1

Supplementary information

An integrated microfluidic system for rapid detection and

multiple subtyping of influenza A viruses by using glycan-

coated magnetic beads and RT-PCR

Kao-Mai Shena, Narayana Murthy Sabbavarapub, Chien-Yu Fua, Jia-Tsrong Janb, Jen-

Ren Wangc, Shang-Cheng Hungb,d* and Gwo-Bin Leea,e,f*

aDepartment of Power Mechanical Engineering, National Tsing Hua University,

Hsinchu 30013, Taiwan

bGenomics Research Center, Academia Sinica, Taipei 11529, Taiwan

cDepartment of Medical Laboratory Science and Biotechnology, College of Medicine,

National Cheng Kung University, Tainan 701, Taiwan

dDepartment of Applied Science, National Taitung University, 369, Section 2,

University Road, Taitung 95092, Taiwan

eInstitute of Biomedical Engineering, National Tsing Hua University, Hsinchu 30013,

Taiwan

fInstitute of NanoEngineering and Microsystems, National Tsing Hua University,

Hsinchu 30013, Taiwan

Electronic Supplementary Material (ESI) for Lab on a Chip.This journal is © The Royal Society of Chemistry 2019

2

Supplementary material table of contents

I. Working principle of the diagnostic assay.……………………………... 4

Supplementary table 1 Experimental procedures on the microfluidic system...…...............................................................

4

II. Influenza virus strains and their preparation……………………...….. 5

Supplementary table 2 The initial titers of influenza virus stocks............... 5

Supplementary fig. 1 The real-time PCR standard curves for quantification of virus plasmid copy numbers.…....

5

III. Glycans and magnetic bead coating.…………………………………..... 6

Supplementary table 3 The chemical structure of the glycans SCH-42, SNM-01-139, and DJR-03-99................................

6

Supplementary fig. 2 Capture abilities of three glycan-coated magnetic beads (SNM-01-139, SCH-42, and DJR-03-99) for the InfA/ H1N1 virus on-chip and with a benchtop protocol……..…......................................

7

Supplementary fig. 3 Capture abilities of two kinds of SNM-01-139-coated magnetic beads (Dynabeads MyOne™ Streptavidin C1 and T1) with 10-fold serial dilutions of InfA/H1N1 virus stocks…...................................................................

7

IV. Chip design, fabrication, and characterization……………………......... 8

4.1.1 Pumping rate........................................................... 84.1.2 Pumping precision................................................... 94.1.3 Mixing index............................................................ 10

V. One-step RT-PCR protocol............................................................................. 12

Supplementary table 4 Sequences of primers used in this study ................. 12Supplementary fig. 4 Specificity tests of the subtyping primers for viral RNA

of InfA/H1N1, InfA/H3N2, InfA/H5N1, InfA/H5N2, InfA/H7N9, InfB/Victoria and InfB/ Yamagata viruses, respectively, by performing benchtop one-step RT-PCR

and gel electrophoresis..................................

13

VI. Sensitivity tests............................................................................................ 14

3

Supplementary fig. 5 The LOD results of this microfluidic system with SNM-01-139-coated beads and the HA-specific and NA-specific subtyping primers.........................

VII. Supplementary references............................................................................ 17

4

I. Working principle of the diagnostic assay

Supplementary table 1. Experimental procedures on the microfluidic system.

5

II. Influenza virus strains and their preparation

Supplementary table 2. The initial titers of influenza virus stocks were quantified by

a plaque assay (yielding the number of plaque forming units [PFU]),1 a hemagglutinin

assay (yielding the number of hemagglutinin units [HAU]),2 or by directly quantifying

viral RNA copy numbers as described in the main text. Error terms represent standard

deviation (n=3).

Virus strains HAU titer(HAU/mL)

PFU titer (PFU/mL)

103 copy number/L

InfA/H1N1/105M049 64 4.25 x 1055

8096±1582InfA/H3N2/16028588 32 8.50 x 104

44075±857

InfA/Vietnam/1194/2004 NIBRG-14 (H5N1) - 5.00 x 1066

622±23InfA/Taiwan/duck/30-2/2005 (H5N2) - 1.00 x 107

7382±1

InfA/Shanghai/2/2013 IDCDC-RG32A (H7N9) - 2.00 x 1077

2973±266InfB/105M044 (Victoria strain) 64 3.50 x 106

61757±764

InfB/17M50121 (Yamagata strain) 128 7.75 x 1066

4939±53

Supplementary fig. 1. Real-time PCR standard curves for quantification of virus

plasmid copy numbers. Real-time PCR-derived threshold cycle (Ct) as a function of

6

InfA (a) and InfB (b) plasmid copy number (n=2; standard deviation error bars are

generally not visible due to high technical precision.).

III. Glycans and magnetic beads coating

Supplementary table 3

The chemical structures of the glycans SCH-42, SNM-01-139, and DJR-03-99.

Glycan Structural formula

SCH-42

SNM-01-139

DJR-03-99

7

Supplementary fig. 2. Capture abilities of three glycan-coated magnetic beads (SNM-

01-139, SCH-42, and DJR-03-99) for the InfA/H1N1 virus on-chip and by using a

benchtop protocol. Error bars represent standard deviation (n=2).

Supplementary fig. 3. Capture abilities of two kinds of SNM-01-139-coated

magnetic beads (Dynabeads MyOne™ Streptavidin C1 and T1) with 10-fold serial

dilutions of InfA/H1N1 virus stocks. Error bars represent standard deviation (n=4).

8

IV. Chip design, fabrication, and characterization

4.1 Characterization of the chip’s performance

4.1.1 Pumping rate

The chip’s pneumatic micropumps with several pneumatic normally-closed

microvalves were precisely controlled by the custom-made control system described in

the main text. In order to evaluate the transport efficiency of the consecutive

micropumps, the pumping rate was measured under different operating conditions as

described in the main text. Water (ddH2O) was used as the test liquid, and it was

transported from the RT-PCR reagent loading chambers to the middle RT-PCR reaction

chambers by the consecutive micropumps. The pumping rates were measured at three

operating frequencies (0.5, 1.0, and 2.0 Hz) at each of six applied negative gauge

pressures (-6.7, -13.3, -26.7, -40.0, -53.3, and -66.7 kPa) at a constantly applied positive

gauge pressure (13.3 kPa). Moreover, the working time of the three steps of the

microvalves was set to 3 s, so the total operating times for each round of fluid transport

enacted by the micropumps at 0.5, 1.0, and 2.0 Hz were 5, 4, and 3.5 s, respectively.

9

4.1.2 Pumping precision

In order to evaluate the fluid transport precision of the chip’s micropumps, the

pumping uniformity was measured under different operating conditions. Water

(ddH2O) was used as the test liquid, and it was transported from the right micromixer

to the middle reaction chambers by the arrayed micropumps. The pumping precision

was measured at four applied negative gauge pressures (-40.0, -53.3, -66.7, and -80.0

kPa) at a constant applied positive gauge pressure (13.3 kPa). Moreover, the working

times of the three steps of the microvalves and the one step of the consecutive

micropumps were set to 3 and 5 s, respectively; this resulted in a total operating time

for each round of transport of 8 s.

10

4.1.3 Mixing index

For assessing the mixing performance of the open-type micromixer, the mixing

index was calculated3 at three frequencies (0.5, 1.0 or 2.0 Hz) and five applied negative

gauge pressures (-13.3, -26.7, -40.0, -53.3, or -66.7 kPa) at a constant applied positive

gauge pressure of 13.3 kPa. Then, 2 μL of blue ink were added to 100 μL of ddH2O to

visualize the mixing efficiency of the virus sample and the glycan-coated beads, and

the performance was recorded by a camera (FDR-AX40, SONY). Digital imaging

techniques were analyzed by ImageJ (National Institutes of Health, USA) to calculate

the mixing index (σ) with the following equation (eq. 1):

σ(A) = × 100% (eq. 1)

(1 -

∫A

|C + - C +∞ |dA

∫A

|C +0 - C +

∞ |dA)where C+ is the local normalized concentration distributed across the cross-sectional

area of the mixing chamber (A), and and are the concentrations associated with C +0 C +

∞

the completely unmixed and completely mixed states, respectively. σ ranges from 0%

(completely unmixed) to 100% (completely mixed).

11

V. One-step RT-PCR protocol

Supplementary table 4. Sequences of primers used in this study.

PrimersForward/

ReverseSequences (5 3) References

Universal InfA

Forward

Reverse

CAGRTACTGGGCHATAAGRAC

GCATTGTCTCCGAAGAAATAAG[4]

Universal InfB

Forward

Reverse

AAATACGGTGGATTAAATAAAAGCAA

CCAGCAATAGCTCCGAAGAAA[5]

InfA/H1 subtype

Forward

Reverse

ACACAATATGTATAGGYTAHCATGC

GAGTGTGTYACTGTYACATTCTT[6]

InfA/H3 subtype

Forward

Reverse

TGGATTTCCTTTGCCATATCATG

ATRCACTCAAATGCAAATGTTGC[6]

InfA/H5 subtype

Forward

Reverse

ACATATGACTACCCACARTATTCAG

AGACCAGCTAYCATGATTGC[6]

InfA/H7 subtype

Forward

Reverse

AAATTGAGCAGYGGMTACAARGA

AAAACCARTCCCATTRCAATGGC[6]

InfA/N1 subtype

Forward

Reverse

CCTTGYTTCTGGGTTGA

ACCGTCTGGCCAAGACCA[6]

InfA/N2 subtype

Forward

Reverse

AGTCTGGTGGACYTCAAAYAG

AATTGCGAAAGCTTATATAGVCAT[6]

InfA/N9 subtype

Forward

Reverse

AGYATAGTATCRATGTGTTCCAG

AAGTACTCTATTTTAGCCCCATC[6]

12

Supplementary fig. 4. Specificity tests of the subtyping primers for RNAs of InfA/H1N1,

InfA/H3N2, InfA/H5N1, InfA/H5N2, InfA/H7N9, InfB/Victoria, and InfB/Yamagata viruses

by performing benchtop, one-step RT-PCR followed by gel electrophoresis of PCR amplicons.

(a) The specificity of universal InfA and universal InfB (a), InfA/H1 and InfA/N1 (b), InfA/H3

and InfA/N2 (c), InfA/H5 (d), and InfA/H7 and InfA/N9 (e) primer sets.

13

VI. Sensitivity tests

14

15

Supplementary fig. 5. The limits of detection (LOD) of the developed microfluidic

system with SNM-01-139-coated beads and the HA-specific and NA-specific

subtyping primers detected by the optical detection module equipped with a

photomultiplier tube (PMT) and agarose gel electrophoresis. The LODs of the specific

RT-PCR assays for the InfA/H3N2 virus (a-b; n=3), InfA/H5N1 virus (c-d; n=3),

InfA/H5N2 virus (e-f; n=3), InfA/H7N9 virus (g-h; n=3), and InfB/Victoria and

InfB/Yamagata viruses (i-j; n=1). Lane M=100-bp DNA ladder, Lane P=positive

control (1 ng viral RNA), Lane N=negative control (ddH2O), and Lane “No virus”=

PBS buffer mixed with SNM-01-139-coated beads.

16

Supplementary references

1. Cooper, P.D., 1961. The plaque assay of animal viruses. Adv Virus Res 8, 319-378.

2. Stuart-Harris, C., 1979. Epidemiology of influenza in man. Brit Med Bull 35(1), 3-

8.

3. Yang, S.Y., Lin, J.L., Lee, G.B., 2009. A vortex-type micromixer utilizing

pneumatically driven membranes. J Micromechanics Microengineering 19(3).

4. Tsukamoto, K., Ashizawa, H., Nakanishi, K., Kaji, N., Suzuki, K., Okamatsu, M.,

Yamaguchi, S., Mase, M., 2008. Subtyping of avian influenza viruses H1 to H15 on

the basis of hemagglutinin genes by PCR assay and molecular determination of

pathogenic potential. J Clin Microbiol 46(9), 3048-3055.

5. Wang, C.H., Lien, K.Y., Hung, L.Y., Lei, H.Y., Lee, G.B., 2012. Integrated

microfluidic system for the identification and multiple subtyping of influenza viruses

by using a molecular diagnostic approach. Microfluid Nanofluid 13(1), 113-123.

6. Hoffmann, B., Hoffmann, D., Henritzi, D., Beer, M., Harder, T.C., 2016. Riems

influenza a typing array (RITA): An RT-qPCR-based low density array for

subtyping avian and mammalian influenza A viruses. Sci Rep 6, 27211.