCGATGGTGGTAC
326285
IFNT Forward Reverse Probe
TGCAGGACAGAAAAGACTTTGGT CCTGATCCTTCTGGAGCTGG
TTCCTCAGGAGATGGTGGAGGGCA [212]
* Forward=sense (5') primer; Reverse=antisense (3') primer. **Each probe was synthesized with a 6-FAM reporter dye and TAMRA quencher.
71
APPENDIX A QUANTITATIVE REAL TIME RT-PCR PROTOCOL
A quantitative assay (qRT-PCR) determines the relative amounts of a nucleic acid target
as it is being amplified with PCR. The following protocol was used when completing qRT-PCR
with either TaqMan® Probes or SYBR Green I Dye detectors.
RNA Concentration
The concentration of RNA should be determined by measuring the absorbance at 260 nm
(A260) in a spectrophotometer.
NanoDrop 8000 (Thermo Scientific, Wilmington, DE)
1. With the sample apparatus open, add 1.5 μL of RNA sample onto the measurement pedestal.
2. Close the sample apparatus. The spectral measurement is made based on the path length of
1mm.
3. When the measurement is complete, open the sample apparatus and wipe the sample from
both the sample arm and sample pedestal using an ordinary tissue (Kimwipes).
DNAse Treatment
This step is necessary to eliminate any DNA contamination in the RNA sample.
1. For the actual samples, combine 600 ng of RNA (or use all eluted RNA if the concentration
is not enough) +12.5 μL of the following DNAse mix in a PCR tube:
2x DNAse mix 1 reaction DNAse 1.0 μL DNAse buffer 1.5 μL DEPC water 9.0 μL TOTAL 12.5 µL
2. Spin for 30 sec in a mini centrifuge. Set the program in a PCR thermocycler as following:
72
a. 37oC/30 min
b. 75oC/15 min
c. 4oC – end
Reverse Transcription (RT)
The RT reaction, also known as first strand cDNA synthesis, is necessary to convert
single-stranded RNA into first strand DNA by a reverse transcriptase enzyme; the resulting
product can be used in RT-PCR reactions.
1. In a 96-well plate, add 10 μL of DNAse-treated product and 10 μL of RT mix. You must
have two wells for the sample and 1 well for the negative control (3 wells/sample).
2x RT mix 1 ⊕ reaction 1 - reaction 10x Buffer 2 μL 2 μL 10x Primer 2 μL 2 μL 25x dNTPs 0.8 μL 0.8 μL 20x RTase 1 μL --
DEPC water 4.2 μL 5.2 μL TOTAL 10 μL 10 μL
2. Spin at 4oC for 2 min at 2000 rpm. Set the program in the PCR thermocycler as following:
a. 25oC/10 min
b. 37oC/60 min – 2x
c. 85oC/5 sec
d. 4oC – end
Real Time PCR: TaqMan® Probe
TaqMan® probe consists of two fluorescent reporter proteins: a quencher (at the 3’ end)
and a reporter (at the 5’ end). Due to their proximity to each other, the quencher drastically
reduces the fluorescence from the reporter. Taq polymerase then removes the TaqMan® probe
73
from the template DNA as it incorporates nucleotides into a new strand of DNA. This event
separates the quencher from the reporter, and allows the reporter to emit its fluorescence, which
is then quantified in real time.
1. In a 96-well optical plate combine 5 μL of the RT product and 45 μL of PCR mix (3
wells/sample).
PCR mix 1reaction 2x TaqMan® Mix 25 μL 10x 2μM Primer For 5 μL 10x 2μM Primer Rev 5 μL 10x 1μM Probe 5 μL 20x 18S Primer/Probe 2.5 μL DEPC water 2.5 μL TOTAL 45 μL
2. Spin at 4oC for 2 min at 2000 rpm. Set the program in the computer by the Real Time PCR
machine:
Stage 1: 50oC/2 min
Stage 2: 95oC/10 min
Stage 3: 50 cycles
95oC/15 sec
55oC/1 min
Real Time PCR: SYBR Green I Dye Chemistry
The SYBR® Green I Dye binds to minor grooves in the double-stranded DNA and emits
light when excited. It eliminates the need for complicated probe design and can be used in
conjunction with any primers for any target of interest, although sensitivity can be compromised
by biding to any dsDNA, including nonspecific products.
1. In a 96-well optical plate combine 5 μL of the RT product and 45 μL of PCR mix (3
wells/sample).
74
PCR mix 1 reaction2x SYBR Green Mix 25 μL 10x 2μM Primer For 5 μL 10x 2μM Primer Rev 5 μL DEPC water 10 μL TOTAL 45 μL
2. Spin at 4oC for 2min at 2000rpm. Set the program in the computer by the Real Time PCR
machine:
Stage 1: 50oC/2min
Stage 2: 95oC/10min
Stage 3: 50 cycles
95oC/15sec
55oC/1min
Add Dissociation Stage:
Stage 4: 95oC/15 sec
60oC/30 sec
95oC/15 sec
75
APPENDIX B RELATIVE STANDARD CURVE METHOD FOR ANALYZING qRT-PCR DATA
The relative standard curve method uses a set of samples as internal standards to generate
linear regression equations that can be used to normalize data across qRT-PCR runs. Relative
standard curves are easy to prepare because quantity is expressed relative to a sample (the
calibrator), which is used for comparing results across qRT-PCR runs.
Standards
Prepare a 5-fold dilution of a representative tcRNA sample that contains the transcripts of
interest. For example, in the work completed herein, standard samples included d 17 bovine
conceptus RNA and lung RNA (250, 50, 10 and 2 ng of each). By using the same stock RNA to
prepare standard curves for multiple plates, the relative quantities can be compared across plates.
The standard samples used for this work were:
• Lung: FGF1, FGF2 (targets) and 18S (endogenous control)
• d17 conceptus: FGF10, IFNT (targets) and 18S (endogenous control)
It is important that stocks of RNA for the standard curve be accurately diluted. Store small
aliquots of each dilution at -80oC, and thaw each aliquot only once.
Determining the Relative Values
Use the slope and intercept for each standard curve in the following formula. Convert raw
Ct values into values that represent the ng of control tcRNA required to equal that detected in
each sample.
10
76
Another way to determine the relative values when the internal control does not change
throughout the samples is to use the slope and intercept from each standard curve in the
following formula:
10
10
77
y = -2.6919x + 37.007R² = 0.9883
30
31
32
33
34
35
36
37
0.00 0.50 1.00 1.50 2.00 2.50 3.00
Ct
log10 RNA (ng/rxn)
Figure B-1. Standard curve created for FGF1 using a lung sample.
78
y = -3.1452x + 33.578R² = 0.9874
25
27
29
31
33
35
0.00 0.50 1.00 1.50 2.00 2.50 3.00
Ct
log10 RNA (ng/rxn)
Figure B-2. Standard curve created for FGF2 using a lung sample.
79
y = -3.2823x + 36.75R² = 0.9915
25
27
29
31
33
35
37
0.00 0.50 1.00 1.50 2.00 2.50 3.00
Ct
log10 RNA (ng/rxn)
Figure B-3. Standard curve created for FGF10 using a d 17 conceptus sample.
80
y = -3.1336x + 23.344R² = 0.9888
10
12
14
16
18
20
22
24
0.00 0.50 1.00 1.50 2.00 2.50 3.00
Ct
log10 RNA (ng/rxn)
Figure B-4. Standard curve created for IFNT using a d 17 conceptus sample.
81
y = -3.145x + 22.57R² = 0.9899
10
12
14
16
18
20
22
24
0.00 0.50 1.00 1.50 2.00 2.50 3.00
Ct
log10 RNA (ng/rxn)
Figure B-5. Standard curve created for 18S using a lung sample.
82
y = -3.0811x + 15.664R² = 0.9876
5
7
9
11
13
15
17
0.00 0.50 1.00 1.50 2.00 2.50 3.00
Ct
log10 RNA (ng/rxn)
Figure B-6. Standard curve created for 18S using a d 17 conceptus sample.
83
LIST OF REFERENCES
1. Inskeep EK, Dailey RA. Embryonic death in cattle. Vet Clin North Am Food Anim Pract 2005; 21: 437-461.
2. Roche JF, Bolandl MP, McGeady TA. Reproductive wastage following artificial insemination of heifers. Vet Rec 1981; 109: 401-404.
3. De Vries A. Economic value of pregnancy in dairy cattle. J Dairy Sci 2006; 89: 3876-3885.
4. Evans JP, Florman HM. The state of the union: the cell biology of fertilization. Nat Cell Biol 2002; 4 Suppl: s57-63.
5. Betteridge KJ, Flechon JE. The anatomy and physiology of pre-attachment bovine embryos. Theriogenology 1988; 29: 155-187.
6. Van Soom A, Boerjan M, Ysebaert MT, De Kruif A. Cell allocation to the inner cell mass and the trophectoderm in bovine embryos cultured in two different media. Mol Reprod Dev 1996; 45: 171-182.
7. Kidder GM, McLachlin JR. Timing of transcription and protein synthesis underlying morphogenesis in preimplantation mouse embryos. Dev Biol 1985; 112: 265-275.
8. Garbutt CL, Chisholm JC, Johnson MH. The establishment of the embryonic-abembryonic axis in the mouse embryo. Development 1987; 100: 125-134.
9. Gardner RL. Investigation of cell lineage and differentiation in the extraembryonic endoderm of the mouse embryo. J Embryol Exp Morphol 1982; 68: 175-198.
10. Rossant J. Postimplantation development of blastomeres isolated from 4- and 8-cell mouse eggs. J Embryol Exp Morphol 1976; 36: 283-290.
11. Chambers I, Colby D, Robertson M, Nichols J, Lee S, Tweedie S, Smith A. Functional expression cloning of Nanog, a pluripotency sustaining factor in embryonic stem cells. Cell 2003; 113: 643-655.
12. Hansis C, Grifo JA, Krey LC. Oct-4 expression in inner cell mass and trophectoderm of human blastocysts. Mol Hum Reprod 2000; 6: 999-1004.
13. Tanaka TS, Kunath T, Kimber WL, Jaradat SA, Stagg CA, Usuda M, Yokota T, Niwa H, Rossant J, Ko MS. Gene expression profiling of embryo-derived stem cells reveals
84
candidate genes associated with pluripotency and lineage specificity. Genome Res 2002; 12: 1921-1928.
14. Yan JL, Tanaka S, Oda M, Makino T, Ohgane J, Shiota K. Retinoic acid promotes differentiation of trophoblast stem cells to a giant cell fate. Dev Biol 2001; 235: 422-432.
15. Beck F, Erler T, Russell A, James R. Expression of Cdx-2 in the mouse embryo and placenta: possible role in patterning of the extra-embryonic membranes. Dev Dyn 1995; 204: 219-227.
16. Hancock SN, Agulnik SI, Silver LM, Papaioannou VE. Mapping and expression analysis of the mouse ortholog of Xenopus Eomesodermin. Mech Dev 1999; 81: 205-208.
17. Morasso MI, Grinberg A, Robinson G, Sargent TD, Mahon KA. Placental failure in mice lacking the homeobox gene Dlx3. Proc Natl Acad Sci USA 1999; 96: 162-167.
18. Flechon JE, Renard JP. A scanning electron microscope study of the hatching of bovine blastocysts in vitro. J Reprod Fertil 1978; 53: 9-12.
19. Perry JS. The mammalian fetal membranes. J Reprod Fertil 1981; 62: 321-335.
20. Maddox-Hyttel P, Alexopoulos NI, Vajta G, Lewis I, Rogers P, Cann L, Callesen H, Tveden-Nyborg P, Trounson A. Immunohistochemical and ultrastructural characterization of the initial post-hatching development of bovine embryos. Reproduction 2003; 125: 607-623.
21. Schlafer DH, Fisher PJ, Davies CJ. The bovine placenta before and after birth: placental development and function in health and disease. Anim Reprod Sci 2000; 60-61: 145-160.
22. Hue I, Renard JP, Viebahn C. Brachyury is expressed in gastrulating bovine embryos well ahead of implantation. Dev Genes Evol 2001; 211: 157-159.
23. Winters LM, Green WW, Comstock RE. Prenatal development of the bovine. Minnesota Technical Bulletin 1942; 151: 3–50.
24. Curran S, Pierson RA, Ginther OJ. Ultrasonographic appearance of the bovine conceptus from days 20 through 60. J Am Vet Med Assoc 1986; 189: 1295-1302.
25. Bertolini M, Beam SW, Shim H, Bertolini LR, Moyer AL, Famula TR, Anderson GB. Growth, development, and gene expression by in vivo- and in vitro-produced day 7 and 16 bovine embryos. Mol Reprod Dev 2002; 63: 318-328.
85
26. Chang MC. Development of bovine blastocyst with a note on implantation. Anat Rec 1952; 113: 143-161.
27. Schlafke S, Enders AC. Cellular basis of interaction between trophoblast and uterus at implantation. Biol Reprod 1975; 12: 41-65.
28. Lee KY, DeMayo FJ. Animal models of implantation. Reproduction 2004; 128: 679-695.
29. Chavatte-Palmer P, Guillomot M. Comparative implantation and placentation. Gynecol Obstet Invest 2007; 64: 166-174.
30. Spencer TE, Johnson GA, Bazer FW, Burghardt RC. Implantation mechanisms: insights from the sheep. Reproduction 2004; 128: 657-668.
31. Guillomot M, Flechon JE, Leroy E. Blastocyst development and implantation. Paris: Ellipses; 1993.
32. Guillomot M, Flechon JE, Wintenberger-Torres S. Conceptus attachment in the ewe: an ultrastructural study. Placenta 1981; 2: 169-182.
33. Guillomot M, Guay P. Ultrastructural features of the cell surfaces of uterine and trophoblastic epithelia during embryo attachment in the cow. Anat Rec 1982; 204: 315-322.
34. Wooding FB. The role of the binucleate cell in ruminant placental structure. J Reprod Fertil Suppl 1982; 31: 31-39.
35. Spencer TE, Johnson GA, Burghardt RC, Bazer FW. Progesterone and placental hormone actions on the uterus: insights from domestic animals. Biol Reprod 2004; 71: 2-10.
36. Spencer TE, Bazer FW. Biology of progesterone action during pregnancy recognition and maintenance of pregnancy. Front Biosci 2002; 7: d1879-1898.
37. Enders AC, Carter AM. What can comparative studies of placental structure tell us?--A review. Placenta 2004; 25 Suppl A: S3-9.
38. Moll W. Structure adaptation and blood flow control in the uterine arterial system after hemochorial placentation. Eur J Obstet Gynecol Reprod Biol 2003; 110 Suppl 1: S19-27.
39. Wooding FB. Current topic: the synepitheliochorial placenta of ruminants: binucleate cell fusions and hormone production. Placenta 1992; 13: 101-113.
86
40. Wooding FB, Morgan G, Adam CL. Structure and function in the ruminant synepitheliochorial placenta: central role of the trophoblast binucleate cell in deer. Microsc Res Tech 1997; 38: 88-99.
41. Gootwine E. Placental hormones and fetal-placental development. Anim Reprod Sci 2004; 82-83: 551-566.
42. Wooding FB, Chambers SG, Perry JS, George M, Heap RB. Migration of binucleate cells in the sheep placenta during normal pregnancy. Anat Embryol (Berl) 1980; 158: 361-370.
43. Wango EO, Wooding FB, Heap RB. The role of trophoblastic binucleate cells in implantation in the goat: a morphological study. J Anat 1990; 171: 241-257.
44. Wooding FB. Role of binucleate cells in fetomaternal cell fusion at implantation in the sheep. Am J Anat 1984; 170: 233-250.
45. Hoffman LH, Wooding FB. Giant and binucleate trophoblast cells of mammals. J Exp Zool 1993; 266: 559-577.
46. Wooding FB, Flint AP, Heap RB, Morgan G, Buttle HL, Young IR. Control of binucleate cell migration in the placenta of sheep and goats. J Reprod Fertil 1986; 76: 499-512.
47. Wooding FB. Frequency and localization of binucleate cells in the placentomes of ruminants. Placenta 1983; 4 Spec No: 527-539.
48. Moor RM, Rowson LE. The corpus luteum of the sheep: effect of the removal of embryos on luteal function. J Endocrinol 1966; 34: 497-502.
49. Moor RM, Rowson LE. The corpus luteum of the sheep: functional relationship between the embryo and the corpus luteum. J Endocrinol 1966; 34: 233-239.
50. Moor RM, Rowson LE, Hay MF, Caldwell BV. The corpus luteum of the sheep: effect of the conceptus on luteal function at several stages during pregnancy. J Endocrinol 1969; 43: 301-307.
51. Rowson LE, Moor RM, Lawson RA. Fertility following egg transfer in the cow; effect of method, medium and synchronization of oestrus. J Reprod Fertil 1969; 18: 517-523.
52. Rowson LE, Lawson RA, Moor RM, Baker AA. Egg transfer in the cow: synchronization requirements. J Reprod Fertil 1972; 28: 427-431.
87
53. Martal J, Lacroix MC, Loudes C, Saunier M, Wintenberger-Torres S. Trophoblastin, an antiluteolytic protein present in early pregnancy in sheep. J Reprod Fertil 1979; 56: 63-73.
54. Bartol FF, Roberts RM, Bazer FW, Lewis GS, Godkin JD, Thatcher WW. Characterization of proteins produced in vitro by periattachment bovine conceptuses. Biol Reprod 1985; 32: 681-693.
55. Godkin JD, Bazer FW, Moffatt J, Sessions F, Roberts RM. Purification and properties of a major, low molecular weight protein released by the trophoblast of sheep blastocysts at day 13-21. J Reprod Fertil 1982; 65: 141-150.
56. Godkin JD, Bazer FW, Roberts RM. Ovine trophoblast protein 1, an early secreted blastocyst protein, binds specifically to uterine endometrium and affects protein synthesis. Endocrinology 1984; 114: 120-130.
57. Godkin JD, Bazer FW, Thatcher WW, Roberts RM. Proteins released by cultured day 15-16 conceptuses prolong luteal maintenance when introduced into the uterine lumen of cyclic ewes. J Reprod Fertil 1984; 71: 57-64.
58. Imakawa K, Anthony RV, Kazemi M, Marotti KR, Polites HG, Roberts RM. Interferon-like sequence of ovine trophoblast protein secreted by embryonic trophectoderm. Nature 1987; 330: 377-379.
59. Demmers KJ, Derecka K, Flint A. Trophoblast interferon and pregnancy. Reproduction 2001; 121: 41-49.
60. Spencer TE, Burghardt RC, Johnson GA, Bazer FW. Conceptus signals for establishment and maintenance of pregnancy. Anim Reprod Sci 2004; 82-83: 537-550.
61. Flint AP, Lamming GE, Stewart HJ, Abayasekara DR. The role of the endometrial oxytocin receptor in determining the length of the sterile oestrous cycle and ensuring maintenance of luteal function in early pregnancy in ruminants. Philos Trans R Soc Lond B Biol Sci 1994; 344: 291-304.
62. Jenner LJ, Parkinson TJ, Lamming GE. Uterine oxytocin receptors in cyclic and pregnant cows. J Reprod Fertil 1991; 91: 49-58.
63. Spencer TE, Becker WC, George P, Mirando MA, Ogle TF, Bazer FW. Ovine interferon-tau regulates expression of endometrial receptors for estrogen and oxytocin but not progesterone. Biol Reprod 1995; 53: 732-745.
88
64. Bazer FW, Thatcher WW, Hansen PJ, Mirando MA, Ott TL, Plante C. Physiological mechanisms of pregnancy recognition in ruminants. J Reprod Fertil Suppl 1991; 43: 39-47.
65. Knickerbocker JJ, Thatcher WW, Bazer FW, Drost M, Barron DH, Fincher KB, Roberts RM. Proteins secreted by day-16 to -18 bovine conceptuses extend corpus luteum function in cows. J Reprod Fertil 1986; 77: 381-391.
66. Bazer FW, Vallet JL, Roberts RM, Sharp DC, Thatcher WW. Role of conceptus secretory products in establishment of pregnancy. J Reprod Fertil 1986; 76: 841-850.
67. Robinson RS, Mann GE, Lamming GE, Wathes DC. The effect of pregnancy on the expression of uterine oxytocin, oestrogen and progesterone receptors during early pregnancy in the cow. J Endocrinol 1999; 160: 21-33.
68. Robinson RS, Mann GE, Lamming GE, Wathes DC. Expression of oxytocin, oestrogen and progesterone receptors in uterine biopsy samples throughout the oestrous cycle and early pregnancy in cows. Reproduction 2001; 122: 965-979.
69. Leung ST, Wathes DC. Oestradiol regulation of oxytocin receptor expression in cyclic bovine endometrium. J Reprod Fertil 2000; 119: 287-292.
70. Wathes DC, Hamon M. Localization of oestradiol, progesterone and oxytocin receptors in the uterus during the oestrous cycle and early pregnancy of the ewe. J Endocrinol 1993; 138: 479-492.
71. Spencer TE, Ott TL, Bazer FW. Expression of interferon regulatory factors one and two in the ovine endometrium: effects of pregnancy and ovine interferon tau. Biol Reprod 1998; 58: 1154-1162.
72. Ott TL, Van Heeke G, Hostetler CE, Schalue TK, Olmsted JJ, Johnson HM, Bazer FW. Intrauterine injection of recombinant ovine interferon-t extends the interestous interval in sheep. Theriogenology 1993; 40: 757-769.
73. Ealy AD, Green JA, Alexenko AP, Keisler DH, Roberts RM. Different ovine interferon-tau genes are not expressed identically and their protein products display different activities. Biol Reprod 1998; 58: 566-573.
74. Meyer MD, Hansen PJ, Thatcher WW, Drost M, Badinga L, Roberts RM, Li J, Ott TL, Bazer FW. Extension of corpus luteum lifespan and reduction of uterine secretion of prostaglandin F2 alpha of cows in response to recombinant interferon- tau. J Dairy Sci 1995; 78: 1921-1931.
89
75. Niswender KD, Li J, Powell MR, Loos KR, Roberts RM, Keisler DH, Smith MF. Effect of variants of interferon-tau with mutations near the carboxyl terminus on luteal life span in sheep. Biol Reprod 1997; 56: 214-220.
76. Winkelman GL, Roberts RM, James PA, Alexenko AP, Ealy AD. Identification of the expressed forms of ovine interferon-tau in the periimplantation conceptus: sequence relationships and comparative biological activities. Biol Reprod 1999; 61: 1592-1600.
77. Clark JD, Lin LL, Kriz RW, Ramesha CS, Sultzman LA, Lin AY, Milona N, Knopf JL. A novel arachidonic acid-selective cytosolic PLA2 contains a Ca(2+)-dependent translocation domain with homology to PKC and GAP. Cell 1991; 65: 1043-1051.
78. Xiao CW, Liu JM, Sirois J, Goff AK. Regulation of cyclooxygenase-2 and prostaglandin F synthase gene expression by steroid hormones and interferon-tau in bovine endometrial cells. Endocrinology 1998; 139: 2293-2299.
79. Parent J, Villeneuve C, Alexenko AP, Ealy AD, Fortier MA. Influence of different isoforms of recombinant trophoblastic interferons on prostaglandin production in cultured bovine endometrial cells. Biol Reprod 2003; 68: 1035-1043.
80. Binelli M, Subramaniam P, Diaz T, Johnson GA, Hansen TR, Badinga L, Thatcher WW. Bovine interferon-tau stimulates the janus kinase-signal transducer and activator of transcription pathway in bovine endometrial epithelial cells. Biol Reprod 2001; 64: 654-665.
81. Guzeloglu A, Michel F, Thatcher WW. Differential effects of interferon-tau on the prostaglandin synthetic pathway in bovine endometrial cells treated with phorbol ester. J Dairy Sci 2004; 87: 2032-2041.
82. Asselin E, Drolet P, Fortier MA. In vitro response to oxytocin and interferon-tau in bovine endometrial cells from caruncular and inter-caruncular areas. Biol Reprod 1998; 59: 241-247.
83. Asselin E, Bazer FW, Fortier MA. Recombinant ovine and bovine interferons tau regulate prostaglandin production and oxytocin response in cultured bovine endometrial cells. Biol Reprod 1997; 56: 402-408.
84. Asselin E, Lacroix D, Fortier MA. Interferon-tau increases PGE2 production and COX-2 gene expression in the bovine endometrium in vitro. Mol Cell Endocrinol 1997; 132: 117-126.
85. Smith WL, Marnett LJ, DeWitt DL. Prostaglandin and thromboxane biosynthesis. Pharmacol Ther 1991; 49: 153-179.
90
86. Skopets B, Li J, Thatcher WW, Roberts RM, Hansen PJ. Inhibition of lymphocyte proliferation by bovine trophoblast protein-1 (type I trophoblast interferon) and bovine interferon-alpha 1. Vet Immunol Immunopathol 1992; 34: 81-96.
87. Thatcher WW. Antiluteolytic signals between the conceptus and endometrium. Theriogenology 1997; 47: 131-140.
88. Niwano Y, Hansen TR, Kazemi M, Malathy PV, Johnson HD, Roberts RM, Imakawa K. Suppression of T-lymphocyte blastogenesis by ovine trophoblast protein-1 and human interferon-alpha may be independent of interleukin-2 production. Am J Reprod Immunol 1989; 20: 21-26.
89. Fillion C, Chaouat G, Reinaud P, Charpigny JC, Martal J. Immunoregulatory effects of ovine trophoblastin protein (oTP): all five isoforms suppress PHA-induced lymphocyte proliferation. J Reprod Immunol 1991; 19: 237-249.
90. Roberts RM, Imakawa K, Niwano Y, Kazemi M, Malathy PV, Hansen TR, Glass AA, Kronenberg LH. Interferon production by the preimplantation sheep embryo. J Interferon Res 1989; 9: 175-187.
91. Newton GR, Vallet JL, Hansen PJ, Bazer FW. Inhibition of lymphocyte proliferation by ovine trophoblast protein-1 and a high molecular weight glycoprotein produced by the peri-implantation sheep conceptus. Am J Reprod Immunol 1989; 19: 99-107.
92. Tuo W, Ott TL, Bazer FW. Natural killer cell activity of lymphocytes exposed to ovine, type I, trophoblast interferon. Am J Reprod Immunol 1993; 29: 26-34.
93. Proost P, Wuyts A, Conings R, Lenaerts JP, Billiau A, Opdenakker G, Van Damme J. Human and bovine granulocyte chemotactic protein-2: complete amino acid sequence and functional characterization as chemokines. Biochemistry 1993; 32: 10170-10177.
94. Choi Y, Johnson GA, Spencer TE, Bazer FW. Pregnancy and interferon tau regulate major histocompatibility complex class I and beta2-microglobulin expression in the ovine uterus. Biol Reprod 2003; 68: 1703-1710.
95. Naivar KA, Ward SK, Austin KJ, Moore DW, Hansen TR. Secretion of bovine uterine proteins in response to type I interferons. Biol Reprod 1995; 52: 848-854.
96. Staggs KL, Austin KJ, Johnson GA, Teixeira MG, Talbott CT, Dooley VA, Hansen TR. Complex induction of bovine uterine proteins by interferon-tau. Biol Reprod 1998; 59: 293-297.
91
97. Teixeira MG, Austin KJ, Perry DJ, Dooley VD, Johnson GA, Francis BR, Hansen TR. Bovine granulocyte chemotactic protein-2 is secreted by the endometrium in response to interferon-tau . Endocrine 1997; 6: 31-37.
98. Johnson GA, Austin KJ, Van Kirk EA, Hansen TR. Pregnancy and interferon-tau induce conjugation of bovine ubiquitin cross-reactive protein to cytosolic uterine proteins. Biol Reprod 1998; 58: 898-904.
99. Johnson GA, Joyce MM, Yankey SJ, Hansen TR, Ott TL. The Interferon Stimulated Genes (ISG) 17 and Mx have different temporal and spatial expression in the ovine uterus suggesting more complex regulation of the Mx gene. J Endocrinol 2002; 174: 7-11.
100. Ott TL, Yin J, Wiley AA, Kim HT, Gerami-Naini B, Spencer TE, Bartol FF, Burghardt RC, Bazer FW. Effects of the estrous cycle and early pregnancy on uterine expression of Mx protein in sheep (Ovis aries). Biol Reprod 1998; 59: 784-794.
101. Charleston B, Stewart HJ. An interferon-induced Mx protein: cDNA sequence and high-level expression in the endometrium of pregnant sheep. Gene 1993; 137: 327-331.
102. Johnson GA, Stewart MD, Gray CA, Choi Y, Burghardt RC, Yu-Lee LY, Bazer FW, Spencer TE. Effects of the estrous cycle, pregnancy, and interferon tau on 2',5'- oligoadenylate synthetase expression in the ovine uterus. Biol Reprod 2001; 64: 1392-1399.
103. Vallet JL, Barker PJ, Lamming GE, Skinner N, Huskisson NS. A low molecular weight endometrial secretory protein which is increased by ovine trophoblast protein-1 is a beta 2-microglobulin-like protein. J Endocrinol 1991; 130: 1-4.
104. Choi Y, Johnson GA, Burghardt RC, Berghman LR, Joyce MM, Taylor KM, Stewart MD, Bazer FW, Spencer TE. Interferon regulatory factor-two restricts expression of interferon- stimulated genes to the endometrial stroma and glandular epithelium of the ovine uterus. Biol Reprod 2001; 65: 1038-1049.
105. Pru JK, Austin KJ, Haas AL, Hansen TR. Pregnancy and interferon-tau upregulate gene expression of members of the 1-8 family in the bovine uterus. Biol Reprod 2001; 65: 1471-1480.
106. Hicks BA, Etter SJ, Carnahan KG, Joyce MM, Assiri AA, Carling SJ, Kodali K, Johnson GA, Hansen TR, Mirando MA, Woods GL, Vanderwall DK, Ott TL. Expression of the uterine Mx protein in cyclic and pregnant cows, gilts, and mares. J Anim Sci 2003; 81: 1552-1561.
92
107. Horisberger MA, Staeheli P, Haller O. Interferon induces a unique protein in mouse cells bearing a gene for resistance to influenza virus. Proc Natl Acad Sci USA 1983; 80: 1910-1914.
108. Horisberger MA, Gunst MC. Interferon-induced proteins: identification of Mx proteins in various mammalian species. Virology 1991; 180: 185-190.
109. Evans SS, Collea RP, Leasure JA, Lee DB. IFN-alpha induces homotypic adhesion and Leu-13 expression in human B lymphoid cells. J Immunol 1993; 150: 736-747.
110. Deblandre GA, Marinx OP, Evans SS, Majjaj S, Leo O, Caput D, Huez GA, Wathelet MG. Expression cloning of an interferon-inducible 17-kDa membrane protein implicated in the control of cell growth. J Biol Chem 1995; 270: 23860-23866.
111. Chen YX, Welte K, Gebhard DH, Evans RL. Induction of T cell aggregation by antibody to a 16kd human leukocyte surface antigen. J Immunol 1984; 133: 2496-2501.
112. Cross JC, Roberts RM. Constitutive and trophoblast-specific expression of a class of bovine interferon genes. Proc Natl Acad Sci USA 1991; 88: 3817-3821.
113. Leaman DW, Cross JC, Roberts RM. Multiple regulatory elements are required to direct trophoblast interferon gene expression in choriocarcinoma cells and trophectoderm. Mol Endocrinol 1994; 8: 456-468.
114. Roberts RM, Liu L, Alexenko A. New and atypical families of type I interferons in mammals: comparative functions, structures, and evolutionary relationships. Prog Nucleic Acid Res Mol Biol 1997; 56: 287-325.
115. Farin CE, Imakawa K, Hansen TR, McDonnell JJ, Murphy CN, Farin PW, Roberts RM. Expression of trophoblastic interferon genes in sheep and cattle. Biol Reprod 1990; 43: 210-218.
116. Roberts RM, Cross JC, Leaman DW. Interferons as hormones of pregnancy. Endocr Rev 1992; 13: 432-452.
117. Hernandez-Ledezma JJ, Sikes JD, Murphy CN, Watson AJ, Schultz GA, Roberts RM. Expression of bovine trophoblast interferon in conceptuses derived by in vitro techniques. Biol Reprod 1992; 47: 374-380.
118. Hernandez-Ledezma JJ, Mathialagan N, Villanueva C, Sikes JD, Roberts RM. Expression of bovine trophoblast interferons by in vitro-derived blastocysts is correlated with their morphological quality and stage of development. Mol Reprod Dev 1993; 36: 1-6.
93
119. Ealy AD, Larson SF, Liu L, Alexenko AP, Winkelman GL, Kubisch HM, Bixby JA, Roberts RM. Polymorphic forms of expressed bovine interferon-tau genes: relative transcript abundance during early placental development, promoter sequences of genes and biological activity of protein products. Endocrinology 2001; 142: 2906-2915.
120. Stewart HJ, McCann SH, Northrop AJ, Lamming GE, Flint AP. Sheep antiluteolytic interferon: cDNA sequence and analysis of mRNA levels. J Mol Endocrinol 1989; 2: 65-70.
121. Roberts RM. Conceptus interferons and maternal recognition of pregnancy. Biol Reprod 1989; 40: 449-452.
122. Roberts RM, Cross JC, Leaman DW. Unique features of the trophoblast interferons. Pharmacol Ther 1991; 51: 329-345.
123. Lifsey BJ, Jr., Baumbach GA, Godkin JD. Isolation, characterization and immunocytochemical localization of bovine trophoblast protein-1. Biol Reprod 1989; 40: 343-352.
124. Fowler AK, Reed CD, Giron DJ. Identification of an interferon in murine placentas. Nature 1980; 286: 266-267.
125. Bennett WA, LagooDeenadayalan S, Brackin MN, Hale E, Cowan BD. Cytokine expression by models of human trophoblast as assessed by a semiquantitative reverse transcription-polymerase chain reaction technique. Am J Reprod Immunol 1996; 36: 285-294.
126. Duc-Goiran P, Robert B, Navarro S, Civas A, Cerutti I, Rudant C, Maury M, Conamine H, Doly J. Developmental control of IFN-alpha expression in murine embryos. Exp Cell Res 1994; 214: 570-583.
127. Fink T, Zachar V, Ebbesen P. Biological characterization of three novel variants of IFN-alpha 13 produced by human placental trophoblast. Placenta 2001; 22: 673-680.
128. Jokhi PP, King A, Loke YW. Cytokine production and cytokine receptor expression by cells of the human first trimester placental-uterine interface. Cytokine 1997; 9: 126-137.
129. Lefevre F, Boulay V. A novel and atypical type one interferon gene expressed by trophoblast during early pregnancy. J Biol Chem 1993; 268: 19760-19768.
130. Lefevre F, Martinat-Botte F, Guillomot M, Zouari K, Charley B, La Bonnardiere C. Interferon-gamma gene and protein are spontaneously expressed by the porcine trophectoderm early in gestation. Eur J Immunol 1990; 20: 2485-2490.
94
131. Niu PD, Lefevre F, Mege D, La Bonnardiere C. Atypical porcine type I interferon. Biochemical and biological characterization of the recombinant protein expressed in insect cells. Eur J Biochem 1995; 230: 200-206.
132. Lefevre F, Martinat-Botte F, Locatelli A, De Niu P, Terqui M, La Bonnardiere C. Intrauterine infusion of high doses of pig trophoblast interferons has no antiluteolytic effect in cyclic gilts. Biol Reprod 1998; 58: 1026-1031.
133. Roberts RM, Ezashi T, Rosenfeld CS, Ealy AD, Kubisch HM. Evolution of the interferon-tau genes and their promoters, and maternal-trophoblast interactions in control of their expression. Reprod Suppl 2003; 61: 239-251.
134. Roberts RM, Liu L, Guo Q, Leaman D, Bixby J. The evolution of the type I interferons. J Interferon Cytokine Res 1998; 18: 805-816.
135. Leaman DW, Roberts RM. Genes for the trophoblast interferons in sheep, goat, and musk ox and distribution of related genes among mammals. J Interferon Res 1992; 12: 1-11.
136. Roberts RM, Bazer FW. The functions of uterine secretions. J Reprod Fertil 1988; 82: 875-892.
137. Hardy K, Spanos S. Growth factor expression and function in the human and mouse preimplantation embryo. J Endocrinol 2002; 172: 221-236.
138. Kaye PL. Preimplantation growth factor physiology. Rev Reprod 1997; 2: 121-127.
139. Gray CA, Taylor KM, Ramsey WS, Hill JR, Bazer FW, Bartol FF, Spencer TE. Endometrial glands are required for preimplantation conceptus elongation and survival. Biol Reprod 2001; 64: 1608-1613.
140. Gray CA, Burghardt RC, Johnson GA, Bazer FW, Spencer TE. Evidence that absence of endometrial gland secretions in uterine gland knockout ewes compromises conceptus survival and elongation. Reproduction 2002; 124: 289-300.
141. Gray CA, Bartol FF, Taylor KM, Wiley AA, Ramsey WS, Ott TL, Bazer FW, Spencer TE. Ovine Uterine Gland Knock-Out Model: Effects of Gland Ablation on the Estrous Cycle. Biol Reprod 2000; 62: 448-456.
142. Herrler A, Krusche CA, Beier HM. Insulin and insulin-like growth factor-I promote rabbit blastocyst development and prevent apoptosis. Biol Reprod 1998; 59: 1302-1310.
95
143. Matsui M, Takahashi Y, Hishinuma M, Kanagawa H. Insulin and insulin-like growth factor-I (IGF-I) stimulate the development of bovine embryos fertilized in vitro. J Vet Med Sci 1995; 57: 1109-1111.
144. Mihalik J, Rehak P, Koppel J. The influence of insulin on the in vitro development of mouse and bovine embryos. Physiol Res 2000; 49: 347-354.
145. Xia P, Tekpetey FR, Armstrong DT. Effect of IGF-I on pig oocyte maturation, fertilization, and early embryonic development in vitro, and on granulosa and cumulus cell biosynthetic activity. Mol Reprod Dev 1994; 38: 373-379.
146. Zhou J, Bondy C. Insulin-like growth factor-II and its binding proteins in placental development. Endocrinology 1992; 131: 1230-1240.
147. Han VK, Bassett N, Walton J, Challis JR. The expression of insulin-like growth factor (IGF) and IGF-binding protein (IGFBP) genes in the human placenta and membranes: evidence for IGF-IGFBP interactions at the feto-maternal interface. J Clin Endocrinol Metab 1996; 81: 2680-2693.
148. Letcher R, Simmen RC, Bazer FW, Simmen FA. Insulin-like growth factor-I expression during early conceptus development in the pig. Biol Reprod 1989; 41: 1143-1151.
149. Reynolds TS, Stevenson KR, Wathes DC. Pregnancy-specific alterations in the expression of the insulin-like growth factor system during early placental development in the ewe. Endocrinology 1997; 138: 886-897.
150. Stevenson KR, Gilmour RS, Wathes DC. Localization of insulin-like growth factor-I (IGF-I) and -II messenger ribonucleic acid and type 1 IGF receptors in the ovine uterus during the estrous cycle and early pregnancy. Endocrinology 1994; 134: 1655-1664.
151. Bilby TR, Guzeloglu A, Kamimura S, Pancarci SM, Michel F, Head HH, Thatcher WW. Pregnancy and bovine somatotropin in nonlactating dairy cows: I. Ovarian, conceptus, and insulin-like growth factor system responses. J Dairy Sci 2004; 87: 3256-3267.
152. Guzeloglu A, Bilby TR, Meikle A, Kamimura S, Kowalski A, Michel F, MacLaren LA, Thatcher WW. Pregnancy and bovine somatotropin in nonlactating dairy cows: II. Endometrial gene expression related to maintenance of pregnancy. J Dairy Sci 2004; 87: 3268-3279.
153. Nancarrow CD, Hill JL. Co-culture, oviduct secretion and the function of oviduct-specific glycoproteins. Cell Biol Int 1994; 18: 1105-1114.
96
154. Bavister BD. Culture of preimplantation embryos: facts and artifacts. Hum Reprod Update 1995; 1: 91-148.
155. Makarevich AV, Markkula M. Apoptosis and cell proliferation potential of bovine embryos stimulated with insulin-like growth factor I during in vitro maturation and culture. Biol Reprod 2002; 66: 386-392.
156. Spanos S, Becker DL, Winston RM, Hardy K. Anti-apoptotic action of insulin-like growth factor-I during human preimplantation embryo development. Biol Reprod 2000; 63: 1413-1420.
157. Jousan FD, Hansen PJ. Insulin-like growth factor-I as a survival factor for the bovine preimplantation embryo exposed to heat shock. Biol Reprod 2004; 71: 1665-1670.
158. Block J, Hansen PJ. Interaction between season and culture with insulin-like growth factor-1 on survival of in vitro produced embryos following transfer to lactating dairy cows. Theriogenology 2007; 67: 1518-1529.
159. Block J, Drost M, Monson RL, Rutledge JJ, Rivera RM, Paula-Lopes FF, Ocon OM, Krininger CE, 3rd, Liu J, Hansen PJ. Use of insulin-like growth factor-I during embryo culture and treatment of recipients with gonadotropin-releasing hormone to increase pregnancy rates following the transfer of in vitro-produced embryos to heat-stressed, lactating cows. J Anim Sci 2003; 81: 1590-1602.
160. Watson AJ, Hogan A, Hahnel A, Wiemer KE, Schultz GA. Expression of growth factor ligand and receptor genes in the preimplantation bovine embryo. Mol Reprod Dev 1992; 31: 87-95.
161. Paria BC, Dey SK. Preimplantation embryo development in vitro: cooperative interactions among embryos and role of growth factors. Proc Natl Acad Sci USA 1990; 87: 4756-4760.
162. Rappolee DA, Sturm KS, Behrendtsen O, Schultz GA, Pedersen RA, Werb Z. Insulin-like growth factor II acts through an endogenous growth pathway regulated by imprinting in early mouse embryos. Genes Dev 1992; 6: 939-952.
163. Larson RC, Ignotz GG, Currie WB. Transforming growth factor beta and basic fibroblast growth factor synergistically promote early bovine embryo development during the fourth cell cycle. Mol Reprod Dev 1992; 33: 432-435.
164. Larson RC, Ignotz GG, Currie WB. Platelet derived growth factor (PDGF) stimulates development of bovine embryos during the fourth cell cycle. Development 1992; 115: 821-826.
97
165. Cui XS, Lee JY, Choi SH, Kwon MS, Kim T, Kim NH. Mouse granulocyte-macrophage colony-stimulating factor enhances viability of porcine embryos in defined culture conditions. Anim Reprod Sci 2004; 84: 169-177.
166. Robertson SA, Sjoblom C, Jasper MJ, Norman RJ, Seamark RF. Granulocyte-macrophage colony-stimulating factor promotes glucose transport and blastomere viability in murine preimplantation embryos. Biol Reprod 2001; 64: 1206-1215.
167. de Moraes AA, Hansen PJ. Granulocyte-macrophage colony-stimulating factor promotes development of in vitro produced bovine embryos. Biol Reprod 1997; 57: 1060-1065.
168. Sjoblom C, Roberts CT, Wikland M, Robertson SA. Granulocyte-macrophage colony-stimulating factor alleviates adverse consequences of embryo culture on fetal growth trajectory and placental morphogenesis. Endocrinology 2005; 146: 2142-2153.
169. Tsai HD, Chang CC, Hsieh YY, Lo HY, Hsu LW, Chang SC. Recombinant human leukemia inhibitory factor enhances the development of preimplantation mouse embryo in vitro. Fertil Steril 1999; 71: 722-725.
170. Bhatt H, Brunet LJ, Stewart CL. Uterine expression of leukemia inhibitory factor coincides with the onset of blastocyst implantation. Proc Natl Acad Sci USA 1991; 88: 11408-11412.
171. Sawai K, Matsuzaki N, Okada T, Shimoya K, Koyama M, Azuma C, Saji F, Murata Y. Human decidual cell biosynthesis of leukemia inhibitory factor: regulation by decidual cytokines and steroid hormones. Biol Reprod 1997; 56: 1274-1280.
172. Polan ML, Simon C, Frances A, Lee BY, Prichard LE. Role of embryonic factors in human implantation. Hum Reprod 1995; 10 Suppl 2: 22-29.
173. Charnock-Jones DS, Sharkey AM, Fenwick P, Smith SK. Leukaemia inhibitory factor mRNA concentration peaks in human endometrium at the time of implantation and the blastocyst contains mRNA for the receptor at this time. J Reprod Fertil 1994; 101: 421-426.
174. Vogiagis D, Fry RC, Sandeman RM, Salamonsen LA. Leukaemia inhibitory factor in endometrium during the oestrous cycle, early pregnancy and in ovariectomized steroid-treated ewes. J Reprod Fertil 1997; 109: 279-288.
175. Oshima K, Watanabe H, Yoshihara K, Kojima T, Dochi O, Takenouchi N, Fukushima M, Komatsu M. Gene expression of leukemia inhibitory factor (LIF) and macrophage colony stimulating factor (M-CSF) in bovine endometrium during early pregnancy. Theriogenology 2003; 60: 1217-1226.
98
176. Kurzrock R, Estrov Z, Wetzler M, Gutterman JU, Talpaz M. LIF: not just a leukemia inhibitory factor. Endocr Rev 1991; 12: 208-217.
177. Stewart CL. The role of leukemia inhibitory factor (LIF) and other cytokines in regulating implantation in mammals. Ann N Y Acad Sci 1994; 734: 157-165.
178. Mitchell MH, Swanson RJ, Hodgen GD, Oehninger S. Enhancement of in vitro murine embryo development by recombinant leukemia inhibitory factor. J Soc Gynecol Investig 1994; 1: 215-219.
179. Stewart CL, Kaspar P, Brunet LJ, Bhatt H, Gadi I, Kontgen F, Abbondanzo SJ. Blastocyst implantation depends on maternal expression of leukaemia inhibitory factor. Nature 1992; 359: 76-79.
180. Fry RC, Batt PA, Fairclough RJ, Parr RA. Human leukemia inhibitory factor improves the viability of cultured ovine embryos. Biol Reprod 1992; 46: 470-474.
181. Yamanaka T, Amano T, Kudo T. Effect of the presence period of bovine leukemia inhibitory factor in culture medium on the development of in vitro fertilized bovine embryos. J Anim Sci 2001; 72: 285-290.
182. Saito S, Sawai K, Ugai H, Moriyasu S, Minamihashi A, Yamamoto Y, Hirayama H, Kageyama S, Pan J, Murata T, Kobayashi Y, Obata Y, Yokoyama KK. Generation of cloned calves and transgenic chimeric embryos from bovine embryonic stem-like cells. Biochem Biophys Res Commun 2003; 309: 104-113.
183. Mitalipova M, Beyhan Z, First NL. Pluripotency of bovine embryonic cell line derived from precompacting embryos. Cloning 2001; 3: 59-67.
184. Thomson JA, Itskovitz-Eldor J, Shapiro SS, Waknitz MA, Swiergiel JJ, Marshall VS, Jones JM. Embryonic stem cell lines derived from human blastocysts. Science 1998; 282: 1145-1147.
185. Amit M, Carpenter MK, Inokuma MS, Chiu CP, Harris CP, Waknitz MA, Itskovitz-Eldor J, Thomson JA. Clonally derived human embryonic stem cell lines maintain pluripotency and proliferative potential for prolonged periods of culture. Dev Biol 2000; 227: 271-278.
186. Reubinoff BE, Pera MF, Fong CY, Trounson A, Bongso A. Embryonic stem cell lines from human blastocysts: somatic differentiation in vitro. Nat Biotechnol 2000; 18: 399-404.
187. First NL, Sims MM, Park SP, Kent-First MJ. Systems for production of calves from cultured bovine embryonic cells. Reprod Fertil Dev 1994; 6: 553-562.
99
188. Talbot NC, Powell AM, Rexroad CE, Jr. In vitro pluripotency of epiblasts derived from bovine blastocysts. Mol Reprod Dev 1995; 42: 35-52.
189. Van Stekelenburg-Hamers AE, Van Achterberg TA, Rebel HG, Flechon JE, Campbell KH, Weima SM, Mummery CL. Isolation and characterization of permanent cell lines from inner cell mass cells of bovine blastocysts. Mol Reprod Dev 1995; 40: 444-454.
190. Vejlsted M, Avery B, Gjorret JO, Maddox-Hyttel P. Effect of leukemia inhibitory factor (LIF) on in vitro produced bovine embryos and their outgrowth colonies. Mol Reprod Dev 2005; 70: 445-454.
191. Foster GV, Baghdiantz A, Kumar MA, Slack E, Soliman HA, Macintyre I. Thyroid Origin of Calcitonin. Nature 1964; 202: 1303-1305.
192. Ding YQ, Zhu LJ, Bagchi MK, Bagchi IC. Progesterone stimulates calcitonin gene expression in the uterus during implantation. Endocrinology 1994; 135: 2265-2274.
193. Ding YQ, Bagchi MK, Bardin CW, Bagchi IC. Calcitonin gene expression in the rat uterus during pregnancy. Recent Prog Horm Res 1995; 50: 373-378.
194. Wang J, Rout UK, Bagchi IC, Armant DR. Expression of calcitonin receptors in mouse preimplantation embryos and their function in the regulation of blastocyst differentiation by calcitonin. Development 1998; 125: 4293-4302.
195. Zhu LJ, Bagchi MK, Bagchi IC. Attenuation of calcitonin gene expression in pregnant rat uterus leads to a block in embryonic implantation. Endocrinology 1998; 139: 330-339.
196. Force T, Bonventre JV, Flannery MR, Gorn AH, Yamin M, Goldring SR. A cloned porcine renal calcitonin receptor couples to adenylyl cyclase and phospholipase C. Am J Physiol 1992; 262: F1110-1115.
197. Albrandt K, Mull E, Brady EM, Herich J, Moore CX, Beaumont K. Molecular cloning of two receptors from rat brain with high affinity for salmon calcitonin. FEBS Lett 1993; 325: 225-232.
198. Sexton PM, Houssami S, Hilton JM, O'Keeffe LM, Center RJ, Gillespie MT, Darcy P, Findlay DM. Identification of brain isoforms of the rat calcitonin receptor. Mol Endocrinol 1993; 7: 815-821.
199. Houssami S, Findlay DM, Brady CL, Myers DE, Martin TJ, Sexton PM. Isoforms of the rat calcitonin receptor: consequences for ligand binding and signal transduction. Endocrinology 1994; 135: 183-190.
100
200. Rout UK, Krawetz SA, Armant DR. Ethanol-induced intracellular calcium mobilization rapidly alters gene expression in the mouse blastocyst. Cell Calcium 1997; 22: 463-474.
201. Lu KP, Means AR. Regulation of the cell cycle by calcium and calmodulin. Endocr Rev 1993; 14: 40-58.
202. Leach RE, Stachecki JJ, Armant DR. Development of in vitro fertilized mouse embryos exposed to ethanol during the preimplantation period: accelerated embryogenesis at subtoxic levels. Teratology 1993; 47: 57-64.
203. Stachecki JJ, Armant DR. Transient release of calcium from inositol 1,4,5-trisphosphate-specific stores regulates mouse preimplantation development. Development 1996; 122: 2485-2496.
204. Stojkovic M, Wolf E, Buttner M, Berg U, Charpigny G, Schmitt A, Brem G. Secretion of biologically active interferon tau by in vitro-derived bovine trophoblastic tissue. Biol Reprod 1995; 53: 1500-1507.
205. Ko Y, Lee CY, Ott TL, Davis MA, Simmen RC, Bazer FW, Simmen FA. Insulin-like growth factors in sheep uterine fluids: concentrations and relationship to ovine trophoblast protein-1 production during early pregnancy. Biol Reprod 1991; 45: 135-142.
206. Smith RM, Garside WT, Aghayan M, Shi CZ, Shah N, Jarett L, Heyner S. Mouse preimplantation embryos exhibit receptor-mediated binding and transcytosis of maternal insulin-like growth factor I. Biol Reprod 1993; 49: 1-12.
207. Imakawa K, Helmer SD, Nephew KP, Meka CS, Christenson RK. A novel role for GM-CSF: enhancement of pregnancy specific interferon production, ovine trophoblast protein-1. Endocrinology 1993; 132: 1869-1871.
208. de Moraes AA, Davidson JA, Fleming JG, Bazer FW, Edwards JL, Betts JG, Hansen PJ. Lack of effect of granulocyte-macrophage colony-stimulating factor on secretion of interferon-tau, other proteins, and prostaglandin E2 by the bovine and ovine conceptus. Domest Anim Endocrinol 1997; 14: 193-197.
209. Emond V, Fortier MA, Murphy BD, Lambert RD. Prostaglandin E2 regulates both interleukin-2 and granulocyte-macrophage colony-stimulating factor gene expression in bovine lymphocytes. Biol Reprod 1998; 58: 143-151.
210. Emond V, Asselin E, Fortier MA, Murphy BD, Lambert RD. Interferon-tau stimulates granulocyte-macrophage colony-stimulating factor gene expression in bovine lymphocytes and endometrial stromal cells. Biol Reprod 2000; 62: 1728-1737.
101
211. Fortin M, Ouellette MJ, Lambert RD. TGF-beta 2 and PGE2 in rabbit blastocoelic fluid can modulate GM-CSF production by human lymphocytes. Am J Reprod Immunol 1997; 38: 129-139.
212. Michael DD, Alvarez IM, Ocon OM, Powell AM, Talbot NC, Johnson SE, Ealy AD. Fibroblast growth factor-2 is expressed by the bovine uterus and stimulates interferon-tau production in bovine trophectoderm. Endocrinology 2006; 147: 3571-3579.
213. Rodina TM, Cooke FN, Hansen PJ, Ealy AD. Oxygen tension and medium type actions on blastocyst development and interferon-tau secretion in cattle. Anim Reprod Sci 2008; doi:10.1016/j.anireprosci.2008.02.014.
214. Bottcher RT, Niehrs C. Fibroblast growth factor signaling during early vertebrate development. Endocr Rev 2005; 26: 63-77.
215. Burgess WH, Maciag T. The heparin-binding (fibroblast) growth factor family of proteins. Annu Rev Biochem 1989; 58: 575-606.
216. Itoh N, Ornitz DM. Evolution of the Fgf and Fgfr gene families. Trends Genet 2004; 20: 563-569.
217. Itoh N, Ornitz DM. Functional evolutionary history of the mouse Fgf gene family. Dev Dyn 2008; 237: 18-27.
218. Powers CJ, McLeskey SW, Wellstein A. Fibroblast growth factors, their receptors and signaling. Endocr Relat Cancer 2000; 7: 165-197.
219. Goldfarb M. Functions of fibroblast growth factors in vertebrate development. Cytokine Growth Factor Rev 1996; 7: 311-325.
220. Ornitz DM, Itoh N. Fibroblast growth factors. Genome Biol. 2001; 2: REVIEWS3005.
221. Eswarakumar VP, Lax I, Schlessinger J. Cellular signaling by fibroblast growth factor receptors. Cytokine Growth Factor Rev 2005; 16: 139-149.
222. Gospodarowicz D. Purification of a fibroblast growth factor from bovine pituitary. J Biol Chem 1975; 250: 2515-2520.
223. Gospodarowicz D, Bialecki H, Greenburg G. Purification of the fibroblast growth factor activity from bovine brain. J Biol Chem 1978; 253: 3736-3743.
224. Gospodarowicz D. Localisation of a fibroblast growth factor and its effect alone and with hydrocortisone on 3T3 cell growth. Nature 1974; 249: 123-127.
102
225. Armelin HA. Pituitary extracts and steroid hormones in the control of 3T3 cell growth. Proc Natl Acad Sci USA 1973; 70: 2702-2706.
226. Johnson DE, Williams LT. Structural and functional diversity in the FGF receptor multigene family. Adv Cancer Res 1993; 60: 1-41.
227. Esch F, Baird A, Ling N, Ueno N, Hill F, Denoroy L, Klepper R, Gospodarowicz D, Bohlen P, Guillemin R. Primary structure of bovine pituitary basic fibroblast growth factor (FGF) and comparison with the amino-terminal sequence of bovine brain acidic FGF. Proc Natl Acad Sci USA 1985; 82: 6507-6511.
228. Gimenez-Gallego G, Rodkey J, Bennett C, Rios-Candelore M, DiSalvo J, Thomas K. Brain-derived acidic fibroblast growth factor: complete amino acid sequence and homologies. Science 1985; 230: 1385-1388.
229. Mignatti P, Morimoto T, Rifkin DB. Basic fibroblast growth factor, a protein devoid of secretory signal sequence, is released by cells via a pathway independent of the endoplasmic reticulum-Golgi complex. J Cell Physiol 1992; 151: 81-93.
230. Miller DL, Ortega S, Bashayan O, Basch R, Basilico C. Compensation by fibroblast growth factor 1 (FGF1) does not account for the mild phenotypic defects observed in FGF2 null mice. Mol Cell Biol 2000; 20: 2260-2268.
231. Hebert JM, Rosenquist T, Gotz J, Martin GR. FGF5 as a regulator of the hair growth cycle: evidence from targeted and spontaneous mutations. Cell 1994; 78: 1017-1025.
232. Sleeman M, Fraser J, McDonald M, Yuan S, White D, Grandison P, Kumble K, Watson JD, Murison JG. Identification of a new fibroblast growth factor receptor, FGFR5. Gene 2001; 271: 171-182.
233. Lee PL, Johnson DE, Cousens LS, Fried VA, Williams LT. Purification and complementary DNA cloning of a receptor for basic fibroblast growth factor. Science 1989; 245: 57-60.
234. Schlessinger J. Cell signaling by receptor tyrosine kinases. Cell 2000; 103: 211-225.
235. Hunter T. Signaling--2000 and beyond. Cell 2000; 100: 113-127.
236. Kim I, Moon S, Yu K, Kim U, Koh GY. A novel fibroblast growth factor receptor-5 preferentially expressed in the pancreas(1). Biochim Biophys Acta 2001; 1518: 152-156.
103
237. Ornitz, DM, Xu J, Colvin JS, McEwen DG, MacArthur CA, Coulier F, Gao, G, Goldfarb, M. Receptor Specificity of the Fibroblast Growth Factor Family. J Biol Chem 1996; 271: 15292-15297.
238. Vainikka S, Partanen J, Bellosta P, Coulier F, Birnbaum D, Basilico C, Jaye M, Alitalo K. Fibroblast growth factor receptor-4 shows novel features in genomic structure, ligand binding and signal transduction. EMBO J 1992; 11: 4273-4280.
239. Johnson DE, Lu J, Chen H, Werner S, Williams LT. The human fibroblast growth factor receptor genes: a common structural arrangement underlies the mechanisms for generating receptor forms that differ in their third immunoglobulin domain. Mol Cell Biol 1991; 11: 4627-4634.
240. Werner S, Duan DS, de Vries C, Peters KG, Johnson DE, Williams LT. Differential splicing in the extracellular region of fibroblast growth factor receptor 1 generates receptor variants with different ligand-binding specificities. Mol Cell Biol 1992; 12: 82-88.
241. Lin X, Buff EM, Perrimon N, Michelson AM. Heparan sulfate proteoglycans are essential for FGF receptor signaling during Drosophila embryonic development. Development 1999; 126: 3715-3723.
242. Ornitz DM, Yayon A, Flanagan JG, Svahn CM, Levi E, Leder P. Heparin is required for cell-free binding of basic fibroblast growth factor to a soluble receptor and for mitogenesis in whole cells. Mol Cell Biol 1992; 12: 240-247.
243. Yayon A, Klagsbrun M, Esko JD, Leder P, Ornitz DM. Cell surface, heparin-like molecules are required for binding of basic fibroblast growth factor to its high affinity receptor. Cell 1991; 64: 841-848.
244. Spivak-Kroizman T, Lemmon MA, Dikic I, Ladbury JE, Pinchasi D, Huang J, Jaye M, Crumley G, Schlessinger J, Lax I. Heparin-induced oligomerization of FGF molecules is responsible for FGF receptor dimerization, activation, and cell proliferation. Cell 1994; 79: 1015-1024.
245. Robinson ML, MacMillan-Crow LA, Thompson JA, Overbeek PA. Expression of a truncated FGF receptor results in defective lens development in transgenic mice. Development 1995; 121: 3959-3967.
246. Ostrovsky O, Berman B, Gallagher J, Mulloy B, Fernig DG, Delehedde M, Ron D. Differential effects of heparin saccharides on the formation of specific fibroblast growth factor (FGF) and FGF receptor complexes. J Biol Chem 2002; 277: 2444-2453.
104
247. Chellaiah AT, McEwen DG, Werner S, Xu J, Ornitz DM. Fibroblast growth factor receptor (FGFR) 3. Alternative splicing in immunoglobulin-like domain III creates a receptor highly specific for acidic FGF/FGF-1. J Biol Chem 1994; 269: 11620-11627.
248. Grundker C, Kirchner C. Uterine fibroblast growth factor-2 and embryonic fibroblast growth factor receptor-1 at the beginning of gastrulation in the rabbit. Anat Embryol (Berl) 1996; 194: 169-175.
249. Yeh J, Osathanondh R, Villa-Komaroff L. Expression of messenger ribonucleic acid for epidermal growth factor receptor and its ligands, epidermal growth factor and transforming growth factor-alpha, in human first- and second-trimester fetal ovary and uterus. Am J Obstet Gynecol 1993; 168: 1569-1573.
250. Eberwine J, Yeh H, Miyashiro K, Cao YX, Nair S, Finnell R, Zettel M, Coleman P. Analysis of Gene-Expression in Single Live Neurons. Proc Natl Acad Sci USA 1992; 89: 3010-3014.
251. Fujimoto J, Hori M, Ichigo S, Tamaya T. Expression of basic fibroblast growth factor and its mRNA in uterine endometrium during the menstrual cycle. Gynecol Endocrinol 1996; 10: 193-197.
252. Rusnati M, Casarotti G, Pecorelli S, Ragnotti G, Presta M. Basic fibroblast growth factor in ovulatory cycle and postmenopausal human endometrium. Growth Factors 1990; 3: 299-307.
253. Cordon-Cardo C, Vlodavsky I, Haimovitz-Friedman A, Hicklin D, Fuks Z. Expression of basic fibroblast growth factor in normal human tissues. Lab Invest 1990; 63: 832-840.
254. Samathanam CA, Adesanya OO, Zhou J, Wang J, Bondy CA. Fibroblast growth factors 1 and 2 in the primate uterus. Biol Reprod 1998; 59: 491-496.
255. Gupta A, Bazer FW, Jaeger LA. Immunolocalization of acidic and basic fibroblast growth factors in porcine uterine and conceptus tissues. Biol Reprod 1997; 56: 1527-1536.
256. Carlone DL, Rider V. Embryonic modulation of basic fibroblast growth factor in the rat uterus. Biol Reprod 1993; 49: 653-665.
257. Ocon-Grove OM, Cooke FN, Alvarez IM, Johnson SE, Ott TL, Ealy AD. Ovine endometrial expression of fibroblast growth factor (FGF) 2 and conceptus expression of FGF receptors during early pregnancy. Domest Anim Endocrinol 2008; 34: 135-145.
105
258. Roberts RM, Ealy AD, Alexenko AP, Han CS, Ezashi T. Trophoblast interferons. Placenta 1999; 20: 259-264.
259. Daniels R, Hall V, Trounson AO. Analysis of gene transcription in bovine nuclear transfer embryos reconstructed with granulosa cell nuclei. Biol Reprod 2000; 63: 1034-1040.
260. Lazzari G, Wrenzycki C, Herrmann D, Duchi R, Kruip T, Niemann H, Galli C. Cellular and molecular deviations in bovine in vitro-produced embryos are related to the large offspring syndrome. Biol Reprod 2002; 67: 767-775.
261. Gospodarowicz D, Ferrara N, Schweigerer L, Neufeld G. Structural characterization and biological functions of fibroblast growth factor. Endocr Rev 1987; 8: 95-114.
262. Baird A, Walicke PA. Fibroblast growth factors. Br Med Bull 1989; 45: 438-452.
263. Hrabe dA, Grundker C, Herrmann BG, Kispert A, Kirchner C. Promotion of gastrulation by maternal growth factor in cultured rabbit blastocysts. Cell Tissue Res 1995; 282: 147-154.
264. Haimovici F, Anderson DJ. Effects of growth factors and growth factor-extracellular matrix interactions on mouse trophoblast outgrowth in vitro. Biol Reprod 1993; 49: 124-130.
265. Taniguchi F, Harada T, Yoshida S, Iwabe T, Onohara Y, Tanikawa M, Terakawa N. Paracrine effects of bFGF and KGF on the process of mouse blastocyst implantation. Mol Reprod Dev 1998; 50: 54-62.
266. Lim JM, Hansel W. Roles of growth factors in the development of bovine embryos fertilized in vitro and cultured singly in a defined medium. Reprod Fertil Dev 1996; 8: 1199-1205.
267. Gospodarowicz D, Thakral KK. Production a corpus luteum angiogenic factor responsible for proliferation of capillaries and neovascularization of the corpus luteum. Proc Natl Acad Sci USA 1978; 75: 847-851.
268. Berisha B, Sinowatz F, Schams D. Expression and localization of fibroblast growth factor (FGF) family members during the final growth of bovine ovarian follicles. Mol Reprod Dev 2004; 67: 162-171.
269. Grazul-Bilska AT, Navanukraw C, Johnson ML, Vonnahme KA, Ford SP, Reynolds LP, Redmer DA. Vascularity and expression of angiogenic factors in bovine dominant follicles of the first follicular wave. J Anim Sci 2007; 85: 1914-1922.
106
270. Seghezzi G, Patel S, Ren CJ, Gualandris A, Pintucci G, Robbins ES, Shapiro RL, Galloway AC, Rifkin DB, Mignatti P. Fibroblast growth factor-2 (FGF-2) induces vascular endothelial growth factor (VEGF) expression in the endothelial cells of forming capillaries: an autocrine mechanism contributing to angiogenesis. J Cell Biol 1998; 141: 1659-1673.
271. Weylie B, Zhu J, Singh U, Ambrus S, Forough R. Phosphatidylinositide 3-kinase is important in late-stage fibroblast growth factor-1-mediated angiogenesis in vivo. J Vasc Res 2006; 43: 61-69.
272. Connolly DT, Stoddard BL, Harakas NK, Feder J. Human fibroblast-derived growth factor is a mitogen and chemoattractant for endothelial cells. Biochem Biophys Res Commun 1987; 144: 705-712.
273. Neufeld G, Cohen T, Gengrinovitch S, Poltorak Z. Vascular endothelial growth factor (VEGF) and its receptors. FASEB J 1999; 13: 9-22.
274. Dvorak HF, Nagy JA, Feng D, Brown LF, Dvorak AM. Vascular permeability factor/vascular endothelial growth factor and the significance of microvascular hyperpermeability in angiogenesis. Curr Top Microbiol Immunol 1999; 237: 97-132.
275. Ferrara N. Vascular endothelial growth factor: molecular and biological aspects. Curr Top Microbiol Immunol 1999; 237: 1-30.
276. Folkman J, Klagsbrun M. Angiogenic factors. Science 1987; 235: 442-447.
277. Thomas KA. Fibroblast growth factors. FASEB J 1987; 1: 434-440.
278. Thomas KA, Gimenez-Gallego G. Fibroblast growth factors: broad spectrum mitogens with potent angiogenic activity. Trends Biochem Sci 1986; 11: 4.
279. Talbot NC, Caperna TJ, Edwards JL, Garrett W, Wells KD, Ealy AD. Bovine blastocyst-derived trophectoderm and endoderm cell cultures: interferon tau and transferrin expression as respective in vitro markers. Biol Reprod 2000; 62: 235-247.
280. Brigstock DR, Heap RB, Brown KD. Polypeptide growth factors in uterine tissues and secretions. J Reprod Fertil 1989; 85: 747-758.
281. Chen C, Spencer TE, Bazer FW. Fibroblast growth factor-10: a stromal mediator of epithelial function in the ovine uterus. Biol Reprod 2000; 63: 959-966.
282. Ornitz DM. FGFs, heparan sulfate and FGFRs: complex interactions essential for development. BioEssays 2000; 22: 108-112.
107
283. Igarashi M, Finch PW, Aaronson SA. Characterization of recombinant human fibroblast growth factor (FGF)-10 reveals functional similarities with keratinocyte growth factor (FGF-7). J Biol Chem 1998; 273: 13230-13235.
284. Emoto H, Tagashira S, Mattei MG, Yamasaki M, Hashimoto G, Katsumata T, Negoro T, Nakatsuka M, Birnbaum D, Coulier F, Itoh N. Structure and expression of human fibroblast growth factor-10. J Biol Chem 1997; 272: 23191-23194.
285. Sekine K, Ohuchi H, Fujiwara M, Yamasaki M, Yoshizawa T, Sato T, Yagishita N, Matsui D, Koga Y, Itoh N, Kato S. Fibroblast growth factor-10 is essential for limb and lung formation. Nat Genet 1999; 21: 138-141.
286. Yamasaki M, Miyake A, Tagashira S, Itoh N. Structure and expression of the rat mRNA encoding a novel member of the fibroblast growth factor family. J Biol Chem 1996; 271: 15918-15921.
287. Metzger RJ, Krasnow MA. Genetic control of branching morphogenesis. Science 1999; 284: 1635-1639.
288. Beer HD, Florence C, Dammeier J, McGuire L, Werner S, Duan DR. Mouse fibroblast growth factor 10: cDNA cloning, protein characterization, and regulation of mRNA expression. Oncogene 1997; 15: 2211-2218.
289. Lu W, Luo Y, Kan M, McKeehan WL. Fibroblast growth factor-10. A second candidate stromal to epithelial cell andromedin in prostate. J Biol Chem 1999; 274: 12827-12834.
290. Bellusci S, Grindley J, Emoto H, Itoh N, Hogan BL. Fibroblast growth factor 10 (FGF10) and branching morphogenesis in the embryonic mouse lung. Development 1997; 124: 4867-4878.
291. Rubin JS, Bottaro DP, Chedid M, Miki T, Ron D, Cheon G, Taylor WG, Fortney E, Sakata H, Finch PW, et al. Keratinocyte growth factor. Cell Biol Int 1995; 19: 399-411.
292. Koji T, Chedid M, Rubin JS, Slayden OD, Csaky KG, Aaronson SA, Brenner RM. Progesterone-dependent expression of keratinocyte growth factor mRNA in stromal cells of the primate endometrium: keratinocyte growth factor as a progestomedin. J Cell Biol 1994; 125: 393-401.
293. Satterfield MC, Hayashi K, Song G, Black SG, Bazer FW, Spencer TE. Progesterone Regulates FGF10, MET, IGFBP1, and IGFBP3 in the Endometrium of the Ovine Uterus. Biol Reprod 2008; doi:10.1095/biolreprod.108.071787.
108
294. Ka H, Jaeger LA, Johnson GA, Spencer TE, Bazer FW. Keratinocyte growth factor is up-regulated by estrogen in the porcine uterine endometrium and functions in trophectoderm cell proliferation and differentiation. Endocrinology 2001; 142: 2303-2310.
295. Ka H, Spencer TE, Johnson GA, Bazer FW. Keratinocyte growth factor: expression by endometrial epithelia of the porcine uterus. Biol Reprod 2000; 62: 1772-1778.
296. Brenner R, Slaydon O, Koji T, Izumi M, Chedid M, Csaky K, Rubin J. Hormonal regulation of the paracrine growth factors HGF and KGF in the endometrium of the rhesus macaque In: Stock G, Habenicht UF (eds) The Endometrium as a Target for Contraception. Berlin: Springer-Verlag 1997: 21–49.
297. Pfarrer C, Weise S, Berisha B, Schams D, Leiser R, Hoffmann B, Schuler G. Fibroblast Growth Factor (FGF)-1, FGF2, FGF7 and FGF receptors are uniformly expressed in trophoblast giant cells during restricted trophoblast invasion in cows. Placenta 2006; 27: 758-770.
298. Winkles JA, Alberts GF, Chedid M, Taylor WG, DeMartino S, Rubin JS. Differential expression of the keratinocyte growth factor (KGF) and KGF receptor genes in human vascular smooth muscle cells and arteries. J Cell Physiol 1997; 173: 380-386.
299. Niswander L, Martin GR. Fgf-4 expression during gastrulation, myogenesis, limb and tooth development in the mouse. Development 1992; 114: 755-768.
300. Rappolee DA, Basilico C, Patel Y, Werb Z. Expression and function of FGF-4 in peri-implantation development in mouse embryos. Development 1994; 120: 2259-2269.
301. Feldman B, Poueymirou W, Papaioannou VE, DeChiara TM, Goldfarb M. Requirement of FGF-4 for postimplantation mouse development. Science 1995; 267: 246-249.
302. Avilion AA, Nicolis SK, Pevny LH, Perez L, Vivian N, Lovell-Badge R. Multipotent cell lineages in early mouse development depend on SOX2 function. Genes Dev 2003; 17: 126-140.
303. Ralston A, Rossant J. How signaling promotes stem cell survival: trophoblast stem cells and Shp2. Dev Cell 2006; 10: 275-276.
304. Kunath T, Strumpf D, Rossant J. Early trophoblast determination and stem cell maintenance in the mouse--a review. Placenta 2004; 25 Suppl A: S32-S38.
305. Arman E, Haffner-Krausz R, Chen Y, Heath JK, Lonai P. Targeted disruption of fibroblast growth factor (FGF) receptor 2 suggests a role for FGF signaling in pregastrulation mammalian development. Proc Natl Acad Sci USA 1998; 95: 5082-5087.
109
306. Hughes M, Dobric N, Scott IC, Su L, Starovic M, St Pierre B, Egan SE, Kingdom JC, Cross JC. The Hand1, Stra13 and Gcm1 transcription factors override FGF signaling to promote terminal differentiation of trophoblast stem cells. Dev Biol 2004; 271: 26-37.
307. Kubisch HM, Larson MA, Kiesling DO. Control of interferon-tau secretion by in vitro-derived bovine blastocysts during extended culture and outgrowth formation. Mol Reprod Dev 2001; 58: 390-397.
308. Shimada A, Nakano H, Takahashi T, Imai K, Hashizume K. Isolation and characterization of a bovine blastocyst-derived trophoblastic cell line, BT-1: development of a culture system in the absence of feeder cell. Placenta 2001; 22: 652-662.
309. Talbot NC, Powell AM, Camp M, Ealy AD. Establishment of a bovine blastocyst-derived cell line collection for the comparative analysis of embryos created in vivo and by in vitro fertilization, somatic cell nuclear transfer, or parthenogenetic activation. In Vitro Cell Dev Biol An 2007; 43: 59-71.
310. Gifford CA, Assiri AM, Satterfield MC, Spencer TE, Ott TL. Receptor transporter protein 4 (RTP4) in endometrium, ovary, and peripheral blood leukocytes of pregnant and cyclic ewes. Biol Reprod 2008; 79: 518-524.
311. Wang BT, Goff AK. Interferon-tau stimulates secretion of macrophage migration inhibitory factor from bovine endometrial epithelial cells. Biol Reprod 2002; 66: 118-119.
312. Austin KJ, Ward SK, Teixeira MG, Dean VC, Moore DW, Hansen TR. Ubiquitin cross-reactive protein is released by the bovine uterus in response to interferon during early pregnancy. Biol Reprod 1996; 54: 600-606.
313. Roberts RM. Embryonic loss and conceptus interferon production. In: Strauss JF, III, Lyttle CR (eds) Uterine and Embryonic Factors in Early Pregnancy. New York, NY Plenum Press; 1991: 21-31.
314. Thatcher WW, Staples CR, Danet-Desnoyers G. Embryo health and mortality in sheep and cattle. J An Sci 1994; 72: 16-30.
315. Thatcher WW, Guzeloglu A, Mattos R, Binelli M, Hansen TR, Pru JK. Uterine-conceptus interactions and reproductive failure in cattle. Theriogenology 2001; 56: 1435-1450.
316. Kubisch HM, Larson MA, Roberts RM. Relationship between age of blastocyst formation and interferon-tau secretion by in vitro-derived bovine embryos. Mol Reprod Dev 1998; 49: 254-260.
110
317. Robinson RS, Fray MD, Wathes DC, Lamming GE, Mann GE. In vivo expression of interferon tau mRNA by the embryonic trophoblast and uterine concentrations of interferon tau protein during early pregnancy in the cow. Mol Reprod Dev 2006; 73: 470-474.
318. Mann GE, Fray MD, Lamming GE. Effects of time of progesterone supplementation on embryo development and interferon-tau production in the cow. Vet J 2006; 171: 500-503.
319. Ealy AD, Larson SF, Liu L, Alexenko AP, Winkelman GL, Kubisch HM, Bixby JA, Roberts RM. Polymorphic forms of expressed bovine interferon-tau genes: relative transcript abundance during early placental development, promoter sequences of genes and biological activity of protein products. Endocrinology 2001; 142: 2906-2915.
320. Roberts RM, Ezashi T, Das P. Trophoblast gene expression: transcription factors in the specification of early trophoblast. Reprod Biol Endocrinol 2004; 2: 47.
321. Roberts RM, Ezashi T, Rosenfeld CS, Ealy AD, Kubisch HM. Evolution of the interferon tau genes and their promoters, and maternal-trophoblast interactions in control of their expression. Reprod Suppl 2003; 61: 239-251.
322. Haimovici F, Hill JA, Anderson DJ. The effects of soluble products of activated lymphocytes and macrophages on blastocyst implantation events in vitro. Biol Reprod 1991; 44: 69-75.
323. Tanaka S, Kunath T, Hadjantonakis AK, Nagy A, Rossant J. Promotion of trophoblast stem cell proliferation by FGF4. Science 1998; 282: 2072-2075.
324. Hughes M, Dobric N, Scott IC, Su L, Starovic M, St-Pierre B, Egan SE, Kingdom JC, Cross JC. The Hand1, Stra13 and Gcm1 transcription factors override FGF signaling to promote terminal differentiation of trophoblast stem cells. Dev Biol 2004; 271: 26-37.
325. Wilkinson DG, Bhatt S, McMahon AP. Expression pattern of the FGF-related proto-oncogene int-2 suggests multiple roles in fetal development. Development 1989; 105: 131-136.
326. Komi-Kuramochi A, Kawano M, Oda Y, Asada M, Suzuki M, Oki J, Imamura T. Expression of fibroblast growth factors and their receptors during full-thickness skin wound healing in young and aged mice. J Endocrinol 2005; 186: 273-289.
327. Umemori H, Linhoff MW, Ornitz DM, Sanes JR. FGF22 and its close relatives are presynaptic organizing molecules in the mammalian brain. Cell 2004; 118: 257-270.
111
328. Degrelle SA, Campion E, Cabau C, Piumi F, Reinaud P, Richard C, Renard JP, Hue I. Molecular evidence for a critical period in mural trophoblast development in bovine blastocysts. Dev Biol 2005; 288: 448-460.
329. Alexopoulos N, Maddox-Hyttel P, Tveden-Nyborg P, D'Cruz N, Tecirlioglu T, Cooney M, Schauser K, Holland M, French A. Developmental disparity between in vitro produced and somatic cell nuclear transfer bovine days 14 and 21 embryos: implications for embryonic loss. Reproduction 2008; doi: 10.1530/REP-07-0392.
330. Fischer-Brown AE, Lindsey BR, Ireland FA, Northey DL, Monson RL, Clark SG, Wheeler MB, Kesler DJ, Lane SJ, Weigel KA, Rutledge JJ. Embryonic disc development and subsequent viability of cattle embryos following culture in two media under two oxygen concentrations. Reprod Fertil Dev 2004; 16: 787-793.
331. Chen Y, Antoniou E, Liu Z, Hearne LB, Roberts RM. A microarray analysis for genes regulated by interferon-{tau} in ovine luminal epithelial cells. Reproduction 2007; 134: 123-135.
332. Bilby TR, Block J, do Amaral BC, Sa Filho O, Silvestre FT, Hansen PJ, Staples CR, Thatcher WW. Effects of dietary unsaturated fatty acids on oocyte quality and follicular development in lactating dairy cows in summer. J Dairy Sci 2006; 89: 3891-3903.
333. Sartori R, Souza AH, Guenther JN, Caraviello DZ, Geiger LN, Schenk JL, Wiltbank MC. Fertilization rate and embryo quality in superovulated Holstein heifers artificially inseminated with X-sorted or unsorted sperm. Anim Reprod 2004; 1: 86-90.
334. Rivera RM, Hansen PJ. Development of cultured bovine embryos after exposure to high temperatures in the physiological range. Reproduction 2001; 121: 107-115.
335. Moreira F, Paula-Lopes FF, Hansen PJ, Badinga L, Thatcher WW. Effects of growth hormone and insulin-like growth factor-I on development of in vitro derived bovine embryos. Theriogenology 2002; 57: 895-907.
336. Paula-Lopes FF, Hansen PJ. Apoptosis is an adaptive response in bovine preimplantation embryos that facilitates survival after heat shock. Biochem Biophys Res Commun 2002; 295: 37-42.
337. Cikos S, Bukovska A, Koppel J. Relative quantification of mRNA: comparison of methods currently used for real-time PCR data analysis. BMC Mol Biol 2007; 8: 113.
338. Larionov A, Krause A, Miller W. A standard curve based method for relative real time PCR data processing. BMC Bioinformatics 2005; 6: 62.
112
113
BIOGRAPHICAL SKETCH
Flavia Nesti Tayar Cooke was born and raised in Campinas, Sao Paulo, Brazil, where she
grew up with sisters Luiza and Patricia (in memoriam), and parents Roberto and Sonia. Since
childhood she developed a passionate interest for animals and wish one day she would be able to
work with them. Flavia moved to Botucatu, Sao Paulo in 2002 to start her Animal Sciences
undergraduate program at the Sao Paulo State University (UNESP), which is ranked, as of 2008,
the Top 1 program in the nation. Her focus has always been on dairy cattle.
Flavia moved to Gainesville, FL in January 2006 to complete the internship program
required in order to receive her B.S. in Animal Sciences, which happened in July 2006, working
with Dr. William Thatcher and Dr. Alan Ealy. After graduation, she accepted a position to
continue her work with Dr. Alan Ealy as a graduate research assistant at the University of
Florida, pursuing her Master of Science in Animal Molecular and Cellular Biology.
Flavia is married to Dr. Reinaldo Cooke, who is now applying for Assistant Professor
positions in several universities in the US. They are expecting their first child due in May 2009.
