1336154 File000001 19549953

S1

Supporting Information

An Efficient System for Heterologous Expression of Secondary Metabolite Genes in Aspergillus

nidulans

Yi-Ming Chiang1,2

, C. Elizabeth Oakley3, Manmeet Ahuja

3, Ruth Entwistle

3, Aric Schultz

3,4,

Shu-Lin Chang1,5

, Calvin T. Sung1, Clay C. C. Wang

1,6,*, Berl R. Oakley

3,*

1Department of Pharmacology and Pharmaceutical Sciences, School of Pharmacy, University of

Southern California, 1985 Zonal Avenue, Los Angeles, California 90089, United States

2Graduate Institute of Pharmaceutical Science, Chia Nan University of Pharmacy and Science,

Tainan 71710, Taiwan, Republic of China

3Department of Molecular Biosciences, University of Kansas, 1200 Sunnyside Avenue,

Lawrence, Kansas 66045, United States

4Current address: Department of Microbiology and Immunology, University of Michigan

Medical School, Ann Arbor, MI 48109, United States

5Department of Biotechnology, Chia Nan University of Pharmacy and Science, Tainan 71710,

Taiwan, Republic of China

6Department of Chemistry, College of Letters, Arts, and Sciences, University of Southern

California, Los Angeles, California 90089, United States

*email: [email protected], [email protected]

Corresponding authors: Berl R. Oakley and Clay C. C. Wang.

S2

Table of Contents

Detailed Structural Characterization S3

Supplemental Methods S4

Compound Spectral Data S9

Supplemental References S12

Figure S1. Diagnostic PCR strategies. S14

Figure S2. An alternative secondary metabolite gene cluster deletion scheme. S18

Figure S3. Phylogenetic analysis of PKSs from the genome of A. terreus. S19

Figure S4. New start codons tested. S21

Figure S5. UV-Vis and ESIMS spectra in negative mode of compound 1 – 11 and 15 – 18. S23

Figure S6. HMBC correlations of compounds 6, 7, and 17 – 19. S26

Table S1. A. nidulans strains used for heterologous expression of NR-PKSs from A.

terreus. S27

Table S2. A. nidulans strains constructed in reconstituting the A. terreus asperfuranone

biosynthesis pathway. S28

Table S3. NMR data for compounds 6 and 7. S29



1H and

13C NMR spectra of new compounds 6, 7, 17, 18, and 19 S33

S3

Detailed Structural Characterizations

Two new compounds (6 and 7) isolated from alcA_ATEG_03432.1 strain

HRESIMS and 13

C NMR data (Table S3) of compound 7 indicated that 7 had a molecular

formula of C13H12O5, representing eight indices of hydrogen deficiency (IHD). 1H,

13C, and

gHMQC NMR spectra showed signals for two methyl groups [δH 1.46 (3H, d, J = 6.8 Hz), δC

24.3; and δH 1.98 (3H, s), δC 8.7], one oxygen-bearing methine [δH 5.23 (1H, q, J = 6.8 Hz), δC

66.7] and two aromatic protons [δH 7.43 and 8.08 (each 1H, s)] (Table S3). The 13

C NMR

spectrum revealed that compound 7 contains four olefins (δC 112.9, 120.4, 126.0, 126.1, 131.3,

140.0, 155.1, and 159.6) and two carbonyl groups (δC 181.8 and 185.2). This together with the

fact that compound 7 has eight IHD suggested that 7 contains a naphthaquinone chromophore.

We recently isolated a fatty-polyketide hybrid 22 (Table S3) from an afo (asperfuranone

biosynthetic pathway) engineered strain.1 Compounds 7 and 22 had almost identical UV-Vis

spectra (Fgiure S5). This suggested that 7 and 22 have the same naphthaquinone chromophore.

HMBC correlations allowed us to fully construct the structure of 7 (Figure S6). The 1H and

13C

NMR spectroscopic data of compound 6 were similar to those of 7 (Table S3). Comparison of

the NMR spectra between 6 and 7 indicated a ketone group at C-11 in 6 was reduced to a

hydroxyl group in 7. The C-11 ketone group caused H3-12 in 6 to shift downfield to δH 2.83

(3H, s). Thus, compound 6 was established as shown in Table 3. HMBC correlations (Figure

S6) also confirmed the assigned structure of 6.

Three new compounds (17 – 19) isolated from reconstitution of the afo biosynthetic

pathway

Compound 17 was isolated as yellow oil. The molecular formula was found to be C19H26O4 by

means of HRESIMS and 13

C NMR. The 1H NMR of 17 exhibited signals for the typical

aliphatic side chain found in azaphilons2, such as compound 16, including three olefinic proton

signals at δH 5.53, 6.04, and 6.90 (each 1H), three aliphatic sp3 proton signals at δH 1.3, 1.4,

and 2.47 (each 1H), and three methyl group signals at δH 0.85, 0.99, and 1.80 (each 3H) (Table

S4). Furthermore, its 1H NMR exhibited AB pattern signals at δH 4.80 and 4.86 (each 1H) and

ABX pattern signals at δH 2.40, 2.69, and 3.91 (each 1H). The ABX pattern of 17 is similar to

the same pattern in the 1H NMR spectrum of asperfuranone

3, suggesting that 17 and

S4

asperfuranone might have the same partial structure. Comparison of the 1H and

13C NMR

spectra between 16 and 17 (Table S4) revealed that 17 has one less keto group and one less

olefinic moiety than 16. The AB and ABX pattern signals in the 1H NMR spectrum of 17

suggested that the isochromene-3,5-dione moiety in 16 was reduced to 5-hydroxy-1H-

isochromen-3-one in 17. HMBC correlations (Figure S6) confirmed the assigned structure of 17.

Since compound 17 is structurally related to asperfuranone (12) from a biosynthetic point of

view, we named compound 17 asperpyranone and 16 preasperpyranone.

Compounds 18 and 19 have the molecular formula C14H18O3 and C17H22O4, respectively, on the

basis of their HRESIMS and 13

C NMR data. Both compounds exhibited typical azaphilone side

chains in their 1H NMR spectra including three olefinic protons, three aliphatic sp3 protons, and

three methyl group signals (Table S5). This suggested that compounds 18 and 19 are shunt

products of the afo biosynthetic pathway. The molecular formulae of 18 (C14H18O3) and 19

(C17H22O4) suggested that 18 utilizes two mal-CoAs and 19 utilizes three mal-CoAs and one

SAM for the process of extension. The fact that both compounds do not contain an aldehyde

functional group indicated that these two shunt products are not released by the R domain of

afoE but released through lactone cyclization. Indeed, both compounds contain an α,β,γ,δ-

unsaturated δ-lactone moiety identified from their 1H and

13C NMR spectral data (Table S5). It

is interesting to note that H-2 in 18 and H2-6 in 19 are exchangeable protons due the keto-enol

tautomerization (Table S5). Both structures were further supported by the long-range HMBC

correlations (Figure S6). We named compounds 18 and 19 proasperfuranone A and B,

respectively.

Supplemental Methods

Isolation of secondary metabolites

For scaling up, all A. nidulans strains were grown in 30 ml of liquid LMM in 125 ml flask and

induced by 10 mM of cyclopentanone as described in Materials and Methods. The culture

medium was then combined and extracted with EtOAc as described below. After flash column

chromatography, all fractions were analyzed by HPLC-DAD-MS and 1H NMR. Fractions

containing secondary metabolites of interest were further purified by semi-preparative reverse

phase HPLC [Phenomenex Luna 5 µm C18 (2), 250 × 10 mm] and monitored by a PDA

S5

detector at 254 nm. The gradient system was MeCN (solvent B) in 5 % MeCN/H2O (solvent A)

with or without 0.05 % TFA as specified below. Due to the instability of the intermediates

produced from the afo biosynthesis pathway in acidic conditions, the eluent from semi-

preparative HPLC containing purified intermediate and TFA was quenched with 0.1M KH2PO4

buffer (pH = 7) immediately. After evaporating the solvent, the intermediate was recovered by

adding 20 ml of ddH2O and partitioned with 20 ml of ethyl acetate twice. The spectra data of

these intermediates were taken as rapidly as possible after evaporating the ethyl acetate. The

known compounds were identified by comparing the spectral data with the literature and are

specified below.

alcA(p)_ATEG_00145.1

30 flasks of LO4522 culture medium were collected and the combined medium after filtration

was extracted with EtOAc. After evaporating EtOAc, the crude extract (33 mg) was subjected

to semi-preparative reverse phase HPLC with the following gradient condition without TFA: 10

to 37 % B from 0 to 27 min, 37 to 100 % B from 27 to 28 min, maintained at 100 % B from 28

to 30 min, 100 to 10 % B from 30 to 31 min, and re-equilibration with 10 % B from 31 to 35

min. 6,8-dihydroxy-3-methylisocoumarin (2, 1.3 mg) was eluted at 26.0 min. The

aforementioned medium was then acidified with HCl to pH 2 and extracted with EtOAc twice.

The two EtOAc extracts were combined and the combined EtOAc layer was evaporated in

vacuo. The crude extract in EtOAc layer (408 mg) was applied to a flash reverse phase C18 gel

column (COSMOSIL 75C18-OPN, 20 × 55 mm) and eluted with MeOH-H2O mixtures of

decreasing polarity (fraction A, 1:9, 100 ml; fraction B, 3:7, 100 ml; fraction C, 7:3, 100 ml;

fraction D, 1:0, 100 ml). Fraction B (146.7 mg) containing the major metabolites found in

HPLC profile was subjected to semi-preparative reverse phase HPLC with the following

gradient condition with 0.05 % of TFA: 5 % B from 0 to 5 min, 5 to 24 % B from 5 to 24 min,

24 to 100 % B from 24 to 26 min, maintained at 100 % B from 26 to 27 min, 100 to 5 % B from

27 to 28 min, and re-equilibration with 5 % B from 28 to 32 min. 4-hydroxy-6-methyl-2H-

pyran-2-one (3, 42.3 mg), 2-carboxy-3,5-dihydroxybenzylmethyl ketone (1, 21.0 mg), and

orsellinic acid (4, 7.8 mg) were eluted at 10.5, 20.3 and 22.6 min, respectively.


S6

10 flasks of LO4527 culture medium were filtrated and collected. The combined medium was

extracted with EtOAc. The water layer was then acidified with HCl to pH 2 and extracted with

EtOAc a second time. The two EtOAc extracts were combined and the combined EtOAc layer

was evaporated in vacuo. Without further purification, the 1H and

13C NMR spectra of crude

extract (136.4 mg) in the EtOAc layer showed that it contained 5-methylorsellinic acid (5) as a

major compound.


30 flasks of LO5093 culture medium were filtrated and collected. The combined medium was



was evaporated in vacuo. The crude extract in the EtOAc layer (136 mg) was applied to a flash

reverse phase C18 gel column (COSMOSIL 75C18-OPN, 20 × 30 mm) and eluted with MeOH-

H2O mixtures of decreasing polarity (fraction A, 1:9, 100 ml; fraction B, 3:7, 100 ml; fraction C,

7:3, 100 ml; fraction D, 1:0, 100 ml). Fraction C (72.2 mg) containing the major metabolites

found in HPLC profile was subjected to semi-preparative reverse phase HPLC with the

following gradient condition with 0.05 % of TFA: 20 to 43 % B from 0 to 23 min, 43 to 100 %

B from 23 to 25 min, maintained at 100 % B from 25 to 26 min, 100 to 20 % B from 26 to 27

min, and re-equilibration with 20 % B from 27 to 31 min. 2,7-dihydroxy-6-(1-hydroxyethyl)-3-

methylnaphthalene-1,4-dione (7, 22.9 mg) and 6-acetyl-2,7-dihydroxy-3-methylnaphthalene-

1,4-dione (6, 14.1 mg) were eluted at 10.8 and 22.6 min, respectively.

alcA(p)_ATEG_10080.1*

10 flasks of LO5408 culture medium were filtrated and collected. The medium was extracted

with EtOAc twice and the combined EtOAc layer was then evaporated in vacuo to obtain 113

mg of crude extract. The purification procedure for isolating 3,5-dimethylorsellinic acid (8) was

as described previously4. 72.3 mg of 8 was obtained from 10 flask culture.

alcA(p)_AteafoG, alcA(p)_AteafoE

10 flasks of LO5283 culture medium were filtrated and collected. The combined medium

containing compound 11 was extracted with EtOAc twice. However, compound 11 was found

S7

to be insoluble in water based medium and the majority of 11 remained in the pellet. Thus, the

pellet was soaked in acetone (100 ml) followed by removing the mycelia through filtration.

Both EtOAc and acetone layer were combined, and the organic solvents were evaporated in

vacuo. The purification procedure for isolating compound 11 was as described previously.3

28.5 mg of 11 was purified from 10 flask culture.

alcA(p)_AteafoG, alcA(p)_AteafoC

30 flask of LO7156 culture medium were filtrated and collected. The medium was extracted

with EtOAc twice and the combined EtOAc layer was then evaporated in vacuo to obtain 17 mg

of the crude extract. This crude extract was subjected to semi-preparative reverse phase HPLC

with the following gradient condition with 0.05 % of TFA: 40 to 60 % B from 0 to 20 min, 60 to

100 % B from 20 to 22 min, maintained at 100 % B from 22 to 27 min, 100 to 40 % B from 27

to 28 min, and re-equilibration with 40 % B from 28 to 32 min. (2Z,4Z)-4,6-dimethylocta-2,4-

dienoic acid (15, 0.5 mg) was eluted at 14.3 min.

alcA(p)_AteafoG, alcA(p)_AteafoE, alcA(p)_AteafoD

30 flask of LO6759 culture medium were filtrated and collected. The combined medium was



was evaporated in vacuo. The crude extract in the EtOAc layer (147 mg) was applied to a flash

reverse phase C18 gel column (COSMOSIL 75C18-OPN, 10 × 100 mm) and eluted with

MeOH-H2O mixtures of decreasing polarity (fraction A, 1:9, 50 ml; fraction B, 3:7, 50 ml;

fraction C, 7:3, 50 ml; fraction D, 1:0, 50 ml). Fraction D (39.6 mg) containing compound 16

was further purified by gel filtration chromatography (Sephadex LH-20, 10 × 220 mm) eluted

with MeOH. Due to the instability of compound 16, NMR experiments were undertaken

immediately after gel filtration chromatography. Compound 17 was found to be mainly in the

mycelia of LO6759. Thus, the mycelia were soaked in methanol (200 ml) overnight followed

by removing the mycelia through filtration. Methanol was evaporated to obtain a crude mycelia

extract (79 mg) which was then applied to a flash reverse phase C18 gel column (COSMOSIL

75C18-OPN, 10 × 100 mm) and eluted with MeOH-H2O mixtures of decreasing polarity

(fraction A, 1:9, 50 ml; fraction B, 3:7, 50 ml; fraction C, 7:3, 50 ml; fraction D, 1:0, 50 ml).

S8

Fraction C (7.9 mg) containing compound 17 was subjected to semi-preparative reverse phase

HPLC with the following gradient condition with 0.05 % of TFA: 40 to 60 % B from 0 to 20

min, 60 to 100 % B from 20 to 22 min, maintained at 100 % B from 22 to 25 min, 100 to 40 %

B from 25 to 26 min, and re-equilibration with 40 % B from 26 to 30 min. Asperpyranone (17,

0.8 mg) was eluted at 19.7 min.

alcA(p)_AteafoG, alcA(p)_AteafoE, alcA(p)_AteafoC, alcA(p)_AteafoD, alcA(p)_AteafoC


extracted with EtOAc. The medium was extracted with EtOAc twice and the combined EtOAc

layer was then evaporated in vacuo to obtain 78 mg of crude extract. This crude extract was

subjected to semi-preparative reverse phase HPLC with the following gradient condition with

0.05 % of TFA: 40 to 60 % B from 0 to 20 min, 60 to 100 % B from 20 to 22 min, maintained at

100 % B from 22 to 27 min, 100 to 40 % B from 27 to 28 min, and re-equilibration with 40 % B

from 28 to 32 min. Compounds 15 and 18 (6.2 mg) were coeluted at 14.3 min.

Proasperfuranone B (19, 1.1 mg) was eluted at 16.8 min. Compounds 16 and 17 (5.3 mg) were

coeluted at 19.4 min. Compounds 15 and 18 were further separated with the following gradient

condition with 0.05% of TFA: 40 to 46 % B from 0 to 30 min, 46 to 100 % B from 30 to 31 min,

maintained at 100 % B from 31 to 32 min, 100 to 40 % B from 32 to 33 min, and re-

equilibration with 40 % B from 33 to 37 min. Compounds 15 (1.5 mg) and 18 (2.6 mg) were

eluted at 26.0 and 27.3 min, respectively.

alcA(p)_AteafoG, alcA(p)_AteafoE, alcA(p)_AteafoC, alcA(p)_AteafoD, alcA(p)_AteafoF


extracted with EtOAc. The medium was extracted with EtOAc twice and the combined EtOAc

layer was then evaporated in vacuo to get 27 mg of crude extract. This crude extract was

subjected to semi-preparative reverse phase HPLC with the following gradient condition with

0.05 % of TFA: 40 to 60 % B from 0 to 20 min, 60 to 100 % B from 20 to 22 min, maintained at

100 % B from 22 to 27 min, 100 to 40 % B from 27 to 28 min, and re-equilibration with 40 % B

from 28 to 32 min. Asperfuranone (12, 3.8 mg) was eluted at 13.0 min.

S9

Compound Spectral Data

Melting points were determined with a Yanagimoto micromelting point apparatus and are

uncorrected. NMR spectra were collected on a Varian Mercury Plus 400 spectrometer. High

resolution electrospray ionization mass spectrum was obtained on Agilent 6210 time of flight

LC-MS. The spectral data of compounds 45, 8

4, 11 – 14

3 and 16

2 were identical to those from

our previous studies. Compound 9 had same UV-Vis and MS data (Figure S3) with

atrochrysone reported.6 Atrochrysone is a known major product produced by ACAS and ACTE

in vitro.7 Compound 10 had identical UV-Vis, MS, and retention time with emodin purified

from our previous studies.8

2-carboxy-3,5-dihydroxybenzylmethyl ketone (1)

Amorphous solid; For UV-Vis and ESIMS spectra, see Figure S5; 1H NMR (acetone-d6, 400

MHz) δ 1.69 (3H, s), 3.19 (2H, s), 6.26 (1H, d, J = 2.0 Hz), 6.31 (1H, d, J = 2.0 Hz), 11.37 (1H,

br s). 1H NMR data were in good agreement with the published data.

9

6,8-dihydroxy-3-methylisocoumarin (2)


MHz) δ 2.20 (3H, d, J = 1.2 Hz), 6.30 (3H, m); 1H NMR (CD3OD, 400 MHz) δ 2.20 (3H, d, J =

1.2 Hz), 6.18 (1H, d, J = 2.4 Hz), 6.21 (1H, d, J = 2.4 Hz), 6.25 (1H, br s). 1H NMR data were

in good agreement with the published data.10

4-hydroxy-6-methyl-2H-pyran-2-one (3)

Colorless needles, mp 181 – 183 °C; For UV-Vis and ESIMS spectra, see Figure S5; 1H NMR

(acetone-d6, 400 MHz) δ 2.18 (3H, s), 5.29 (1H, br s), 5.96 (1H, br s); 13

C NMR (acetone-d6,

100 MHz) δ 19.9 (q), 89.6 (d), 100.8 (d), 164.4 (s), 165.0 (s), 171.2 (s). 1H NMR data were in

good agreement with the published data.11

5-methylorsellinic acid (5)


MHz) δ 2.08 (3H, s), 2.49 (3H, s), 6.31 (1H, s); 13

C NMR (acetone-d6, 100 MHz) δ 11.7 (q),

S10

19.0 (q), 101.1 (d), 105.8 (s), 117.1 (s), 142.3 (s), 161.4 (s), 163.8 (s), 174.4 (s). 1H NMR data

were in good agreement with the published data.12

6-acetyl-2,7-dihydroxy-3-methylnaphthalene-1,4-dione (6)

Brown plates, mp > 300 °C; For UV-Vis and ESIMS spectra, see Figure S5; For 1H and

13C

NMR (acetone-d6), see Table S3; HRESIMS, [M – H]– m/z found 245.0456, calc. for C13H9O5:

245.0455.

2,7-dihydroxy-6-(1-hydroxyethyl)-3-methylnaphthalene-1,4-dione (7)

Orange needles, mp 252 – 254 °C (decomposition); For UV-Vis and ESIMS spectra, see Figure

S5; For 1H and

13C NMR (acetone-d6), see Table S3; HRESIMS, [M – H]

– m/z found 247.0612,

calc. for C13H11O5: 247.0612.

(2Z,4Z)-4,6-dimethylocta-2,4-dienoic acid (15)

Colorless amorphous solid; For UV-Vis and ESIMS spectra, see Figure S5; 1H NMR (CDCl3,

400 MHz) δ 0.85 (3H, t, J = 7.6 Hz), 0.99 (3H, d, J = 6.8 Hz), 1.3 and 1.4 (each 1H, m), 1.80

(3H, br s), 2.46 (1H, m), 5.72 (1H, br d, J = 10.0 Hz), 5.79 (1H, d, 15.6 Hz), 7.40 (1H, d, 15.6

Hz); 1H NMR (CD3OD, 400 MHz) δ 0.87 (3H, t, J = 7.2 Hz), 1.00 (3H, d, J = 6.4 Hz), 1.3 and

1.4 (each 1H, m), 1.80 (3H, br s), 2.49 (1H, m), 5.67 (1H, br d, J = 9.6 Hz), 5.78 (1H, d, 15.6

Hz), 7.28 (1H, d, 15.6 Hz); 13

C NMR (CDCl3, 100 MHz) δ 11.9 (q), 12.4 (q), 20.1 (q), 29.9 (t),

35.0 (d), 114.6 (d), 131.6 (s), 149.7 (d), 152.2 (d), 172.4 (s); 13

C NMR (CD3OD, 100 MHz) δ

12.5 (q), 12.7 (q), 20.7 (q), 31.3 (t), 36.2 (d), 117.2 (d), 133.2 (s), 149.4 (d), 151.5 (d), 171.4 (s).

1H and

13C NMR data were in good agreement with the published data.

13

preasperpyranone (16)

Yellow oil; For UV-Vis and ESIMS spectra, see Figure S5; For 1H and

13C NMR (CD3OD), see

Table S4; HRESIMS, [M + H]+ m/z found 315.1589, calc. for C19H22O4: 315.1591.

1H and

13C

NMR data in CDCl3 were identical with our previous published data.2

asperpyranone (17)

S11

Yellow oil; For UV-Vis and ESIMS spectra, see Figure S5; For 1H and

13C NMR (CD3OD), see

Table S4; HRESIMS, [M + H]+ m/z found 319.1912, calc. for C19H26O4: 319.1904.

proasperfuranone A (18)

Yellow-orange oil; For UV-Vis and ESIMS spectra, see Figure S5; For 1H and

13C NMR

(CDCl3 and CD3OD), see Table S5; HRESIMS, [M + H]+ m/z found 235.1328, calc. for

C14H18O3: 235.1329.

proasperfuranone B (19)

Light yellow oil; For UV-Vis and ESIMS spectra, see Figure S5; For 1H and

13C NMR (CDCl3

and CD3OD), see Table S5; HRESIMS, [M + H]+ m/z found 291.1591, calc. for C17H22O4:

291.1591.

S12

Supplemental References

(1) Liu, T.; Chiang, Y. M.; Somoza, A. D.; Oakley, B. R.; Wang, C. C. J Am Chem Soc 2011,

133, 13314-6.

(2) Somoza, A. D.; Lee, K. H.; Chiang, Y. M.; Oakley, B. R.; Wang, C. C. Org Lett 2012, 14,

972-5.

(3) Chiang, Y. M.; Szewczyk, E.; Davidson, A. D.; Keller, N.; Oakley, B. R.; Wang, C. C. J

Am Chem Soc 2009, 131, 2965-70.

(4) Ahuja, M.; Chiang, Y. M.; Chang, S. L.; Praseuth, M. B.; Entwistle, R.; Sanchez, J. F.; Lo,

H. C.; Yeh, H. H.; Oakley, B. R.; Wang, C. C. J Am Chem Soc 2012, 134, 8212-21.

(5) Sanchez, J. F.; Chiang, Y. M.; Szewczyk, E.; Davidson, A. D.; Ahuja, M.; Elizabeth

Oakley, C.; Woo Bok, J.; Keller, N.; Oakley, B. R.; Wang, C. C. Mol Biosyst 2010, 6,

587-93.

(6) Muller, M.; Lamottke, K.; Low, E.; Magor-Veenstra, E.; Steglich, W. Journal of the

Chemical Society, Perkin Transactions 1 2000, 2483-2489.

(7) Awakawa, T.; Yokota, K.; Funa, N.; Doi, F.; Mori, N.; Watanabe, H.; Horinouchi, S.

Chem Biol 2009, 16, 613-23.

(8) Bok, J. W.; Chiang, Y. M.; Szewczyk, E.; Reyes-Domingez, Y.; Davidson, A. D.; Sanchez,

J. F.; Lo, H. C.; Watanabe, K.; Strauss, J.; Oakley, B. R.; Wang, C. C.; Keller, N. P. Nat

Chem Biol 2009, 5, 462-464.

(9) Iwasaki, S.; Muro, H.; Sasaki, K.; Nozoe, S.; Okuda, S.; Sato, Z. Tetrahedron Letters

1973, 14, 3537-3542.

(10) Kendall, J. K.; Fisher, T. H.; Schultz, H. P.; Schultz, T. P. The Journal of Organic

Chemistry 1989, 54, 4218-4220.

(11) Evans, G. E.; Staunton, J. Journal of the Chemical Society, Perkin Transactions 1 1988,

755-761.

(12) Harris, T. M.; Murphy, G. P.; Poje, A. J. Journal of the American Chemical Society 1976,

98, 7733-7741.

(13) Yoshida, E.; Fujimoto, H.; Baba, M.; Yamazaki, M. Chemical & Pharmaceutical Bulletin

1995, 43, 1307-1310.

(14) Takahashi, T.; Jin, F. J.; Sunagawa, M.; Machida, M.; Koyama, Y. Appl Environ

Microbiol 2008, 74, 7684-93.

(15) Bergmann, S.; Schumann, J.; Scherlach, K.; Lange, C.; Brakhage, A. A.; Hertweck, C. Nat

Chem Biol 2007, 3, 213-7.

(16) Chiang, Y. M.; Szewczyk, E.; Nayak, T.; Davidson, A. D.; Sanchez, J. F.; Lo, H. C.; Ho,

W. Y.; Simityan, H.; Kuo, E.; Praseuth, A.; Watanabe, K.; Oakley, B. R.; Wang, C. C.

Chem Biol 2008, 15, 527-32.

(17) Fujii, I.; Ono, Y.; Tada, H.; Gomi, K.; Ebizuka, Y.; Sankawa, U. Mol Gen Genet 1996,

253, 1-10.

(18) Kennedy, J.; Auclair, K.; Kendrew, S. G.; Park, C.; Vederas, J. C.; Hutchinson, C. R.

Science 1999, 284, 1368-72.

(19) Gressler, M.; Zaehle, C.; Scherlach, K.; Hertweck, C.; Brock, M. Chem Biol 2011, 18,

198-209.

(20) Rzhetsky, A.; Nei, M. Molecular Biology and Evolution 1992, 9, 945-67.

(21) Felsenstein, J. Evolution 1985, 39, 783-91.

S13

(22) Zuckerkandl, E.; Pauling, L. Evolutionary divergence and convergence in proteins. Edited

in Evolving Genes and Proteins by V. Bryson and H.J. Vogel 1965, pp. 97-166. Academic

Press, New York.

(23) Nei, M.; Kumar, S. Molecular Evolution and Phylogenetics. 2000, Oxford University

Press, New York.

(24) Saitou, N.; Nei, M. Molecular Biology and Evolution 1987, 4, 406-25.

S14

Figure S1. Diagnostic PCR strategies and representative results

a. Diagnostic PCR for a gene cluster replaced with the AfpyrG gene, in this case the

sterigmatocystin (ST) cluster. Strategies are shown diagramatically above. Primers P1 and P4

are beyond the ends of the ST cluster and primers P2 and P3 are within the AfpyrG sequence

that was used to replace the cluster. The ethidium bromide stained agarose gel below the

diagram shows results for one transformant in which the ST cluster was deleted as well as for a

parental control. Lane 1 shows bacteriophage λ digested with HindIII. Sizes of the fragments

(in kb) are given at the left. Lane 2 shows the results of a P1/P4 amplification of DNA from an

ST cluster deletant. Because the cluster has been deleted, P1 and P4 should be approximately 6

kb apart in the genome and a band of the correct size is amplified. Lane 8 is a PCR

amplification of DNA from the parental strain with the same primers. In the parental strain the

ST cluster is intact and the two primers are more than 50 kb apart. There is weak amplification

of several bands but none of the size predicted for the deletant. In the absence of strong,

specific amplification we often see weak amplification of several bands. Lanes 3 and 4 are

amplifications of deletant DNA with two primer sets (not shown) specific for genes within the

ST cluster. If the genes are present, strong bands of predictable sizes should be amplified.

There is weak, nonspecific amplification with one primer pair (lane 3) and no amplification with

the other (lane 4) indicating that the genes are absent. Lanes 9 and 10 show amplification of

parental DNA with the same primer pairs. The genes are present and bands of the expected

S15

sizes are amplified. Lanes 5 and 6 are amplifications of transformant DNA with P1 and P3 (lane

5) and P2 and P4 (lane 6). Strong bands of the expected sizes are amplified, indicating that the

cluster has been correctly replaced with AfpyrG. There is an additional weaker, lower band in

lane 5 that is also present in parental controls (lane 11). Lanes 11 and 12 show results with the

same primer pairs used to amplify parental DNA. Bands of the sizes expected for the cluster

deletion are not seen although some weaker bands are present.

b. Diagnostic PCR of a completely replaced cluster as created by the approaches shown in

Figure 1b and Supplemental Figure S2. The primers (red arrowheads) are from beyond the ends

of the transforming fragment. Amplification will only occur if the cluster is deleted and the size

of the PCR product can be predicted accurately. The gel below shows results obtained with the

monodictyphenone cluster. The primers used for amplification are outside of the two ends of

the cluster and they are 25,324 bp apart in the genome when the cluster is intact. Deletion of the

cluster leaves them 4015 pb apart. HindIII digests of bacteriophage λ DNA serves as size

standards. A band of the correct size is amplified in DNA from each of five transformants. In

transformant 3 the amplification is weaker as is sometimes the case when one uses miniprep

DNA. Amplification of wild-type DNA with the same primer set does not yield a band of the

size expected if the cluster is deleted but yields weak bands of a variety of sizes.

S16

c. Diagnostic PCR of the first gene transferred from a cluster (in this case a PKS) (see Figure 2

in the main text). Homologous recombination results in the correct reconstruction of the PKS

under the control of the alcA promoter [alcA(p)]. PCR primers (orange arrowheads) are

designed such that they anneal to regions outside of the zone of overlap. Amplification only

occurs if the overlapping fragments recombine correctly and the size can be predicted from

sequence information. In addition, correct integration results in the transforming strain

becoming pyr+, ribo

+ and in conidia becoming white. There are, thus, multiple indicators as to

whether correct integration has occurred. The ethidium bromide stained agarose gel below

shows results with the A. terreus PKS ATEG_02434 transferred into A. nidulans. The PCR

primers are specific for the A. terreus gene and are approximately 1000 bp apart in the gene.

Lane 1 is a HindIII digest of bacteriophage lambda. Sizes of the fragments (in kb) are listed at

the left. The 0.56 kb fragment is very faint. Lanes 2-4 show PCR amplifications from

transformants. All show a band of the correct size although the band in lane 2 is faint. Lane 5 is

S17

an amplification with the same primers of wild-type control DNA. As expected, no band is

amplified. Additional primer pairs may be used for additional verification.

d. Diagnostic PCR of genes transferred subsequently (see Figure 3 in the main text). Primers

(red arrowheads) are designed such that amplification will only occur if the second gene has

integrated correctly and the size of the amplified fragment can be predicted from sequence

information. The second integration also makes the transformed strain ribo- and pyro

+. The

ethidium bromide agarose gel below shows PCR amplification results with DNA from a strain

in which the A. terreus genes ATEG_02434 and ATEG_02438 have been inserted. One primer

is within ATEG_02434 (the PKS) and the second is within ATEG_02438 (Gene B). If the two

genes have been inserted correctly, a band of approximately 4400 bp will be amplified. Lane 1

is bacteriophage lambda DNA digested with HindIII. Fragment sizes (in kb) are shown at the

left. Lanes 2-5 show the results of PCR amplifications with four transformants. Two have a

band of the predicted size and thus have the two genes inserted correctly. Lane 6 is a wild-type

control and shows no specific amplification (a faint smear was visible in the original).

Additional primer pairs may be used for additional verification.

S18

Figure S2. An alternative secondary metabolite gene cluster deletion scheme. This scheme

is derived from one that was developed for Aspergillus sojae and Aspergillus oryzae by

Takahashi et al.14

a. A transforming fragment is generated by fusion PCR that includes two

sequences of ≈ 1 kb each from upstream of the target cluster (U1 and U2) as well as a ≈ 2 kb

sequence from downstream of the cluster (D) and AfpyrG as a selectable marker. Upon

transformation this fragment integrates upstream of the target cluster and the correct integration

is confirmed by diagnostic PCR. b. At a low frequency the duplicated sequences D undergo

homologous recombination with each other excising the target cluster. The loss of AfpyrG, and

thus excisants, can be selected for on 5-FOA. The result is a cleanly removed SM cluster and

since AfpyrG is removed, it can be reused as a selectable marker.

S19

S20

Figure S3. Phylogenetic analysis of PKSs from the genome of A. terreus. The optimal tree

with the sum of branch length = 18.70013344 is shown. The tree is drawn to scale, with branch

lengths in the same units as those of the evolutionary distances used to infer the phylogenetic

tree. Experimentally confirmed NR-PKSs such as A. parasiticus NSAS (AAS66004), A.

fumigatus PksP (CAA76740), P. brevicompactum MpaC (ADY00130), M. purpureus PksCT

(BAD44749), A. strictum MOS (CAN87161), and all NR-PKSs from A. nidulans;4 PKS-NRPSs

such as A. nidulans ApdA,15

A. fumigatus PsoA (EAL85113), A. flavus CpaA (BAI53678), and

C. bassiana TENS (CAL69597); HR-PKSs such as A. nidulans EasB,16

AfoG3, and

ANID_02035.14 were included in this tree. The polyketides of A. terreus ACAS,

7 MSAS,

17

LovB, and LovF18

have been addressed. The product of ATEG_00325.1 has been described

recently.19

Methods for Phylogenetic Analysis.

Amino acid sequences of NR-PKSs were obtained from National Center for Biotechnology

Information (NCBI) or the Broad Institute Aspergillus Comparative Database

(http://www.broadinstitute.org/annotation/genome/aspergillus_group/MultiHome.html).

Identification of KS, AT, ACP, CMeT, TE, and R domains was performed using the NCBI

Conserved Domain Database. Multiple sequence alignments were constructed using ClustalX

(http://www.clustal.org) with default settings and phylogenetic analyses were conducted using

MEGA5 (http://www.megasoftware.net). The evolutionary history was inferred using the

Minimum Evolution method.20

The bootstrap consensus tree inferred from 1000 replicates is

taken to represent the evolutionary history.21

The evolutionary distances were computed using

the Poisson correction method22

and are in the units of the number of amino acid substitutions

per site. The ME tree was searched using the Close-Neighbor-Interchange (CNI) algorithm23

at

a search level of 0. The Neighbor-joining algorithm24

was used to generate the initial tree.

S21

ATEG_02434: >A. terreus supercont_1.3 of Aspergillus terreus [DNA] 1516992-1517305 +

GACAACATGGGCAGCTAGGCCTTCGCTTACGAAGGAACAGGGACTTTCGATCCAACCTGC

ATGCGTATATTCCCAAGGGGTATGCATGCCCGCATAAAGAATGGCGGTCACAGACACATC

CTCGTGCGATACGTACATCAAGAACACATATAAAACTGTCGTGCGGGCACCAAACAGGCA

CTCCATACATGGCAAGATCAACACCGCAAGCATGAATGACAAACCGGCATTCAAGCTCTT

CTACTTTACCAACGAGAAGCCATCGGGTAATCCGAAAGAAGTGTTTCGTCGACTTCGTTC

TCACAGCAAAACCA

Originally annotated start codon Revised start codon ________________________________________________________________ ATEG_07500: >A. terreus supercont_1.11 of Aspergillus terreus [DNA] 259772-261045 -

TGAAGCATGTGCGTAACCCATGTCCGCTAGAATCTAAATTGAGGATTTAAGCAAAAGGAC

TCAACTCCGAGCGTTCATCCAGGTTTGGGTAACGACAACGATGAACGGAGACCATCCCGA

AGAACCATGCCAGGTCATCCTGTTTGGGGACTTGAGCCTAGTTAACATCAAAGACACACT

GAAGAACCTTCTCCATGTCAAGTCAAACCCTCTGCTAACATCTTTCTTTGCCCGCACGAA

TTATTCTCTACGCAGGCTATTGGAGAATCTATCCGGAGATCAACAAGCCCTTTTCCCTCG

TTTCACCACATTGATAGATCTTCTCGCGCGGTTTGGAGAGACACCGGGAACACCAACCCT

TGCTTTCTTTCTTCTATGTGTCCAACAAGTGGCACAATGCATCGTGTACATTTCTAGGTT

CCGTTTGGCGAGTGACATATGCTGATGGACACAGGCATTTCTCGACTGAAAATGACCACT

CGAGCATCTTCCCTCCAAGGAACACATATCTTATCGGTCCTTGCACTGGTGGCTTCTGCG

CAGCTGCATTGAGCTGTTCAACAAGTGTTTCAGACCTCGTGTCAAATGGCGTGGAGGTAT

CAATTAGTGCATTCAAAACAGCACTCCGCTCGTTTCTCGAAGCCAGTGCTATCTCACTCC

ATGACCCGTCATCGAGGAACAGTTGGGCCGCAGTGGTAACCCCATCAGGGAACGTTAGCC

TGGAGCAACTATTAACGGAATATACAGCAAGTTTTCTCTGATCTTTGCGTGGATCGTATC

TGACGGTGGATAGACCTCGACAACGCTTCATCAGCCCATGCATTGGACAAGCGCTCTCAC

CACCACCTCAACATGCACACTGAGTGGACGGCCTTCTAGGTTACGAGATTTCCTGGAGAC

AAACCAAGGCACATTGAAATATCGGTATCTGGAAATTGAATCACCATACCACGCCAGCAG

CCTGTTTGGTGACGCCGATGTTGAAGGCATTATTAATCATGTCGCAGATACGGCCAGGGC

ACCTCAAAGATCCCGCATACCGATTCTCTCATCCACAAGTGGTAGGATCATCCCAGAAGT

CGACTTCATAGGTCTGCTGCGTACGATTGTTCGTGAGACATTATGTGAACCCATTCGATG

GGACCTCATATTGGAATCGTGCCGTAGCTTAATGGCCAAGGAACATGGGAAAAAATGGAC

TATTTTACCATTCTCCAGCAATGCAACCGCGATGGTTGCGGCTGCCCTCACAAAGCAGAA

AGACATCCAGGTAA

Originally annotated start codon Revised start codon ________________________________________________________________ ATEG_08668: >A. terreus supercont_1.13 of Aspergillus terreus [DNA] 494265-494743 +

CAGCCTATAAGCTCTTTGTCGAGTTACTTGCGTGAGTTATCTCCATCATCCCCCATTTCT

AGCACTGATTGGTAAGTTATCAACTAGCATCCCCGGTTAGATGGTAAGTGCTCGAGGGCA

TACGTCGTGGGTGGAACAACAAAAGTATAACCTGTCTAGGATCGAGACTCAAAACCAGCT

S22

ATTCCATCGGGATCCGCGTATTCGTCGATTCATCGAGATAGGACCAAGGACGACGCTCTC

TACCATAGCCAAAAAATCCGCTGCAAAATATCATGCCTCTCATGCTCCATCGCAGTGGTC

AGACCTGCAGTTCTTGTCCTATCAAGAACACAAGGACGAGATCATCTACCGGTATTCAGA

TCCTTCTCAGGATGAAATGCCCTTTAGCAACAAAAAGTCGGAATCCCCGGGACCAGCTCT

TCCTGACCCCAACGTGCTACTGCCCGTGACCAGAGCAGCGGAGAAAGACACCAACCGTG

Originally annotated start codon Revised start codon _______________________________________________________________ ATEG_10080: >A. terreus supercont_1.16 of Aspergillus terreus [DNA] 378550-378768 -

GTTCCTCTCCCCAATGCGTTCTCCCTGCAATTTCTACCCTCCATCCACTCCCTGTCAGGT

TATCCCAACCAAGCGCTGCTGCCCGTTGTCCCTTCCCGACATGGGTTCACTACAGGATGC

CCATCCGCACCGCGTTTCAGTTCTATTCGGACCTAAATGCCCCAAGACTGATCGATCAGT

TCTGCATATACGCCGCTATCTTTCATCTCATAGAAATAC

Originally annotated start codon Revised start codon

Figure S4. New start codons tested for ATEG_07500.1, ATEG_02434.1, ATEG_10080.1, and

ATEG_08668.1. All sequences are from the Broad Institute Aspergillus comparative database.

S23

S24

S25

Figure S5. UV-Vis and ESIMS spectra of compounds 1 – 11 (negative mode) and 15 – 19

(positive mode).

S26

Figure S6. HMBC correlations (C → H) of compounds 6 and 7 in acetone-d6, and 17 – 19 in

CD3OD.

S27

Table S1. A. nidulans strains used for heterologous expression of NR-PKSs from A. terreus. Fungal strain or

transformant(s)

alcA promoter replaced

gene genotypes

LO4388, LO4389, LO4390 None pyrG89; pyroA4; nkuA::argB; riboB2; stcA-W∆

LO4522, LO4524 ATEG_00145.1 pyrG89; pyroA4; nkuA::argB; riboB2; stcA-W∆; wA::AfpyrG:

alcA(p)-ATEG_00145.1: AfriboB

LO4532, LO4533, LO4534 ATEG_07500.1 pyrG89; pyroA4; nkuA::argB; riboB2; stcA-W∆; wA::AfpyrG:


LO5977, LO5978, LO5979 ATEG_07500.1* pyrG89; pyroA4; nkuA::argB; riboB2; stcA-W∆; wA::AfpyrG:

alcA(p)-ATEG_07500.1*: AfriboB



LO4583, LO4587, LO4588,

LO4591, LO4593, LO4595,

LO4596, LO4597

ATEG_08451.1

ATEG_08450.1

pyrG89; pyroA4; nkuA::argB; riboB2; stcA-W∆; wA::AfpyrG:

alcA(p)-ATEG_08451.1: AlcA(p)-ATEG_08450.1-AfpyroA



LO6243, LO6244, LO6249,

LO6250, LO6253, LO6254 ATEG_02434.1

ATEG_02438.1


alcA(p)-ATEG_02434.1: alcA(p)_ATEG_02438.1: AfpyroA



LO6214, LO6215, LO6223,

LO6229, LO6230

ATEG_02434.1*

ATEG_02438.1


alcA(p)-ATEG_02434.1*: alcA(p)-ATEG_02438.1: AfpyroA











LO5283, LO5285 ATEG_07661.1

ATEG_07659.1


alcA(p)-ATEG_07659.1: alcA(p)-ATEG_07661.1: AfpyroA



LO5794, LO5795, LO5796,

LO5797, LO5798

ATEG_08662.1

ATEG_08667.1

ATEG_08668.1


alcA(p)-ATEG_08662.1: alcA(p)-ATEG_08668.1: alcA(p)-

ATEG_08667.1: AfriboB

LO6120, LO6121, LO6125,

LO6127, LO6130, LO6131,

LO6132, LO6135, LO6136,

LO6137

ATEG_08662.1

ATEG_08667.1

ATEG_08668.1*


alcA(p)-ATEG_08662.1: alcA(p)-ATEG_08667.1: alcA(p)-

ATEG_08668.1*: AfriboB

* indicates that the start codon was reaannotated.

S28

Table S2. A. nidulans strains constructed in reconstituting the A. terreus asperfuranone biosynthesis pathway.

Fungal strain or

transformant(s)

A. terreus gene

transferred into A.

nidulans and placed

under control of

alcA(p)

genotypes

LO7020, LO7021, LO7022 none pyrG89; pyroA4; nkuA::argB; riboB2; stcA-W∆; afoA-G∆

LO6751, LO6754 AteafoG, AteafoE pyrG89; pyroA4; nkuA::argB; riboB2; stcA-W∆; afoA-G∆;

wA::AfpyrG: alcA(p)-AteafoG: alcA(p)-AteafoE: AfpyroA

LO6763, LO6764, LO6765,

LO6777, LO6778, LO6779

AteafoG, AteafoE,

AteafoF

pyrG89; pyroA4; nkuA::argB; riboB2; stcA-W∆; afoA-G∆;

wA::AfpyrG: alcA(p)-AteafoG: alcA(p)-AteafoE: alcA(p)-

AteafoF: AfriboB

LO6758, LO6759, LO6760,

LO6772, LO6773, LO6774

AteafoG, AteafoE,

AteafoD


wA::AfpyrG: alcA(p)-AteafoG: alcA(p)-AfoafoE: alcA(p)-

AteafoD: AfriboB

LO6767, LO6768, LO6769,

LO6782, LO6783, LO6784

AteafoG, AteafoE,

AteafoC



AteafoC: AfriboB

LO7156, LO7157, LO7158,

LO7159 AteafoG, AteafoC


wA::AfpyrG: alcA(p)-AteafoG: alcA(p)-AteafoC: AfpyroA

LO6817, LO6838 AteafoG, AteafoE,

AteafoC, AteafoD



AteafoC: alcA(p)-AteafoD: AfpyroA

LO6853, LO6854

AteafoG, AteafoE,

AteafoC, AteafoD,

AteafoC



AteafoC: alcA(p)-AteafoD: alcA(p)-AteafoC: AfriboB

LO6864, LO6865

AteafoG, AteafoE,

AteafoC, AteafoD,

AteafoF



AteafoC: alcA(p)-AteafoD: alcA(p)-AteafoF: AfriboB

LO6843, LO6844, LO6848,

LO6849

AteafoG, AteafoE,

AteafoF, AteafoD,

AteafoC


wA::AfpyrG: alcA(p)-AteafoG; alcA(p)-AteafoE; alcA(p)-

AteafoF: alcA(p)-AteafoD: alcA(p)-AteafoC: AfriboB

LO6855, LO6856, LO6859,

LO6860

AteafoG, AteafoE,

AteafoF, AteafoC,

AteafoD



AteafoF: alcA(p)-AteafoC: alcA(p)-AteafoD: AfriboB

LO 7160, LO7161, LO7162,

LO7163, LO7164

AteafoG, AteafoE,

AteafoF, AteafoC,

AteafoD, AteafoB



AteafoF: alcA(p)-AteafoC: alcA(p)-AteafoD: alcA(p)-

AteafoB: AfriboB

Multiple transformants were used in analyses of secondary metabolite production. AfriboB,

AfpyrG, and AfpyroA are A. fumigatus genes used for replacement of A. nidulans genes. All

strains were constructed in this study except for LO4389.4 There is no standard designation for

genes inserted in tandem so we have created the following designation: wA::AfpyrG: alcA(p)-

AteafoG: alcA(p)-AteafoE: AfpyroA means that the wA gene was replaced with (in order) AfpyrG,

AteafoG under control of alcA(p), AteafoE under control of alcA(p) and AfpyroA.

S29

Table S3. NMR data for compounds 6, 7, and 22 (400 and 100 MHz)

a

6 (acetone-d6) 7 (acetone-d6) 22 (CD3OD)b

position δC δH δC δH δC δH

1 131.2 (CH) 8.49 (1H, s) 126.0 (CH) 8.08 (1H, s) 125.4 (CH) 8.06 (1H, s)

2 124.9 (C) — 126.1 (C) — 125.0 (C) —

3 183.9 (C) — 185.2 (C) — 185.6 (C) —

4 122.3 (C) — 120.4 (C) — 119.6 (C) —

5 156.0 (C) — 155.1 (C) — 155.2 (C) —

6 180.8 (C) — 181.8 (C) — 181.0 (C) —

7 136.4 (C) — 131.3 (C) — 130.7 (C) —

8 115.8 (CH) 7.43 (1H, s) 112.9 (CH) 7.43 (1H, s) 111.4 (CH) 7.36 (1H, s)

9 166.0 (C) — 159.6 (C) — 158.7 (C) —

10 123.6 (C) — 140.0 (C) — 138.5 (C) —

11 206.5 (C) — 66.7 (CH) 5.23 (1H, q, 6.8) 68.3 (CH) 5.02 (1H, dd, 4.4, 3.2)

12 27.7 (CH3) 2.83 (3H, s) 24.3 (CH3) 1.46 (3H, d, 6.8) 37.2 (CH2) 1.66, 1.74 (each 1H, m)

13 8.9 (CH3) 2.01 (3H, s) 8.7 (CH3) 1.98 (3H, s) 25.3 (CH2) 1.27-1.32

14 31.7 (CH2) 1.27-1.32

15 22.5 (CH2) 1.27-1.32

16 13.2 (CH3) 0.89 (3H, t, 6.4)

17 7.3 (CH3) 1.99 (3H, s) aFigures in parentheses are multiplicities and coupling constants (J) in Hz.

bData obtained from our previous studies (Liu et al., J. Am. Chem. Soc. 2011, 133, 13314-13316).

S30

Table S4. NMR data for compounds 16, and 17 (400 and 100 MHz)a

16 (CD3OD) 17 (CD3OD)

position δC δH δC δH

1 154.6 (CH) 8.06 (1H, s) 65.1 (CH2) 4.80 and 4.86 (each 1H, d, 12.4)

2 116.8 (C) — 115.6 (C) —

3 198.6b (C) — 198.8 (C) —

4 84.5 (C) — 78.3 (C) —

5 198.8b (C) — 73.8 (CH) 3.91 (1H, dd, 10.0, 5.6)

6 107.1 (CH) 5.53 (1H, s) 35.6 (CH2) 2.40 (1H, m), 2.69 (1H, dd, 18.0, 5.6)

7 146.2 (C) — 151.6 (C) —

8 110.3 (CH) 6.47 (1H, s) 106.2 (CH) 5.55 (1H, s)

9 158.7 (C) — 162.7 (C) —

10 117.5 (CH) 6.19 (1H, d, 15.6) 119.8 (CH) 6.04 (1H, d, 15.6)

11 142.7 (CH) 7.06 (1H, d, 15.6) 141.7 (CH) 6.90 (1H, d, 15.6)

12 133.8 (C) — 134.0 (C) —

13 148.4 (CH) 5.66 (1H, br d, 9.6) 146.8 (CH) 5.53 (1H, br d, 7.2)

14 36.3 (CH) 2.50 (1H, m) 36.2 (CH) 2.47 (1H, m)

15 31.4 (CH2) 1.3 and 1.4 (each 1H, m) 31.4 (CH2) 1.3 and 1.4 (each 1H, m)

16 12.5 (CH3) 0.86 (3H, t, 7.6) 12.5 (CH3) 0.85 (3H, t, 7.2)

17 20.8 (CH3) 1.00 (3H, d, 6.8) 20.9 (CH3) 0.99 (3H, d, 6.4)

18 12.6 (CH3) 1.84 (3H, br s) 12.7 (CH3) 1.80 (3H, br s)

19 28.2 (CH3) 1.48 (3H, s) 18.4 (CH3) 1.23 (3H, s) aFigures in parentheses are multiplicities and coupling constants (J) in Hz.

bvalues assigned maybe interchanged.

S31

O

O

HO

OO

O

HO

1918

1

47

14

1516

171

4 12

1314

Table S5. NMR data for compounds 18, and 19 (400 and 100 MHz)a

18 (CD3OD) 19 (CD3OD)


1 168.2 (C) — 169.0 (C) —

2 n.o.b n.o.

b 99.8 (C) —

3 174.8 (C) — 168.1 (C) —

4 103.0 (CH) 6.04 (1H, s) 104.4 (CH) 6.12 (1H, s)

5 162.0 (C) — 158.4 (C) —

6 118.1 (CH) 6.14 (1H, d, 15.6) nob no

b

7 142.0 (CH) 7.09 (1H, d, 15.6) 196.5 (C) —

8 133.6 (C) — 124.4 (CH) 6.21 (1H, d, 15.6)

9 147.4 (CH) 5.63 (1H, br d, 9.6) 151.7 (CH) 7.37 (1H, d, 15.6)

10 36.3 (CH) 2.49 (1H, m) 133.7 (C) —

11 31.4 (CH2) 1.3 and 1.4 (each 1H, m) 152.4 (CH) 5.86 (1H, br d, 9.6)

12 12.5 (CH3) 0.87 (3H, t, 7.6) 36.5 (CH) 2.51 (1H, m)

13 20.8 (CH3) 1.01 (3H, d, 6.8) 31.2 (CH2) 1.3 and 1.4 (each 1H, m)

14 12.7 (CH3) 1.83 (3H, br s) 12.5 (CH3) 0.87 (3H, t, 7.2)

15 20.5 (CH3) 1.01 (3H, d, 6.4)

16 12.7 (CH3) 1.83 (3H, br s)


bn.o.: not observed due to deuterium exchangeable proton(s).

S32

O

O

HO

OO

O

HO

1918

1

47

14

1516

171

4 12

1314

Table S5 cont. NMR data for compounds 18, and 19 (400 and 100 MHz)a

18 (CDCl3) 19 (CDCl3)


1 166.9 (C) — 166.9 (C) —

2 90.2 (CH) 5.57 (1H, s) 99.7 (C) —

3 172.7 (C) — 165.3 (C) —

4 101.7 (CH) 5.98 (1H, s) 103.4 (CH) 6.15 (1H, s)

5 160.4 (C) — 155.5 (C) —

6 116.3 (CH) 5.95 (1H, d, 15.6) 44.6 (CH2) 3.73 (2H, s)

7 141.2 (CH) 7.13 (1H, d, 15.6) 194.9 (C) —

8 131.7 (C) — 122.7 (CH) 6.13 (1H, d, 15.6)

9 146.7 (CH) 5.60 (1H, br d, 9.2) 151.5 (CH) 7.29 (1H, d, 15.6)

10 34.8 (CH) 2.43 (1H, m) 131.9 (C) —

11 30.1 (CH2) 1.3 and 1.4 (each 1H, m) 152.5 (CH) 5.82 (1H, br d, 9.6)

12 11.9 (CH3) 0.83 (3H, t, 7.2) 35.3 (CH) 2.47 (1H, m)

13 20.2 (CH3) 0.98 (3H, d, 6.4) 29.8 (CH2) 1.3 and 1.4 (each 1H, m)

14 12.3 (CH3) 1.79 (3H, br s) 11.9 (CH3) 0.84 (3H, t, 7.2)

15 19.9 (CH3) 0.99 (3H, d, 6.4)

16 12.4 (CH3) 1.78 (3H, br s)


bData obtained form gHMBC correlations.

S33

1H NMR spectrum of compound 6 in acetone-d6.

S34

13

C NMR spectrum of compound 6 in acetone-d6.

S35

1H NMR spectrum of compound 7 in acetone-d6.

S36

13

C NMR spectrum of compound 7 in acetone-d6.

S37

1H NMR spectrum of compound 17 in CD3OD.

S38

13

C NMR spectrum of compound17 in CD3OD.

S39


S40

13

C NMR spectrum of compound 18 in CD3OD.

S41

1H NMR spectrum of compound 18 in CDCl3.

S42

13

C NMR spectrum of compound 18 in CDCl3.

S43


S44

13

C NMR spectrum of compound 19 in CD3OD.

S45

1H NMR spectrum of compound 19 in CDCl3.

S46

13

C NMR spectrum of compound 19 in CDCl3.

Documents

1336154 File000001 19549953