1 Running head: Novel tobacco proteins required for nicotine

1

Running head: Novel tobacco proteins required for nicotine biosynthesis

Corresponding author:

Professor Takashi Hashimoto

Graduate School of Biological Sciences, Nara Institute of Science and Technology,

8916-5 Takayama-cho, Ikoma, Nara 630-0192, Japan

[email protected], TEL (+81)743-72-5520, FAX (+81)743-72-5529

Journal research area:

Biochemical Processes and Macromolecular Structures

Plant Physiology Preview. Published on February 22, 2011, as DOI:10.1104/pp.110.170878

Copyright 2011 by the American Society of Plant Biologists

www.plantphysiol.orgon March 24, 2018 - Published by Downloaded from Copyright © 2011 American Society of Plant Biologists. All rights reserved.

http://www.plantphysiol.org

2

Vacuolar-localized berberine bridge enzyme-like proteins are required for a late step of

nicotine biosynthesis in tobacco

Masataka Kajikawa, Tsubasa Shoji, Akira Kato, and Takashi Hashimoto*

Graduate School of Biological Sciences, Nara Institute of Science and Technology,

8916-5 Takayama-cho, Ikoma, Nara 630-0192, Japan



3

Footnote:

This study was supported in part by the Global COE program of NAIST (Frontier

Biosciences: Strategies for survival and adaptation in a changing global environment)

from the Ministry of Education, Sports, Science, and Technology, Japan.

*Corresponding author; [email protected]



4

Abstract

Tobacco plants (Nicotiana tabacum) synthesize nicotine and related pyridine-type

alkaloids, such as anatabine, in their roots and accumulate them in their aerial parts as

chemical defenses against herbivores. Herbivory-induced jasmonate-signaling

activates structural genes for nicotine biosynthesis and transport, by way of the NIC

regulatory loci. The biosynthesis of tobacco alkaloids involves the condensation of an

unidentified nicotinic acid-derived metabolite with the N-methylpyrrolinium cation or

with itself, but the exact enzymatic reactions and enzymes involved remain unclear.

We here report that jasmonate-inducible tobacco genes encoding flavin-containing

oxidases of the berberine bridge enzyme family (BBLs) are expressed in the roots and

regulated by the NIC loci. When expression of the BBL genes was suppressed in

tobacco hairy roots or in tobacco plants, nicotine production was highly reduced with a

gradual accumulation of a novel nicotine metabolite, dihydromethanicotine. In the

jasmonate-elicited cultured tobacco cells, suppression of BBL expression efficiently

inhibited the formation of anatabine and other pyridine alkaloids. Subcellular

fractionation and localization of green fluorescent protein-tagged BBLs showed that

BBLs are localized in the vacuoles. These results indicate that BBLs are involved in a

late oxidation step subsequent to the pyridine-ring condensation reaction in the

biosynthesis of tobacco alkaloids.

Keywords

Alkaloid, berberine bridge enzyme, flavin, NIC loci, nicotine, tobacco



5

Tobacco (Nicotiana tabacum) and other Nicotiana species synthesize nicotine to mount

defensive responses to insect herbivores. Because the activation of acetylcholine

receptors is inherently toxic to all heterotrophs with neuromuscular junctions, nicotine

is thought to be a broadly effective plant defense metabolite (Baldwin, 2001). A

reduction in the amount of nicotine in the tobacco leaf, due to either natural variation

(Jackson et al., 2002) or genetic manipulation (Steppuhn et al., 2004), results in more

pronounced damage by insect herbivores. Tobacco plants sense browsing insects on

their leaves, and increase the de novo synthesis of nicotine by utilizing the general

jasmonate signaling pathway and nicotine-specific regulatory components (Shoji and

Hashimoto, 2010). The highly bioactive isoleucine conjugate of jasmonate is

perceived by a complex of CORONATINE INSENSITIVE 1 and the transcriptional

repressors JAZs (Sheard et al., 2010), resulting in JAZs’ degradation and a subsequent

release of transcription repression (Chini et al., 2007). Tobacco orthologs of these

signaling proteins are utilized in tobacco to regulate jasmonate-inducible nicotine

biosynthesis (Shoji et al., 2008). As reported recently (Shoji et al., 2010), several

tobacco transcription factors, including ERF189, of an ethylene response factor (ERF)

subfamily are encoded in clustered genes at the nicotine regulatory locus NIC2, and

bind to the GCC-box element in the promoter of the putrescine N-methyltransferease

gene (PMT; Hibi et al., 1994). ERF189 and related tobacco transcription factors are

shown to directly and specifically activate all known structural genes in the nicotine

pathway (Shoji et al., 2010).

The early enzymatic steps of nicotine biosynthesis are well established



6

(Supplemental Fig. S1). The pyrrolidine ring of nicotine is derived from putrescine,

via consecutive reactions involving the enzymes PMT and N-methylputrescine oxidase

(MPO; Heim et al., 2007; Katoh et al., 2007), which together produce the

N-methylpyrrolinium cation, whereas the pyridine ring uses enzymes involved in the

early steps of NAD biosynthesis, such as aspartate oxidase, quinolinic acid synthase,

and quinolinic acid phosphoribosyl transferase (Sinclair et al., 2000; Katoh et al., 2006).

The genes for these five enzymes are coordinately regulated in tobacco roots (Shoji et

al., 2010). When isotopically labeled nicotinic acids were fed to tobacco plants, the

isotope labels were incorporated into the pyridine ring of nicotine (Dawson et al., 1956).

Interestingly, the tritium label at C-6 of nicotinic acid was specifically lost in isolated

nicotine (Dawson et al., 1960; Leete and Liu, 1973), suggesting that the C-6 position is

first oxidized and subsequently reduced during the incorporation of nicotinic acid into

nicotine. The putative oxidoreductases involved in the activation of nicotinic acid and

the mechanisms behind the nicotine-forming condensation reactions between a nicotinic

acid-derived intermediate and the N-methylpyrrolinium cation are yet to be clarified.

A PIP family oxidoreductase, A622, is required for the biosynthesis of tobacco alkaloids,

possibly in a step to produce a nicotinic acid-derived precursor, but the exact enzymatic

reaction catalyzed by A622 is not known (Deboer et al., 2009; Kajikawa et al., 2009).

Besides nicotine, other pyridine alkaloids also accumulate at substantial levels

in tobacco roots, in elicited cultured tobacco cells, and in wild Nicotiana species

(Supplemental Fig. S1; Saito et al., 1985; Shoji and Hashimoto, 2010). Anatabine is

synthesized by the dimerization of a metabolite of nicotinic acid (Leete and Slattery,



7

1976), whereas the piperidine ring of anabasine is derived from lysine by way of

cadaverine (Watson et al., 1990). Anatalline consists of two pyridyl rings and a central

piperidine ring (Häkkinen et al., 2004). The biosynthesis of tobacco alkaloids

consisting of more than two six-membered heterocyclic rings may involve the same ring

condensation reactions as predicted for the production of nicotine. Indeed, suppression

of A622, an enzyme proposed to form a coupling-competent nicotinic acid intermediate,

in tobacco roots and cultured tobacco cells inhibited the formation of not only nicotine

but also other pyridine alkaloids (Kajikawa et al., 2009). Nornicotine is formed from

nicotine by cytochrome P450 monooxygenases of the CYP82E subfamily in tobacco

leaf tissues (Siminszky et al., 2005; Xu et al., 2007; Lewis et al., 2010), but the pathway

of nornicotine biosynthesis in other cell types is not established.

In this study, we identified vacuolar-localized tobacco flavoproteins, BBLs,

that were required for the synthesis of nicotine, anatabine, anabasine, and anatalline.

The accumulation of a novel pyridine alkaloid in BBL-suppressed tobacco root tissues

suggests that BBLs are involved in a late, possibly the final, step of tobacco alkaloid

biosynthesis. The dimerization of a pyridine ring with an unsaturated pyrrolidine or

piperidine ring appears to involve multiple oxidoreductases of different families.

RESULTS

Isolation of NIC-Regulated BBL Genes from Tobacco

To identify novel genes that are controlled by the NIC regulatory loci, we compared

comprehensive cDNA expression profiles of wild-type tobacco roots and nic1nic2



8

double mutant roots obtained using tobacco oligonucleotide microarrays (Katoh et al.,

2007; Shoji et al., 2010). One tobacco gene (BBLa) encoding a berberine bridge

enzyme-like protein (BBL) was identified as a putative target of the NIC regulatory loci.

After searching the tobacco genome database (http://solgenomics.net/) and extensive

PCR screening and sequencing, we recovered four tobacco BBL cDNAs encoding

full-length proteins (BBLa, BBLb, BBLc and BBLd). BBLb has been reported as a

jasmonate-inducible gene in cultured tobacco BY-2 cells (Goossens et al., 2003).

BBLa is 94%, 83%, and 63% identical in amino acid sequence to BBLb, BBLc, and

BBLd, respectively (Supplementary Fig. S2). These tobacco BBLs constitute a

distinct clade in the FAD-containing oxidoreductase family that includes berberine

bridge enzymes (BBEs), carbohydrate oxidases, cannabinoid synthases, and

6-hydroxynicotine oxidases (Fig. 1). Tobacco BBL genes contained no introns.

Genomic PCR using primers specific to each BBL gene amplified BBLa and BBLc from

the genomic DNA of N. tabacum and N. sylvestris, and BBLb and BBLd from that of N.

tabacum and N. tomentosiformis (Fig. 2A). Therefore, the diploid progenitors of N.

tabacum possess two related BBL genes; BBLa and BBLc probably originate from N.

sylvestris, whereas BBLb and BBLd may be derived from N. tomentosiformis.

Expression profiles of BBLs were analyzed by reverse transcription (RT)-PCR.

By using specific primers to amplify each BBL gene, we showed that BBLa, BBLb, and

BBLc are expressed in wild-type tobacco roots, but BBLd mostly is not (Fig. 2B).

Levels of BBLa-c expression were markedly low in the nic1nic2 mutant roots,

indicating that they were positively regulated by the NIC loci. Quantitative RT-PCR



9

using a common primer set that amplified all BBL genes was next conducted to examine

tissue-specific and jasmonate-inducible expression patterns. BBLs were expressed

strongly in the root but at very low or negligible levels in the stem and leaf of wild-type

tobacco plants (Fig. 2C). In the nic1nic2 mutant roots, the abundance of the BBL

transcripts was reduced by 80% (Fig. 2C). The application of 50 μM methyljasmonate

(MeJA) increased BBL expression 4-5-fold in the wild-type tobacco roots (Fig. 2D), and

strongly induced BBL expression from an initially very low level within 30 min in

cultured tobacco BY-2 cells (Fig. 2E). When the expression of the NIC2-locus ERF

genes, which specifically activated all known structural genes of nicotine biosynthesis

(Shoji et al., 2010), was suppressed by the constitutive expression of a dominant

repressive form of ERF189 in two transgenic tobacco root lines (D1 and D2; see Shoji

et al., 2010), expression of the BBL genes was effectively reduced by more than 80%

(Fig. 2F). Furthermore, overexpression of ERF189 in three transgenic tobacco root

lines (OE9, OE10, and OE11; see Shoji et al., 2010) resulted in 2-3-fold increases in the

levels of the BBL transcripts (Fig. 2G). These expression patterns of BBLs are highly

similar to those of structural genes involved in the biosynthesis and transport of nicotine

(Hibi et al., 1994; Reed and Jelesko, 2004; Cane et al., 2005; Katoh et al., 2007; Shoji et

al., 2009; Kajikawa et al., 2009; Shoji et al., 2010).

Constitutive BBL Knockdown in Tobacco Hairy Roots

To investigate their possible roles in the biosynthesis of tobacco alkaloids, we first

suppressed the expression of BBL genes constitutively with RNA interference (RNAi) in



10

tobacco hairy roots, using the cauliflower mosaic virus 35S promoter. Three

independent transgenic lines (KR1, KR2, and KR3) were obtained in which the

transcript levels of BBLa, BBLb, and BBLc were highly reduced (Fig. 3A). When the

accumulation of BBL proteins was analyzed by immunoblotting using the BBL-specific

antiserum, the wild-type (WT) and two vector control (VC) hairy root lines showed

signals for BBLs of 58 kD (isoform I) and 53 kD (isoform II), whereas the three KR

lines did not (Fig. 3B). Since the predicted full-length forms of BBLa, BBLb, and

BBLc are 62 kD, 63 kD, and 62 kD, respectively, BBLs are processed in tobacco cells

to yield two smaller protein species. Suppression of BBL expression did not affect

the growth of the hairy roots.

Tobacco alkaloids consisted mostly of nicotine, in addition to a smaller

amount of nornicotine, in the WT and VC hairy roots (Fig. 3C). Nicotine levels were

much lower in the KR lines (1-3 μmol g-1 dry weight) than the WT and VC lines (13-16

μmol g-1 dry weight). In contrast, nornicotine levels were slightly higher in the KR

lines (4-6 μmol g-1 dry weight) than the WT and VC lines (2 μmol g-1 dry weight).

Interestingly, an unknown compound was detected in the KR lines at a retention time of

19.7 min in the gas-liquid chromatograms (Fig. 4A). This novel metabolite was

identified as dihydrometanicotine (DMN; Fig. 4C) by comparing its retention time in

the gas-liquid chromatograms (Fig. 4A), its mass spectra (Fig. 4B), and its mobility

shift in the thin layer chromatograms (Fig. 5C), with the authentic compound. DMN

has been isolated as a catabolite of nicotine in mammals (De Clercq and Truhaut, 1962;

Neurath et al., 1966), but had not been found in plants. DMN was only detectable in



11

the KR lines where it accumulated at levels comparable to nicotine (2-3 μmol g-1 dry

weight) (Fig. 3C).

Inducible BBL Knockdown in Tobacco Hairy Roots

To examine the time courses of the reduction in nicotine and accumulation of DMN

after suppression of the BBL genes, we used an inducible expression system (the

XVE-β-estradiol system; Zuo et al., 2000) to drive RNAi-based gene suppression.

Two independent tobacco hairy root lines (iKR1 and iKR2) were obtained in which

expression of the BBL genes was efficiently suppressed after the addition of the inducer

β-estradiol to the culture medium. In the iKR1 line, the levels of the BBL proteins

began to decrease after two days of treatment, and were very low by the third day (Fig.

5A). We did not observe inhibitory effects of the inducer on root growth in the iKR

lines, or on the accumulation of tobacco alkaloids in wild-type and vector control roots

(also see Kajikawa et al., 2009). When the iKR line was treated with the inducer, the

formation of nicotine continued for two days and then stopped, whereas the untreated

iKR roots continued to synthesize nicotine (Fig. 5B). DMN became detectable after

two days of treatment, and continued to increase thereafter. It should be noted,

however, that the accumulation of DMN was very small compared to the suppressed

level of nicotine synthesis. For example, at day seven, the production of as much as 17

μmol g-1 dry weight of nicotine was estimated to be inhibited by the suppression of

BBLs, but DMN merely accumulated to a level of 0.5 μmol g-1 dry weight. Similar

results were obtained in another inducible BBL-knockdown line, iKR2 (Fig. S5).



12

When the alkaloid extracts from iKR hairy roots were analyzed by thin layer

chromatography, two metabolites with Rf values of 0.01 and 0.07, in addition to DMN

(Rf 0.11), were detected using Dragendorff’s reagent after the suppression of BBLs (Fig.

5C). Although the chemical structure of these metabolites was not determined, their

reactivity toward Dragendorff’s reagent suggests that they contain nitrogen. These

two compounds also accumulated in the BBL-suppressed lines KR1-3, but not in the

untreated iKR lines, VC lines, or wild-type tobacco roots (data not shown). Thus, at

least three metabolites, including DMN, accumulate in tobacco cells as a consequence

of the BBL suppression.

BBL Knockdown in Transgenic Tobacco Plants

To evaluate consequences of the BBL suppression in tobacco plants, we constitutively

suppressed the expression of the BBL genes by RNAi in transgenic tobacco plants. Six

independent transgenic lines (KP1, KP2, KP3, KP4, KP5, and KP6) showed little

accumulation of BBL proteins in the immunoblot analysis (Fig. 6A). Suppression of

BBLs did not affect the growth or development of the KP tobacco plants. We analyzed

tobacco alkaloids in the leaves and roots of one-month-old plants. Nicotine was the

predominant alkaloid in both parts in wild-type plants (Fig. 6B, C). In the leaves, the

amounts of nicotine and nornicotine (μmol g-1 dry weight) were much lower in the KP

plants (1-8 and 0.3-3 μmol g-1 dry weight, respectively) than wild-type plants (22 μmol

and 5 μmol g-1 dry weight, respectively). We did not detect DMN in the leaves of

either wild-type or KP plants. In the roots, the nicotine content was considerably



13

lower in the KP plants (1-3 μmol g-1 dry weight) than wild-type plants (4 μmol g-1 dry

weight), whereas the nornicotine content was somewhat higher in the KP plants (0.6-1

μmol g-1 dry weight) than wild-type plants (0.4 μmol g-1 dry weight). Interestingly,

DMN was the most abundant alkaloid in the roots of the KP plants, reaching 12-21

μmol g-1 dry weight, but was absent in the wild-type roots (Fig. 6C). DMN may

accumulate in the root tissue, possibly because of its inability to be transported to the

aerial tissues via the xylem.

BBL Knockdown in Cultured Tobacco Cells

Next, we examined whether BBLs are required for the synthesis of anatabine, anabasine,

and anatalline, which consist entirely of the pyridine moiety. Cultured tobacco BY-2

cells mainly produce these pyridine-type alkaloids upon elicitation by MeJA since they

do not synthesize the N-methylpyrrolinium cation, due to very inefficient expression of

the N-methylputrescine oxidase genes (Shoji and Hashimoto, 2008). The metabolic

impact of BBL suppression was thus examined in the MeJA-elicited BY-2 cells. Two

control cell lines (VC1 and VC2) were transformed with an empty vector, and two KB

cell lines (KB1 and KB2) were transformed with the BBL RNAi vector. An

immunoblot analysis showed that 50 μM MeJA induced the expression of BBL proteins

in the wild-type and VC cell lines, but not in the KB line cells (Fig. 7A). Anatabine

was the major alkaloid in the MeJA-elicited wild-type and VC cells; nicotine and

anatalline were the next most abundant alkaloids, and anabasine was a minor alkaloid

(Fig. 7B). The amount of anatabine in the two KB cell lines was 1-3% of that in the



14

wild-type and VC cell lines. Other tobacco alkaloids (nicotine, anatalline, and

anabasine) also accumulated at highly reduced levels in the KB cell lines, compared to

the wild-type and VC cell lines (Fig. 7C). DMN and other novel metabolites were not

detected in the MeJA-elicited KB cell lines, when analyzed by gas-liquid

chromatography.

Subcellular Localization of BBL Proteins

To examine the subcellular localization of the BBL proteins, we expressed a fusion

protein comprising the full-length BBLa and green fluorescent protein (GFP) in cultured

tobacco BY-2 cells, and analyzed its distribution by confocal laser microscopy. The

cultured cells contained large central vacuoles, which could be labeled by the

vacuole-targeting marker SP-GFP-2SC (Mitsuhashi et al., 2000; Fig. 8A). BBLa-GFP

was consistently observed in the central vacuoles (Fig. 8B). Accordingly, secretion

signal peptides were predicted at the N-termini of BBLa (21 amino acids), BBLb (22

amino acids), and BBLc (22 amino acids) by the motif prediction program, SignalP

(Emanuelsson et al., 2007) (see Fig. S3). To test the function of these N-terminal

sequences, we fused the N-terminal 50 amino acids of BBLs to GFP, and expressed

BBL(1-50)-GFP proteins in cultured tobacco cells. BBLa(1-50)-GFP was transported

to the vacuole, which was demarked by the FM4-64-labeled tonoplast (Fig. 8C).

Similarly, BBLb(1-50)-GFP and BBLc(1-50)-GFP were also located in the central

vacuoles (Fig. S4). These results indicate that the N-terminal region of BBLs contains

the vacuolar sorting determinants.



15

To further support the vacuolar localization of BBL proteins, vacuole-rich

vesicles and cytoplasm-rich mini-protoplasts were purified by Percoll gradient

centrifugation of protoplasts prepared from the BBLa-expressing BY-2 cells (Hamada et

al., 2004; Fig. 8D). Immunoblotting with an antiserum against an established

vacuole-resident protein, class I chitinase (Matsuoka et al., 1995), confirmed the purity

of the prepared fractions. A BBL of 58 kD (isoform I) was detected by the antiserum

in the protoplasts and the vacuole-rich vesicles, but not in the mini-protoplasts,

indicating that BBLs are highly enriched in the vacuole-rich vesicles. The signal

intensity of a smaller BBL, isoform II (53 kD), was below the detection limit.

Biochemical Properties of Recombinant BBL Proteins Produced in Yeast

To gain insights into the biochemical properties of BBLs, we expressed recombinant

BBL proteins as secreted forms in the methyrotrophic yeast Pichia pastoris, and

purified them from the culture medium. The predicted N-terminal signal sequence of

BBLs was substituted with the signal sequence of yeast α-factor, and the Strep tag was

added to the C-terminus of BBLs. Since we obtained the highest expression level for

BBLa, compared to BBLb and BBLc, we purified the recombinant BBLa from the

culture medium. The recombinant BBLa (95 kD) was much larger than the theoretical

size of BBLa (60 kD) that lacked the predicted secretion signal sequence, and was

found to be glycosylated, as revealed by Periodic acid-Schiff (PAS) staining (Fig. 9A).

When the purified BBLa protein was treated by an endoglycosidase, EndoHf, the

deglycosylated form had a theoretical molecular mass of 60 kD, and was insensitive to



16

PAS staining (Fig. 9A, B), indicating that the secreted recombinant BBLa protein was

highly N-glycosylated by the endogenous glycosyltransferases of the yeast host. The

two endogenous BBL isoforms (53 kD and 58 kD; lane 2 in Fig. 9B) found in the

MeJA-treated tobacco BY-2 cells were smaller than the 60-kD deglycosylated BBLa

expressed in yeast (lane 1 in Fig. 9B).

The concentrated solution of the recombinant BBLa protein that had been

purified from the yeast culture medium and subsequently deglycosylated was yellowish,

and showed absorbance maxima at 350 nm and 439 nm, which resembled the

absorbance spectrum of free flavin adenine dinucleotide (FAD) (Fig. 9C). The

fluorescence emission of the BBLa protein exhibited a maximum at 514 nm, and

treatment of the enzyme solution with the flavin-reducing reagent sodium dithionite

effectively quenched the fluorescence (Fig. 9D). These spectrophotometric properties

suggest that the recombinant BBLa protein has a flavin molecule. All the known

members of the BBE family are flavoproteins, containing an enzyme-bound FAD

(Brandsch et al., 1987; Carter et al., 2004; Dittrich and Kutchan, 1991; and

Sirikantaramas et al., 2004). Indeed, a putative flavin-binding site is found in the BBL

protein sequences (indicated by a dashed line in Fig. 3S).

When the recombinant BBLa protein and crude cell extracts from the tobacco

root or elicitor-treated cultured tobacco cells were used in the in vitro enzyme assay, we

did not detect oxidative conversion of DMN to nicotine or other alkaloids (data not

shown). The exact enzymatic reaction catalyzed by BBLs needs to be studied further.



17

DISCUSSION

Here, we identified novel BBL genes required for the biosynthesis of tobacco alkaloids.

Spectrophotometric analyses of a recombinant BBL protein that had been produced and

purified from the culture medium of a yeast cell culture suggest that BBLs contain FAD.

BBLs belong to an oxidoreductase subfamily that includes BBE (Fig. 1), within a larger

vanillyl-alcohol oxidase flavoprotein superfamily (Leferink et al., 2008). The

three-dimensional X-ray crystal structures of BBE, glucooligosaccharide oxidase,

6-hydroxy-D-nicotine oxidase, and aclacinomycin oxidoreductase showed that the

flavoproteins of the BBE subfamily comprise two domains: a conserved FAD-binding

domain and an α/β domain with a seven-stranded, antiparallel β-sheet forming the

less-conserved substrate-binding domain. BBE (Winkler et al., 2008),

glucooligosaccharide oxidase (Huang et al., 2005), and aclacinomycin oxidoreductase

(Alexeev et al., 2007) bi-covalently attach FAD to the protein via two amino acid

residues, His and Cys, whereas 6-hydroxy-D-nicotine oxidase covalently binds the

flavin cofactor only via a His residue (Koetter and Schulz, 2005). In BBLs, the His

residue which forms the covalent linkage of FAD in these four enzymes is conserved

but the Cys residue which is used for the bi-covalent linkage is missing, except for

BBLd whose expression was not detected in the tobacco roots (Fig. 2B), as in the case

of 6-hydroxy-D-nicotine oxidase (Fig. S2). Besides these flavoproteins, for which

crystal structures have been solved, many other BBE-subfamily oxidoreductases

catalyze the oxidation of a variety of metabolites with the consumption of molecular

oxygen and production of hydrogen peroxide, and generally contain covalently tethered



18

FAD (Leferink et al., 2008). Covalent flavinylation is thought to increase the redox

potential of the cofactor and thus its oxidation power.

Metabolic functions of BBLs were analyzed by suppressing their expression

in transgenic tobacco systems that normally synthesize pyridine-type alkaloids.

Suppressed expression of BBL genes in tobacco hairy roots and tobacco plants

effectively inhibited the formation of nicotine, whereas in jasmonate-elicited cultured

tobacco cells, BBL suppression severely inhibited the formation of a major alkaloid,

anatabine, as well as of minor tobacco alkaloids, nicotine, anabasine, and anatalline.

These pyridine-type alkaloids are the products of condensation between a pyridine ring

and another pyridine ring (anatabine, anabasine, and anatalline) or a pyrrolidine ring

(nicotine). Therefore, BBLs are required for a presumed step in the activation of

nicotinic acid, or a condensation reaction yielding bicyclic pyridine alkaloids.

Expression profiles of BBL genes are also consistent with their involvement in

the biosynthesis of tobacco alkaloids. Nicotine is formed almost exclusively in the

roots, and its synthesis is enhanced by hervivory on leaves by way of the general

jasmonate-signaling pathway and the specific nicotine regulatory loci, NIC1 and NIC2.

Tobacco BBL genes are specifically expressed in the roots, induced by jasmonate

treatment, and are positively regulated by the NIC loci. Dominant negative

suppression and overexpression of a NIC2-locus ERF gene showed that the NIC2 locus

regulates the expression of BBL genes. These expression patterns are shared by all

known tobacco structural genes involved in nicotine biosynthesis (Shoji et al., 2010).

To narrow down the enzymatic step catalyzed by BBL oxidoreductases, it is



19

informative to analyze metabolites which accumulate in otherwise alkaloid-synthesizing

tobacco cells when the BBL reaction is inhibited. A novel alkaloid, DMN, began to

accumulate as soon as the expression of BBLs was inducibly suppressed in tobacco

hairy roots. DMN has been identified as a metabolite of nicotine in the rat (De Clercq

and Truhaut, 1962) and was reported in cigarette smoke (Neurath et al., 1966), but has

not been reported in tobacco plants, indicating that the BBL-catalyzed reaction normally

proceeds very efficiently in planta. In the BBL-suppressed tobacco plants, DMN was

retained in the roots, constituting the major alkaloid in this organ, but was totally absent

in the leaves, suggesting that DMN is not transported from the roots to the aerial parts.

The root-to-leaf transport system for tobacco alkaloids, possibly involving putative

transporters, may not recognize DMN. Alternatively, DMN may not be exported from

a subcellular compartment, possibly the vacuole, in the root cells for the long distance

transport. The chemical structure of DMN, in which the N-(methylamino)butyl moiety

is attached to the C-3 position of the pyridine ring, shows that the condensation of the

pyridine ring and the N-methylpyrroline ring has been completed before the

BBL-catalyzed oxidation acts on an unknown reaction intermediate. Possibly, DMN

may be an in vivo substrate of BBLs. Our inability to demonstrate the conversion of

DMN to nicotine by a yeast-produced BBL protein might be caused by a lack of

putative posttranslational processing of the nascent BBL polypeptide in the yeast. The

two native BBL isoforms (I and II) detected in alkaloid-producing tobacco cells are

considerably smaller in molecular mass than the yeast-produced deglycosylated BBL

protein, indicative of posttlanslational processing of BBLs in tobacco cells, which might



20

be important for their catalytic activation. Alternatively, DMN might be derived from

an unstable BBL substrate. At least two metabolites accumulated, in addition to DMN,

when the BBL reaction was inhibited in the tobacco cells which otherwise produced

nicotine. These unidentified metabolites likely contain nitrogen, based on their

reactivity toward Dragendorff’s reagent. The accumulation of multiple metabolites

suggests that the intermediate accumulating immediately after the blockage of the BBL

reaction is unstable and readily metabolized in tobacco cells. An analogous situation

is found for the tobacco orphan reductase A622 (Kajikawa et al., 2009). When the

expression of A622 was suppressed in alkaloid-producing tobacco cells, formation of

tobacco alkaloids was effectively inhibited, with a concomitant accumulation of

nicotinic acid N-glucoside. The glucoside, however, is not a substrate for A622 but is

thought to be a detoxification product of nicotinic acid. Although the results presented

here strongly suggest that BBLs catalyze a late oxidation step in tobacco alkaloid

biosynthesis, we cannot rule out a possibility that BBLs are accessory factors required

for full activities of biosynthetic enzymes.

BBLs are recruited to the vacuole, when analyzed as GFP-fused constructs or

by subcellular fractionation. The N-terminal 50 amino acid residues of BBLs are

sufficient for targeting GFP to the vacuole, probably by way of the endoplasmic

reticulum (ER), and contain predictable signal peptides. Interestingly, the

characterized BBE family proteins of plant origin all contain N-terminal cleavable

signal peptides (Bird and Facchini, 2001; Carter and Thornburg, 2004; Dittrich and

Kutchan, 1991; Sirikantaramas et al., 2004; Taura et al., 2007a). The cannabidiolic



21

acid synthase and Δ1-tetrahydrocannabinolic acid synthase of Cannabis sativa are

probably glycosylated and recruited to the vacuole (Sirikantaramas et al., 2004; Taura et

al., 2007a). The nectarin V protein of ornamental tobacco (Nicotiana langsforffii x N.

sanderae) possesses glucose oxidase activity, and is secreted into the floral nectar

(Carter and Thornburg, 2004). The BBE of Papaver sominiferum is transported to the

vacuole, although it is presumed to be active in the lumen of the ER or an ER-derived

vesicle that is destined for the vacuole (Bird and Facchini, 2001). The subcellular

localization of BBLs in the vacuole indicates that a late step of nicotine biosynthesis is

catalyzed in this organelle, or in the lumen of the ER or an ER-derived, vacuole-targeted

vesicle. Determining the subcellular distributuion of other enzymes involved in

nicotine biosynthesis will clarify the compartmentation of the pathway. There may be

unexpected transmembrane trafficking of intermediates.

It should be noted that, in tobacco hairy roots, the nornicotine level did not

decrease, or actually increased, after knockdown of the BBL genes (Fig. 3). Previously,

we observed that levels of nicotine and nornicotine did not correlate in tobacco hairy

roots when the regulatory NIC loci were mutated in combinations (Hibi et al., 1994).

In the tobacco leaf, nornicotine is synthesized from nicotine in an oxidative

demethylation reaction catalyzed by nicotine N-demethylases of the cytochrome P450

monooxygenase subfamily CYP82E (Siminszky et al., 2005). When three known

nicotine N-demethylase genes were inactivated by mutations, the triple mutant tobacco

plants still contained a small amount of nornicotine (Lewis et al., 2010). There might

be an alternative pathway of nornicotine biosynthesis that does not utilize nicotine as



22

the sole, direct intermediate. In addition to its preferred substrate N-methylputrescine,

tobacco N-methylputrescine oxidase converts putrescine to Δ1-pyrroline (Heim et al.,

2007; Katoh et al., 2007). If Δ1-pyrroline condenses with a derivative of nicotinic acid

in tobacco plants, nornicotine could be generated by a route independent of nicotine.

BBLs might be dispensable for such a nicotine-independent pathway of nornicotine

formation.

MATERIALS AND METHODS

Plant Materials and Genetic Transformation

Binary vectors were introduced into Agrobacterium by electroporation. To generate

transgenic hairy roots, leaf discs were prepared from 4-6-week-old tobacco plants

(Nicotiana tabacum cv. Petit Havana SR1), were sterilized, and were inoculated with A.

rhizogenes ATCC15834 as described by Kanegae et al. (1994). After selection and

disinfection on solid MS medium containing 250 mg l-1 cefotaxime and 15 mg l-1

hygromycin (for pXVE-BBLRNAi) or 50 mg l-1 kanamycin (for

pHANNIBAL-BBLRNAi), hairy roots were subcultured in liquid MS medium with 3%

sucrose every two weeks. Transgenic tobacco plants were generated with A.

tumefaciens strain EHA105, as described by Horsch et al. (1985). Transgenic T0 and

T1 plants were selected for resistance against 50 mg l-1 kanamycin, and the transgenic

plants of the T1 generation were used in this study. Cultured tobacco BY-2 cells (N.

tabacum cv. Bright Yellow-2) were grown in liquid MS medium supplemented with 20

mg l-1 KH2PO4, 0.5 g l-1 MES, and 0.2 mg l-1 2,4-D. Transgenic tobacco BY-2 cells



23

were generated with A. tumefaciens strain EHA105, as described by An (1985).

Four-day-old BY-2 cells were elicited with 50 μM MeJA in an auxin-free medium

(Shoji et al., 2008), whereas one-month-old tobacco plants (cv. Burley 21) were treated

with 100 μM MeJA for 1 d, and the root tissues were analyzed for up-regulated

expression of nicotine biosynthesis-related genes (Shoji et al., 2002). Seeds of N.

sylvestris and N. tomentosiformis were obtained from Leaf Tobacco Research Center,

Japan Tobacco Inc.

Vector Construction

For constitutive expression, the coding region of BBLa cDNA was amplified by PCR,

and cloned into pGWB2 (Nakagawa et al., 2007). For subcellular localization assays,

the coding region of BBLa cDNA excluding the stop codon, and the partial fragments

(+1 to +150; the adenine in the translational start codon ATG as +1) of BBLa, BBLb,

and BBLc cDNAs were amplified by PCR, and cloned into pGWB5 (Nakagawa et al.,

2007). For RNAi-mediated constitutive suppression, a partial fragment of BBLa

cDNA (+1,312 to +1,654) was amplified by PCR, subcloned into pHANNIBAL

(Westley et al., 2001), and then transferred to the binary vector pBI121 (Clontech) to

provide pHANNIBAL-BBLRNAi, whereas the inducible RNAi vector

pXVE-BBLRNAi was constructed by transferring the RNAi cassette containing an

inverted repeat of the partial BBLa fragment and the PDK intron from

pHANNIBAL-BBLRNAi to a multi-cloning site downstream of the OLexA promoter in

pER8 (Zuo et al., 2000).



24

Genomic PCR, RT-PCR, and Quantitative RT-PCR

Genomic DNA was isolated from root tissues of N. tabacum (cv Petit Havana SR1), N.

sylvestris, and N. tomentsiformis by using a PureLink Plant Total DNA Purification kit

(Invitrogen). The following PCR primers were used to amplify genomic DNA (10 ng)

with Ex Taq DNA polymerase (TaKaRa Bio) for 30 cycles of 94 °C for 30 s, 55 °C for

30 s, and 72 °C for 30 s: 5’- AAACTGCTACTGGAGCTGTTAC and

5’-TCTTCGCCCATGGCTTTTCGGTCT for BBLa,

5’-ACAAAGAATGATCAAAGTAG and 5’-TCTTCGCCCATGGCTTTTCGGTCT for

BBLb, 5’-CTACTAGTGGAGCAGGAGAA and 5’-ACTCCGAATTTTCTGGACAG

for BBLc, 5’-AAGGAATCATGCTGGTAATAG and

5’-TGCTGGCTCGGGAAATGGCA for BBLd, and

5’-AGTTGGAGGAGGTGATGATG and 5’-TATGTGGGTCGCTCAATGTC for

tobacco α-tubulin genes.

Total RNA was isolated by using an RNeasy Plant Mini kit (Qiagen). cDNA

was synthesized from 1 μg of the total RNA by Super Script II reverse transcriptase

(Invitrogen), and amplified using Ex Taq DNA polymerase (TaKaRa Bio) under the

following PCR conditions: 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 30 s. The

BBLs and α-tubulin cDNA were amplified with the same primers used for the genomic

PCR. The reactions for plant roots were repeated 24 cycles for BBLa and α-tubulin

cDNAs, and 30 cycles for BBLb, BBLc, and BBLd cDNAs. The number of reaction

cycles for hairy roots was 22 for BBLa, BBLb, and BBLc cDNAs, and 24 for α-tubulin



25

cDNAs.

For quantitative RT-PCR, cDNA was amplified using the LC480 real-time

thermal cycler system (Roche Applied Science) with SYBER Premix Ex Taq (Perfect

Real Time) (TaKaRa Bio). The thermal program was 5 min at 95 ºC followed with

45 cycles of 10 s at 95ºC, 10 s at 60ºC, and 10 s at 72 ºC. The specificity of the

reactions was confirmed by the machine's standard melt curve method. The primers

used were; 5’- CTGCTGATAATGTCGTTGATGCTC and 5’-

CACCTCTGATTGCCCAAAACAC for BBLs, and

5’-AAGCCCATGGTTGTTGAGAC and 5’-GTCAACGTTCTTGATAACAC for the

tobacco EF-1α gene as a control.

Production of BBL Antiserum

A partial cDNA fragment of BBLa (+1,006 to the stop codon) was amplified and cloned

into pDONR221 (Invitrogen) by BP reaction, and transferred into an E. coli expression

vector, pET-DEST42 (Invitrogen). The recombinant His-tagged BBLa protein was

induced in the E. coli strain BL21 (DE3) (Invitrogen) by the addition of 1mM IPTG for

3 h at 37ºC. The recombinant protein was extracted in denatured extraction buffer (8

M urea, 20 mM sosium phosphate, pH 7.4, 0.5 M NaCl, and 10 mM DTT) by sonication,

and purified by Ni-NTA agarose (Qiagen) according to the manufacturer’s instructions.

Eluted fractions containing the recombinant protein were combined and dialyzed

against the extraction buffer containing 4 M urea. The recombinant protein was

further purified by gradient elution (from 0M to 1M NaCl) from the Q-Sepharose Fast



26

Flow column (GE Healthcare). BBLa antisera were produced in rabbits by Hokkaido

System Science.

Immunoblot Analysis

Root tissues and cultured cells were frozen in liquid nitrogen, homogenized by mortar

and pestle, thawed, and then immediately mixed with CelLytic P Cell Lysis Reagent

(Sigma). After centrifugation of the homogenate, 3 μg of soluble protein in the

supernatant was separated by SDS-PAGE (10% T), and transferred onto a BioTrace

PVDF membrane (Pall) using a Trans-blot SD Semi-Dry Electrophoretic Transfer Cell

(Bio-Rad). The membrane was blocked in 1xTBS buffer containing 3% (w/v) bovine

serum albumin for 1 h. Polyclonal anti-BBLa rabit serum and polyclonal

anti-phosphoenolpyruvate carboxylase (PEPC) rabbit serum (Chemicon) were diluted

1:1,000 in 1xTBS buffer containing 0.05% Triton X-100, and incubated with the

membranes for 1 h. Similarly, polyclonal anti-Class I chitinase rabbit serum was

diluted 1:500 in 1xTBS buffer containing 0.05% Triton X-100, and incubated with the

membranes for 1 h. After washing, HRP-conjugated anti-mouse IgG from sheep and

HRP-conjugated anti-rabbit IgG from donkey (GE Healthcare) were used as secondary

antibodies to detect target proteins with the ECL-plus Western Blotting System (GE

Healthcare).

Preparations of Vacuoles and Mini-Protoplasts

Vacuoles and mini-protoplasts were prepared from tobacco protoplasts, according to



27

Hamada et al. (2004). Five-day-old tobacco BY-2 cells were incubated with an

enzyme solution containing 2% Sumizyme C, 0.2% Sumizyme AP2 (both from

Shin-Nihonkagaku Industries Ltd.), and 0.45 M sorbitol, at 30°C (pH 5.5) for 2 h,

gently homogenized with a teflon homogenizer, and fractionated by density gradient

centrifugation in a solution containing 37% Percoll, 6.5 mM HEPES–KOH (pH 7.3),

0.49 M sucrose, 0.62 M sorbitol, and 0.04 M MgCl2, at 25,000×g for 30 min.

Cytoplasm-rich mini-protoplasts and vacuole-rich vesicles were separately collected

from the corresponding fractions, washed twice with cold 0.6 M mannitol, and were

suspended in 10 volumes of an ice-cold extraction buffer containing 50 mM

HEPES–KOH (pH 7.5), 5 mM EDTA, 0.25M sorbitol, 2 mM MgCl2, 1 mM

phenylmethylsulfonyl fluoride, complete protease inhibitor (Roche), and 1 mM DTT.

The fractionated preparations were homogenized, centrifuged at 13,000×g at 4°C for

30 min, and subjected to SDS-PAGE.

Confocal Microscopy

Tobacco BY-2 cells expressing GFP-fused proteins were examined with a C1-ECLIPSE

E600 confocal laser scanning microscope (Nikon) equipped with an argon laser, the

GFP(R)-BP filter, and the HQ-FITC-BP filter for GFP fluorescence or with a

helium-neon laser and the G-2A filter for FM4-64 fluorescence. Tonoplasts of tobacco

BY-2 cells were labeled with FM4-64 (Invitrogen) at 32 μM for 12 h.

Metabolite Analyses



28

Plant samples (50 mg dry weight) were lyophilized, homogenized, and soaked in 4 ml

of 0.1N sulfuric acid. The homogenate was sonicated for 15 min and centrifuged at

3,100 rpm for 15 min. The supernatant was neutralized by adding 0.4 ml of 25%

ammonia water. The mixture (1 ml) was loaded onto an Extrelut-1 column (Merck)

and eluted with 6 ml of chloroform. The elutant was dried at 37°C. The dry residues

were dissolved in ethanol containing 0.1% dodecane as an internal standard, and

analyzed by gas-liquid chromatography (GC-2010; Shimadzu) or gas-liquid

chromatography-mass spectrometry (Hewlett Packard 5890 SERIES II/JEOL MStation

MS700 system; Agilent) with an Rtx-5 Amine capillary column (I.D. 0.25 mm, df 0.50

μm, 30m; Restek). Nicotine, nornicotine, anatabine, and anabasine were purchased

from Wako or Sigma. The anatalline standard was a gift from Dr. Oksman-Caldentey

(Häkkinen et al., 2004). Dihydrometanicotine was purchased from Toronto Research

Chemicals.

Thin layer chromatography was used to evaluate alkaloid profiles. Alkaloid

extracts (10 μl) prepared as above were spotted on Merck silica gel 60 F254 plates

(20x20 cm, 0.2-mm layer), and developed with a solvent system comprising

chloroform: methanol: 25% ammonia water (85:15:2, v/v/v). Nitrogen-containing

compounds were detected after spraying with Dragendorff’s reagent (Harborne, 1984).

Expression of BBLs in Yeast

A partial coding region of BBLa cDNA (+64 to the stop codon) excluding the putative

signal peptide region was fused to the Strep tag II sequence (Schmidt and Skerra, 2007)



29

at the N-terminus by PCR, and cloned into the PmlI site of pPICZαB (Invitrogen),

which was then transformed to the P. pastoris SMD1168H strain (Invitrogen) by using

the Pichia EasyComp kit (Invitrogen). Pichia cells grown in BMGY medium were

collected and resuspended in 1,000 ml of modified BMMY medium containing 100 mM

sodium citrate buffer (pH5.5), 1% (v/v) methanol, 0.5% (w/v) casamino acid, and 10

mg l-1 riboflavin, as described by Taura et al. (2007b). The culture was shaken (90

rpm) at 20 °C for 4 d with the addition of a 0.5% volume of methanol every 24 h. The

culture was centrifuged, and the supernatant was concentrated by addition of 70% (w/v)

ammonium sulfate for 12 h. The precipitant was dialyzed against 20 mM sodium

acetate buffer (pH 5.5). The EndoHf endoglycosidase (1,000 U; New England

Biolabs), which had been fused to maltose-binding protein, was added and incubated at

37 °C for 3 h. The EndoHf protein was removed by passing the samples through an

amylose resin column (New England Biolabs), and the elutants were dialyzed against

Strep-Tacin Buffer W containing 100 mM Tris-HCl (pH 8.0), 150 mM NaCl, and 1mM

EDTA. Recombinant BBLa was purified with a Strep-Tacin Sepahrose affinity

column (IBA), according to the manufacturer’s instructions, and dialyzed against 10

mM sodium phosphate buffer (pH 7.0) or 10 mM sodium citrate buffer (pH 4.0).

Sequence data from this article can be found in the GenBank/EMBL data

libraries under the accession numbers: AB604219 (NtBBLa), AM851017 (NtBBLb),

AB604220 (NtBBLc), AB604221 (NtBBLd), P30986 (EcBBE), AF049347 (BsBBE),

P93479 (PsBBE), AY610511 (TfBBE), P08159 (AoHDNO), AJ507836 (AnHDNO),



30

AB292682 (CsCBDAS), AB057805 (CsTHCAS), AF472609 (HaCHOX), AF472608

(LsCHOX), and AF503442 (NspNEC5).

Supplemental Data

The following materials are available in the online version of this article.

Supplemental Figure S1. Biosynthesis of tobacco alkaloids.

Supplemental Figure S2. Alignment of deduced amino acid sequences of tobacco

BBLs and related proteins.

Supplemental Figure S3. Subcellular localization of BBLb and BBLc proteins in

cultured tobacco cells.

Supplemental Figure S4. Time courses of inducible BBL suppression and alkaloid

accumulation in the transgenic tobacco root line XN2.

ACKNOWLEDGMENTS

We thank Ikuko Nishimura (Kyoto University), Tsuyoshi Nakagawa (Shimane

University), Num Hai Chua (Rockefeller University), Peter Waterhouse (CSIRO Plant

Industry), and Ken Matsuoka (Kyushu University) for providing the

SP-GFP-2SC-expressing tobacco BY-2 cells, pGWB2 and pGWB5 vectors, pER8

vector, pHANNIBAL vector, and class I chitinase antiserum, respectively. We are also

grateful to Junko Tsukamoto (Nara Institute of Science and Technology) for GC-MS.



31

LITERATURE CITED

Alexeev I, Sultana A, Mäntsälä P, Niemi J, Schneider G (2007) Aclacinomycin

oxidoreductase (AknOx) from the biosynthetic pathway of the antibiotic

aclacinomycin is an unusual flavoenzyme with a dual active site. Proc Natl Acad

Sci USA 104: 6170-6175

An G (1985) High efficiency transformation of cultured tobacco cells. Plant Physiol 79:

568-570

Baldwin IT (2001) An ecologically motivated analysis of plant-herbivore interactions in

native tobacco. Plant Physiol 127: 1449-1458

Bird DA, Facchini PJ (2001) Berberine bridge enzyme, a key branch-point enzyme in

benzylisoquinoline alkaloid biosynthesis, contains a vacuolar sorting determinant.

Planta 213: 888-897

Brandsch R, Hinkkanen AE, Mauch L, Nagursky H, Decker K (1987)

6-Hydroxy-D-nicotine oxidase of Arthrobacter oxidans. Gene structure of the

flavoenzyme and its relationship to 6-hydroxy-L-nicotine oxidase. Eur J Biochem

167: 315-320

Cane KA, Mayer M, Lidgett AJ, Michael A, Hamill JD (2005) Molecular analysis of

alkaloid metabolism in AABB v. aabb genotype Nicotiana tabacum in response to

wounding of aerial tissues and methyl jasmonate treatment of cultured roots. Funct

Plant Biol 32: 305-320

Carter CJ, Thornburg RW (2004) Tobacco nectarin V is a flavin-containing berberine

bridge enzyme-like protein with glucose oxidase activity. Plant Physiol 134:



32

460-469

Chini A, Fonseca S, Fernández G, Adie B, Chico JM, Lorenzo O, García-Casado G,

López-Vidriero I, Lozano FM, Ponce MR, Micol JL, Solano R (2007) The JAZ

family of repressors is the missing link in jasmonate signallin. Nature 448:

666-671

Dawson RF, Christman DR, Anderson RC, Solt ML, D’Adamo A, Weiss U (1956)

Biosynthesis of the pyridine ring of nicotine. J Am Chem Soc 78: 2645-2646

Dawson RF, Christman DR, D’Adamo A, Solt ML, Wolf AP (1960) The biosynthesis of

nicotine from isotropically labeled nicotinic acids. J Am Chem Soc 82: 2628-2633

De Clercq M, Truhaut R (1962) Sur les mėcanismes d’action de la nicotine. Bull Soc

Chim Biol 44: 227-234

Dittrich H, Kutchan TM (1991) Molecular cloning, expression, and induction of

berberine bridge enzyme, an enzyme essential to the formation of

benzophenanthridine alkaloids in the response of plants to pathogenic attack. Proc

Natl Acad Sci USA 88: 9969-9973

Deboer KD, Lye JC, Aitken CD, Su AK, Hamill JD (2009) The A622 gene in Nicotiana

glauca (tree tobacco): Evidence for a functional role in pyridine alkaloid synthesis.

Plant Mol Biol 69: 299-312

Emanuelsson O, Brunak S, von Heijne G, Nielsen H (2007) Locating proteins in the cell

using TargetP, SignalP, and related tools. Nat Protoc 2: 953-971

Goossens A, Hakkinen ST, Laakso I, Seppanen-Laakso T, Biondi S, De Sutter V,

Lammertyn F, Nuutila AM, Soderlund H, Zabeau M, Inze D, Oksman-Caldentey



33

KM (2003) A functional genomics approach toward the understanding of

secondary metabolism in plant cells. Proc Natl Acad Sci USA 100: 8595-8600

Häkkinen ST, Rischer H, Laakso I, Maaheimo H, Seppänen-Laakso T,

Oksman-Caldentey K-M (2004) Anatalline and other methyl jasmonate-inducible

nicotine alkaloids from Nicotiana tabacum cv. BY-2 cell cultures. Planta Med 70:

936-941

Hamada T, Igarashi H, Itoh TJ, Shimmen T, Sonobe S (2004) Characterization of a 200

kDa microtubule-associated protein of tobacco BY-2 cells, a member of the

XMAP215/MOR1 family. Plant Cell Physiol 45: 1233-1242

Harborne JB (1984) Phytochemical Methods: A guide to modern techniques of plant

analysis, 2nd ed. Chapman and Hall, London, UK

Heim WG, Sykes KA, Hildreth SB, Sun J, Lu RH, Jelesko JG (2007) Cloning and

characterization of a Nicotiana tabacum methylputrescine oxidase transcript.

Phytochemistry 68: 454-463

Hibi N, Higashiguchi S, Hashimoto T，Yamada Y (1994) Gene expression in tobacco

low-nicotine mutants. Plant Cell 6: 723-735

Horsch RB, Fry JE, Hoffmann NL, Eicholtz D, Rogers SG, Fraley RT (1985) A simple

and general method for transferring genes into plants. Science 227: 1229-1231

Huang C-H, Lai W-L, Lee M-H, Chen C-J, Vasella A, Tsai Y-C, Liaw S-H (2005)

Crystal structure of glucooligosaccharide oxidase from Acremonium strictum. A

novel flavinylation of 6-S-crysteinyl, 8α-N1-histidyl FAD. J Biol Chem 280:

38831-38838



34

Jackson DM, Johnson AW, Stephenson MG (2002) Survival and development of

Heliothis virescens (Lepidoptera: Noctuidae) larvae on isogenic tobacco lines with

different levels of alkaloids. J Econ Entomol 95: 1294-1302

Kajikawa M, Hirai N, Hashimoto T (2009) A PIP-family protein is required for

biosynthesis of tobacco alkaloids. Plant Mol Biol 69: 287-298

Kanegae T, Kajiya H, Amano Y, Hashimoto T, Yamada Y (1994) Species-dependent

expression of the hyoscyamine 6β-hydroxylase gene in the pericycle. Plant Physiol

105: 483-490

Katoh A, Uenohara K, Akita M, Hashimoto T (2006) Early steps in the biosynthesis of

NAD in Arabidopsis start with aspartate and occur in the plastid. Plant Physiol

141: 851-857

Katoh A, Shoji T, Hashimoto T (2007) Molecular cloning of N-methylputrescine

oxidase from tobacco. Plant Cell Physiol 48: 550-554

Koetter JW, Schulz GE (2005) Crystal structure of 6-hydroxy-D-nicotine oxidase from

Arthrobacter nicotinovorans. J Mol Biol 352: 418-428

Leete E, Liu Y (1973) Metabolism of [2-3H]- and [6-3H]-nicotinic acid in intact

Nicotiana tabacum plants. Phytochemistry 12: 593-596

Leete E, Slattery SA (1976) Incorporation of [2-14C]- and [6-14C]-nicotinic acid into the

tobacco alkaloids. Biosynthesis of anatabine and α,β-dipyridyl. J Am Chem Soc

98: 6326-6330

Leferink NGH, Heuts DPHM, Fraaije MW, van Berkel WJH (2008) The growing VAO

flavoprotein family. Arch Biochem Biophys 474: 292-301



35

Lewis RS, Bowen SW, Keogh MR, Dewey RE (2010) Three nicotine demethylase

genes mediate nornicotine biosynthesis in Nicotiana tabacum L.: Functional

characterization of the CYP82E10 gene. Phytochemistry (in press)

Matsuoka K, Bassham DC, Raikhel NV, Nakamura K (1995) Different sensitivity to

wortmannin of two vacuolar sorting signals indicates the presence of distinct

sorting machineries in tobacco cells. J Cell Biol 130: 1307-1318

Mitsuhashi N, Shimada T, Mano S, Nishimura M, Hara-Nishimura I (2000)

Characterization of organelles in the vacuolar sorting pathway by visualization

with GFP in tobacco BY-2 cells. Plant Cell Physiol 41: 993-1001

Nakagawa T, Kurose T, Hino T, Tanaka K, Kawamukai M, Niwa Y, Toyooka K,

Matsuoka K, Jinbo T, Kimura T (2007) Development of series of gateway binary

vectors, pGWBs for realizing efficient construction of fusion genes for plant

transformation. J Biosci Bioeng 104: 34-41

Neurath G, Dűnger M, Gewe J, Lűttich W, Wichern H (1966) Unterschung der

Flűchtigen Basen des Tabakrauches. Beitr Tabakforsch 3: 563-569

Reed DG, Jelesko JG (2004) The A and B loci of Nicotiana tabacum have

non-equivalent effects on the mRNA levels of four alkaloid biosynthesis genes.

Plant Sci 167: 1123-1130

Saito K, Noma M, Kawashima N (1985) The alkaloid contents of sixty Nicotiana

species. Phytochemistry 24: 477-480

Schmidt TGM, Skerra A (2007)The Strep-tag system for one-step purification and

high-affinity detection or capturing of proteins. Nat Protoc 2: 1528-1535



36

Sheard LB, Tan X, Mao H, Withers J, Ben-Nissan G, Hinds TR, Kobayashi Y, Hsu F,

Sharon M, Browse J, He SY, Rizo J, Howe GA, Zheng N (2010) Jasmonate

perception by inositol-phosphate-potentiated COI1-JAZ co-receptor. Nature 468:

400-405

Shoji T, Winz R, Iwase T, Nakajima K, Yamada Y, Hashimoto T (2002) Expression

patterns of two tobacco isoflavone reductase-like genes and their possible roles in

secondary metabolism in tobacco. Plant Mol Biol 50: 427-440

Shoji T, Hashimoto T (2008) Why does anatabine, but not nicotine, accumulate in

jasmonate-elicited cultured tobacco BY-2 cells? Plant Cell Physiol 49: 1209-1216

Shoji T, Ogawa T, Hashimoto T (2008) Jasmonate-induced nicotine formation in

tobacco is mediated by tobacco COI1 and JAZ genes. Plant Cell Physiol 49:

1003-1012

Shoji T, Inai K, Yazaki Y, Sato Y, Takase H, Shitan N, Yazaki K, Goto Y, Toyooka K,

Matsuoka K, Hashimoto T (2009) Mulyidrug and toxic compound extrusion-type

transporters implicated in vacuolar sequestration of nicotine in tobacco roots. Plant

Physiol 149: 708-718

Shoji T, Hashimoto T (2010) Nicotine biosynthesis. In Plant Metabolism and

Biotechnology, John Wiley and Sons Ltd.

Shoji T, Kajikawa M, Hashimoto T (2010) Clustered transcription factor genes regulate

nicotine biosynthesis in tobacco. Plant Cell 22: 3390-3409.

Siminszky B, Gavilano L, Bowen SW, Dewey RE (2005) Conversion of nicotine to

nornicotine in Nicotiana tabacum is mediated by CYP82E4, a cytochrome P450



37

monooxygenase. Proc Natl Acad Sci USA 102: 14919-14924

Sinclair SJ, Murphy KL, Birch CD, Hamill JD (2000) Molecular characterization of

quinolinate phosphoribosyltransferase (QPRtase) in Nicotiana. Plant Mol Biol 44:

603-617

Sirikantaramas S, Morimoto S, Shoyama Y, Ishikawa Y, Wada Y, Shoyama Y, Taura F

(2004) The gene controlling marijuana psychoactivity: molecular cloning and

heterologous expression of Δ1-tetrahydrocannabinolic acid synthase from Cannabis

sativa L. J Biol Chem 279: 39767-39774

Steppuhn A, Gase K, Krock B, Halitschke R, Baldwin IT (2004) Nicotine’s defensive

function in nature. PLOS Biol 2: e217

Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: Molecular Evolutionary

Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol 24: 1596-1599

Taura F, Sirikantaramas S, Shoyama Y, Yoshikai K, Shoyama Y, Morimoto S (2007a)

Cannabidiolic-acid synthase, the chemotype-determining enzyme in the fiber-type

Cannabis sativa. FEBS Lett 581: 2929-2934

Taura F, Dono E, Sirikantaramas S, Yoshimura K, Shoyama Y, Morimoto S (2007b)

Production of Δ1-tetrahydrocannabinolic acid by the biosynthetic enzyme secreted

from transgenic Pichia pastoris. Biochem Biophys Res Commun 361: 675-680

Watson AB, Brown AM, Colquhoun IJ, Walton NJ, Robins DJ (1990) Biosynthesis of

anabasine in transformed root cultures of Nicotiana species. J Chem Soc Perkin

Trans 1990: 2607-2610

Wesley SV, Helliwell CA, Smith NA, Wang MB, Rouse DT, Liu Q, Gooding PS, Singh



38

SP, Abbott D, Stoutjesdijk PA, Robinson SP, Gleave AP, Green AG, Waterhouse

PM (2001) Construct design for efficient, effective and high-throughput gene

silencing in plants. Plant J 27: 581-590

Winkler A, Kutchan TM, Macheroux P (2008) 6-S-cysteinylation of bi-covalently

attached FAD in berberine bridge enzyme tunes the redox potential for optimal

activity. J Biol Chem 282: 24437-24443

Xu D, Shen Y, Chappell J, Cui M, Nielsen M (2007) Biochemical and molecular

characterization of nicotine demethylase in tobacco. Physiol Plantarum 129:

307-319

Zuo J, Niu Q-W, Chua NH (2000) An estrogen receptor-based transactivator XVE

mediates highly inducible gene expression in transgenic plants. Plant J 24: 265-273



39

Figure legends

Figure 1. Phylogenetic tree of BBE-like proteins. Shown is an unrooted

neighbor-joining phylogenetic tree of tobacco BBE-like proteins (NtBBLs), and of

related proteins belonging to four subgroups, i.e. berberine bridge enzymes (BBE),

6-hydroxynicotine oxidases, cannabinoid synthases, and carbohydrate oxidases. The

tree was generated using MEGA4 software (Tamura et al., 2007) with the

neighbor-joining algorithm. Bootstrap values (1,000 replicates) are indicated at branch

nodes, and the scale bar indicates the number of amino acid substitutions per site.

NtBBLa (Nicotiana tabacum), NtBBLb (N. tabacum), NtBBLc (N. tabacum), NtBBLd

(N. tabacum), EcBBE (Eschscholzia californica), BsBBE (Berberis stolonifera), PsBBE

(Papaver somniferum), TfBBE (Thalictrum flavum), AoHDNO (Arthrobacter oxydans),

AnHDNO (Arthrobacter nicotinovorans), CsCBDAS (Cannabis sativa), CsTHCAS

(Cannabis sativa), HaCHOX (Helianthus annuus), LsCHOX (Lactuca sativa), and

NspNEC5 (Nicotiana langsdorffii x N. sanderae).

Figure 2 Expression profiles of tobacco BBL genes. A and B, PCR primers specific

to each BBL member were used, and the tobacco α-Tublin gene was amplified as a

control. A, Genomic PCR analysis of N. tabacum (Nta) and its probable progenitors,

N. sylvestris (Nsy) and N. tomentosiformis (Nto). B, transcript levels of each BBL gene

were assessed by RT-PCR in the roots of wild-type (WT) and nic1nic2 mutant (nic)

tobacco plants. C-G, Quantitative RT-PCR analysis of BBL genes using BBL-consensus



40

PCR primers. Transcript levels are shown as relative values. C, Organ-specific

expression pattern in the WT plant, and expression level in the nic root. ND; not

detectable. D, Treatment of tobacco roots with 100 μM MeJA for 24 h. E, Treatment

of cultured tobacco cells with 50 μM MeJA for the period indicated. F, BBL transcript

levels in cultured tobacco roots of the vector-transformed control line (VC) and two

transgenic lines expressing a dominant-negative ERF189 form (ERF189-EAR, D1 and

D1; see Shoji et al., 2010). G, BBL transcript levels in cultured tobacco roots of the

vector-transformed control line (VC) and three transgenic lines overexpressing ERF189

(OE9, OE10, and OE11; see Shoji et al., 2010).

Figure 3. Downregulation of BBL genes in transgenic tobacco roots. Tobacco hairy

roots of the wild type (WT), two vector-transformed control lines (VC1 and VC2), and

three RNAi lines (KR1, KR2 and KR3) were analyzed. A, RT-PCR analysis of BBLa,

BBLb, and BBLc, as well as the control α-Tubulin gene. B, Immunoblot analysis using

the antisera against BBL and phosphoenolpyruvate carboxylase (PEPC; loading control).

BBLs existed in two forms with different molecular masses (I; 60 kD, and II; 53 kD).

C, Alkaloid contents of hairy roots. Data indicate the mean values +/- standard

deviations, from three biological replicates. ND; not detected.

Figure 4. Identification of DMN in the BBL-suppressed tobacco roots. A,

Gas-liquid chromatograms of alkaloid fractions from the cell extracts of WT and the

KR2 line, along with the DMN standard. DMN (retention time; 19.7min) accumulated



41

in the KR2 roots but not WT roots. B, Mass fragment patterns of the DMN peak in the

KR2 roots, and of the authentic DMN. C, Chemical structures of DMN and nicotine.

Figure 5. Time courses of inducible BBL suppression and alkaloid accumulation in

transgenic tobacco roots. A, Immunoblot analysis of BBL and PEPC proteins in the

inducible BBL RNAi root line (XN1) after the roots were treated with β-estradiol for

the period indicated. B, Accumulation of nicotine and DMN in XN1 roots cultured in

the absence or presence of β-estradiol. Data indicate the mean values +/- standard

deviations, from three biological replicates. C, Metabolite analysis by thin layer

chromatography (TLC). Nitrogen-containing compounds were detected using

Dragendorff’s reagent. At least two unidentified compounds (Rf values of 0.01 and

0.07), in addition to DMN (Rf of 0.11), were detectable after the inducer treatment.

Figure 6. BBL downregulation in tobacco plants. Tobacco plants of wild type (W)

and six independent BBL RNAi lines (KP1 to KP6) were grown for one month after

germination, and analyzed for gene expression and alkaloids. A, Immunoblot analysis

of BBL and PEPC (control) proteins in the root. B and C, Levels of nicotine, DMN,

and nornicotine in the 4th newest leaf (B) and the root (C). Data indicate the mean

values +/- standard deviations, from three replicates. ND; not detected.

Figure 7. BBL downregulation in cultured tobacco cells. Cultured BY-2 cells of the

wild type (WT), two vector-transformed control cell lines (VC1 and VC2), and two



42

BBL RNAi lines (KB1 and KB2) were treated with 50 μM MeJA for 48h (+ symbols),

and their protein levels and alkaloid contents were analyzed. Wild-type BY-2 cells

were also cultured in the absence of MeJA (- symbols). A, Immunoblot analysis of

BBL and PEPC (control) proteins. B, Anatabine content. C, Levels of nicotine,

anabasine, and anatalline. Note that the scale is different from that in B. Data

indicate the mean values +/- standard deviations, from three replicates. ND; not

detected.

Figure 8. Subcellular localization of BBLa protein in cultured tobacco cells. A,

Full-length BBLa protein was fused at its C-terminus to GFP, and stably expressed in

cultured BY-2 cells. Fluorescence was observed with a laser-scanning confocal

microscope. B, Confocal image of BY-2 cells expressing SP-GFP-2SC, which had

been shown to be located in the vacuoles (Mitsuhashi et al., 2000). C, An N-terminal

50-amino acid fragment of BBLa was fused to GFP, and stably expressed in the tobacco

cells. The transformed tobacco cells were pulse-labeled by the fluorescent dye

FM4-64, and inspected 10 h later when the dye had been shown to primarily label the

vacuolar membrane (Shoji et al., 2009). Bars: 50 μm. D, Immunoblot of subcellular

fractions. Vacuoles and cytoplasm-rich mini-protoplasts were prepared from

protoplasts of a BBLa-overexpressing tobacco cell line by Percoll-gradient

centrifugation. Vacuoles were stained with a 10 μg ml-1 neutral red solution for 10 min.

Immunoblots probed with antisera against BBL and class I chitinase (vacuolar resident

protein) are shown, together with a CBB-stained gel as a loading control. Bars: 100



43

μm.

Figure 9. Biochemical characterization of the recombinant BBLa protein produced in

the Pichia cell culture. A, BBLa purified from the culture medium of Pichia pastoris

was glycosylated. The purified protein was treated with (+) the endoglycosidase

EndoHf, and analyzed by SDS-PAGE. Separated proteins were stained with

Coomassie Brilliant Blue (CBB) or the carbohydrate-staining PAS reagent after being

transferred to a PVDF membrane. Approximately 1 μg of the native protein and

approximately 5 μg of the deglycosylated protein were loaded in the lanes. B,

Immunoblot analysis of the deglycosylated recombinant BBLa protein produced from

the Pichia culture (lane 1) and BBL proteins present in MeJA-treated wild-type BY-2

cells (lane 2). The antiserum against BBL was used for detection. C, Absorbance

spectra of the deglycosylated recombinant BBLa protein (0.23 mg ml-1 in 10 mM

sodium phosphate buffer, pH 7.0) and a standard solution of FAD. D, Fluorescence

emission spectra of the deglycosylated recombinant BBLa protein before (control) and

after the treatment with sodium dithionite. The protein samples (0.23 mg ml-1 in 10

mM sodium citrate buffer, pH 4.0) were irradiated at 450 nm.



44

Supplemental Figures

Figure S1. Biosynthesis of tobacco alkaloids. In tobacco, nicotinic acid

mononucleotide is synthesized de novo from aspartate by three enzymes; aspartate

oxidase (AO), qunolinate synthase (QS), and quinolinate phosphoribosyltransferase

(QPT). A salvage pathway of NAD provides nicotinic acid, although direct conversion

of nicotinic acid mononucleotide to nicotinic acid might be possible (see Wagner et al.,

1986). Nicotinic acid or its metabolite is coupled with the N-methylpyrrolinium cation,

Δ1-piperidine, and a nicotinic acid derivative to yield nicotine, anabasine, and anatabine,

respectively. Putrescine N-methyltransferase (PMT) and N-methylputrescine oxidase

(MPO) convert putrescine to the N-methylpyrrolinium cation. Nornicotine is mainly

synthesized from nicotine by CYP82E nicotine N-demethylases, whereas anatalline may

be formed from anatabine. A PIP-family reductase A622 may be involved in the

formation of a nicotinic acid-derived precursor. Dihydrometanicotine (DMN) may be

derived from an unknown immediate condensation product (X) of the nicotine

ring-coupling reaction. BBL is required for the ring-coupling reactions involving an

activated nicotinic acid-derived metabolite. The present study does not rigorously

exclude the possibility that DMN is converted to nicotine by BBL.

Wagner R, Feth F, Wagner KG (1986) The pyridine-nucleotide cycle in tobacco. Planta

167: 226-232.



45

Figure S2. Alignment of deduced amino acid sequences of tobacco BBLs and related

proteins. Amino acid residues which are identical at least among four sequences are

shaded. Dashes indicate alignment gaps. Predicted vacuolar sorting signals and

putative flavin-binding motifs in BBLs are indicated by a bold line and a broken line,

respectively. The conserved His residues invariably used for the FAD linkage and the

Cys residues which form the bi-covalent linkage of the flavin cofactor in some enzymes

are indicated by triangles. The sequence similarities between BBLa and the other

proteins are indicated in parentheses at the end of each sequence. Berberine bridge

enzyme of Eschscholzia californica (EcBBE), Δ1-tetrahydrocannabinolic acid synthase

of Cannabis sativa (THCAS), and 6-hydroxy-D-nicotine oxidase of Arthrobacter

nicotinovorans (AnHDNO).

Figure S3. Subcellular localization of BBLb and BBLc proteins in cultured tobacco

cells. N-terminal 50-amino acid fragments of BBLb and BBLc were fused to GFP, and

stably expressed in the cultured BY-2 cells. Fluorescence was observed with a

laser-scanning confocal microscope. Bars: 50 μm.

Figure S4. Time courses of inducible BBL suppression and alkaloid accumulation in

the transgenic tobacco root line XN2. A, Immunoblot analysis of BBL and PEPC

proteins in the inducible BBL RNAi root line (XN2) after the roots were treated with

β-estradiol for the period indicated. B, Accumulation of nicotine and DMN in XN2

roots cultured in the absence or presence of β-estradiol. Data indicate the mean values



46

+/- standard deviations, from three biological replicates.



Figure 1. Phylogenetic tree of BBE-like proteins.berberinebridge enzymes

cannabinoidsynthases

Carbohydrateoxidases

NtBBLa

AoHDNO

CsCBDAS

LsCHOXHaCHOX

NspNEC5

EcBBEPsBBE BsBBE

CsTHCAS

6-hydroxynicotineoxidases

100NtBBLb

NtBBLc

BBE-like proteins

NtBBLd

TfBBE

AnHDNO100

100

100

100

100

10099

97

59

10089

0.1

w

ww

.plantphysiol.orgon M

arch 24, 2018 - Published by

Dow

nloaded from

Copyright ©

2011 Am

erican Society of P

lant Biologists. A

ll rights reserved.


Figure 2 Expression profiles of tobacco BBL genes.

Time after MeJA treatment (h)

BBLa

α-tublin

WT

BBLb

BBLc

BBLd

nic

BBLa

α-tublin

Nta

BBLb

BBLc

BBLd

Nsy NtoGenomic PCR

NT trace

leaf stem root root

WT nic

Plants

Rel

ativ

e E

xpre

ssio

n Le

vel

Plant roots

control MeJARel

ativ

e E

xpre

ssio

n Le

vel

Cultured cells

Rel

ativ

e E

xpre

ssio

n Le

vel

VC D1 D2

Cultured roots

ERF189-EAR

Rel

ativ

e E

xpre

ssio

n Le

vel

VC OE9 OE10 OE11

Cultured roots

ERF189 OE

Rel

ativ

e E

xpre

ssio

n Le

vel

C D

E

A B

F G

w

ww



Dow

nloaded from

Copyright ©

2011 Am

erican Society of P

lant Biologists. A

ll rights reserved.


NDAlk

aloi

d C

onte

nts

μm

ol/g

dry

wei

ght)

Figure 3. Downregulation of BBL genes in transgenic tobacco roots.

A

Cnicotine DMN nornicotine

ND ND

WT VC1 VC2 1 2 3 WT VC1 VC2 1 2 3 WT VC1 VC2 1 2 3

BKR lines

WT 1 2 3BBLa

BBLb

BBLc

α-tublin

KR lines KR lines KR lines

54 kD

WT

αBBL

αPEPC

VC1 VC2 1 2 3

KR lines

I (58 kD)

II (53 kD)

w

ww



Dow

nloaded from

Copyright ©

2011 Am

erican Society of P

lant Biologists. A

ll rights reserved.


DMN peak in KR2

Abun

danc

e

m/z

164133107

149121

93

M+

100

50

0

DMN standard

Abun

danc

e

m/z

164133107

149121

93

M+

100

50

0

KR2

DMN standard

nornicotine

nicotine

Retention time (min)

WT

Figure 4. Identification of DMN in the BBL-suppressed tobacco roots.

DMN

dodecane(Internal standard)

Det

ecto

r res

pons

e

10 12 14 16 18 20 22 24 26

A B

C

DMN nicotine

N

HNCH3 N

NCH3

w

ww



Dow

nloaded from

Copyright ©

2011 Am

erican Society of P

lant Biologists. A

ll rights reserved.


54 kDαBBL

αPEPC

Time after addition of inducer (d)

Figure 5. Time courses of inducible BBL suppression and alkaloid accumulation in transgenic tobacco roots.

B

Time after addition of β-estradiol (d)


0 1 2 3 4

nicotine

DMN

A

7

unknown compound 1(Rf=0.07)

DMN (Rf=0.11)

14


0

CTLC

unknown compound 2(Rf=0.01)

origin

I

II

μmol

/g d

ry w

eigh

tμm

ol/g

dry

wei

ght

w

ww



Dow

nloaded from

Copyright ©

2011 Am

erican Society of P

lant Biologists. A

ll rights reserved.


54 kDαBBL

αPEPC

Figure 6. BBL downregulation in tobacco plants.

WT

1 2 3 4 5 6 A

B

BBL knockdown plant (KP) lines

ND

nicotine nornicotineDMN

Alkaloids in the root Alkaloids in the leafnicotine nornicotineDMN

NDNDNDNDNDNDND

C

I

II

μmol

/g d

ry w

eigh

t

μmol

/g d

ry w

eigh

t

1 2 3 4 5 6W 1 2 3 4 5 6W 1 2 3 4 5 6W 1 2 3 4 5 6W 1 2 3 4 5 6W 1 2 3 4 5 6W

w

ww



Dow

nloaded from

Copyright ©

2011 Am

erican Society of P

lant Biologists. A

ll rights reserved.


54 kD

anatabine

ND

MeJACell line

αBBL

αPEPC

WT VC1 VC2 KB1 KB2 WTA

B

+ + + + + -MeJA

Figure 7. BBL downregulation in cultured tobacco cells.

WT VC1 VC2 KB1 KB2 WT+ + + + + -

I

II

nicotine anabasine anatalline

ND ND ND

MeJA

Cell line WT

WT

VC1

VC2

KB

1

KB

2

+ + + + + - + + + + + - + + + + + -

WT

WT

VC1

VC2

KB

1

KB

2

WT

WT

VC1

VC2

KB

1

KB

2

μmol

/g d

ry w

eigh

t

μmol

/g d

ry w

eigh

t

C

w

ww



Dow

nloaded from

Copyright ©

2011 Am

erican Society of P

lant Biologists. A

ll rights reserved.


Figure 8. Subcellular localization of BBLa protein in cultured tobacco cells.

A

C

B

Protoplasts Mini-protoplastsNeutral red-stained

vacuoles

αBBLa

αchitinase 38 kD

54 kD

CBB83 kD

47 kD

I

DSP-GFP-2SC BBLa-GFP

BBLa(1-50)-GFP+ FM4-64

w

ww



Dow

nloaded from

Copyright ©

2011 Am

erican Society of P

lant Biologists. A

ll rights reserved.


114

47.3

31.3

kD1 2- +

kD97.466.2

45.0

31.0

CBB

deglycosylated (60 kD)

glycosylated (95 kD)

- +

PAS ImmunoblotA B

Figure 9. Biochemical characterization of recombinant BBLa protein produced in Pichia cell culture.

84.7

Rel

ativ

e flu

ores

cenc

e in

tens

ity (%

)

Wavelength (nm)

+Dithionite

100

80

60

40

20

0

Abs

orba

nce

Wavelength (nm)

C D

54.1

Control

EndoHf

FAD standard

BBLa protein

III

60 kD

w

ww



Dow

nloaded from

Copyright ©

2011 Am

erican Society of P

lant Biologists. A

ll rights reserved.


Documents

1 Running head: Novel tobacco proteins required for nicotine