1.1 Perl Programming for Biology The Bioinformatics Unit G.S. Wise Faculty of Life Science Tel Aviv University, Israel March 2009 Eyal Privman and Dudu

1.1

Perl Programming for Perl Programming for BiologyBiology

The Bioinformatics UnitG.S. Wise Faculty of Life Science

Tel Aviv University, IsraelMarch 2009

Eyal Privman and Dudu Burstein

1.2Why biologists need Why biologists need computers?computers? Collecting and managing data

http://www.ncbi.nlm.nih.gov/ Searching databases

http://www.ncbi.nlm.nih.gov/BLAST/ Interpreting data

Protein function prediction - http://smart.embl-heidelberg.de/

Gene expression - http://www.bioconductor.org/

Browsing genomes - http://genome.ucsc.edu/

1.3

Why biologists need to Why biologists need to program?program?

(or: why are you here?) (or: why are you here?)

1.4 Why biologists need Why biologists need to to programprogram??

A real life exampleA real life exampleProto-oncogene activation by retroviral insertional mutagenesisc-Myc: an example for transformation caused by translocation,over- or misexpression.(In w.t. cells c-Myc is expressed only during the G1 phase).

1.5

A real life exampleA real life example

Shmulik

>tumor1TAGGAAGACTGCGGTAAGTCGTGATCTGAGCGGTTCCGTTACAGCTGCTACCCTCGGCGGGGAGAGGGAAGACGCCCTGCACCCAGTGCTG...>tumor157

Run BLAST: http://www.ncbi.nlm.nih.gov/BLAST/Click “Reformat these results”, choose “Show alignment as plain text”, click “view report” and save it to a text file:

Score ESequences producing significant alignments: (bits) Valueref|NT_039621.4|Mm15_39661_34 Mus musculus chromosome 15 genomic... 186 1e-45ref|NT_039353.4|Mm6_39393_34 Mus musculus chromosome 6 genomic c... 38 0.71 ref|NT_039477.4|Mm9_39517_34 Mus musculus chromosome 9 genomic c... 36 2.8 ref|NT_039462.4|Mm8_39502_34 Mus musculus chromosome 8 genomic c... 36 2.8 ref|NT_039234.4|Mm3_39274_34 Mus musculus chromosome 3 genomic c... 36 2.8 ref|NT_039207.4|Mm2_39247_34 Mus musculus chromosome 2 genomic c... 36 2.8

>ref|NT_039621.4|Mm15_39661_34 Mus musculus chromosome 15 genomic contig, strain C57BL/6J Length = 64849916

Score = 186 bits (94), Expect = 1e-45 Identities = 100/102 (98%) Strand = Plus / Plus Query: 1 taggaagactgcggtaagtcgtgatctgagcggttccgttacagctgctaccctcggcgg 60 ||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||Sbjct: 23209391 taggaagactgcggtgagtcgtgatctgagcggttccgtaacagctgctaccctcggcgg 23209450

...

...

1.6 A Perl script can do it for A Perl script can do it for youyou

Shmulik writes a simple Perl script to parse blast results and find all hits that are in the myc locus, or up to 10kbp from it:

• Use the BioPerl package SearchIO

• Open and read file “mice.blast”

• Iteration – for each blast result:

• If we hit the genomic sequence “Mm15_39661_34”

• in the coordinates of the Myc locus (23,198,120 .. 23,223,004)

• then print this hit (hit number and position in locus)


use Bio::SearchIO;my $blast_report = new Bio::SearchIO ('-format'=>'blast', '-file' =>'mice.blast');

while (my $result = $blast_report->next_result){ print "Checking query ", $result->query_name, "...\n"; my $hit = $result->next_hit(); my $hsp = $hit->next_hsp(); if ($hit->name() =~ m/Mm15_39661_34/ && $hsp->hit->start() > 23198120 && $hsp->hit->end() < 23223004) { print " hit ", $hit->name(); print " (at position ", $hsp->hit->start(), ")\n"; }}

Shmulik writes a simple Perl script to parse blast results and find all hits that are in the myc locus, or up to 10kbp from it:

Use the BioPerl package SearchIO Open file “mice.blast”

Iterate over all blast results

For each blast hit – ask if we hit the genomic sequence “Mm15_39661_34” in

the coordinates of the Myc locus 23,198,120..23,223,004

If so – print hit name and position


Checking query tumor1...

hit ref|NT_039621.4|Mm15_39661_34 (at position 23209391)















1.9

What is Perl ?What is Perl ?

• Perl was created by Larry Wall. (read his forward to the book “Learning Perl”)

Perl = Practical Extraction and Report Language(or: Pathologically Eclectic Rubbish Lister)

• Perl is an Open Source project

• Perl is a cross-platform programming language.

1.10

Why Perl ?Why Perl ?

• Perl is an Open Source project • Perl is a cross-platform programming language.

• Perl is a very popular programming language, especially for bioinformatics• Perl allows a rapid development cycle• Perl is strong in text manipulation• Perl can easily handle files and directories• Perl can easily run other programs

1.11

Perl & biologyPerl & biology

BioPerl: “An international association of developers of open source Perl tools for bioinformatics, genomics and life science research”http://bioperl.org/

Many smaller projects, and millions of little pieces of biological Perl code (which you should use as references – google and find them!)

1.12

This courseThis course Intended for students with no experience in

programming, and for those who have taken one programming course in the past (e.g. A course in C or Pascal classes in high school)

Requires more hours than your average seminar…

Oriented towards programming tasks for molecular biology

1.13

Some formalities…Some formalities… Please read the course web page:

http://bioinfo.tau.ac.il/~perluser/perl/tashsatPresentations will be available on the morning of the class.

There will be 5-6 exercises, amounting to 30% of your grade. You get full points if you do the whole exercise, even if your answers are wrong.

Exercises are for individual practice. DO NOT submit exercises in pairs or copy exercises from anyone.

Submit your exercises by email to your metargel (either Eyal [email protected] or Dudu [email protected]) and we will reply with our feedback.

There will be a final exam on the computers in the computer classroom.

1.14

Email list for the courseEmail list for the course Everybody please send us an email

([email protected] and [email protected]) and write that you’re taking the course (even if you are not enrolled yet)

1.15

Example exercisesExample exercises

Ex. 1: Write a script that prints "I will submit my homework on time" 100 times(by the end of this lesson! )

Ex. 3: Read a GenBank file and print coordinates of ORFs

Ex. 5: Write a module of functions for reading sequence files and identification of palindromes

1.16

A first Perl script

print "Hello world!";

A Perl statement must end with a semicolon “;”

The print function outputs some information to the terminal screen

1.17

Data Type Description

scalar A single number or string value

9 -17 3.1415 "hello"

array An ordered list of scalar values

(9,-15,3.5)

associative_array Also known as a “hash”. Holds an unordered list of key-value couples.

('eyal' => '[email protected]',

'dudu' => '[email protected]')

Data types

1.18

Scalar Data

1.19

A scalar is either a string or a number.

Numerical values 3 -20 3.14152965

1.3e4 (= 1.3 × 104 = 1,300)

6.35e-14 ( = 6.35 × 10-14)

Scalar values

1.20

Single-quoted strings

print 'hello world';hello world

Double-quoted strings

print "hello world";hello world

print "hello\tworld";hello world

print 'a backslash-t: \t ';a backslash-t: \t

ConstructMeaning

\nNewline

\tTab

\\Backslash

\”Double quote

Strings

Backslash is an “escape” character that gives the next character a special meaning:

print "a backslash: \\ ";a backslash: \

print "a double quote: \" ";a double quote: "

Scalar values

1.21

Operators

An operator takes some values (operands), operates on them, and produces a new value.

Numerical operators: + - * / ** (exponentiation) ++ -- (autoincrement)

print 1+1; 2

print ((1+1)**3); 8

1.22

Operators

An operator takes some values (operands), operates on them, and produces a new value.

String operators: . (concatenate) x (replicate)

e.g.

print ('swiss'.'prot'); swissprot

print (('swiss'.'prot')x3); swissprotswissprotswissprot

1.23

String or number?

Perl decides the type of a value depending on its context:

(9+5).'a'

14.'a'

'14'.'a'

'14a'

Warning: When you use parentheses in print make sure to put one pair of parantheses around the WHOLE expression:

print (9+5).'a'; # wrong

print ((9+5).'a'); # right

You will know that you have such a problem if you see this warning:

print (...) interpreted as function at ex1.pl line 3.

(9x2)+1

('9'x2)+1

'99'+1

99+1

100

1.24

Variables

Scalar variables can store scalar values.

Variable declaration my $priority;

Numerical assignment $priority = 1;

String assignment $priority = 'high';

Assign the value of variable $b to $a

$a = $b;

Note: Here we make a copy of $b in $a.

1.25

Variables - notes and tips

Tips:• Give meaningful names to variables: e.g. $studentName is better than $n• Always use an explicit declaration of the variables using the my function

Note: Variable names in Perl are case-sensitive. This means that the following variables are different (i.e. they refer to different values):$varname = 1; $VarName = 2;$VARNAME = 3;

Note: Perl has a long list of scalar special variables ($_, $1, $2,…) So please don’t use them!

1.26

Variables - always use strict!

Always include the line: use strict;as the first line of every script.• “Strict” mode forces you to declare all variables by my.• This will help you avoid very annoying bugs, such as spelling mistakes in the names of variables.

1.27

Interpolating variables into strings

$a = 9.5;print "a is $a!\n";

a is 9.5!

Reminder:print 'a is $a!\n';

a is $a!\n

1.28

Reading input<STDIN> allows us to get input from the user:

print "What is your name?\n";my $name = <STDIN>;print "Hello $name!";

Here is a test run:

What is your name? Shmulik Hello Shmulik !

$name: "Shmulik\n"

1.29

$name: "Shmulik\n"

Reading inputUse the chomp function to remove the “new-line” from the end of the string (if there is any):

print "What is your name?\n";my $name = <STDIN>;chomp $name; # Remove the new-line print "Hello $name!";

Here is a test run:

What is your name? Shmulik Hello Shmulik!

$name: "Shmulik"

1.30Built-in Perl functions:

The length function

The length function returns the length of a string: print length("hi you"); 6

1.31

The substr functionThe substr function extracts a substring out of a string. It receives 3 arguments: substr(EXPR,OFFSET,LENGTH)

For example:$str = "university"; $sub = substr ($str, 3, 5);$sub is now "versi", and $str remains unchanged.

Note: If length is omitted, everything to the end of the string is returned. You can use variables as the offset and length parameters.The substr function can do a lot more, google it and you will see…

Documents

1.1 Perl Programming for Biology The Bioinformatics Unit G.S. Wise Faculty of Life Science Tel Aviv University, Israel March 2009 Eyal Privman and Dudu