Upload
umair-faheem
View
215
Download
0
Embed Size (px)
Citation preview
7/27/2019 1-s2.0-S096517480700238X-main
1/9
InsectBiochemistry
andMolecularBiology
Insect Biochemistry and Molecular Biology 38 (2008) 146154
Alterations of the acetylcholinesterase enzyme in the oriental fruit fly
Bactrocera dorsalis are correlated with resistance to the
organophosphate insecticide fenitrothion
Ju-Chun Hsua,b,, Wen-Jer Wub, David S. Haymerc, Hsiu-Ying Liaoa, Hai-Tung Fenga
aTaiwan Agricultural Chemicals and Toxic Substances Research Institute, Council of Agriculture, 11, Guang ming Road,
Wufong, 413 Taichung Hsien, TaiwanbDepartment of Entomology, National Taiwan University, 27, Lane 113, Roosevelt Road, Sec. 4, Taipei 106, Taiwan
cDepartment of Cell and Molecular Biology, University of Hawaii at Manoa, 1960 EastWest Road, Honolulu, HI 96822, USA
Received 1 June 2007; received in revised form 6 October 2007; accepted 8 October 2007
Abstract
Alterations of the structure and activity of the enzyme acetylcholinesterase (AChE) leading to resistance to organophosphate
insecticides have been examined in the oriental fruit fly, Bactrocera dorsalis (Hendel), an economic pest of great economic importance in
the Asia-Pacific region. We used affinity chromatography to purify AChE isoenzymes from heads of insects from lines showing the
phenotypes of resistance and sensitivity to insecticide treatments. The AChE enzyme from a strain selected for resistance to the
insecticide fenitrothion shows substantially lower catalytic efficiency for various substrates and 124-, 373- and 5810-fold less sensitivity to
inhibition by paraoxon, eserine and fenitroxon, respectively, compared to that of the fenitrothion susceptible line. Using peptide mass
fingerprinting, we also show how specific changes in the structure of the AChE enzymes in these lines relate to the resistant and sensitive
alleles of the AChE (ace) gene characterized previously in this species (described in Hsu, J.-C., Haymer, D.S., Wu, W.-J., Feng, H.-T.,
2006. Mutations in the acetylcholinesterase gene of Bactrocera dorsalis associated with resistance to organophosphorus insecticides.Insect Biochem. Mol. Biol. 36, 396402). Polyclonal antibodies specific to the purified isoenzymes and real-time PCR were also used to
show that both the amount of the isoenzyme present and the expression levels of the ace genes were not significantly different between the
R and S lines, indicating that quantitative changes in gene expression were not significantly contributing to the resistance phenotype.
Overall, our results support a direct causal relationship between the mutations previously identified in the ace gene of this species and
qualitative alterations of the structure and function of the AChE enzyme as the basis for the resistance phenotype. Our results also
provide a basis for further comparisons of insecticide resistance phenomena seen in closely related species, such as Bactrocera oleae, as
well as in a wide range of more distantly related insect species.
r 2007 Elsevier Ltd. All rights reserved.
Keywords: Fenitrothion; ace gene; Insecticide resistance; Enzyme kinetics; Bactrocera dorsalis
1. Introduction
The oriental fruit fly (Bactrocera dorsalis (Hendel))
causes serious financial losses to orchards globally and is
the most serious fruit pest of fruit trees in Taiwan.
Organophosphate based insecticides have been used tocontrol this pest for many years. However, the develop-
ment of even subtle resistance has been shown to be
capable of causing a loss of effectiveness of such control
agents (Hsu and Feng, 2000). For example the organopho-
sphorous insecticide fenitrothion has been used for pest
control since 1960 (Nishizawa et al., 1961), but in areas
such as Taiwan it has become increasingly limited in
effectiveness for control of B. dorsalis (Hsu and Feng,
2002). Similar cases of the development of resistance and
subsequent reductions in effectiveness to this and other
ARTICLE IN PRESS
www.elsevier.com/locate/ibmb
0965-1748/$ - see front matterr 2007 Elsevier Ltd. All rights reserved.
doi:10.1016/j.ibmb.2007.10.002
Corresponding author. Taiwan Agricultural Chemicals and Toxic
Substances Research Institute, Council of Agriculture, 11, Guang ming
Road, Wufong, 413 Taichung Hsien, Taiwan. Tel.: +886 4 23302101;
fax: +886 4 23314106.
E-mail address: [email protected] (J.-C. Hsu).
http://www.elsevier.com/locate/ibmbhttp://localhost/var/www/apps/conversion/tmp/scratch_6/dx.doi.org/10.1016/j.ibmb.2007.10.002mailto:[email protected]:[email protected]://localhost/var/www/apps/conversion/tmp/scratch_6/dx.doi.org/10.1016/j.ibmb.2007.10.002http://www.elsevier.com/locate/ibmb7/27/2019 1-s2.0-S096517480700238X-main
2/9
organophosphate based insecticides have been observed
in a wide range of other insect species in different localities
(Hama, 1983, 1984; Konno and Shishido, 1989; Kotze
and Walkbank, 1996; Kozaki et al., 2001). Because of
this, improved understanding of the actual or potential
mechanisms of resistance can be very important for
preventing even greater loss of the tools available for pestcontrol.
The enzyme acetylcholinesterase (AChE, EC 3.1.1.7) is
known to be the target of many organophosphate and
carbamate based insecticides. These insecticides work by
promoting phosphorylation or carbamylation type mod-
ifications of the active site of the AChE enzyme. These
modifications inhibit AChE activity and block the hydro-
lysis of acetylcholine (Oppenoorth and Welling, 1979), a
step that is normally necessary for the proper regulation of
nerve cell activity. In Drosophila melanogaster as well as
several other insect species, the development of resistance
to these insecticides has been associated with point
mutations in the gene (ace) encoding the AChE enzyme
(Fournier et al., 1992; Mutero et al., 1994; Vaughan et al.,
1997). In a number of species (Zhu and Clark, 1995a, b;
Kozaki et al., 2001; Weill et al., 2004), at least some of
these point mutations appear to correspond to regions
encoding the active site of the enzyme. Included in this
latter category is a previous study ofB. dorsalis (Hsu et al.,
2006) where two of the sites producing missense mutations
were shown to be identical to sites that had been altered in
a strain of a congeneric species, B. oleae, which also
exhibited insecticide resistance (Vontas et al., 2002;
Hawkes et al., 2005).
In addition to the clear evidence associating DNAchanges with the acquisition of resistance, it is also
important to develop a better understanding of how these
mutations may exert either quantitative or qualitative
effects on specific genes and their products. In some
species, for example the aphid Myzus persicae, insecticide
resistance has been associated with various mechanisms
such as the overproduction of detoxifying esterases,
qualitative alterations of the AChE enzyme itself and
mutations in other genes conferring knockdown resistance
(reviewed in Margaritopoulos et al., 2007). It is of interest
to know which if any of these phenomena occur in
B. dorsalis, especially in light of the work in the congeneric
species B. oleae that shows a decreased sensitivity to the
inhibitors and a qualitative reduction of the catalytic
activity of the AChE enzyme as the basis for resistance in
this species (Vontas et al., 2002).
To this end we examine here the effects on ace gene
expression and AChE enzyme activity due to the previously
described mutations in the ace gene of B. dorsalis (Hsu
et al., 2006). Overall, our results confirm that the resistance
phenotype is associated with qualitative effects on the
structure and activity of this enzyme. At least for the cases
examined here, quantitative changes in the levels of gene
expression can also be ruled out as significant contributors
to this phenotype.
2. Materials and methods
2.1. Fly strains
An insecticide-susceptible (S) line of the oriental fruit fly,
B. dorsalis, was established in our laboratory from flies
collected from central Taiwan in 1994. This laboratorycolony was reared on an artificial diet maintained without
any exposure to insecticides. An insecticide resistant (R)
line was selected from this line, and susceptibilities (LD50)
of the flies to varied doses of fenitrothion and methomyl
were assayed using topical application as described in Hsu
et al. (2004).
2.2. Chemicals
Insecticides and their respective oxons used in this study
were analytical grade. Fenitrothion, and paraoxon-ethyl
were obtained from Fluka Chemie GmbH (Switzerland).
Fenitroxon was obtained from Tokyo Kasei Kogyo Co.
(Japan).
AChE assay reagents and inhibitors, including acet-
ylthiocholine iodide (ATC), propionylthiocholine iodide
(PTC), 5,5-dithiobis-2-nitrobenzoic acid (DTNB), S-butyr-
ylthiocholine iodide (BTC), 1,5-bis(4-allyldimethylammo-
nium phenyl)pentan-3-one dibromide (BW284C51), eserine
hemisulfate (eserine), ethopropazine hydrochloride (etho-
propazine) were purchased from Sigma Chemical Co.
(USA).
The ECH Sepharose 4B was purchased from Amersham
Pharmacia Biotech (Piscataway, NJ). The chemicals tetra-
ethylammonium iodide (Net4I), procainamide, andN-ethoxycarbonyl-2-ethoxy-1, 2-dihydroquinoline (EEDQ)
were purchased from ACROS Organics (USA). The bovine
serum albumin (BSA) protein assay standard was pur-
chased from Bio-Rad Laboratories (USA).
2.3. Enzyme purification
AChE was purified from the heads of adults by affinity
chromatography using procainamide as described in
Hsiao et al. (2004). Approximately, 12 g of frozen heads
were homogenized in 120 mL of ice-cold phosphate buffer
(pH 7.4) containing 0.5% (v/v) triton-X100 (extracted
buffer). After centrifugation at 13 000g for 15min, the
supernatant was filtered through two layers of cheesecloth
to remove the lipids. The recovered material was then
applied to a procainamide-based Sepharose 4B affinity
column as described by the manufacturer. A buffer
containing 50mM NaCl (PTS) was used to wash the
column until the absorbance at 280 nm fell below 0.01 and
the AChE was then eluted with 30mM Net4I in PTS
buffer.
The purity of enzyme was analyzed by SDS-PAGE.
Fractions containing purified AChE were pooled, dialyzed
against PTS buffer to remove the Net4I and concentrated
using an Amicon concentrator (model 8050) at 4 1C.
ARTICLE IN PRESS
J.-C. Hsu et al. / Insect Biochemistry and Molecular Biology 38 (2008) 146154 147
7/27/2019 1-s2.0-S096517480700238X-main
3/9
2.4. AChE enzyme quantitation
Immunoassays were conducted to quantify the amount
of AChE present in flies from both lines. The indirect-
ELISA sandwich method and anti-AChE polyclonal
antibodies were used based on a modification of the
method from Yeh and Gonsalves (1984). Two purifiedextracts (about 1 mg, titer of anti-AChEs (1:10000)) of
polyclonal antibodies against AChE from both feni-
trothion-susceptible and -resistant B. dorsalis, respectively,
were produced in rabbits (Taiwan Protein Co., Ltd).
Purification was done from pooled antisera using the
Melon Gel IgG spin purification kit (Pierce Biotech., USA)
following instructions provided by the manufacturer.
The concentration of IgG protein was estimated using
readings from a spectrophotometer at optical density at
280 nm (OD280).
For both lines, ten heads cut from fresh flies were
homogenized in phosphate-buffered saline (PBS) and
diluted to 1.2mg total protein per well to coat 96-well
microtiter plates for 1 h at 37 1C. Each sample was assayed
using four replicates to minimize intra-experiment varia-
tion. The 96-well microtiter plates were used for either
direct measurement of AChE activity or for an ELISA
assay.
After blocking, wells were sequentially incubated
with anti-AChE rabbit serum (at concentrations of
0.22 mg for anti-susceptible AChE or 0.28mg anti-feni-
trothion AChE/well), and the alkaline phosphatase-
conjugated goat anti-rabbit IgG (Jackson Immuno
Research; 0.04 mg/well). All incubations were carried out
fo r 1 h a t 3 7 1C with washes between successive steps.The absorbance value was determined in an ELISA reader
at 405 nm using a Benchmark microplate reader (Bio-Rad,
USA).
2.5. AChE activity assays and enzyme kinetics
AChE activity was determined by the method of Ellman
et al. (1961). AChE extracts (before and after purification)
buffered in sodium phosphate (pH 7.0) were assayed for
activity with ATC (0.50 mM) as a substrate. The change in
light absorbance at 410 nm was recorded for 5 min in a
Benchmark microplate reader (Bio-Rad) and used to
calculate AChE activity as in units of mmol ATC
hydrolysed/min/mg.
The substrate specificity of purified AChE was assessed
using ATC, PTC, and BTC. A total of 11 different
substrate concentrations ranging from 40 to 4000 mM for
ATC and 161600 mM for PTC and BTC were used (as well
as no substrate) to determine the enzyme kinetic para-
meters of purified enzyme from both the fenitrothion-
susceptible (S) and -resistant (R) lines. For each substrate
the maximum velocities (Vmax) and the Michaelis con-
stants (Km) were calculated using Hanes/Woolf plots
(Java-EMBOSS Software). The ratio Vmax/Km is referred
to as efficiency of catalysis and the turnover number (Kcat)
was calculated from the molecular mass of purified AChE
(116 kDa, the predicted mass) and Vmax. The substrate
specificity constant (Kcat/Km) was determined from the Kcatand Km values according to the method of Zhu and
Brindley (1992).
2.6. Sensitivity of AChE to inhibition
Purified AChE was incubated with eight different
concentrations of each of five inhibitors (ethopropaxine,
BW284C51, eserine, paraoxon and fenitroxon) at 37 1C for
5 min before adding substrate to assay the AChE activity
(the substrate is ATC (0.50 mM)). Ethopropazine was used
in a concentration range of 0.886 to 114 mM, BW284C51
from 4.55pM to 45.5 mM, eserine from 2.73pM to
2.27 mM, paraoxon from 145 pM to 11.4 mM and fenitrox-
on from 40.6 pM to 11.4mM. In each case, AChE activity
was assayed as described.
The inhibition concentration (I50) for each inhibitor
was determined based on log-concentration vs. log-% inhibi-
tion regression analysis. In this study, the concentrations
of five inhibitors were 3.55455mM for ethopropazine,
4.55 pM45.5mM for BW284C51, 37.2 pM22.7 nM for eser-
ine, 74.5 nM45.5mM for paraoxon and 18.6 nM11.4mM for
fenitroxon, respectively. Results are reported as means7stan-
dard deviation and the sample size is five for every inhibitor
analysis.
The plot of the log of residual activity (AChE) against
time was linear for a given inhibitor concentration. The
bimolecular rate constant (Ki) was calculated by linear
regression as described by Main and Iverson (1966). The
concentrations in BW284C51, paraoxon and fenitroxon were20.8 nM45.5mM, 0.145 nM11.4mM and 88.8 nM11.4mM,
respectively, and the other inhibitors were in the same
concentration ranges as the inhibition concentration
described.
2.7. Peptide mass fingerprinting analysis
Using material from both fenitrothion-susceptible and
-resistant lines, AChE was obtained for peptide mass
analysis using either gel slices isolated from SDS-PAGE
gels, processed by in-gel digestion, or from PBS solutions
dialyzed against deioned water where direct digestion
with trypsin was carried out. These were analyzed by
laser desorption/ionization with matrix assisted, time-of-
flight spectroscopy (MALDI-TOF) (Applied Biosystems/
Voyager DE Pro) (Proteomic MS Core Laboratory,
National Chung Hsing University). Peptide mass values
obtained were used to search the NCBInr database
(2006.02.16) using Ms-Fit software (http://prospector.ucsf.
edu/prospector/4.0.8/html/msfit.htm). The mass tolerance
was set at 100 ppm, and other parameters were typically set
as follows: trypsin up to two miss cleavages; cysteine
modification, acrylamide; and considered modifications
including oxidation of Met and carbamidmethylation of
cystein.
ARTICLE IN PRESS
J.-C. Hsu et al. / Insect Biochemistry and Molecular Biology 38 (2008) 146154148
http://prospector.ucsf.edu/prospector/4.0.8/html/msfit.htmhttp://prospector.ucsf.edu/prospector/4.0.8/html/msfit.htmhttp://prospector.ucsf.edu/prospector/4.0.8/html/msfit.htmhttp://prospector.ucsf.edu/prospector/4.0.8/html/msfit.htm7/27/2019 1-s2.0-S096517480700238X-main
4/9
2.8. Quantitative real-time PCR method
Total RNA was extracted from the heads of 15 flies of
each line using a microscale total RNA extraction kit
(RNeasyR Mini kit, Qiagen Gmbh). After treatment with
DNase, one microgram of total RNA was used for the first
strand synthesis of cDNA in 20ml of total volume using theThermoScriptTM reverse transcription cDNA synthesis
system (Invitrogen) with poly T as the primer, according
to the manufacturers instructions.
Real-time PCR was used to examine the expression of
the ace gene in specimens from both the R and S lines.
Primers designed to specifically amplify ace gene sequences
from cDNA were used (described below). In both lines
similar amplifications were also carried out with primers
designed from conserved ribosomal 18S sequences (18S) as
a control, and ratios of ace/18S levels of gene expression
were calculated.
Real-time PCR amplifications were done using an IQ5
machine (Bio-Rad, USA). One microliter of template was
used in each reaction of 25ml total volume (including
the SYBR Green I). Primers specific to the ace gene
(AY155500) were sense: CGGCAAGTTGAACGAGAG;
and antisense: AGAGGAAGCGGATGATGG. Primers
specific to the 18S ribosomal gene (AF033944) were sense:
ATTTGTGCTTCATACGGGTAG; and antisense: AA-
CAGAGGTCTTATTTCATTATTCC.
Quantification references were designed to have similar
properties in terms of length and %GC content. An
optimized thermal program consisting of one cycle of 95 1C
for 3 min, 40 cycles of 95 1C for 10s, 52 1C for 15s, and
followed by a final one cycle of 72 1C for 2.5 min was used.Following the qRTPCR, the homogeneity of PCR product
was confirmed by the melting curve analysis. The relative
amount of target gene against reference gene was
calculated according to the 2DCt method (Pfaffl, 2001).
The assay was repeated six times with total RNA extracted
separately for flies from both lines, and three replicates
were carried out for each reaction to minimize intra-
experiment variation.
2.9. Statistical analysis
Using EXCEL software statistical analysis of the AChEkinetics was carried out using two factor ANOVA. For
other experiments the two-tailed Students t-test was used.
Differences were considered significant at Po0.05 level.
3. Results
3.1. AChE purification and activity
The purity of the AChE isoenzyme was confirmed by
SDS-PAGE using the coomassie blue staining method
using material obtained from both the fenitrothion-
susceptible (S) and -resistant (R) lines. In both cases a
monomer of 59.7 kDa (estimated molecular weight, MW)
was obtained (Fig. 1).
The overall purification factors and yields were similar
for both lines (about 1500-fold and 20%, respectively)
(Table 1). Resistance ratios and cross-resistance ratios were
calculated as the ratio of the resistant LD50 to the
susceptible LD50 values for fenitrothion (RR) or methomyl
(CR) insecticide treatments.
3.2. AChE kinetics
Three substrates (ATC, PTC, and BTC) were used to
assess the kinetic parameters of the AChE enzyme purified
from both the S and R lines (Table 2):
(a) The hydrolyzing efficiencies (Vmax) for these substrates
differed significantly between two lines (Fsubstrates
(2,20) 139.2, Po0.05). The AChE from the R line
exhibited hydrolyzing efficiency about two times lower
(two factor ANOVA, Fline (1,20) 35.6, Po0.05)
compared with the AChE purified from the S line for
all substrates investigated.
(b) The substrate affinities (Km) also differed significantly
between two lines using two factor ANOVA (Fsubstrate
(2,20) 75.3, Po0.05 for Km) with the AChE from the R
line exhibiting significantly lower affinities (two factor
ANOVA, Fline (1,20) 20.8, Po0.05) for all three of the
substrates compared to the AChE purified from the Sline.
3.3. Sensitivity of AChE to inhibition
AChEs purified from both S and R lines showed similar
curves for inhibition by BW284C51, eserine, paraoxon and
ARTICLE IN PRESS
Fig. 1. SDS-PAGE analysis of AChEs purified from flies of the
susceptible and fenitrothion-resistant lines. Purified AChEs were mixed
with loading dye and DTT reducing agent and heated at 95 1C for 5 min in
a dry bath. Treated samples were loaded onto a 10% SDS-PAGE and
electrophoresed for 1.5 h at 100 V at room temperature. The protein bands
were visualized by coomassie blue staining (kit from AmershamPharmacia Biotech). Susppurified AChE from susceptible oriental fruit
flies; Resistpurified AChE from fenitrothion-resistant flies; marker
lanemid-range protein marker (GeneMark, Taiwan).
J.-C. Hsu et al. / Insect Biochemistry and Molecular Biology 38 (2008) 146154 149
7/27/2019 1-s2.0-S096517480700238X-main
5/9
fenitroxon although inhibition by ethopropazine required
approximately a 100-fold higher concentration (Fig. 2). In
all cases the purified AChE from the R line displayed lessoverall activity compared to that of the AChE purified
from the S line.
The I50 values in Table 3 show that in the S line, eserine
was the most potent inhibitor of purified AChE, followed
by fenitroxon, paraoxon, BW284C51, and finally ethopro-
pazine. In the R line eserine was also the most potent
inhibitor (followed by fenitroxon), but in this case
BW284C51 was a more potent inhibitor than paraoxon.
However, ethopropazine was the least effective here also.
This table also shows that overall for eserine, fenitroxon
and paraoxon, the purified AChE enzyme from the R line
was much less sensitive to inhibition compared to the
AChE from the S line.
Table 3 also shows that the values for inhibition
constants (Ki) of AChE in each of the lines ranged from
4.93 103 to 5.09 107 M1 min1. Here again eserine was
the most potent inhibitor while ethopropazine was the
least. Except for eserine, these inhibitors also showed
higher Ki values for the S line compared to the R line.
3.4. Peptide mass fingerprinting
Peptide mass fingerprinting was used first to confirm that
the enzymes purified from these B. dorsalis lines were
AChEs (Table 4). AChE from the S line is identified as the
normal AChE of this species (AAO06900), and the
peptide products from this line are also compared to the
AChE from the R line (AAO06932). Next, the residuesobtained for the R and S lines were directly compared.
Only the amino acid change corresponding to position
G488 (peptide corresponding to residues #486506) was
found in these experiments despite the fact this experiment
was performed several times using both AChE enzyme in
solution and from slices of polyacrylamide gels for both
lines.
3.5. Quantitation of gene expression
As assessed using the t-test, no significant differences
were detected in terms of the quantities of AChE recovered
as indicated by the indirect-ELISA assay using antibodies
directed against both the susceptible AChE and resistant
AChE (Table 5).
The real-time PCR analysis also shows that the levels of
expression of the ace gene (relative to 18Sexpression levels)
were roughly equivalent in individuals from both the
susceptible and resistant lines (Table 6).
4. Discussion
The development of resistance to organophosphate
based insecticides is a current and growing problem for
the management of many insect pest species of agricultural
ARTICLE IN PRESS
Table 1
Purification ratios of acetylcholinesterase for homogenized extracts (crude) and purified by affinity chromatography from fenitrothion-susceptible ( S) and
-resistant (R) oriental fruit fly linesa
Lines Step Total activity
(mmol/min)
Specific activity
(mmol/min/mg)
Yield (%) Purification factor
(fold)
Resistance ratios
RR CR
S Crude 78.375.17 0.2870.01 100 1 1 1
Purified 16.470.15 4217120 20.9 1504
R Crude 50.471.22 0.1870.01 100 1 416 6.1
Purified 10.271.13 2667111 20.2 1478
The resistance ratio was calculated as the value of the resistant LD50/the susceptible LD50 value for fenitrothion (RR) or methomyl (CR) treatment,
respectively. The susceptible LD50 values for fenitrothion and methomyl are 22.8 and 43.7 ng/fly, respectively.aThe results are presented as the means7SD (n 2).
Table 2
Comparison of the kinetic parameters of AChE purified from S and R lines by hydrolysis of three substratesa
Substrates Lines Vmax (mmol/min/mg) Km (mM) Vmax/Km (ratio) Kcat (min1) Kcat/Km (mM
1 min1)
ATC S 158.575.69 16.574.00 9.62 18 400 1116
R 69.770.95 35.578.43 1.96 8080 228
PTC S 131.274.15 53.4725.2 2.46 15 200 285
R 70.972.43 65.576.21 1.08 8220 126
BTC S 79.671.55 85.777.27 0.93 9230 108
R 45.870.49 129.272.76 0.35 5310 41
aThe results are presented as the means7SD (n 4). The Vmax and Km for these substrates differ significantly between two lines by two factor ANOVA
test (Po0.05) as described in the text (Section 3.2).
J.-C. Hsu et al. / Insect Biochemistry and Molecular Biology 38 (2008) 146154150
7/27/2019 1-s2.0-S096517480700238X-main
6/9
and medical importance, and because of this a wide range
of studies have focused on the elucidation of the molecular
basis of this resistance. For example, our previous study of
insecticide resistance in B. dorsalis (Hsu et al., 2006)
showed that flies exhibiting high levels of resistance to the
organophosphate insecticide fenitrothion carried three
specific mutations in the ace gene of this species (designated
bdace2). Indeed mutations of ace genes have been reported
to be associated with insecticide resistance for a wide range
of dipteran species (Fournier et al., 1992; Mutero et al.,
1994; Vaughan et al., 1997; Vontas et al., 2002). For our
study in particular it was of interest to note that two of the
changes we identified (Hsu et al., 2006) occurred at
positions identical to mutations of the ace gene reported
in a strain of a congeneric species, B. oleae, which also
exhibited insecticide resistance (Vontas et al., 2002).
In addition to the association of mutations with the
acquisition of insecticide resistance it is important to
examine whether such mutations are associated primarily
with either quantitative or qualitative effects on the
production and/or activity of specific enzymes. In B. oleae,
for example, it is clear that the mutations were associated
with reductions of the catalytic efficiency of the AChE
enzyme on the order of 3540% (Vontas et al., 2002).
However, in non-dipteran species such as those in the
Hemiptera (Aphididae) at least three distinct mechanisms
have been associated with the acquisition of resistance.
These include alterations exhibiting both quantitative and
qualitative effects on the structure and function of the
AChE enzyme and on distinct genes involved in sodium
channeling (Margaritopoulos et al., 2007). To investigate
this phenomenon in B. dorsalis, here we purified and
analyzed the biochemical properties of AChE isoenzymes
obtained from both the resistant (R) and susceptible (S)
insects analyzed in our previous study (Hsu et al., 2006).
We also compared the changes we observed with those
reported for B. oleae (Vontas et al., 2002) as well as various
other insect species.
We first used peptide mass fingerprinting to link specific
alterations in the AChE proteins from the two lines to
predictions made from the DNA sequence of the alleles of
the ace gene associated with the R and S phenotypes
described in Hsu et al. (2006). The alteration at position
G488 (found in the R line) was, however, the only one out
ARTICLE IN PRESS
Fig. 2. Effects of five inhibitors (ethopropaxine, BW284C51, eserine, paraoxon and fenitroxon) on activity of AChE from both fenitrothion-susceptible
and -resistant lines at eight concentrations.
Table 3
I50 values and bimolecular rate constants (Ki) for five inhibitors of enzyme activity for AChE from both S and R lines of B. dorsalis
Inhibitor I50 (nM) R/S Ki ( 103 M1 min1) S/R
Susceptible Resistant Susceptible Resistant
Eserine 0.01270.0095 4.4870.38 373 46 00077050 50 90071880 0.90
Fenitroxon 0.04370.037 2507121 5810 314783.8 18378.37 1.72
Paraoxon 49.379.08 61207374 124 26678.33 12276.93 2.09
BW284C51 10407315 9757405 0.94 54.071.31 50.271.49 1.08
Ethopropazine 195 000721 900 215 000797 200 1.10 6.0370.136 4.9770.353 1.21
The R/S ratio was calculated as the value of the resistant I50/the susceptible I50. The S/R ratio was calculated as the value of the susceptible Ki/the
resistant Ki.Significant differences from the susceptible colony by Student t-test (Po0.05).
J.-C. Hsu et al. / Insect Biochemistry and Molecular Biology 38 (2008) 146154 151
7/27/2019 1-s2.0-S096517480700238X-main
7/9
of three predicted missense changes in the peptides we
could actually identify. The I214 mutation position may
not be easily identified by the peptide mass fingerprinting
because the MW of trypsin digested peptide fragment
including this mutation is on the order of 6340 Da in the S
line (6326 Da in the R line). Normally, the abundance of
monoisotopic ions above 3000 Da becomes vanishingly low
and difficult to resolve (Yergey et al., 1983). The inability
to detect alterations of peptides corresponding to the third
mutation may be explained by proximity to the end of the
primary translation product. This was also seen in the case
in the AChE purified from Drosophila, and here it was
speculated that mutations occurring near the end of a gene
might place them beyond the C-terminal amino-acid of the
mature protein (Mutero and Fournier, 1991) remaining
after posttranslational processing. Further investigations
may show that similar phenomena may apply to the AChE
protein from the oriental fruit fly.
ARTICLE IN PRESS
Table 4
Peptide mass fingerprint results
Residues nos. Measured mass (Da) Calculated mass (Da) Error (ppm) Sequence
AChE from the susceptible line match details:
400407 966.454 966.438 16 MMETADLR
408417 1137.59 1137.57 15 GYDILMGNVR
443455 1584.88 1584.81 44 KYLEIMNNIFGK
462467 748.433 748.435 3.6 EAIIFR
468485 2021.02 2020.99 15 HTSWVGNPGLENQQQIGR
486506 2397.17 2397.09 30 AVGDHFFTCPTNEYAQALAER
507518 1500.73 1500.70 18 GASVHYYYFTHR
561570 1135.63 1135.62 7.2 MLNAVIEFAK
571586 1763.83 1763.79 22 TGNPATDGEEWPNFTK
588602 1834.86 1834.84 14 DPVYYVFSTDDKEEK
612620 1258.59 1258.57 14 CAFWNEYLR
625642 2021.03 2020.98 24 WGSQCELKPSSASSLQQK
AChE from the fenitrothion-resistant line match details:
5059 1142.66 1142.55 97 MSSVYGVIDR
6070 1142.66 1142.65 7.9 LVVQTSSGPVR
101116 1772.97 1772.94 12 KPVPAEPWHGVLDATR
400407 966.507 966.438 71 MMETADLR408417 1137.60 1137.57 23 GYDILMGNVR
418442 3033.36 3033.40 13 DEGTYFLLYDFIDYFDKDEATSLPR
462467 748.480 748.435 60 EAIIFR
468485 2021.02 2021.00 11 HTSWVGNPGLENQQQIGR
486506 2427.12 2427.10 7 AVSDHFFTCPTNEYAQALAER
507518 1500.73 1500.70 16 GASVHYYYFTHR
560570 1307.70 1307.71 7.9 RMLNAVIEFAK
571586 1763.82 1763.79 17 TGNPATDGEEWPNFTK
587602 1962.96 1962.93 13 KDPVYYVFSTDDKEEK
588502 1834.98 1834.84 79 DPVYYVFSTDDKEEK
606611 628.380 628.341 61 GPLEGR
612620 1258.59 1258.57 15 CAFWNEYLR
625642 2021.02 2020.98 20 WGSQCELKPSSASSLQQK
Indicates residue changes noted between the peptides from the two different lines.
Table 6
Real-time PCR results showing levels of expression of the ace and
ribosomal 18S genes in the fenitrothion-susceptible (S) and -resistant (R)
lines
Lines Ace (Ct) 18S (Ct) Ratioa of ace/18S
S 24.4970.84 15.1071.20 0.0017570.00101
R 25.4170.76 16.1371.52 0.0017770.000847
Ct refers to the threshold cycle. The ratio is used to show the relative
quantification of expression of the target gene (ace) in comparison to the
reference gene (18S) (Pfaffl, 2001).aRatio 2[Ctace-Ct18S].
Table 5
Quantifying the AChE from the S and R lines by the indirect-ELISA
methoda
Lines AChE activity
(mmol/min/mg)
The absorbance value in OD405(mean7SD, n 6)
Anti-susceptible
AChE
Anti-resistant
AChE
S 0.26970.071 0.9770.12 0.8570.23
R 0.12170.022 0.8870.12 0.7970.22
Significant differences from the susceptible colony by Student t-test
(Po0.05).aThe alkaline phosphatase activities were detected spectrophotometri-
cally at 405 nm, and the absorbance values for this wavelength (OD405)
were used to calculate the quantity of AChE.
J.-C. Hsu et al. / Insect Biochemistry and Molecular Biology 38 (2008) 146154152
7/27/2019 1-s2.0-S096517480700238X-main
8/9
In terms of activity, we found that the purified AChE
enzyme from the R line of B. dorsalis exhibited approxi-
mately one half the level of activity compared to the Sline.
This lower level of activity agreed with our previous
findings obtained from crude preparations of AChE in
these same flies (Hsu et al., 2006). This reduction in activity
of purified AChE from resistant individuals is also similarto results seen in studies of resistance in the Colorado
potato beetle (Zhu and Clark, 1995b). However, in studies
of organophosphate-resistance for insects such as the green
rice leafhopper (Hama, 1983, 1984) and lesser grain borer
(Guedes et al., 1998) no similar reductions were seen.
In terms of hydrolyzing efficiencies (Vmax), the overall
range of values obtained for the purified AChE from both
lines were similar to those observed from studies of
Drosophila (Gnagey et al., 1987) and other insect species
such as the Colorado potato beetle, lesser grain borer,
Western corn rootworm and greenbug (Zhu and Clark,
1994; Guedes et al., 1998; Gao et al., 1998; Gao and Zhu,
2001). However, between the S and R lines of B. dorsalis
examined here, the purified AChEs had different kinetic
characteristics. For the R line the enzyme activity, Vmax/Kmratio, turnover number (Kcat) and substrate specificity
constant (Kcat/Km) of AChE for the substrates, ATC, PTC,
and BTC were nearly two-fold lower compared to that
from the S line (Table 2). This is consistent with the
hypothesis that a modification of the enzyme catalytic site
is present in the enzyme from the resistant flies.
Purified AChE from the two lines examined here also
differed in terms of inhibition by various compounds
(as measured using I50 values). The R line was insensitive to
inhibition even under high concentrations of paraoxon orfenitroxon (105107 M), and was also 1245810-fold
more insensitive to inhibition by eserine, paraoxon and
fenitroxon, respectively, compared to the Sline. This range
of effects using different inhibitors is to some extent also
consistent with cross resistance to other organophosphate
insecticides seen previously in B. dorsalis (Hsu et al., 2004).
However, AChE from the R line showed only slight
differences in inhibition by BW284C51 or ethopropazine
compared to AChE from the S line. The BW284C51
compound is considered to be a very specific inhibitor of
AChE (Felder et al., 2002), and it is curious why our results
do not show a greater difference in inhibitory effects
between the two lines. One possible explanation for this is
the fact that although one of the sites affected here (I214V)
interacts with the key anionic site residue W121
(in Torpedo californica; position 138 in B. dorsalis) (Harel
et al., 2000; Hsu et al., 2006), Felder et al. (2002) showed
that in T. californica, BW284C51 binds only weakly to this
particular site. Because of the weak binding, any altering of
the interactions between the I214V and W121 sites may
simply be limited in effect.
Finally, using anti-AChE polyclonal antibodies we also
showed that there were no quantitative differences in the
amount of enzyme present in extracts from the R and S
lines. Real-time PCR was also used to measure the levels of
RNA expression of the different alleles of the ace gene
(relative to the 18S gene), and here again no significant
differences were detected between the two lines.
Overall, these findings strongly indicate that the qualitative
alteration of the structure and function of the AChE
enzyme appears to be the major cause for the observed
resistance of B. dorsalis to fenitrothion. No evidence ofquantitative effects on expression of the ace gene or
the amount of enzyme produced between the R and S lines
that would explain the phenotypes observed was obtained
here.
The conclusion that the resistance phenomenon observed
in B. dorsalis results from qualitative effects on the AChE
enzyme is entirely consistent with the results seen for
B. oleae (Vontas et al., 2002). For both of these species,
point mutations at two identical positions in the ace gene
producing predicted amino acid substitutions in the AChE
enzyme were detected, and in both cases significant
reductions in the catalytic efficiency of the enzyme and
decreased sensitivity to inhibition were observed in
association with resistance. As described in the paper by
Vontas et al. (2002) one of these alterations, specifically the
I214V mutation, appears to be located within the active site
of enzyme, and this certainly would be expected to have a
dramatic impact on enzyme activity for both species.
Alteration of this site may also result in decreased
deacetylation activity, and this could affect the sensitivity
of the enzyme to various carbamate based insecticides
(Harel et al., 2000; Villatte et al., 2000; Shi et al., 2004).
In addition to these qualitative effects, we also showed
that at least for the B. dorsalis lines analyzed here, these
mutations did not appear to be associated with anyquantitative alterations in the level of gene expression. It
remains to be seen whether these kinds of effects on gene
expression or alterations of distinct genes, such as that seen
in the Aphididae (Margaritopoulos et al., 2007), apply to
the case of resistance phenomena in these or other fruit fly
species.
Acknowledgments
The authors wish to acknowledge the helpful comments
and corrections on an earlier version of this manuscript
made by Dr. J.G. Vontas and the suggestions for signi-ficant improvements made by two anonymous reviewers.
We also wish to thank Y.-C. Chen for assistance with the
bioassays and G.-S. Lin for his assistance with the real-time
PCR assay. We also appreciate Dr. C.-C. Lo for access to
the real-time PCR equipment. This research was supported
by the Council of Agriculture, Executive Yuan, and
National Science Council (NSC 95-2313-B-001), Taiwan.
References
Ellman, G.L., Courtney, K.D., Andres Jr., V., Featherstone, R.M., 1961.
A new and rapid colorimetric determination of acetylcholinesterase
activity. Biochem. Pharmacol. 7, 8896.
ARTICLE IN PRESS
J.-C. Hsu et al. / Insect Biochemistry and Molecular Biology 38 (2008) 146154 153
7/27/2019 1-s2.0-S096517480700238X-main
9/9
Felder, C.E., Harel, M., Silman, I., Sussman, J.L., 2002. Structure of a
complex of the potent and specific inhibitor BW284C51 with Torpedo
californica acetylcholinesterase. Acta Cryst. D 58, 17651771.
Fournier, D., Bride, J.M., Hoffman, F., Karch, F., 1992. Acetylcholines-
terase: two types of modifications confer resistance to insecticides.
J. Biol. Chem. 267, 1427014274.
Gao, J.R., Zhu, K.Y., 2001. An acetylcholinesterase purified from the
greenbug (Schizaphis graminum) with some unique enzymological andpharmacological characteristics. Insect Biochem. Mol. Biol. 31,
10951104.
Gao, J.R., Rao, J.V., Wilde, G.E., Zhu, K.Y., 1998. Purification and
kinetic analysis of acetylcholinesterase from Western corn rootworm,
Diabrotica virgifera virgifera (Coleoptera: Chrysomelidae). Arch.
Insect Biochem. Physiol. 39, 118125.
Gnagey, A.L., Forte, M., Rosenberry, T.L., 1987. Isolation and
characterization of acetylcholinesterase from Drosophila. J. Biol.
Chem. 262, 1329013298.
Guedes, R.N., Zhu, K.Y., Kambhampati, S., Dover, B.A., 1998.
Characterization of acetylcholinesterase purified from the lesser grain
borer, Rhyzopertha dominica (Coleoptera: Bostrichidae). Comp.
Biochem. Physiol. C Pharmacol. Toxicol. Endocrinol. 119, 205210.
Hama, H., 1983. Resistance to insecticides due to reduced sensitivity of
acetylcholinesterase. In: Georghiou, P.G., Saito, T. (Eds.), PestResistance to Pesticides. Plenum Press, New York, pp. 146.
Hama, H., 1984. Mechanism of fenitrothion-resistance and diazinon-
resistance in the green rice leafhopper, Nephotettix cincticeps Uhler
(Hemiptera, Deltocephalidae)the role of aliesterase. Jpn. J. Appl.
Entomol. Zool. 28, 143149.
Harel, M., Kryger, G., Rosenberry, T.L., Mallender, W.D., Lewis, T.,
Fletcher, R.J., Guss, J.M., Silman, I., Sussman, J.L., 2000. Three-
dimensional structures ofDrosophila melanogaster acetylcholinesterase
and of its complexes with two potent inhibitors. Prot. Sci. 9,
10631072.
Hawkes, N.J., Janes, R.W., Hemingway, J., Vontas, J., 2005. Detection of
resistance-associated point mutations of organophosphate-insensitive
acetylcholinesterase in the olive fruit fly, Bactrocera oleae (Gmelin).
Pestic. Biochem. Physiol. 81, 154163.
Hsiao, Y.-M., Lai, J.-Y., Liao, H.-Y., Feng, H.-T., 2004. Purification andcharacterization of acetylcholinesterase from oriental fruit fly
(Bactrocera dorsalis (Hendel)) (Diptera: Tephritidae). J. Agric. Food
Chem. 52, 53405346.
Hsu, J.-C., Feng, H.-T., 2000. Insecticide susceptibility of the oriental fruit
fly (Bactrocera dorsalis (Hendel)) (Diptera: Tephritidae) in Taiwan.
Chinese J. Entomol. 20, 109118.
Hsu, J.-C., Feng, H.-T., 2002. Susceptibility of melon fly (Bactrocera
cucurbitae) and oriental fruit fly (B. dorsalis) to insecticides in Taiwan.
Plant Prot. Bull. 44, 303314 (in Chinese, with English abstract).
Hsu, J.-C., Feng, H.-T., Wu, W.-J., 2004. Resistance and synergistic
effects of insecticides in Bactrocera dorsalis (Diptera: Tephritidae) in
Taiwan. J. Econ. Entomol. 97, 16821688.
Hsu, J.-C., Haymer, D.S., Wu, W.-J., Feng, H.-T., 2006. Mutations in the
acetylcholinesterase gene of Bactrocera dorsalis associated with
resistance to organophosphorus insecticides. Insect Biochem. Mol.Biol. 36, 396402.
Konno, Y., Shishido, T., 1989. Binding-protein, a factor of fenitrooxon
detoxication in OP-resistant rice stem borers. J. Pestic. Sci. 14,
359362.
Kotze, A.C., Walkbank, B.E., 1996. Esterase and monooxygenase
activities in organophosphate-resistant strains of Oryzaephilus surina-
mensts (Coleoptera, Cucujidae). J. Econ. Entomol. 89, 571576.
Kozaki, T., Shono, T., Tomita, T., Kono, Y., 2001. Fenitroxon insensitive
acetylcholinesterases of the housefly, Musca domestica associated with
point mutations. Insect Biochem. Mol. Biol. 31, 991997.
Main, A.R., Iverson, F., 1966. Measurement of the affinity and
phosphorylation constants governing irreversible inhibition of choli-
nesterases by di-isopropyl phosphorofluoridate. Biochem. J. 100,
525531.
Margaritopoulos, J.T., Skouras, P.J., Nikolaidou, P., Manolikaki, J.,
Maritsa, K., Tsamandani, K., Kanavaki, O.M., Bacandritsos, N.,
Zarpas, K.D., Tsitsipis, J.A., 2007. Insecticide resistance status of
Myzus persicae (Hemiptera: Aphididae) populations from peach and
tobacco in mainland Greece. Pest Manage. Sci. 63, 821829.
Mutero, A., Fournier, D., 1991. Drosophila acetylcholinesterase structure.In: Massouile, J., Bacou, F., Bacou, E., Chatonnet, A., Doctor, B.P.,
Quinn, D.M. (Eds.), Cholinesterases: Structure, Function, Mechanism,
Genetics, and Cell Biology. American Chemical Society Publishers,
Washington, pp. 141145.
Mutero, A., Pralavorio, M., Bride, J.M., Fournier, D., 1994. Resistance-
associated point mutations in insecticide-insensitive acetylcholinester-
ase. Proc. Natl. Acad. Sci. USA 91, 59225926.
Nishizawa, Y., Fujii, K., Kadota, T., Miyamoto, J., Sakamoto, H., 1961.
Studies on organophosphorus insecticides part VII. Chemical and
biological properties of new low toxic organophosphorus insecticide,
O, O-dimiethyl-O-(3-methyl-4-nitrophenyl) phosphorothioate. Agric.
Biol. Chem. 25, 605610.
Oppenoorth, F.J., Welling, W., 1979. Biochemistry and physiology of
resistance. In: Wilkinson, C.F. (Ed.), Insecticide Biochemistry and
Physiology, second ed. Plenum Press, New York, pp. 507551.Pfaffl, M.W., 2001. A new mathematical model for relative quantification
in real-time RT-PCR. Nucleic Acids Res. 29, e45.
Shi, M.A., Lougarre, A., Alies, C., Fremaux, I., Tang, Z.H., Stojan, J.,
Fournier, D., 2004. Acetylcholinesterase alterations reveal the fitness
cost of mutations conferring insecticide resistance. BMC Evol. Biol. 4,
5.
Vaughan, A., Rocheleau, T., Ffrench-Constant, R., 1997. Site-directed
mutagenesis of an acetylcholinesterase gene from the yellow fever
mosquito Aedes aegypticonfers insecticide insensitivity. Exp. Parasitol.
87, 237244.
Villatte, F., Ziliani, P., Marcel, V., Menozzi, P., Fournier, D.,
2000. A high number of mutations in insect acetylcholinesterase
may provide insecticide resistance. Pestic. Biochem. Physiol. 67,
95102.
Vontas, J.G., Hejazi, M.J., Hawkes, N.J., Cosmidis, N., Loukas, M.,Hemingway, J., 2002. Resistance-associated point mutations of
organophosphate insensitive acetylcholinesterase, in the olive fruit fly
Bactrocera oleae. Insect Mol. Biol. 11, 329336.
Weill, M., Malcolm, C., Chandre, F., Mogensen, K., Berthomieu, A.,
Marguine, M., Raymond, M., 2004. The unique mutation in ace-1
giving high insecticide resistance is easily detectable in mosquito
vectors. Insect Mol. Biol. 13, 17.
Yeh, S.D., Gonsalves, D., 1984. Purification and immunological analyses
of cylindrical-inclusion protein induced by papaya ringspot virus and
watermelon mosaic virus 1. Phytopathology 74, 12731278.
Yergey, J., Heller, D., Hansen, G., Cotter, R.J., Fenselau, C., 1983.
Isotopic distributions in mass spectra of large molecules. Anal. Chem.
55, 353356.
Zhu, K.Y., Brindley, W.A., 1992. Catalytic and inhibitory properties of a
major molecular form of acetylcholinesterase isolated from Lygushesperus Knight (Hemiptera: Miridae). Comp. Biochem. Physiol. 103B,
147151.
Zhu, K.Y., Clark, J.M., 1994. Purification and characterization of
acetylcholinesterase from the Colorado potato beetle, Leptinotarsa
decemlineata (Say). Insect Biochem. Mol. Biol. 24, 453461.
Zhu, K.Y., Clark, J.M., 1995a. Cloning and sequencing of a cDNA
encoding acetylcholinesterase in Colorado potato beetle, Leptinotarsa
decemlineata (Say). Insect Biochem. Mol. Biol. 25, 11291138.
Zhu, K.Y., Clark, J.M., 1995b. Comparisons of kinetic properties of
acetylcholinesterase purified from azinphosmethyl-susceptible and
resistant strains of Colorado potato beetle. Pestic. Biochem. Physiol.
51, 5767.
ARTICLE IN PRESS
J.-C. Hsu et al. / Insect Biochemistry and Molecular Biology 38 (2008) 146154154