1 Development of Two Types of Rapid Diagnostic Test Kits to Detect

1

Development of Two Types of Rapid Diagnostic Test Kits to Detect the 1

Hemagglutinin or Nucleoprotein of the Swine-Origin Pandemic Influenza A Virus 2

H1N1 3

4

Rika Mizuike,1,† Tadahiro Sasaki,1,† Koich Baba,2 Hisahiko Iwamoto,3 Yusuke Shibai,3 5

Mieko Kosaka,4 Ritsuko Kubota-Koketsu,1 Cheng-Song Yang,1 Anariwa Du,1 Akikazu 6

Sakudo,5 Muneo Tsujikawa,6 Mikihiro Yunoki,1,6 and Kazuyoshi Ikuta1,* 7

8

Department of Virology, Research Institute for Microbial Diseases, Osaka University, 9

Suita, Osaka 565-08711; Baba Pediatric Clinic, Kadoma, Osaka 571-0046

2; Tanaka 10

Kikinzoku Kogyo Corporation, LTD., Hiratsuka, Kanagawa 254-00763; Alfresa Pharma 11

Corporation, Ibaraki, Osaka 567-08064; Laboratory of Biometabolic Chemistry, School 12

of Health Sciences, Faculty of Medicine; University of the Ryukyus, Nishihara, Okinawa 13

903-02155; and Osaka Research Laboratory, Benesis Corporation, Yodogawa-ku

6, 14

Osaka 532-85055, Japan 15

16

Running title: IC KIT FOR PANDEMIC H1N1 2009 17

†Equal contribution. 18

*Corresponding author. Mailing address: Department of Virology, Research Institute 19

for Microbial Diseases, Osaka University, 3-1 Yamadaoka, Suita, Osaka 565-0871, 20

Japan. Phone: 81-6-6879-8307. Fax: 81-6-6879-8310. E-mail: 21

[email protected]. 22

Copyright © 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Clin. Vaccine Immunol. doi:10.1128/CVI.00269-10 CVI Accepts, published online ahead of print on 12 January 2011

on February 22, 2018 by guest

http://cvi.asm.org/

Dow

nloaded from

http://cvi.asm.org/

2

ABSTRACT 1

2

Since its emergence in April 2009, pandemic flu H1N1 (H1N1 pdm), a new 3

type of influenza A virus with a triple reassortant genome, has spread throughout the 4

world. Initial attempts to diagnose patients using immunochromatography (IC) relied 5

on test kits developed for seasonal influenza A and B viruses, many of which proved 6

significantly less sensitive to H1N1 pdm. Here, we prepared monoclonal antibodies 7

that react with H1N1 pdm, but not seasonal influenza A (H1N1 and H3N2) or B viruses. 8

Using two of these antibodies, one recognizing viral hemagglutinin (HA), the other 9

nucleoprotein (NP), we developed kits for the specific detection of H1N1 pdm and 10

tested them using clinical specimens of nasal wash fluid or nasopharyngeal fluid from 11

patients with influenza-like illness. The specificity of both IC test kits was very high 12

(93% for HA kit and 100% for NP kit). The test sensitivities for detection of H1N1 13

pdm were 85.5% with the anti-NP antibody, 49.4% with the anti-HA antibody, and 14

79.5% with a commercially available influenza A detection assay. Use of the anti-NP 15

antibody could allow for the rapid and accurate diagnosis of H1N1 pdm infections. 16


http://cvi.asm.org/

Dow

nloaded from

http://cvi.asm.org/

3

INTRODUCTION 1

2

In April 2009, novel influenza A virus of swine origin (H1N1) appeared rapidly 3

and quickly spread. The WHO decided on June 12 2009 to declare a pandemic (level 4

6). Although infections appeared relatively mild, there had been significant mortality, 5

hospitalization, and a gradually increasing number of fatal cases. As of August 6 2010, 6

more than 214 countries, overseas territories, and communities have reported laboratory 7

confirmed cases of pandemic influenza H1N1 2009, including over 18,449 deaths 8

(WHO, http://www.who.int/csr/don/2010_08_06/en/index.html). 9

Comprehensive phylogenetic analyses revealed H1N1 pdm to have a 10

triple-reassortant genome, comprised of genes derived from the avian (PB2 and PA), 11

human H3N2 (PB1), Eurasian avian-like swine (NA and M), and classical swine (HA, 12

NP and NS) lineages (18, 20). The 2009 CDC guidelines recommended prompt 13

treatment with antiviral drugs and management using specific infection control 14

precautions for high-risk and hospitalized patients (1). A point of care strategy with 15

the rapid diagnosis of H1N1 pdm is crucial for efficient clinical treatment and infection 16

control measures. In the early days of the pandemic, several countries tried to 17

diagnose H1N1 pdm infections using immunochromatography (IC) and subjecting the 18


http://cvi.asm.org/

Dow

nloaded from

http://cvi.asm.org/

4

positive samples to the real-time polymerase chain reaction (PCR) and if necessary, to 1

viral isolation. The IC test kits, essentially developed for seasonal human influenza A 2

and B viruses, were found to be less sensitive than other tests such as PCR (4, 6, 8, 11, 3

16, 25). Several kits were significantly less sensitive to H1N1 pdm (7, 11, 14), 4

although others showed comparable results (2, 10, 12, 22). Generally, the diagnosis of 5

this infection by real-time PCR is difficult, because relatively few hospitals have the 6

medical expertise and equipment required. Therefore, a new test kit that can easily and 7

rapidly diagnose H1N1 pdm infections without a need for subsequent PCR is needed. 8

In addition, the test kit for H1N1 pdm may have the utility of influenza A subtyping, 9

since antiviral drug resistance of H1N1 pdm is still rare (21). In this study, we 10

prepared murine monoclonal antibodies (MAbs) that react with H1N1 pdm, but not with 11

seasonal influenza A (H1N1 and H3N2) or B viruses. Interestingly, we obtained an 12

antibody specific to the nucleoprotein (NP), in addition to an antibody specific to the 13

hemagglutinin (HA), of H1N1 pdm. As expected, the kit developed using the anti-NP 14

antibody showed higher specificity and sensitivity than the test using the anti-HA 15

antibody and even existing kits for seasonal influenza viruses. 16


http://cvi.asm.org/

Dow

nloaded from

http://cvi.asm.org/

5

MATERIALS AND METHODS 1

2

Viruses. Several strains of influenza A and B viruses were used: 3

A/Osaka/168/09 and A/Suita/01/09 as H1N1 pdm; A/Sw/Hokkaido/2/81 as swine 4

H1N1; A/Yamagata/32/89, A/Beijing/262/95, A/New Caledonia/20/99, and 5

A/Brisbane/59/07 as seasonal H1N1; A/Aichi/2/68, A/Guizhou/54/89, A/Wyoming/2/03, 6

A/Hiroshima/52/05, and A/Urguay/16/07 as seasonal H3N2; and B/Malaysia/2506/04, 7

and B/Florida/4/06 as seasonal B. A/Osaka/168/09 was provided by Saeko Morikawa, 8

Osaka Prefectural Institute of Public Health, Osaka, Japan. 9

Mouse immunization. BALB/c mice (4 weeks old, female) were 10

intraperitoneally immunized several times with A/Osaka/168/09 or A/Suita/01/09 viral 11

particles, which were partially purified from the culture fluid of infected MDCK cells 12

by ultracentrifugation. Three days after the last immunization, the spleen cells from 13

the mice were used to prepare hybridomas. 14

Preparation of hybridomas. The spleen cells from immunized mice were 15

fused with PAI myeloma cells, as described previously (27). Specific antibody 16

production was screened based on reactions with A/Osaka/168/09 and A/Suita/01/09, 17

but no reaction with A/New Caledonia/20/99, by indirect immunofluorescence assay 18


http://cvi.asm.org/

Dow

nloaded from

http://cvi.asm.org/

6

(IFA). The cells in the wells producing the specific antibody were cloned by limiting 1

dilution, then subjected to secondary screening as above. 2

IFA. IFA was performed as detailed previously (24). Briefly, 2.5 x 104 3

MDCK cells per well in a 96-well plate were infected with various viruses. After 6-12 4

hr, the cells were fixed with 4% paraformaldehyde in phosphate-buffered saline (PBS) 5

and permeabilized with 0.1% Triton X-100 in PBS. The bound antibody was 6

visualized by a further reaction with an AlexaFluor 488-conjugated secondary antibody 7

(1:1000; Invitrogen). For the staining of infected MDCK cells with positive control 8

MAbs, C179 and C43 were used as anti-influenza A HA and NP, respectively (19). 9

Isotyping. The MAbs obtained were isotyped using a Sigma IsoQuick™ Kit 10

for Mouse Monoclonal Isotyping (Sigma-Aldrich Corporation). 11

Western blotting. The MDCK cells infected with A/Suita/01/09 or A/New 12

Caledonia/20/99 were solubilized in sodium dodecyl sulfate-polyacrylamide gel 13

electrophoresis (SDS-PAGE) sample buffer and subjected to SDS-PAGE with a 10% 14

polyacrylamide gel. Horseradish peroxidase-conjugated goat anti-mouse IgG (Jackson 15

ImmunoResearch Laboratories) was used for the secondary antibody. The peroxidase 16

reaction was visualized using ECL plus (GE Healthcare UK Ltd., Buckinghamshire, 17

UK). 18


http://cvi.asm.org/

Dow

nloaded from

http://cvi.asm.org/

7

Influenza HA or NP expression. The coding regions for the HA and NP 1

derived from A/Suita/01/09 were amplified with reverse transcriptase (RT)-PCR and 2

cloned into a pCAGGS ΙΙ expression plasmid, as described (5). The 293T cells 3

transfected with the plasmids were used as viral antigens for the reaction with the MAb 4

in ascites fluid by IFA. 5

Preparation of ascites fluid. BALB/c mice (6 weeks old, female) were 6

intraperitoneally treated with pristane (Sigma-Aldrich Corporation). After 1 week, the 7

mice were injected with hybridoma cells (about 4 x 106 cells per mouse). Ascites 8

fluids obtained at 1 to 2 weeks post-injection were used for the characterization of 9

individual MAbs. 10

Assembly for rapid diagnostic testing using the IC method. The IgG 11

fraction purified from murine ascites fluid was used to develop the IC test kit, with a 12

system from Alfresa Pharma Corporation, Osaka, Japan. The anti-H1N1 pdm-specific 13

MAbs (N-SW2-6 and N-SW4-6) prepared in this study were immobilized onto a 14

nitrocellulose membrane (0.6 and 0.4 µg/test, respectively) for the test line to capture 15

H1N1 pdm protein. To prepare the control line, an anti-mouse IgG antibody (Nippon 16

Biotest Labo., Tokyo, Japan) was immobilized onto a nitrocellulose membrane (1.8 17

µg/test) to capture mouse IgG. A conjugated pad containing the same N-SW2-6 or 18


http://cvi.asm.org/

Dow

nloaded from

http://cvi.asm.org/

8

N-SW4-6 MAb used for the test line, was labeled with colloidal gold, impregnated onto 1

glass fibers, dried and placed between the test line and the sample-dropping region. 2

The nitrocellulose membrane and glass fiber pad were assembled with a glass fiber 3

sample pad on a plastic sheet within a plastic case. This assembled kit was stored in a 4

bag with desiccant at room temperature until used. 5

Evaluation of test kits. The IC test kits were evaluated with samples of nasal 6

wash from patients with influenza-like symptoms (n=126) collected in 2009-2010 at 7

Baba Pediatric Clinic, Osaka, Japan. As control samples of seasonal influenza virus to 8

confirm the specificity of the primers for PCR, specimens of nasopharyngeal fluid from 9

influenza patients (n=42) collected before the H1N1 pdm pandemic by Baba Pediatric 10

Clinic and Alfresa Pharma Corporation were used. As a control test, existing IC kit for 11

rapid detection of the NP proteins of seasonal influenza A and B viruses (Capilia Flu 12

A+B; Alfresa Pharma Corporation, Osaka, Japan) was used. 13

An RT-PCR-based analysis for the highly sensitive detection of viral RNA as a 14

gold standard was also performed. Primer sets that were newly designed based on the 15

NP region using a swine-derived H1N1 isolates (Table 1), together with those 16

recommended by WHO 17

(http://www.who.int/entity/csr/resources/publications/swineflu/CDCRealtimeRTPCR_ 18


http://cvi.asm.org/

Dow

nloaded from

http://cvi.asm.org/

9

SwineH1Assay-2009_20090430.pdf) for the specific detection of the HA region of the 1

H1N1 pdm viral genome were used. The primer sets for individual seasonal A (H1N1 2

and H3N2) and B viruses (Table 1) were prepared according to Yamada et al. (26), and 3

used for multiplex PCR. Briefly, viral RNA was extracted from the clinical samples 4

with a QIAamp® Viral RNA Mini kit (QIAGEN, Tokyo, Japan). RT-PCR was 5

performed with QIAGEN One Step RT-PCR Kit (QIAGEN, Tokyo, Japan) for H1N1 6

pdm and SuperScriptTM III One-Step RT-PCR System with Platinum® Taq High 7

Fidelity (Invitrogen) for seasonal influenza viruses. The RT-PCR condition was as 8

follows: 50˚C for 30 min, 94˚C for 3 min, then 40 cycles consisting of 94˚C for 30 sec, 9

54˚C for 30 sec, 72˚C for 30 sec, then 72˚C for 7 min. 10

Ethics. The research protocols for human samples as well as the mouse 11

experiments for the preparation of MAb and ascites fluids were approved by the ethics 12

committee of the Research Institute for Microbial Diseases at Osaka University. 13


http://cvi.asm.org/

Dow

nloaded from

http://cvi.asm.org/

10

RESULTS 1

2

Preparation of MAbs and development of IC test kits for rapid detection 3

of the HA and NP of H1N1 pdm. From BALB/c mice immunized with an H1N1 4

pdm viral particle fraction, three hybridoma clones (N-SW2-6, N-SW4-5, and 5

N-SW4-6) were obtained as producers of antibodies specifically reactive to several 6

strains of H1N1 pdm but not seasonal H1N1 by screening using IFA. The isotypes of 7

these MAbs were determined using kits: IgG1 (kappa chain) in N-SW2-6 and N-SW4-6, 8

and IgA (kappa chain) in N-SW4-5. 9

The three MAbs were confirmed to react only to H1N1 pdm and swine H1N1 10

but not to seasonal influenza A and B viruses, using several strains of H1N1 pdm and 11

seasonal A (H1N1 and H3N2) and B viruses as described in Materials and Methods. 12

The staining pattern for N-SW2-6 indicated a reaction to HA, with similar 13

membrane/cytoplasmic staining to the control anti-seasonal H1N1 HA (C179), whereas 14

the staining patterns for N-SW4-5 and N-SW4-6 indicated reactions to NP, with similar 15

nuclei staining to the control anti-influenza virus NP (C43) (Fig. 1). However, Western 16

blotting using viral proteins did not show any band reactive with the antibodies (data 17

not shown), indicating that all three may recognize conformational epitopes. 18


http://cvi.asm.org/

Dow

nloaded from

http://cvi.asm.org/

11

Therefore, we next examined IFA using 293T cells transfected with the plasmid 1

expressing HA or NP of H1N1 pdm (Fig. 2). The results clearly showed reactivity of 2

N-SW2-6 to HA protein and N-SW4-5 and N-SW4-6 to NP protein in transfected 293T 3

cells. Therefore, we used N-SW2-6 and N-SW4-6 to develop the IC test kit: N-SW2-6 4

for the H1N1 pdm anti-HA kit, to rapidly detect HA of H1N1 pdm, but not seasonal 5

influenza A (H1N1 and H3N2) or B viruses; and N-SW4-6 for the H1N1 pdm anti-NP 6

kit, to rapidly detect NP of H1N1 pdm, but not seasonal influenza A (H1N1 and H3N2) 7

or B viruses. N-SW4-5 was not used, because it shows the IgA isotype and slightly 8

lower activity than N-SW4-6. 9

Evaluation of IC test kits using influenza viruses produced in cultured 10

cells. First, we produced H1N1 pdm (A/Suita/01/09) and seasonal influenza A (H1N1, 11

A/New Caledonia/20/99; and H3N2, A/Wyoming/2/03) and B (B/Malaysia/2506/04) 12

viruses in MDCK cells. Compared with the primer sets recommended by the WHO, 13

those newly designed in this study (Table 1) were about 10-fold more sensitive in 14

real-time PCR (data not shown). Therefore, we preferred our primers for the specific 15

amplification of H1N1 pdm, and used primer sets for individual seasonal influenza A 16

and B viruses (Table 1) in multiplex PCR, according to a previous paper (26). 17

Next, serial 10-fold dilutions of the H1N1 pdm (A/Suita/01/09) solution, 18


http://cvi.asm.org/

Dow

nloaded from

http://cvi.asm.org/

12

corresponding to 1.0 x 105 to 1.0 x 10-2 focus-forming units (FFU)/ml, were subjected to 1

RT-PCR with the newly designed same primer set used for H1N1 pdm. The virus titer 2

(FFU) assay was performed by PAP staining method as described previously (23). The 3

primers could amplify 1 x 101 FFU/ml or even 1 x 100 FFU/ml, a trace amount of the 4

viral genome (Fig. 3A). Then, the same samples were tested with the newly developed 5

kits (Fig. 3B). The H1N1 pdm anti-NP kit (1.0 x 101) was significantly more sensitive 6

than the H1N1 pdm anti-HA kit (1.0 x 103). As a control for the detection of both 7

seasonal A and B as well as H1N1 pdm, we used Capilia Flu A+B. This kit showed 8

moderate sensitivity (1.0 x 102) (Fig. 3B). 9

Evaluation of IC test kits using clinical specimens from patients with 10

influenza-like syndromes. A total of 126 specimens from the Baba Pediatric Clinic, 11

sampled in 2009-2010 after the appearance of H1N1 pdm, and 42 specimens collected 12

by Baba Pediatric Clinic and Alfresa Pharma Corporation before the epidemic of H1N1 13

pdm, were used. The results of subtyping by RT-PCR using the primer sets listed in 14

Table 1 were as follows: 83 of the 126 (nasal wash) samples from the Baba Pediatric 15

Clinic were H1N1 pdm-positive while the other 43 samples tested negative for all 16

influenza A and B viruses including H1N1 pdm, and all 42 samples (nasopharyngeal 17

fluid) collected by Baba Pediatric Clinic and Alfresa Pharma Corporation were positive 18


http://cvi.asm.org/

Dow

nloaded from

http://cvi.asm.org/

13

for seasonal influenza virus (5, 27, and 10 samples for influenza A (H1N1 and H3N2) 1

and B viruses). 2

These clinical samples were then used to test the new kits for H1N1 pdm, 3

together with Capilia Flu A+B as a control. The sensitivity, specificity, positive 4

predictive value (PPV) and negative predictive value (NPV) of the individual test kits 5

are summarized in Table 2. H1N1 pdm anti-NP kit showed 85.5% sensitivity, 100% 6

specificity, 100% PPV, and 87.6% NPV. These values were significantly higher than 7

those for H1N1 pdm anti-HA kit, and slightly higher than those for Capilia Flu A+B. 8

Six clinical samples that tested negative for all subtypes of influenza virus by RT-PCR 9

showed a positive reaction with the H1N1 pdm anti-HA kit, probably due to a 10

nonspecific reaction with the N-SW2-6 MAb. The sensitivity of Capilia Flu A+B was 11

84.8% for the detection of both H1N1 pdm and seasonal influenza A virus, and 79.5% 12

for the detection of H1N1 pdm. One clinical sample that tested negative for all 13

subtypes by RT-PCR showed bands for both influenza A and B viruses with the Capilia 14

Flu A+B, again probably due to a nonspecific reaction. 15


http://cvi.asm.org/

Dow

nloaded from

http://cvi.asm.org/

14

DISCUSSION 1

2

In this study, we developed two rapid diagnostic test kits using newly 3

prepared murine MAbs that react with the HA and NP proteins of H1N1 pdm, but not 4

those of seasonal influenza viruses. The H1N1 pdm anti-NP kit showed high 5

sensitivity and specificity, reacting with H1N1 pdm but not seasonal influenza A viruses 6

in clinical specimens. The estimates for this test kit were slightly higher than those for 7

Capilia Flu A+B developed for seasonal influenza A or B viruses. 8

Similar approaches to the rapid diagnosis of H1N1 pdm infections using 9

anti-NP MAb have been reported. Miyoshi-Akiyama et al. (17) developed a test kit 10

that can be used to distinguish H1N1 pdm from seasonal influenza A (H1N1 and H3N2) 11

and B viruses. They used an anti-NP MAb obtained from mice immunized with H5N1 12

and evaluated it using 5 clinical specimens. Choi et al. (3) evaluated the newly 13

available SD Bioline Influenza Ag A/B/A(H1N1) Pandemic test kit with a large number 14

of clinical specimens, although they did not give any information on the antibody in the 15

kit. 16

Several rapid diagnostic test kits, so-called “point-of-care” or “on-spot” 17

diagnostic test kits, are commercially available in many countries. Kits for the 18


http://cvi.asm.org/

Dow

nloaded from

http://cvi.asm.org/

15

diagnosis of seasonal influenza A or B viral infections have been widely used, 1

especially in Japan, to avoid delayed diagnostic testing that could affect antiviral 2

treatment. In addition, patients with underlying diseases such as diabetes and renal 3

disease as well as obese individuals and pregnant women are often severely affected by 4

infections of H1N1 pdm (13, 15). Therefore, a point of care strategy with the rapid 5

diagnosis of H1N1 pdm infections seems crucial for efficient clinical treatment. In 6

addition, pediatric infections with this virus can also caused severe illness (9), although 7

the sensitivity of existing test kits was shown to be significantly higher in children 5 8

years of age or younger (4, 10). 9

H1N1 pdm anti-NP test kit could be useful not only for the conformational test 10

for H1N1 pdm at the clinical hospitals, but also for the surveillance of the antigenic 11

shift and drift of seasonal and zoonotic influenza viruses at laboratories. 12


http://cvi.asm.org/

Dow

nloaded from

http://cvi.asm.org/

16

ACKNOWLEDGMENTS 1

2

This study was part of a collaborative research project between Osaka 3

University and Tanaka Kikinzoku Kogyo Corporation-Alfresa Pharma Corporation. 4

This study was partly supported by Japan Science and Technology Agency (JST)/Japan 5

International Cooperation Agency (JICA), “Science and Technology Research 6

Partnership for Sustainable Development (SATREPS)”. 7

8


http://cvi.asm.org/

Dow

nloaded from

http://cvi.asm.org/

17

REFERENCES 1

2

1. Centers for Disease Control and Prevention. 2009. H1N1 flu clinical and public 3

health guidance [cited 2009 Nov. 20]. http://www/cdc/gov/H1N1flu/guidance/ 4

2. Chan, K. H., S. T. Lai, L. L. Poon, Y. Guan, K. Y. Yuen, and J. S. Peiris. 2009. 5

Analytical sensitivity of rapid influenza antigen detection tests for swine-origin 6

influenza virus (H1N1). J. Clin. Virol. 45:205-207. 7

3. Choi, Y. J,, H. J. Kim, J. S. Park, M. H. Oh, H. S. Nam, Y. B. Kim, B. K. Cho, 8

M. J. Ji, and J. S. Oh. 2010. Evaluation of new rapid antigen test for the detection 9

of pandemic influenza A/H1N1 2009 virus. J. Clin. Microbiol. 48:2260-2262. 10

4. Cruz, A. T., G. J. Demmler-Harrison, A. C. Caviness, G. J. Buffone, and P. A. 11

Revell. 2010. Performance of a rapid influenza test in children during the H1N1 12

2009 influenza a outbreak. Pediatrics 125:e645-e650. 13

5. Daidoji, T., T. Koma, A. Du, C. S. Yang, M. Ueda, K. Ikuta, and T. Nakaya. 14

2008. H5N1 avian influenza virus induces apoptotic cell death in mammalian 15

airway epithelial cells, J. Virol. 82:11294-11307. 16

6. Drexler, J. F., A. Helmer, H. Kirberg, U. Reber, M. Panning, M. Müller, K. 17

Höfling, B. Matz, C. Drosten, and A. M. Eis-Hübinger. 2009. Poor clinical 18


http://cvi.asm.org/

Dow

nloaded from

http://cvi.asm.org/

18

sensitivity of rapid antigen test for influenza A pandemic (H1N1) 2009 virus. Emerg. 1

Infect. Dis. 15:1662-1664. 2

7. Faix, D. J., S. S. Sherma, and S. H. Waterman. 2009. Rapid-test sensitivity for 3

novel swine-origin influenza A (H1N1) virus in humans. N. Eng. J. Med. 4

361:728-729. 5

8. Ganzenmueller, T., J. Kluba, B. Hilfrich, W. Puppe, W. Verhagen, A. Heim, T. 6

Schulz, and C. Henke-Gendo. 2010. Comparison of the performance of direct 7

fluorescent antibody staining, a point-of-care rapid antigen test and virus isolation 8

with that of RT-PCR for the detection of novel 2009 influenza A (H1N1) virus in 9

respiratory specimens. J. Med. Microbiol. 59:713-717. 10

9. Halasa, N. B. 2010. Update on the 2009 pandemic influenza A H1N1 in children. 11

Curr. Opin. Pediatr. 22:83-87. 12

10. Hawkes, M., S. E. Richardson, M. Ipp, S. Schuh, D. Adachi, and D. Tran. 2010. 13

Sensitivity of rapid influenza diagnostic testing for swine-origin 2009 a (H1N1) 14

influenza virus in children. Pediatrics 125:e639-e644. 15

11. Herzum, I., T. Lutz, F. Koch, R. Geisel, and A. Gehrt. 2010. Diagnostic 16

performance of rapid influenza antigen assays in patients infected with the new 17

influenza A (H1N1) virus. Clin. Chem. Lab. Med. 48:53-56. 18


http://cvi.asm.org/

Dow

nloaded from

http://cvi.asm.org/

19

12. Hurt, A. C., C. Bass, Y. Deng, S. Roberts, A. Kelso, and I. G. Barr. 2009. 1

Performance of influenza rapid point-of-care tests in the detection of swine lineage 2

A (H1N1) influenza viruses. Influenza Other Respi. Viruses 3:171-176. 3

13. Jain, S., L. Kamimoto, A. M. Bramley, A. M. Schmitz, S. R. Benoit, J. Louie, D. 4

E. Sugerman, J. K. Druckenmiller, K. A. Ritger, R. Chugh, S. Jasuja, M. 5

Deutscher, S. Chen, J. D. Walker, J. S. Duchin, S. Lett, S. Soliva, E. V. Wells, D. 6

Swerdlow, T. M. Uyeki, A. E. Fiore, S. J. Olsen, A. M. Fry AM, C. B. Bridges, 7

and L. Finelli. 2009. Hospitalized patients with 2009 H1N1 influenza in the United 8

States, April-June 2009. N. Engl. J. Med. 361:1935-1944. 9

14. Kok, J., C. C. Blyth, H. Foo, J. Patterson, J. Taylor, K. McPhie, V. M. 10

Ratnamohan, J. R. Iredell, and D. E. Dwyer. 2010. Comparison of a rapid antigen 11

test with nucleic acid testing during cocirculation of pandemic influenza A/H1N1 12

2009 and seasonal influenza A/H3N2. J. Clin. Microbiol. 48:290-291. 13

15. La Ruche, G., A. Tarantola, P. Barboza, L. Vaillant, J. Gueguen, M. 14

Gastellu-Etchegorry, and epidemic intelligence team at InVS. 2009. The 2009 15

pandemic H1N1 influenza and indigenous populations of the Americas and the 16

Pacific. Euro. Surveill. 14. 17


http://cvi.asm.org/

Dow

nloaded from

http://cvi.asm.org/

20

16. Louie, J. K., H. Guevara, E. Boston, M. Dahike, M. Nevarez, T. Kong, R. 1

Schechter, C. A. Glaser, and D. P. Schnurr. 2010. Rapid influenza antigen test for 2

diagnosis of pandemic (H1N1) 2009. Emerg. Infect. Dis. 16:824-826. 3

17. Miyoshi-Akiyama, T., K. Narahara, S. Mori, H. Kitajima, T. Kase, S. 4

Morikawa, and T. Kirikae. 2010. Development of an immunochromatographic 5

assay specifically detecting pandemic H1N1 (2009) influenza virus. J. Clin. 6

Microbiol. 48:703-708. 7

18. Neumann, G., T. Noda, and Y. Kawaoka. 2009. Emergence and pandemic 8

potential of swine-origin H1N1 influenza virus. Nature 459:931-939. 9

19. Okuno, Y., Y. Isegawa, F. Sasao, and S. Ueda. 1993. A common neutralizing 10

epitope conserved between the hemagglutinins of influenza A virus H1 and H2 11

strains. J. Virol. 67:2552-2558. 12

20. Smith, G. J., D. Vijaykrishna, J. Bahl, S. J. Lycett, M. Worobey, O. G. Pybus, S. 13

K. Ma, C. L. Cheung, J. Raghwani, S. Bhatt, J. S. Peiris, Y. Guan, and A. 14

Rambaut. 2009. Origin and evolutionary genomics of the 2009 swine-origin H1N1 15

influenza A epidemic. Nature 459:1122-1125. 16


http://cvi.asm.org/

Dow

nloaded from

http://cvi.asm.org/

21

21. Tang, J. W., N. Shetty, and T. T. Lam. 2010. Features of the new pandemic 1

influenza A/H1N1/2009 virus: virology, epidemiology, clinical and public health 2

aspects. Curr. Opin. Pulm. Med. 16: 235-241. 3

22. Taylor, J., K. McPhie, J. Druce, C. Birch, and D. E. Dwyer. 2009. Evaluation of 4

twenty rapid antigen tests for the detection of human influenza A H5N1, H3N2, 5

H1N1, and B viruses. J. Med. Virol. 81:1918-1922. 6

23. Ueda M, A. Maeda, N. Nakagawa, T. Kase, R. Kubota, H. Takakura, A. 7

Ohshima, Y. Okuno. 1998. Application of subtype-specific monoclonal antibodies 8

for rapid detection and identification of influenza A and B viruses. J Clin Microbiol. 9

36:340-344. 10

24. Ueda, M., M. Yamate, A. Du, T. Daidoji, Y. Okuno, K. Ikuta, and T. Nakaya. 11

2008. Maturation efficiency of viral glycoproteins in the ER impacts the production 12

of influenza A virus. Virus Res. 136:91-97. 13

25. Vasoo, S., J. Stevens, and K. Singh. 2009. Rapid antigen tests for diagnosis of 14

pandemic (Swine) influenza A/H1N1. Clin. Infect. Dis. 49:1090-1093. 15

26. Yamada, A., J. Imanishi, E. Nakajima, K. Nakajima, and S. Nakajima. 1991. 16

Detection of influenza viruses in throat swab by using polymerase chain reaction. 17

Microbiol. Immunol. 35:259-265. 18


http://cvi.asm.org/

Dow

nloaded from

http://cvi.asm.org/

22

27. Yamate, M., M. Yamashita, T. Goto, S. Tsuji, Y. G. Li, J. Warachit, M. Yunoki, 1

and K. Ikuta. 2005. Establishment of Vero E6 cell clones persistently infected with 2

severe acute respiratory syndrome coronavirus. Microbes Infect. 7:1530-1540. 3


http://cvi.asm.org/

Dow

nloaded from

http://cvi.asm.org/

23

FIGURE LEGENDS 1

2

FIG. 1. Confocal immunostaining of H1N1 pdm-infected MDCK cells with 3

the newly prepared murine MAbs. MDCK cells were mock-infected or infected with 4

seasonal H1N1 (A/New Caledonia/20/99) or H1N1 pdm (A/Suita/01/2009). The 5

ascites fluids for N-SW2-6, N-SW4-5, and N-SW4-6 were diluted 1000-fold and used 6

for the staining. C179 and C43 were used as anti-HA and anti-NP control murine 7

MAbs that are common to both seasonal H1N1 and H1N1 pdm viruses. 8

9

FIG. 2. Specific immunostaining of H1N1 pdm HA and NP proteins in 10

transfected 293T cells with the newly prepared murine MAbs. 293T cells were 11

mock-transfected with empty plasmid or transfected with plasmid expressing HA or NP 12

protein of H1N1 pdm. The ascites fluids for N-SW2-6, N-SW4-5, and N-SW4-6 were 13

diluted and used for staining, as in Fig. 1. The control murine MAbs were C43 and 14

C179, also as in Fig. 1. 15

16

FIG. 3. Typical banding profiles of the rapid diagnostic test kits with the 17

newly prepared murine MAbs. A) Serial 10-fold dilutions of the H1N1 pdm 18

(A/Suita/01/09) solution, corresponding to 1.0 x 105 to 1.0 x 10-2 FFU/ml, were 19

subjected to RT-PCR with the newly designed primer set for H1N1 pdm. B) 20

Representative profiles of the H1N1 pdm anti-NP and anti-HA test kits using the H1N1 21

pdm viral samples with the same dilutions are shown. As a control, the results for 22


http://cvi.asm.org/

Dow

nloaded from

http://cvi.asm.org/

24

Capilia Flu A+B with the same samples are shown. 1


http://cvi.asm.org/

Dow

nloaded from

http://cvi.asm.org/

Table 1. Primer sets used to determine the subtype of influenza virus in the patients’ specimens by RT-PCR.

Subtype Primer Sequence Position Reference strain Accession number

NP-SF04 CGCAGGCCAGATCAGTGT 1206-1223 H1N1 pdm

NP NP-SF05 CGGATGTCCGTCCTTCATTG 1315-1296 A/California/04/09 FJ966083

HA1-1N TGAGGGAGCAATTGAGTTCA 320-339 Seasonal

H1N1 HA1-1C TGCCTCAAATATTATTGTGT 747-728 A/New Caledonia/20/99 EF566076.1

HA3-5al GAGCTGGTTCAGAGTTCCTC 197-216 Seasonal

H3N2 HA3-3al GTGACCTAAGGGAGGCATAATC 407-386 A/Aichi/2/68 M55059.1

NP-5bl GAAGTAGGTGGAGACGGAGGG 1387-1407 Seasonal

B NP-3bl GTAAACACCCACATTCCAAACG 1777-1756 B/Malaysia/2506/04 CY038290.1


http://cvi.asm.org/

Dow

nloaded from

http://cvi.asm.org/

Table 2. Summarized results for the newly developed IC test kits with specimens from patients with influenza -like illness.

RT-PCR (Specimen number1)

IC test kit Negative H1N1 pdm

Seasonal A

(H1, H3) or B

Sensitivity (%) Specificity (%) PPV2 (%) NPV

3 (%)

+ 0 71 0 H1N1 pdm

anti-NP kit － 43 12 42 85.5 100 100 87.6

+ 6 41 0 H1N1 pdm

anti-HA kit － 37 42 42 49.4 93.0 87.2 65.3

+ 1 66 40 Capilia Flu A+B

4

－ 42 17 2

84.8

(79.5)5

97.7 99.1 68.9

1 The same patients’ specimens used for IC test kits were also used for RNA extraction to determine the subtype of influenza virus by

RT-PCR using primer sets shown in Table 1 and the resulting specimen’s number is described in this column. 2

PPV = Positive Predictive Value.

3 NPV = Negative Predictive Value.

4 All estimates (%) for Capilia were calculated for both the seasonal influenza A (H1N1 and H3N2) and B viruses and H1N1 pdm.

5 % Sensitivity of Capilia kit for H1N1 pdm. % Sensitivity of Capilia kit for H1N1 pdm is shown in parentheses.


http://cvi.asm.org/

Dow

nloaded from

http://cvi.asm.org/


http://cvi.asm.org/

Dow

nloaded from

http://cvi.asm.org/


http://cvi.asm.org/

Dow

nloaded from

http://cvi.asm.org/


http://cvi.asm.org/

Dow

nloaded from

http://cvi.asm.org/

Documents

1 Development of Two Types of Rapid Diagnostic Test Kits to Detect