Upload
dokhuong
View
216
Download
1
Embed Size (px)
Citation preview
Architecture of the yeast RNA polymerase II open complex and regulation of
activity by TFIIF
James Fishburn and Steven Hahn*
Fred Hutchinson Cancer Research Center
PO Box 10924
1100 Fairview Ave N
MS A1-162
Seattle, WA 98109
*email: [email protected]
*phone: 206 667 5261
Running Title: yeast RNA Polymerase II open complexes
Word Count: introduction, results and discussion = 5640
Word count: materials and methods = 2491
Copyright © 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Mol. Cell. Biol. doi:10.1128/MCB.06242-11 MCB Accepts, published online ahead of print on 24 October 2011
on April 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
Abstract
To investigate the function and architecture of the open complex state of RNA
polymerase (Pol) II, S. cerevisiae minimal open complexes were assembled using
a series of heteroduplex HIS4 promoters, TBP, TFIIB, and Pol II. The yeast
system demonstrates great flexibility in the position of active open complexes,
spanning 30-80 base pairs downstream from TATA, consistent with the
transcription start site scanning behavior of yeast Pol II. TFIIF unexpectedly
modulates activity of the open complexes, either repressing or stimulating
initiation. The response to TFIIF was dependent on the sequence of the template
strand within the single stranded bubble. Mutations in the TFIIB reader and
linker region, which were inactive on duplex DNA, were suppressed by the
heteroduplex templates, showing that a major function of the TFIIB reader and
linker is in initiation or stabilization of single stranded DNA. Probing the
architecture of the minimal open complexes with TFIIB-FeBABE derivatives
showed that the TFIIB core domain is surprisingly positioned away from Pol II,
and addition of TFIIF repositions the TFIIB core domain to the Pol II wall
domain. Together, our results show an unexpected architecture of minimal open
complexes and regulation of activity by TFIIF and the TFIIB core domain.
Introduction
Transcription initiation is a multistep process that is conserved in all organisms
(6, 17, 29). RNA polymerase (Pol) first recognizes and binds to promoter DNA
with the assistance of one or more factors forming a state termed the closed
complex. Subsequently, DNA surrounding the transcription start site is unwound
and the template strand is positioned in the Pol active site, forming the open
complex (24). Transcription initiation then commences, initially producing short
RNA products in an abortive initiation reaction, until Pol releases contacts with
the promoter and transitions into a processive elongation mode. Each of these
intermediate steps can be targeted to regulate transcription.
The closed complex state of eukaryotic Pol II is termed the preinitiation complex
(PIC) and contains Pol II and 6 general transcription factors (TFIIA, TBP, TFIIB,
on April 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
TFIIF, TFIIE, and TFIIH) (11, 25). Unlike the closed complex of other Pols, the
Pol II PIC is stable and does not spontaneously form open complexes. Instead,
open complex formation requires ATP hydrolysis and the XPB helicase activity to
unwind the DNA strands from ~ –10 to +2 with respect to the human
transcription start site (14, 28). These open complexes are unstable, with a half-
life of ~1 min, and require continuous ATP hydrolysis to remain in this state (8,
14, 30).
For Archaea and many eukaryotes, the bubble of unwound DNA in the open
complex overlaps the transcription start site, located about 30 bp distant from
the TATA element. One exception is the yeast S. cerevisiae, where transcription
starts within a window of ~50-120 bp downstream from TATA even though yeast
PICs are assembled surrounding the TATA (12, 16, 20, 31). In vivo permanganate
probing suggested that unwinding of yeast promoter DNA begins, with respect to
TATA, at about the same position as in mammals and extends to the distant
transcription start site (10). However, it is not known if all DNA is unwound at
once in a large single stranded bubble or, whether a smaller bubble is propagated
downstream, while Pol II scans for an appropriate initiation site. It is also not
known whether start site scanning involves release of Pol II from the general
factors and promoter DNA. Finally, it is not clear why yeast and mammalian
start site selection is different, since Pol II and the general factors are well
conserved. It was suggested that differences in Pol II and TFIIB can account for
start site preference (18), and mutations that have modest effects on start site
preference have been isolated in Pol II, TFIIF, and TFIIB (reviewed in (9)).
Models for the architecture of the PIC at a TATA-containing promoter have been
proposed based on biochemical probes positioned within the PIC (4, 9, 20) and
from x-ray structures of the Pol II-TFIIB complex (15, 19). In these models, the
TFIIB core domain binds both TATA-TBP and the wall domain of Pol II,
positioning downstream promoter DNA over the Pol II central cleft with
upstream DNA directed toward the top surface of Rpb2, the second largest Pol II
subunit. Two structured domains of TFIIF are positioned at separate sites on
on April 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
Rpb2 (5, 9) and one of these domains, the winged helix of the TFIIF small
subunit, is near upstream promoter DNA where it may bind and stabilize the PIC
(9).
Two major questions concerning the mechanism of Pol II initiation are: what is
the architecture of the Pol II open complex and, how does Pol II scan for the
transcription start site? Two models for open complex formation were recently
proposed by combining PIC models and the x-ray structure of the Pol II
elongation complex (15, 19). In one model, the unwound template strand is
positioned in the enzyme active site with upstream single stranded DNA near a
flexible region of TFIIB termed the B-reader, proposed to recognize DNA 8 bp
upstream from the transcription start site (15). Another TFIIB element termed
the B-linker is positioned near the junction of single and double stranded
promoter DNA and is proposed to function in DNA melting (15, 19). In both
models, the TFIIB core domain, TBP, and upstream promoter DNA remain in the
same location compared to the PIC. These models, however, do not explain how
yeast Pol II can initiate mRNA synthesis at distant downstream sites.
In this work, we examine the activity and architecture of a minimal Pol II open
complex. We observe remarkable flexibility in the open complex state that is
consistent with downstream initiation, unexpected sequence-dependent
modulation of open complex activity by TFIIF, and surprising differences with
the previously proposed open complex models for the position of the TFIIB core
domain and the path of upstream promoter DNA.
Materials and Methods
Heteroduplex promoters and immobilized templates
DNA templates were generated by PCR from pSH1271 (containing a single Gal4
binding site upstream from a modified HIS4 promoter; see below) with primers
pBio965 (biotin-taatgcagctggcacgacagg) and pNOT (ggccgctctagctgcattaatg). The
629 bp product was used to generate immobilized templates as in Ranish et. al.
on April 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
, and used for transcription and FeBABE cleavage assays. Alternatively, the
product was digested with DraIII and AlwN1 restriction enzymes (NEB), yielding
fragments of 363 bp, 92bp, and 174 bp. These fragments were separated and
purified from 2.5 % agarose gels, and used in the generation of heteroduplex
templates. Heteroduplexes were formed by annealing phosphorylated 92 base
oligos containing 12 bp mismatches at the positions indicated in Fig 1A. The
oligos were designed to leave overhangs complimentary to DraIII and AlwN1 sites
in pSH1271, thus allowing replacement of the HIS4 promoter from the TATA box
through the start sites of in vitro transcription. The 92 bp heteroduplexes were
purified on 2.5 % agarose gels. Heteroduplex promoters were generated by
overnight ligation at 16 °C of the mismatched 92 bp promoter inserts with the
363 bp and 174 bp fragments from pSH1271 templates. T4 DNA Ligase (NEB)
was heat inactivated (10 min at 65 ºC), and the reactions run on 2 % agarose gels.
The 629 bp products were purified by gel extraction kit (Qiagen), ethanol
precipitated, and the DNA resuspended in 10 mM Tris (pH 8.0). The
heteroduplex templates were quantified by ND-1000 spectrophotometer
(NanoDrop), and used to generate immobilized templates as above.
The sequence of the modified HIS4 promoter from plasmid pSH1271 used to
generate immobilized templates is given below, with the HIS4 TATA in bold and
underlined:
taatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaatt
aatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgt
atgttgtgtggaattgtgagcggataacaatttcacacaggaaacagctatgaccatgat
tacgccaagcgcgcaattaaccctcactaaagggaacaaaagctgggtaccgggcccccc
ctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagcccgggggatcgatc
cgggtgacagccctccgaattcgagctcggtacccggggatctgtcgacctcgagaacag
tagcacgctgtgtatataatagctatggaacgttcgattcacctccgatgtgtgttgtac
atacataaaaatatcatagcacaactgcgctgtgtcagcgactgaatagtaatacaatag
tttacaaaattttttttctgaataatgaccggatccggagcttggctgttgcccgtctca
ctggtgaaaagaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttg
gccgattcattaatgcagctagagcggcc
on April 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
In vitro transcription and primer extension
20 μl reactions contained the following: 20 mM HEPES (pH 7.6), 100 mM
potassium acetate, 1 mM EDTA, 5 mM magnesium acetate, 3 mM DTT, 38 mM
creatine phosphate, 0.03 units creatine phosphokinase, 2 μg BSA, 4 units RNAse
OUT (Invitrogen), 0.05 % NP40, and 1 μg poly-dGdC competitor DNA. To each
reaction, 1 μl immobilized template (86 ng template) was added, along with 24 ng
VP16 activator and 120 μg nuclear extract, or purified factors (TFs) as follows: 68
ng TBP, 26 ng TFIIB, 54 ng TFIIF, 12 ng TFIIE, 85 ng TFIIH, and 280 ng PolII.
With the exception of TFIIH, all factors were saturating for activity at these
concentrations. Preinitiation complexes were allowed to form for 30-40 min at
room temperature. Transcription was initiated by adding 1 μl NTPs (10 mM
each), and stopped after 3 minutes by adding 180 μl stop mix of 100 mM sodium
acetate, 10 mM EDTA, 0.5 % SDS, and 17 μg/ml tRNA (Sigma). Reactions were
phenol/chloroform (2:1) extracted once, the RNA precipitated ,washed in
ethanol, and dried. The pellets were resuspended in 10 μl primer annealing mix
of 5 mM Tris (pH 8.3), 75 mM potassium chloride, 1 mM EDTA, and either 32P-
labeled lacI primer (~5 x 105 cpm) or 65 μM 700IR-fluorescently labeled lacI (LI-
COR Biosciences). Reactions were incubated for 45 min at 48 ºC (32P-lacI), or 55
ºC (700IR-lacI). Next, 20 μl cDNA synthesis mix (25 mM Tris (pH 8.3), 75 mM
potassium chloride, 4.5 mM magnesium chloride, 15 mM DTT, 150 μM dNTPs,
and 100 units MMLV-RT (Invitrogen)) was added to each reaction, and
incubated 30 min at 37 ºC. Reactions were stopped by ethanol precipitation.
The pellets were washed with 80% ethanol, dried, resuspended in 3 μl RNAse A
(40 μg/ml), and incubated 3 min at room temperature before adding 3 μl
formamide loading dye containing bromophenyl blue. Just before
electrophoresis, samples were heated for 1 minute at 90 ºC, transferred to ice,
and run on denaturing 8 % acrylamide gels. Gels were visualized by
PhosphorImager (32P; Molecular Dynamics), or by Odyssey scanner (700-IR; LI-
COR).
on April 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
Transcription initiation assay
Reactions were assembled under the same conditions used for in vitro
transcription with purified factors (TFs). Complexes were allowed to form for
30-40 min at RT on immobilized heteroduplex templates. Transcription was
initiated from Bubble 3 with 1 μl limiting NTPs (10 mM ATP and CTP plus 1 mM
UTP) plus 5 μCi α 32P-UTP (Perkin Elmer), or from Bubble 15 with 1 μl limiting
NTPs (10 mM CTP and UTP plus 1 mM GTP) plus 5 μCi α 32P-GTP, and stopped
after 30 min by adding 180 μl transcription stop mix. The reactions were
extracted once with phenol/chloroform (2:1), the labeled-RNA precipitated,
washed in ethanol, and dried. The pellets were resuspended with formamide
loading dye, heated to 65 °C for 30 sec, and transferred to ice before loading on
denaturing 20 % acrylamide urea gels. The RNA products were visualized by
PhosphorImager (Molecular Dynamics).
FeBABE cleavage assays
TFIIB-FeBABE derivatives were assembled into PICs using immobilized template
DNAs. Cleavage assays and analysis of cleavage products was performed as
described (3, 4).
TFIIB purification
TFIIB was expressed as an N-terminal SUMO fusion protein from pLH237
(pET21a-6(His)-SUMO-yTFIIB) in BL21 (DE3) RIL cells. 2 liters of cells were
collected by centrifugation and resuspended in 20 ml lysis buffer (50 mM HEPES
(pH 7.0), 500 mM NaCl, 10 % glycerol, 40 mM Imidazole). The cells were treated
with lysozyme (0.5 mg/ml) for 45 minutes at 4 °C, and disrupted by sonication.
The extract was clarified by centrifugation, and purified using Ni-Sepharose
affinity media (GE Healthcare). TFIIB was eluted with 50 mM HEPES (pH 7.0),
0.5 M NaCl, 0.5 M Imidazole, 0.05 % NP40, and 10 % glycerol. The eluate was
dialyzed to remove Imidazole and reduce [NaCl] to 375 mM, and subsequently
treated with SUMO protease Ulp1 (1.7 μg/ml) for 1 hour at room temp (RT).
Following cleavage, Ni-Sepharose was used to capture the 6His-SUMO-tag and
on April 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
protease. TFIIB was dialyzed in 20 mM Tris (pH 7.8), 150 mM KOAc, 50 μM
ZnOAc, and 10 % glycerol, and was further purified over BioRex 70 (BioRad) with
a linear gradient of 7.5 – 30 % buffer B [20 mM Tris (pH 7.8), 2 M KOAc, 50 μM
ZnOAc, 10 % glycerol]. TFIIB eluted at ~ 540 mM KOAc, and was stored at -80
°C. All buffers were supplemented with 1 mM DTT and PMSF.
TFIIH purification
SHY810 (RAD3-(Flag)1-TAP tag) cells were grown at 30 °C in YPD (3% glucose,
0.002 % adenine) to OD600 5.0. Cells were washed with cold TAP extraction
buffer (20 mM HEPES (pH 7.6 at 4 °C), 0.2 M KOAc, 20 % glycerol, 1 mM
EDTA). Cells were resuspended in 1 ml TAP extraction buffer per gram wet
pellet, and homogenized using chilled 425-600 μm glass beads (Sigma) using a
Bead Beater (BioSpec Products). The extract was clarified in steps by
centrifugation at 4 °C for 20 min at 25,000 x g followed by 90 min at 200,000 x
g. Clarified extract was added to 33 μl IgG Sepharose (GE Healthcare) per gram
of pellet, and incubated for 2 hours at 4 °C. IgG beads were collected by
centrifugation, washed twice with TAP extraction buffer, and once with TEV
cleavage buffer (20 mM HEPES (pH 7.6 at 4 °C), 0.2 M KOAc, 20 % glycerol, 1
mM EDTA, 0.1 % NP40). One volume TEV cleavage buffer was added to IgG
beads along with 10 μg TEV protease per ml IgG, and incubated for 60 min at
room temperature (RT). IgG beads were collected by centrifugation, and TFIIH
eluate was removed. One volume TEV cleavage buffer was added to IgG beads
and incubated 10 min at RT. The beads were collected and eluate transferred,
and a third 10 min elution step carried out. The eluates were combined and
added to 3 volumes Calmodulin binding buffer (20 mM HEPES (pH 7.6 at 4 °C),
0.2 M KOAc, 20 % glycerol, 1 mM EDTA, 0.1 % NP40, 1 mM MgOAc, 1 mM
Imidazole, 2 mM CaCl2) and adjusted to 3 mM CaCl2. This solution was added to
Calmodulin Affinity Resin (Stratagene) and incubated for 90 min at 4 °C. The
resin was collected by centrifugation, washed twice with Calmodulin binding
buffer, and once with Calmodulin binding buffer- low NP40 (0.01 %). Two
volumes Calmodulin elution buffer (20 mM HEPES (pH 7.6 at 4 °C), 0.2 M
on April 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
KOAc, 20 % glycerol, 1 mM EDTA, 0.01 % NP40, 1 mM MgOAc, 1 mM Imidazole,
3 mM EGTA) was added to the resin and incubated 20 min at RT. The resin was
collected as before, and the elution repeated twice. TFIIH containing eluates
were combined and concentrated with Microcon YM-100 filters (Millipore). DTT
was added to 5 mM, and TFIIH was stored at -80 °C. Buffers were supplemented
with 1 mM DTT, 1 mM PMSF, 2 mM benzamidine, 3 μM leupeptin, 2 μM
pepstatin, and 3.3 μM chymostatin.
RNA Pol II purification
Yeast strain SHy808 (His6 tag at the N-terminus of Rpb3) was grown at 30 °C in
YPD (3 % glucose, 0.002 % adenine) to OD600 5.0, harvested by centrifugation,
and weighed. Pol II was typically prepared from 30 liters of cells. The cells were
resuspended in 0.33 ml freezing buffer (150 mM Tris (pH 7.9 at 4 °C), 3 mM
EDTA, 30 μM ZnCl2, 30% glycerol, 3 % DMSO, 30 mM mercaptoethanol, 3 x
protease inhibitors) per gram wet pellet, and flash frozen before storing at -80 °C.
The cell suspension was thawed in a room temperature water bath, homogenized
by Bead Beater (Biospec Products) and the extract clarified by centrifugation as
done for purification of TFIIH. The clarified extract was transferred to a glass
beaker, and stirred overnight at 4 °C with 291 mg/ml ammonium sulfate. The
sample was centrifuged 30 min at 25,000 x g, and the supernatant discarded.
The pellet was resuspended in 75 μl HSB-0/10 per gram of cells harvested, and
conductivity was adjusted to 400 μS/cm with HSB-0/10 [50 mM Tris (pH 7.9 at 4
°C), 1 mM EDTA, 10 μM ZnCl2, 10 mM Imidazole, 10 % glycerol, 10 mM β-
mercaptoethanol]. The sample was added to HSB-1000/10 [HSB-0/10 plus 1 M
KCl] equilibrated Ni-Sepharose (10 μl resin per gram of cells harvested), and
incubated 2 hours at 4 °C. The beads were collected by centrifugation, washed
for 5 min at 4 °C with 5 volumes HSB-1000/10, and washed twice more with Ni-
20 [20 mM Tris (pH 7.9 at 4 °C), 150 mM KCl, 10 μM ZnCl2, 20 mM Imidazole,
10 % glycerol, 10 mM mercaptoethanol]. Pol II was eluted three times by 10 min
incubation at RT in 2.5 volumes Ni-200 [Ni-20 with 200 mM Imidazole]. The
desired eluates were combined, and slowly adjusted to 55 μS/cm conductivity
on April 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
with Q buffer A [20 mM Tris (pH 7.9 at 4 °C), 0.5 mM EDTA, 10 μM ZnCl2, 10 %
glycerol, 10 mM DTT]. Pol II was further purified over Source 15 Q (GE
Healthcare) using 2 linear gradients of Q buffer B [Q buffer A plus 1.5 M KOAc ]:
10 – 35 % over 15 CV, and 35 – 70 % over 30 CV. The desired fractions were
pooled, and dialyzed in 3 steps (1 liter for 1.5 hours each step) in Pol II buffer [20
mM HEPES (pH 7.6 at 4 °C), 20 % glycerol, 8 mM MgSO4, 60 mM (NH4)2SO4, 10
μM ZnCl2, 10 mM DTT]. Pol II was concentrated using Amicon Ultra-30k filters
(Millipore), and stored at -80 °C. Buffers were supplemented with protease
inhibitors as in the purification of TFIIH.
TBP purification
TBP was expressed from pSH713 (pET21a-6His-TBP) in BL21 (DE3) RIL cells. 4
liters of cells were grown to log phase, induced, and harvested by centrifugation.
The cells were washed, and resuspended in 40 ml 20 mM Tris (pH 7.8), 250 mM
KCl, 10 % glycerol, and 5 mM mercaptoethanol. Cells were treated with 0.5
mg/ml lysozyme for 30 minutes, and disrupted by sonication. The extract was
clarified by centrifugation, and purified using Ni-Sepharose affinity media (GE
Healthcare). TBP was eluted with 20 mM Tris (pH 7.8), 0.25 M KCl, 0.25 M
Imidazole, 10 % glycerol, and 5 mM mercaptoethanol. TBP was adjusted for
conductivity to 50 μS/cm by dilution with buffer A [20 mM Tris (pH 7.8), 10 %
glycerol, 1 mM DTT], and further purified over Source 15 S (GE Healthcare) using
a linear gradient of 2.5 – 30 % buffer B [buffer A plus 2 M KCl] over 20 column
volumes. TBP eluted at approximately 200 mM KCl, and was stored at -80 °C.
All buffers were supplemented with 1 mM PMSF. The TFIIBN-TBP fusion was
also purified using this method.
TFIIF and TFIIE purification
Recombinant TFIIF containing S. mikatae Tfg1 and S. cerevisiae Tfg2 was
expressed and purified as described . Recombinant TFIIE typically had ~2-
fold lower specific activity compared to yeast-purified TFIIE, using the
reconstituted transcription system, so yeast-purified TFIIE was used for all
on April 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
assays. SHY392 (TFA1-(1x Flag)-TAP tag) cells were grown at 30 °C in YPD (3 %
glucose, 0.002 % adenine) to OD600 5.0. 12 liters of cells were harvested by
centrifugation and washed with 100 ml extraction buffer (40 mM HEPES-KOH
(pH 7.5), 350 mM NaCl, 10 % glycerol, 0.1 % Tween-20, 0.5 mM DTT). The cell
pellet was resuspended in 1 ml extraction buffer per gram of cells. The cells were
homogenized, and the extract clarified as in the purification of TFIIH. The
clarified extract was added to 3 ml IgG Sepharose (GE Healthcare), washed 3
times with 10 volumes extraction buffer without DTT) and incubated 3 hours at 4
°C. The beads were collected by centrifugation, washed twice with extraction
buffer, and once in TFIIH cleavage buffer (10 mM Tris (pH 8.0), 150 mM NaCl,
0.5 mM EDTA, 0.1 % NP40, 10 % glycerol, 1 mM DTT). 3 ml TFIIH cleavage
buffer plus 30 μg TEV protease were added to the washed beads, and incubated
45 minutes at RT. The beads were spun down, and the supernatant collected for
elution 1.3 ml cleavage buffer was added to the beads, and incubated 15 minutes
before collected elution 2. This step was repeated for a third elution. The eluates
were combined, and added to 3 volumes binding buffer (10 mM Tris (pH 8.0), 1
mM MgOAc, 1 mM Imidazole, 2 mM CaCl2, 0.1 % NP40, 10 % glycerol, 0.5 mM
DTT) and adjusted to 3 mM CaCl2. This solution was added to 2 ml Calmodulin
Affinity Resin (Stratagene) and incubated for 2 hours at 4 °C. The resin was
collected by centrifugation, washed once with binding buffer, and then twice with
wash buffer (binding buffer with reduced NaCl (150 mM) and without NP40). 1
volume elution buffer (10 mM Tris (pH 8.0), 150 mM NaCl, 1 mM MgOAc, 1 mM
Imidazole, 3 mM EGTA, 10 % glycerol, 0.5 mM DTT) was added to the resin, and
incubated 20 minutes at RT. The resin was collected as before, and the elution
repeated twice. TFIIE containing eluates were combined, adjusted to 0.01%
NP40, and concentrated 10-fold with an Amicon Ultra-4 (10,000 MWCO) filter
device (Millipore) before storing at -80 °C. All buffers were supplemented with
protease inhibitors as in TFIIH purification.
Results
Isolation of yeast minimal open complexes and regulation by TFIIF.
on April 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
Human Pol II open complexes can be formed in vitro by two methods. In the
first method, PICs containing Pol II and all the general transcription factors are
incubated with ATP or dATP, leading to the unwinding of ~10 bp surrounding the
transcription start site, monitored by KMnO4 reactivity with single stranded
DNA (14, 28). Maintenance of this state requires the continued hydrolysis of
ATP, since addition of excess of ATPγS reverts the open complex back to the PIC
(8, 14, 30). In contrast, ATP addition to S. cerevisiae PICs has not yet been
observed to generate KMnO4 sensitive DNA between TATA and the transcription
start site. One possible reason for this is that ATP may also induce start site
scanning, so that the single stranded DNA is not localized to a single position.
An alternative method of open complex formation involves assembling factors on
promoter DNA containing a preformed heteroduplex bubble (13, 21, 26). In the
human system, the optimal position for the bubble is variable depending on the
promoter used, but is generally located from ~ -9 to +2 relative to the
transcription start site. Transcription from these complexes requires only the
factors TBP, TFIIB and Pol II (21). TBP and TFIIB are presumably necessary to
tether Pol II near the heteroduplex DNA and to assist positioning the DNA within
the Pol II active site. TFIIF has been reported to either stimulate or have little
effect on activity of these minimal human open complexes (21, 26). TFIIE and
TFIIH are unnecessary for activity of the human heteroduplex complexes,
probably because they act primarily in DNA strand separation and/or
stabilization of the open state.
Yeast transcription initiates at variable distances downstream from the site of
PIC formation and it is not clear why the yeast system does not initiate at the
same position as human Pol II. One model consistent with previous results is
that initiation at ~30 bp downstream from TATA is blocked, forcing Pol II to scan
downstream sequences for an appropriate start site. Because of this behavior, it
was not clear whether yeast Pol II open complexes could be formed using
heteroduplex templates and, if so, where best to position the single stranded
on April 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
bubble. To test whether open complexes could be formed, a series of 10
heteroduplex templates were generated based on the yeast HIS4 promoter, each
containing 12 bases of unpaired single stranded DNA. These bubbles span the
region beginning 18 bp downstream of TATA, through the normal HIS4
initiation sites ~80 bp downstream of TATA (Fig 1A). The promoter derivatives
also contained an additional 372 and 165 bp of upstream and downstream DNA
(23) and were attached to magnetic beads via biotin at the 5’ end of the promoter.
The major most upstream HIS4 transcription start is defined as position +1.
We initially characterized the activity of two bubble templates, one coincident
with the position of mammalian transcription initiation (Bubble 3) and the other
overlapping the normal HIS4 transcription start site (Bubble 15). Fig 1B shows
the activity of the Bubble 3 heteroduplex template compared to transcription
using the double stranded HIS4 promoter. In all experiments, nucleotides were
added for 3 min to preformed protein-DNA complexes to limit transcription to
approximately one round of initiation. Fig 1B, lanes 1-2 shows VP16 activated
transcription using yeast nuclear extracts on the double stranded HIS4 template.
This transcription activity is comparable to the level of basal transcription (no
activator) using a system containing highly purified and recombinant yeast
factors (TFs) (Fig 1B, lanes 3-4). As expected, both the crude and reconstituted
complete system requires hydrolysable ATP as ATPγS, a substrate for RNA
synthesis but not open complex formation, does not promote transcription when
substituted for ATP (Fig 1B, lanes 2, 4).
Very high levels of transcription were observed using both the Bubble 3 and
Bubble 15 promoters (Fig 1B,C). High level transcription from Bubble 3 required
Pol II, TBP and TFIIB (Fig 1B, lanes 5-8) and similar behavior was observed with
Bubble 15. As expected, transcription initiation from these promoters was
independent of β-γ hydrolysable ATP, since substitution of ATPγS for ATP gave
similar levels of mRNA (Fig 1C, lanes 1,2,7,8).
on April 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
Unexpectedly, transcription from Bubble 3 using the complete set of general
factors was 3-fold lower compared to the minimal system (Fig 1C, lanes 1-2, 5-6).
This repression appeared to be caused by TFIIF, since TFIIF addition to the
minimal set of factors also repressed transcription (Fig 1C, lane 4). In contrast,
TFIIF had no effect on transcription from Bubble 15 at the normal site of HIS4
initiation (Fig 1C, lanes 7-12). Our results demonstrate a surprising flexibility of
the yeast system for the position of the heteroduplex bubble, ranging over 60
bp, and show that there is nothing preventing the minimal set of Pol II factors
from initiation at the position used by mammalian Pol II. Importantly, TFIIF
inhibits initiation by yeast Pol II at the mammalian start site position in
heteroduplex HIS4 templates. This mechanism may also contribute to inhibiting
initiation from the mammalian start site position in double stranded DNA when
all factors are present.
To further investigate the flexibility of open complexes and the ability of TFIIF to
repress initiation, the complete set of heteroduplex templates was tested for
transcription activity and repression by TFIIF (Fig 2A). Bubbles 1-7 spanning
the mammalian start site position from 18-42 bp downstream of TATA were all
active as templates for the minimal set of factors. Bubble 7 had a significant
background of transcription from Pol II alone, while the other templates all gave
significantly higher transcription when TBP and TFIIB were added.
Transcription from all these templates was repressed by the addition of TFIIF. In
contrast, Bubbles 9,10, and 12 (single stranded DNA 42-65 bp from TATA) gave
little or no transcription. Finally, Bubbles 14-16, which all overlap the normal
HIS4 initiation sites, gave high levels of initiation that were either stimulated or
indifferent to the addition of TFIIF. Bubble 14 also had a high background of
transcription from Pol II alone.
Analysis of initiation from Bubble 3 using a high resolution gel shows that
initiation in the absence of TFIIF begins from sites within and just downstream
of the single stranded region, and that TFIIF has its strongest repressive effect on
starts within single stranded DNA (Fig 2B, brackets indicate the region of single
on April 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
stranded DNA). In contrast, transcription from Bubble 15 initiates almost
entirely within the single stranded region and transcription from at least two
initiation sites are stimulated by TFIIF.
To test whether TFIIF repressed transcription initiation from Bubble 3, rather
than a later step such as transition to the elongation mode, minimal open
complexes were incubated with ATP, CTP and α32P UTP for 30 min, generating a
series of short RNAs (Fig 3, lane 2). Synthesis of these short RNAs was inhibited
by TFIIF, showing that TFIIF inhibits initiation (Fig 3, lane 3). In contrast,
addition of TFIIF stimulates production of short RNAs from Bubble 15 and the
nucleotides CTP, UTP and α32P GTP (Fig 3, lanes 5,6). Thus, TFIIF appears to
act by modulation of transcription initiation.
Sequence of the heteroduplex bubble determines the response to
TFIIF
We next investigated why transcription from the different bubble templates
showed different responses to TFIIF. Possible variables include distance of the
bubbles from TATA or DNA sequence differences upstream of and/or within the
bubbles. To test if the sequence upstream of the single stranded region was
important for regulation by TFIIF, 12 bp of DNA upstream from Bubble 3
(repressed by TFIIF) were replaced by 12 bp upstream of bubble 15 (stimulated
by TFIIF) (Fig 4A; Bubble 3 [-54-43]). The replaced upstream DNA is
underlined. Transcription from this new promoter variant was still repressed to
the same extent by TFIIF addition as compared to Bubble 3 (Fig 4B, lanes 1-4),
showing that sequence upstream of the bubble has no effect on the response to
TFIIF. To test the importance of the bubble sequence for the TFIIF response, we
replaced the single stranded Bubble 3 sequence with that of Bubble 15 (Fig 4A;
Bubble 3::15). Surprisingly, we found that transcription from this promoter
variant was slightly stimulated by TFIIF (Fig 4B, lanes 7-8). High resolution gel
analysis showed that initiation from this template used two primary start sites at
on April 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
positions -34 and -32 and that TFIIF addition caused a strong preference for the -
32 transcription start site (Fig 4C, lanes 5,6).
Since TFIIF altered the sequence preference of Pol II at the transcription start
site, we tested the effect of changing the base at one of these TFIIF-dependent
starts. At Bubble 3, initiation is evenly distributed among 3 start sites with two
being within the single stranded bubble (Fig 4C, lane 1). Upon TFIIF addition,
transcription within the bubble is repressed while initiation within double
stranded DNA at -29G is only modestly repressed. However, if -29 G is changed
to T (a non preferred base; Bubble G -29T), the addition of TFIIF represses
nearly all transcription since there is no optimal transcription start site
remaining (Fig 4B, lanes 5-6,Fig 4C, lanes 3,4). These results show that TFIIF
imposes a strong and unexpected sequence preference on the transcription start
site.
Both sequence and distance of the bubble from TATA contributes to
the efficiency of initiation.
We next investigated why transcription initiates poorly from the bubbles located
between the mammalian initiation position and the normal HIS4 transcription
start sites (Bubbles 9-12; 42-65 bp downstream from TATA) (Fig 2A). One
possibility is that this region is at a non-optimal distance from TATA and perhaps
generates a strained, inactive open complex. Alternatively, the DNA sequence
within this region may not be a good substrate for initiation. Several promoter
variants were constructed to test these two possibilities (Fig 5A). The single
stranded region of Bubble 15 was moved 20 bp closer to TATA in two different
ways: (i) 20 bp of internal promoter sequence was deleted (Bubble 15 [Δ20]) such
that the Bubble 15 sequence was moved to the position occupied by the inactive
Bubble 10 with the sequence immediately upstream the same as in Bubble 15 and,
(ii) the Bubble 10 single stranded DNA sequence was precisely replaced by that of
Bubble 15 (Bubble 10::15). In contrast to the nearly inactive Bubble 10 template,
these two new variants promoted initiation, although with less efficiency
on April 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
compared to Bubble 15 (Fig 5B, lanes 1,3,5). The sequence upstream of the
bubble contributed to efficiency of transcription since Bubble 15 [Δ20] was
transcribed more efficiently compared to Bubble 10::15 (Fig 5B, lanes 3,5),
although neither was transcribed as well as Bubble 15. These results show that
the sequence of the bubble is critical for transcription activity, but the position
with respect to TATA and the upstream DNA sequence can also influence
transcription efficiency. In agreement with the previous finding that sequence of
the heteroduplex region determines the responsiveness to TFIIF, transcription
from both of these new bubble variants was stimulated by TFIIF (Fig 5B, lanes
3-6), consistent with the fact that their single stranded DNA is identical with that
of Bubble 15, which is normally stimulated by TFIIF.
A single base change in the heteroduplex region alters the response to
TFIIF.
To further test the finding that DNA sequence of the bubble determines TFIIF
responsiveness, we replaced Bubble 15 sequence with that of Bubble 3 (Bubble
15::3). As predicted, transcription from this new bubble was partially repressed
by TFIIF (Fig 5B, lanes 9-10). High resolution analysis showed that TFIIF
strongly repressed initiation within the bubble, while slightly stimulating
initiation in downstream double stranded DNA, analogous to the behavior
observed with Bubble 3 (Fig 5C, lanes 1,2).
The DNA sequences of Bubbles 3 and 15 just upstream from the 3’ single-double
strand junction are: CTC (Bubble 3) and CGC (Bubble 15) where the G in Bubble
15 (+14) is the major initiation site in the presence of TFIIF. To test if this
sequence difference is responsible for the different TFIIF-response, we altered
Bubble 3 base T -32 to G (Bubble 3 T -32G; Fig 6A) and measured transcription
with and without TFIIF. In comparison to Bubble 3 where initiation within the
single stranded DNA is repressed by TFIIF, the single base change in Bubble 3
switches the response to TFIIF so that transcription from position -32 is now
stimulated by TFIIF. Combined, our results show that the sequence of the
on April 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
heteroduplex near the single-double strand junction can have a strong influence
on the response to TFIIF.
The template strand sequence determines the response to TFIIF.
In principal, modulation of transcription by TFIIF could be in response to
changes in the template, non-template or both strands of the heteroduplex. To
test which DNA strands are responsible for the TFIIF response, four
heteroduplex variants, diagramed in Fig 6B, were tested for transcription with
and without TFIIF. All these variants were created at the site of Bubble 15 (Fig
6B). We chose the Bubble 6 sequence to pair with Bubble 15 since these two
sequences are not complimentary. Bub15/Bub15 is identical to Bubble 15 with
the wild type HIS4 sequence on the template strand (T) and identical bases on
the opposite non-template (NT) strand. The other variants have either the
Bubble 6 heteroduplex, or Bubble 15 and 6 on either the template or non-
template strands as diagramed.
Fig 6C shows that initiation from Bubble 15 at G +14 is stimulated by TFIIF, and
that this pattern is the same when Bubble 15 is only on the template strand
(Bub6/Bub15), (lanes 2,3,8,9). In contrast, initiation from the single stranded
region of Bubble 6 is repressed by TFIIF with initiation starting primarily within
the double stranded region of the promoter. This behavior is identical to that
observed when Bubble 6 is present only on the template strand (Bub15/Bub6)
(lanes 5,6,11,12). Also, note that the pattern of transcription initiation on all the
templates with Pol II alone is nearly identical, but at a lower level, compared to
that when TBP and TFIIB are also present. Therefore, Pol II has an inherent
preference for the initiation sites within the single stranded bubbles that is
enhanced by TBP and TFIIB. Together, our results demonstrate that it is the
template strand that determines that transcription initiation pattern and the
responsiveness to TFIIF.
A primary function of the TFIIB reader and linker regions is in
initiation and/or stability of DNA melting.
on April 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
The bubble templates allowed us to test the function of the TFIIB B-reader and
linker regions. Previously, it was shown that mutations in the B-reader of the
Archaeal factor TFB were suppressed to variable extents by pre opening the DNA
and that mutations in the B-linker were suppressed by Archaeal TFE, proposed to
function by stabilizing the DNA bubble (15). Several mutations were generated in
the TFIIB reader and linker regions and tested using the complete reconstituted
transcription system on double stranded DNA (Fig 7, lanes 1-5). These TFIIB
mutations resulted in little or no transcription. In contrast, all of these mutations
were almost fully suppressed by the heteroduplex templates Bubble 3 and Bubble
15 (Fig 7, lanes 6-15). The fact that transcription from these templates is
suppressed so efficiently by pre-opened DNA suggests that a primary function of
the B-reader and linker regions is in formation and/or stabilization of single
stranded DNA in the open complex state.
High resolution analysis of initiation using the reader and linker mutants shows
that they initiate from the same positions within single stranded DNA compared
to wild type TFIIB, however, they initiate poorly from double stranded DNA just
downstream from the Bubble. Transcription using the TFIIB reader mutants,
like with wild type TFIIB, is repressed by addition of TFIIF. In contrast,
transcription using the TFIIB linker mutant L110P is repressed by TFIIF for
single stranded initiation but is stimulated for initiation within downstream
double stranded DNA. This distinct behavior shows that the roles of the linker
and reader are not identical in the response to TFIIF.
Unexpected architecture of open complexes and the role of TFIIF in
TFIIB positioning
An important question is how the architecture of the open complex differs from
that of the PIC. To probe the structure of the minimal open complexes, TFIIB-
FeBABE derivatives were used to form PICs either with double stranded DNA
and the complete reconstituted system or minimal open complexes with the
bubble templates. Activation of FeBABE with H2O2 generates hydroxyl radicals
that cut polypeptides within ~30 Å and allows mapping protein-protein
on April 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
interactions in large complexes (3, 7). Cleavage of the Pol II subunit Rpb1 was
monitored by Western blot using an antibody reactive against the N-terminus of
Rpb1. Fig 8A, lanes 2-3 shows that in the PIC, FeBABE positioned within the
TFIIB Zn ribbon at either residue 37 or 53 generates strong cleavage within the
Rpb1 active site and dock region (A/D) and within the Rpb1 clamp domain as
previously shown (2, 3). Probing open complexes formed on Bubble 3 with these
same TFIIB derivatives gives an identical pattern, showing that the position of
the Zn ribbon domain is similar in PICs and open complexes (Fig 8A, lanes 8,9).
Similarly, FeBABE positioned at TFIIB residues 67 and 118, in the B-reader and
linker regions respectively, give similar cleavage patterns in both PICs and open
complexes (Fig 8A, lanes 4,5 and 10-11) showing that the reader and linker loops
are positioned similarly in both complexes.
In contrast is cleavage generated by FeBABE linked to the TFIIB core domain at
residue 135 (green residue in Fig 8D). In fully assembled PICs, this derivative
generates strong cleavage in the Rpb1 clamp domain (Fig 8A, lane 6; blue
highlighted surface in Fig 8D) and in the fork/protrusion domain of Rpb2 (pink
surface) (2). Importantly, this strong Rpb1 cleavage is absent the open complex
(Fig 8A, lane 12). These results suggest that while the TFIIB Zn ribbon and
reader/linker regions are positioned on Pol II similarly in both the PIC and open
complexes, the position of the TFIIB core domain is very different, with the TFIIB
core domain in the minimal open complex positioned away from the Pol II wall
domain.
These mapping results suggested that one of the other general factors is
responsible for positioning the TFIIB core domain within the PIC. To test
whether TFIIF contributes to TFIIB positioning, PICs or minimal open
complexes were assembled with TFIIB-FeBABE (at residue 135) and with or
without TFIIF (Fig 8B). PICs assembled lacking TFIIF contained all added
general factors and Pol II (not shown), likely due to the high concentrations of
factors used for assembly. These incomplete PICs were not active in initiation
from double stranded DNA. Rpb1 cleavage was monitored using the antibody
on April 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
reactive against the N-terminus of Rpb1. These results show that Rpb1 cleavage
is observed only when TFIIF is present.
To extend these findings, TFIIB derivatives with FeBABE at either residue 135 or
184 on the core domain were used to probe cleavage of Rpb2 containing a triple
Flag-tag at the C-terminus (Fig 8C, D). In complete PICs, FeBABE at residue
184 primarily cleaves the Rpb2 wall domain (brown surface in Fig 8D) while
FeBABE at 135 cleaves the fork/protrusion. Rpb2 cleavage from both these
FeBABE-labeled positions was observed only upon addition of TFIIF (Fig 8C,
lanes 2,4). Together, these results show that the TFIIB core domain is positioned
differently in the PIC and minimal open complexes, and that TFIIF is primarily
responsible for this difference.
TFIIF-dependent positioning of TFIIB contributes to repression of
open complex activity.
Since TFIIF repressed transcription from many of the bubble templates and has a
dramatic effect on the location of the TFIIB core domain, we tested if TFIIF-
dependent positioning of the core domain contributes to repression. To test this
hypothesis, the positioning of the TFIIB core needed to be unlinked from the
presence of TFIIF. Given the results presented above, we reasoned that the Zn
ribbon and possibly the reader/linker would be necessary for full activity of the
open complexes, but the TFIIB core domain would be dispensable. To generate a
construct lacking the TFIIB core domain, the N-terminus of TFIIB containing the
ribbon and reader/linker regions was fused to the N-terminus of TBP (Fig 9A).
The first 60 residues of yeast TBP is not conserved, and likely serves as a flexible
linker between the TFIIB N-terminus and the TBP conserved domain.
This recombinant factor was purified and, as expected, had no activity in the
reconstituted transcription system with double stranded DNA (not shown). In
striking contrast, the TFIIBN-TBP fusion worked nearly as well to promote
transcription from Bubble 3 as did TBP and TFIIB (Fig 9B, compare lanes 2,4).
If TFIIF-dependent positioning of the TFIIB core domain on Pol II contributes to
on April 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
repression, then transcription using the fusion construct lacking the core domain
should be resistant to TFIIF. As predicted by this model, addition of TFIIF had
no repressive effect, in contrast to the system with TBP and TFIIB that was
repressed by TFIIF (Fig 9B, lanes 4,5). High resolution analysis showed that the
TFIIB-TBP fusion allowed initiation at the same position in the single stranded
DNA bubble as wild type factors, but the fusion was defective in promoting
initiation from downstream double stranded DNA (Fig 9C). Together, our
results suggest that positioning of the TFIIB core domain on the Pol II wall at
Bubble 3 is inhibitory to initiation.
Discussion
Although Pol II and the general transcription factors are highly conserved, there
is a clear difference in the position and mechanism of transcription start site
selection between S. cerevisiae and mammals. Here we have examined the
ability of the yeast system to initiate transcription at variable distances from
TATA using a series of pre-melted HIS4 promoters, forming minimal open
complexes with Pol II, TFIIB and TBP. We found that yeast Pol II has
remarkable flexibility in the ability to initiate transcription from these bubbles
spaced over >50 bp of promoter DNA. Within this window, we found that the
sequence of the bubble was the most important determinant of promoter activity,
but that the position of the bubble and the sequence immediately upstream of the
bubble also contributed to initiation efficiency. Activity of these templates
required only Pol II, TBP and TFIIB, the same components required for the
human system to transcribe pre-melted promoters (13, 21, 26). The most active
HIS4 promoter derivatives were those with bubbles overlapping either the
mammalian start site (~30 bp downstream of TATA) or promoters with bubbles
overlapping the normal HIS4 start sites (~70 bp downstream). However, bubbles
of appropriate sequence positioned between these two optimal locations did
support initiation, although less efficiently.
An unexpected finding was that TFIIF could modulate the activity of the minimal
open complexes. At most bubble derivatives, TFIIF repressed initiation within
on April 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
the single stranded region, while permitting initiation 2-4 bp downstream of the
bubble when an appropriate sequence was present. In contrast, bubbles
surrounding the normal HIS4 start sites were either slightly stimulated by TFIIF
or were insensitive to its presence. Surprisingly, we found that the response to
TFIIF was mediated by the sequence of the bubble. For example, replacing
Bubble 3 (repressed by TFIIF and overlapping the mammalian start site) with the
Bubble 15 sequence (stimulated by TFIIF and located at the yeast start site)
created a promoter that was stimulated by TFIIF, but initiated transcription close
to the mammalian start site. Conversely, replacing Bubble 15 with the Bubble 3
sequence gave a promoter that initiated far from TATA and was repressed by
TFIIF. Additional experiments showed that the sequence of the single stranded
template strand, within a few bases upstream of the single-double strand
junction, can determine whether an open complex is repressed or stimulated by
TFIIF (Fig 6A). What sequence feature of the heteroduplex region dictates the
response to TFIIF? Heteroduplex templates that are not repressed by TFIIF tend
to have some A/T character at the 5’ end of the bubble and G/C at the 3’ end,
while bubbles repressed by TFIIF tend to have G/C spread throughout the bubble
sequence. Heteroduplex regions that do not work as efficient promoters are very
A/T-rich (Bubbles 9, 10, 12).
Combined, our results show that the HIS4 promoter sequence is optimized to
direct initiation from the in vivo initiation region located ~60-80 bp from TATA.
Pol II, attempting to initiate at the mammalian position, would presumably be
inhibited by TFIIF. Further, the sequence of HIS4 ~40-60 bp downstream from
TATA does not support initiation when single stranded. However, there must be
additional control over transcription start site selection. Positioning an active
initiator (the Bubble 15 sequence) 30 bp downstream from TATA in double
stranded DNA does not allow initiation (JF, not shown). Consistent with this,
insertion of the strong SNR14 initiator at variable distances from the HIS4 TATA,
shows that transcription cannot initiate closer than ~50 bp from TATA (SH, not
shown). Thus, there are at least two levels of control that dictate the
on April 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
transcription start site in the yeast system, (i) the promoter sequence, and (ii) an
inherent property of Pol II and/or the general factors.
The complete purified transcription system also allowed us to test the function of
the TFIIB reader and linker regions. B-Linker mutations were found to block
transcription from double stranded DNA in the yeast and archaeal systems and
archaeal TFB linker mutants were rescued by pre-melting promoter DNA (15).
Here, we found that mutations in the TFIIB linker could also be rescued by pre-
melting the DNA, as transcription from both Bubbles 3 and 15 occurred at near
normal levels using the TFIIB L110P reader mutant. Similarly, three B-reader
mutants were nearly inactive on double stranded DNA but were rescued by pre-
melted promoter DNA. The B-reader was previously known to be critical for
TFIIB function and to assist in transcription start site selection (1, 15, 22, 26, 27).
Together, our new results show that both the B-reader and linker regions play a
major role in melting and/or stabilization of the melted DNA in the open
complex; detrimental effects of the TFIIB mutations on transcription of double
stranded DNA are almost completely reversed at heteroduplex promoters.
Finally, the minimal open complex system allowed us to probe the architecture of
these complexes compared to PICs. Although the TFIIB ribbon, reader and
linker regions were positioned similarly in PICs and open complexes, there was a
striking difference in the position of the TFIIB core domain in the two complexes.
In PICs, the TFIIB core domain binds the Pol II wall, while this TFIIB domain is
positioned away from the wall in the minimal open complex containing TBP,
TFIIB, Pol II and the heteroduplex bubble. Addition of TFIIF caused a shift in
positioning of the TFIIB core domain to the location on the Pol II wall observed
in PICs, and this occurred at both Bubbles 3 and 15. We found that eliminating
the TFIIB core domain also eliminated the ability of TFIIF to repress
transcription at Bubble 3, showing that repositioning TFIIB contributes to
repression of transcription by TFIIF. These results give a different model for the
architecture of the open complex state compared to previous proposals based on
merging models for the PIC and the Pol II elongation complex (Fig 10) (15, 19).
on April 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
In the previous models, positioning of the TFIIB core domain on Pol II results in
a sharp bend in the template strand, 14 bp upstream from the transcription start
site, at the junction of single and double stranded DNA. In contrast,
repositioning the TFIIB core domain away from Pol II would eliminate this bend
and the presumed resulting strain on the stability of the complex.
To develop a working model for the architecture of the TFIIF-containing open
complexes, we need to account for the findings that TFIIF does not repress all
minimal open complexes. Recall that open complexes formed on Bubble 15 were
slightly stimulated by TFIIF, while at the same time, TFIIF caused repositioning
of the TFIIB core on Bubble 15 (Fig 8B). One model consistent with our data is
that TFIIF, either directly or indirectly, can “read” the sequence of the single
stranded template strand and help position this DNA within Pol II in an active
and/or stable state. By this model, stable positioning of the Bubble 15 template
strand would be assisted by TFIIF. In contrast, when TFIIF is added to open
complexes that are repressed by TFIIF (e.g., Bubble 3) the resulting bend in the
template strand, caused by binding of TFIIB to the Pol II wall, may pull the DNA
into a non functional position leading to repression of initiation. From modeling
of the PIC and the structure of the TFIIB-Pol II complex, we know that the TFIIB
B-reader and linker as well as the unstructured linker in the TIIF small subunit
are close to or within the Pol II active site cleft (9, 15, 19). In future work to test
this model, it will be informative to probe protein-DNA contacts between the
single stranded bubble, TFIIB, TFIIF and Pol II to more precisely determine the
path of single stranded DNA in both active and inactive minimal complexes and
to probe for direct interactions between TFIIB, TFIIF and promoter DNA.
Acknowledgements
We thank Hung-Ta Chen for initial design of the heteroduplex bubble strategy,
Bruce Knutson for sequence analysis, Patrick Cramer for communication of an
RNA Pol II purification method, and members of the Hahn lab for advice and
on April 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
comments on the manuscript. This work was supported by grant GM053451
from the National Institutes of Health.
on April 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
References
1. Bangur, C. S., T. S. Pardee, and A. S. Ponticelli. 1997. Mutational analysis of the D1/E1 core helices and the conserved N-terminal region of yeast transcription factor IIB (TFIIB): identification of an N-terminal mutant that stabilizes TBP-TFIIB-DNA complexes. Mol. Cell. Biol. 17:6784-6793.
2. Chen, H.-T., and S. Hahn. 2004. Mapping the location of TFIIB within the RNA Polymerase II transcription preinitiation complex: A model for the structure of the PIC. Cell 119:169-180.
3. Chen, H. T., and S. Hahn. 2003. Binding of TFIIB to RNA polymerase II: Mapping the binding site for the TFIIB zinc ribbon domain within the preinitiation complex. Mol Cell 12:437-447.
4. Chen, H. T., L. Warfield, and S. Hahn. 2007. The positions of TFIIF and TFIIE in the RNA polymerase II transcription preinitiation complex. Nat Struct Mol Biol 14:696-703.
5. Chen, Z. A., A. Jawhari, L. Fischer, C. Buchen, S. Tahir, T. Kamenski, M. Rasmussen, L. Lariviere, J. C. Bukowski-Wills, M. Nilges, P. Cramer, and J. Rappsilber. 2010. Architecture of the RNA polymerase II-TFIIF complex revealed by cross-linking and mass spectrometry. EMBO J 29:717-726.
6. Cramer, P., K. J. Armache, S. Baumli, S. Benkert, F. Brueckner, C. Buchen, G. E. Damsma, S. Dengl, S. R. Geiger, A. J. Jasiak, A. Jawhari, S. Jennebach, T. Kamenski, H. Kettenberger, C. D. Kuhn, E. Lehmann, K. Leike, J. F. Sydow, and A. Vannini. 2008. Structure of eukaryotic RNA polymerases. Annu Rev Biophys 37:337-352.
7. Datwyler, S. A., and C. F. Meares. 2000. Protein-protein interactions mapped by artificial proteases: where sigma factors bind to RNA polymerase. Trends Biochem Sci 25:408-414.
8. Dvir, A., K. P. Garrett, C. chault, J.-M. Egly, J. W. Conaway, and R. C. Conaway. 1996. A role for ATP and TFIIH in activation of the RNA polymerase II preinitiation complex prior to transcription initiation. J. Biol. Chem. 271:7245-7248.
9. Eichner, J., H. T. Chen, L. Warfield, and S. Hahn. 2010. Position of the general transcription factor TFIIF within the RNA polymerase II transcription preinitiation complex. EMBO J 29:706-716.
10. Giardina, C., and J. T. Lis. 1993. DNA melting on yeast RNA polymerase II promoters. Science 261:759-762.
11. Hahn, S. 2004. Structure and mechanism of the RNA polymerase II transcription machinery. Nat Struct Mol Biol 11:394-403.
12. Hahn, S., and E. T. Young. 2011. Transcriptional regulation in S. cerevisiae: transcription factor regulation and function, mechanisms of initiation, and roles of activators and coactivators. submitted.
13. Holstege, F. C., P. C. van der Vliet, and H. T. Timmers. 1996. Opening of an RNA polymerase II promoter occurs in two distinct steps and requires the basal transcription factors IIE and IIH. Embo J 15:1666-1677.
on April 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
14. Holstege, F. C. P., U. Fiedler, and H. T. M. Timmers. 1997. Three transitions in the RNA polymerase II transcription complex during initiation. EMBO J. 16:7468-7480.
15. Kostrewa, D., M. E. Zeller, K.-J. Armache, M. Seizl, K. Leike, M. Thomm, and P. Cramer. 2009. Structure of the RNA polymerase II-TFIIB complex and the mechanism of transcription initiation. Nature 462:323-330.
16. Kuehner, J. N., and D. A. Brow. 2006. Quantitative analysis of in vivo initiator selection by yeast RNA polymerase II supports a scanning model. J Biol Chem 281:14119-14128.
17. Lane, W. J., and S. A. Darst. 2010. Molecular evolution of multisubunit RNA polymerases: structural analysis. J Mol Biol 395:686-704.
18. Li, Y., P. M. Flanagan, H. Tschochner, and R. D. Kornberg. 1994. RNA polymerase II initiation factor interactions and transcription start site selection. Science 263:805-807.
19. Liu, X., D. A. Bushnell, D. Wang, G. Calero, and R. D. Kornberg. 2010. Structure of an RNA polymerase II-TFIIB complex and the transcription initiation mechanism. Science 327:206-209.
20. Miller, G., and S. Hahn. 2006. A DNA-tethered cleavage probe reveals the path for promoter DNA in the yeast preinitiation complex. Nat Struct Mol Biol 13:603-610.
21. Pan, G., and J. Greenblatt. 1994. Initiation of transcription by RNA Polymerase II is limited by melting of the promoter DNA in the region immediately upstream of the initiation site. J. Biol. Chem. 269:30101-30104.
22. Pinto, I., W.-H. Wu, J. G. Na, and M. Hampsey. 1994. Characterization of sua7 mutations defines a domain of TFIIB involved in transcription start site selection in yeast. J. Biol. Chem. 269:30569-30573.
23. Ranish, J. A., N. Yudkovsky, and S. Hahn. 1999. Intermediates in formation and activity of the RNA polymerase II preinitiation complex: holoenzyme recruitment and a postrecruitment role for the TATA box and TFIIB. Genes Dev 13:49-63.
24. Saecker, R. M., M. T. Record, Jr., and P. L. Dehaseth. 2011. Mechanism of Bacterial Transcription Initiation: RNA Polymerase - Promoter Binding, Isomerization to Initiation-Competent Open Complexes, and Initiation of RNA Synthesis. J Mol Biol.
25. Thomas, M. C., and C. M. Chiang. 2006. The general transcription machinery and general cofactors. Crit Rev Biochem Mol Biol 41:105-178.
26. Thompson, N. E., B. T. Glaser, K. M. Foley, Z. F. Burton, and R. R. Burgess. 2009. Minimal promoter systems reveal the importance of conserved residues in the B-finger of human transcription factor IIB. J Biol Chem 284:24754-24766.
27. Tran, K., and J. D. Gralla. 2008. Control of the timing of promoter escape and RNA catalysis by the transcription factor IIb fingertip. J Biol Chem 283:15665-15671.
on April 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
28. Wang, W., M. Carey, and J. D. Gralla. 1992. Polymerase II promoter activation: closed complex formation and ATP-driven start site opening. Science 255:450-453.
29. Werner, F., and D. Grohmann. 2010. Evolution of RNA polymerases in the three domains of life. Nat Rev Micro submitted.
30. Yan, M., and J. D. Gralla. 1997. Multiple ATP-dependent steps in RNA polymerase II promoter melting and intiiation. EMBO J. 16:Not available.
31. Zhang, Z., and F. S. Dietrich. 2005. Mapping of transcription start sites in Saccharomyces cerevisiae using 5' SAGE. Nucleic Acids Res 33:2838-2851.
on April 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
Figure legends
Figure 1. Great flexibility in the location of active minimal open complexes
using S. cerevisiae Pol II, TBP, and TFIIB. (A) The location of heteroduplex
bubbles generated at the HIS4 promoter. Bubbles 3 and 15, at the theoretical
human and measured yeast transcription start sites respectively, are highlighted
in green. The location of initiation typically found at human TATA-containing
promoters is indicated by a blue arrow, and corresponding blue base. The yeast
in vitro transcription start sites are indicated by red arrows and red bases in the
HIS4 sequence. (B) In vitro transcription from HIS4 comparing VP16-activated
nuclear extract (lane 1) and all basal purified factors including TFIIF, TFIIE and
TFIIH (lane 3). Transcription was visualized using primer extension. ATP or
ATPγS, along with all other nucleotides, was added where indicated. Unless
otherwise specified, NTPs were added for 3 min in all transcription reactions.
Lanes 5-14 used the heteroduplex bubble templates with addition of factors as
indicated. (C) Transcription from Bubble 15 and 3 templates as above, but also
containing TFIIF, TFIIE, and TFIIH as indicated. All reactions contained ATP
unless otherwise specified. Differences in primer extension product length are
due to the distance of the initiation site to the downstream primer. For each
bubble template, relative RNA levels are indicated, where the level observed with
TBP/TFIIB/Pol II is set to 1.0.
Figure 2. Open complex activity and the response to TFIIF at heteroduplex
bubbles spanning the HIS4 promoter. (A) In vitro transcription, visualized using
primer extension, from 10 heteroduplex bubbles with Pol II alone, or
TBP/TFIIB/Pol II (minimal open complexes) with or without added TFIIF. For
each bubble template, relative RNA levels are indicated, where the level observed
with TBP/TFIIB/Pol II is set to 1.0. (B) High resolution analysis of initiation
from Bubbles 3 and 15. The complement of the template strand sequence of the
HIS4 promoter derivatives are shown (analogous to the RNA sequence) with the
region of heteroduplex DNA indicated by brackets and the major sites of
initiation highlighted in red. The non-template strand sequence within the
on April 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
bubble is identical to the template strand to prevent annealing. Sequences are
numbered relative to the most upstream S. cerevisiae HIS4 start site (Fig 1). Size
standards GA and AC are modified Maxam-Gilbert sequencing reactions using a
DNA fragment from the HIS4 promoter that was amplified using the same
primer used in RNA primer extension analysis.
Figure 3. TFIIF represses transcription initiation activity of the open complex.
In vitro transcription from Bubbles 3 and 15 by minimal open complexes with or
without TFIIF, was initiated with limiting nucleotides for 30 min. An α32P
labeled nucleotide (UTP, Bubble 3; GTP, Bubble 15) was included in all reactions
and used to visualize the short mRNA products. The position of DNA standards
of 5, 10, and 15 nucleotide lengths are indicated.
Figure 4. The sequence of Bubble 3 determines the response to TFIIF. (A)
Sequence of the HIS4 promoter and Bubble 3 variants. Highlighted are the TATA
box in red, hypothetical human transcription start site position in green, S.
cerevisiae start sites in red, with locations of the bubbles boxed in black. [-55 to -
43] replaces DNA upstream of Bubble 3 with the underlined DNA upstream from
Bubble 15; Bubble 3::15 replaces Bubble 3 sequence with Bubble 15 and [G -29T]
changes an initiating nucleotide downstream of the bubble (indicated with an
arrow) to a non preferred base (B) In vitro transcription from Bubble 3 and
variants using Pol II, TBP and TFIIB. TFIIF was added as indicated.
Transcription visualized by primer extension. For each bubble template, relative
RNA levels are indicated, where the level observed with TBP/TFIIB/Pol II is set
to 1.0. (C) High resolution analysis of initiation from Bubble 3 and two variants.
The complement of the template strand sequence of Bubble 3 is shown on the
left, and annotated as in Fig. 2B. At right is the sequence for the Bubble 3::15
promoter. The bubble location (brackets) and major start sites (red) are
indicated. GA is a DNA sequencing reaction size standard as described in Fig 2.
on April 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
Figure 5. Promoter sequence and spacing affect initiation efficiency and the
response to TFIIF. (A) Sequence of the HIS4 variants. Highlighted are the TATA
box in red, human transcription start site position in green, S. cerevisiae start
sites in red, and locations of the bubbles are boxed in black. (B) In vitro
transcription from Bubble 15 and variants using Pol II, TBP and TFIIB. TFIIF
was added as indicated. For each bubble template, relative RNA levels are
indicated, where the level observed with TBP/TFIIB/Pol II is set to 1.0; ND = not
determined. Differences in primer extension product length are due to the
distance of the initiation site from the downstream primer. (C) High resolution
analysis of initiation from Bubble 15 and two variants. The complement of the
template strand sequence of Bubble 15 is shown at right, and annotated as in Fig.
2B. On the left is the sequence for the Bubble15::3 template. The bubble location
and major start sites are highlighted in red. GA is a DNA sequencing reaction
size standard as described in Fig 2.
Figure 6. Sequence of the template strand dictates the TFIIF response and the
transcription start site. (A) High resolution analysis of initiation from Bubble 3
and a variant promoter. The variant promoter contains a single nucleotide
change at position -32. The complement of the template strand sequences are
shown. TFIIF was added as indicated. GA is a DNA sequencing reaction size
standard as described in Fig 2. (B) Diagram showing Bubble 15 and three variant
heteroduplex promoters. All four bubbles are located at the site of Bubble 15 (Fig
1), with the variants possessing the template (T) and/or non- template (NT)
strand sequence from the Bubble 6 heteroduplex as indicated. (C) Initiation
from Bubble 15 and variants by minimal open complexes with and without IIF.
The complement of the template strand from wild type HIS4 at Bubble 15 is
shown at left, and the analogous sequence of Bubble 6 at right
Figure 7. TFIIB B-reader and linker mutants are active in minimal open
complexes. (A) In vitro transcription comparing wild type TFIIB with B-
reader/linker mutants. Transcription utilizing a complete purified transcription
system on double stranded (DS) HIS4 (lanes 2-5), or minimal open complexes
on April 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
(Pol II, TBP, TFIIB) transcribing Bubble 3 (lanes 6-10) or Bubble 15 (lanes 11-15).
For each promoter, relative RNA levels are indicated, where the level observed
with TBP/TFIIB/Pol II (bubble templates) or with the complete set of factors (DS
templates) is set to 1.0. (B) High resolution analysis of initiation by minimal
open complexes, with and without TFIIF, comparing wild type TFIIB (lanes 1 and
2) with B-reader/linker mutants (lanes 3-10) from the Bubble 3 promoter. The
promoter sequence, major start sites, bubble location, and size standards are
labeled as in Fig 2.
Figure 8. TFIIF positions the TFIIB core domain in the open complex. (A)
TFIIB derivatives were conjugated to FeBABE at the indicated cysteine residues,
and assembled in PICs on a duplex HIS4 promoter (lanes 1-6) or in minimal open
complexes on the Bubble 3 promoter (lanes 7-12). Hydroxyl radical cleavage was
monitored by Western blot probed with an antibody reactive to the N-terminus of
Rpb1. Reproducible cleavage products are indicated by red asterisks, and are
located in the active center and dock regions (A/D), and Rpb1 clamp. (B) TFIIB
with FeBABE linked to residue 135 was used to form PICs on duplex HIS4 DNA
(lanes 1 and 2), or minimal open complexes on Bubble 3 (lanes 3 and 4) or
Bubble 15 (lanes 5 and 6). TFIIF was added where indicated, and cleavage of
Rpb1 was monitored as in (A). (C) TFIIB-FeBABE derivatives were assembled in
PICs on a duplex HIS4 promoter with or without IIF as indicated. Hydroxyl
radical cleavage of C-terminally Flag-tagged Rpb2 was monitored by Western
blot, and was observed in the fork/protrusion (F/P) and wall domains. (D) A
model for the position of the TFIIB core on Pol II is shown (9, 15). Cleavage (3) is
shown in the Rpb2 protrusion (magenta) and Rpb1 clamp domain (blue) from
TFIIB 135-FeBABE (green spheres). Also shown is the area of cleavage in the
wall domain of Rpb2 (brown) from TFIIB 184-FeBABE (red spheres).
Figure 9. The TFIIB core domain is required for repression of open complexes
by TFIIF (A) Schematic diagram of full length TBP, TFIIB, and the IIBN-TBP
fusion protein. (B) In vitro transcription from the Bubble 3 promoter by Pol II
alone (lane 1), Pol II plus the IIBN-TBP fusion protein (lanes 2 and 3), or Pol II
on April 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
plus TBP and TFIIB (lanes 4 and 5). TFIIF was added to the reactions as
indicated. Relative RNA levels are indicated, where the level observed with
TBP/TFIIB/Pol II is set to 1.0. (C) High resolution analysis of initiation from
reactions as in (B). The promoter sequence, major start sites, bubble location,
and size standards are annotated as in Figure 2.
Figure 10. Model for the active form of the minimal open complex at Bubble 3.
The top panel shows a model for the minimal open complex in which the TFIIB
core domain has been displaced from the Rpb2 wall domain, eliminating the
sharp bend in the template strand DNA (Blue) at the junction of double and
single stranded DNA. Non-template strand (pink), TBP (green) and TFIIB
(yellow) are shown. Bottom panel shows a model for the minimal open complex
proposed by Cramer and colleagues (15) with the addition of TFIIF (Tfg1, orange;
Tfg2 red) (9).
on April 13, 2018 by guest
http://mcb.asm
.org/D
ownloaded from