1vital pulp therapy

7/29/2019 1vital pulp therapy

1/7

Effect of Dental Materials Calcium HydroxidecontainingCement, Mineral Trioxide Aggregate, and Enamel MatrixDerivative on Proliferation and Differentiation of HumanTooth Germ Stem CellsEsra Pamukcu Guven, DDS, PhD,* Mehmet Emir Yalvac, MSc,

Fikrettin Sahin, PhD,

Munevver M. Yazici, MSc,

Albert A. Rizvanov, PhD, DrSci,k

and Gunduz Bayirli, DDS, PhD*

Abstract

Introduction: Biocompatibility of pulp capping mate-rials is important for successful use in dentistry. Thesematerials should be nontoxic and permissive for prolifer-ation and induction of odontogenic differentiation ofpulp cells. The aim of our study was to evaluate theeffects of enamel matrix derivative (EMD), mineraltrioxide aggregate (MTA), and calcium hydroxidecon-taining cement (DYCAL) on proliferation and odonto-genic differentiation of human tooth germ stem cells(hTGSCs) in which cells belonging to both pulp tissueand dental follicle exist. Methods: The 96-well plates,24-well plates, and special chamber slides were coatedwith biomaterials for cell proliferation, differentiation,and scanning electron microscopy analysis. Odontogenicdifferentiation of hTGSCs was evaluated by analyzingmRNA expression of dentin sialophosphoprotein(DSPP) by real-time polymerase chain reaction expres-sion analysis, measurement of alkaline phosphatase

activity, and visualization of calcium depositions byvon Kossa staining. Results: Our results demonstratethat EMD is the best material in terms of inducing differ-entiation and proliferation of hTGSCs. DYCAL was foundto be toxic to hTGSCs; however, EMD-coated DYCALshowed less toxicity. EMD-coated MTA was not efficientat inducing proliferation and differentiation. Conclu-sions: Pulp capping materials come in direct contact

with dental pulp cells; thus, they require comprehensive evaluation of interactionsbetween cells and biomaterials. Therefore, we cultured hTGSCs, capable of odontogenicdifferentiation, on pulp capping materials directly. Our results suggest that combinationof capping materials with EMD would increase the quality of capping by increasingbiocompatibility of capping materials. (J Endod 2011;37:650656)

Key WordsCalcium hydroxide-containing cement (DYCAL), enamel matrix derivative (EMD),human tooth germ stem cells, mineral trioxide aggregate (MTA), pulp capping

Recent advances in stem cell biology provide new strategies for regenerativeendodontics. It has been shown that bone marrow stem cells, which are currentlymost widely used in clinical applications, are able to differentiate into odontoblasts andform hard tissue (1). On the other hand, dental stem cells including dental pulp cells(DPCs), dental follicle cells, and periodontal stem cells were isolated, characterized,and used in tooth tissue engineering (2). In the presence of signaling molecules trans-forming growth factor-beta (TGF-b), bone morphogenetic proteins BMP-2, BMP-4,

BMP-7, and heme oxygenase-1 enzyme, DPCs differentiated into odontoblast cells(35). During treatment of exposed vital pulp, differentiation and proliferation ofpulp cells are also affected dramatically by the interactions of DPCs and pulpcapping materials. Calcium hydroxidecontaining cement (DYCAL) is an anti-bacterial material that is routinely used as pulp capping agent. Induction of in-flammation in clinical use is disadvantage of DYCAL (6). Mineral trioxide aggregate(MTA) has been shown to induce hard tissue formation within 2 weeks with limitedinflammation (7). It was suggested that MTA increases dentin regeneration more effec-tively than calcium hydroxide (8) probably as a result of release of large numbers ofCa2+ ions (9) or inducing periodontal fibroblasts to secrete BMP-2 and TGF-b1(10, 11). Enamel matrix derivative (EMD) has been reported to be very effective inregeneration of cementum, periodontal ligament, and bone (12). It was hypothesizedthat EMD exerts its therapeutic effect by providing an extracellular matrix that forms

a more natural microenvironment for cells, stimulating cell attachment and differenti-ation (13). Biologically active molecules, present in EMD, do not cause severe allergicreactions except minimal inflammation (13, 14), butthey increase proliferation of cellsand increase hard tissue formation (15). In a recent study it was demonstrated thatwhen MTA and EMD were applied to human DPCs together, the cells differentiatedinto odontoblast-like cells, suggesting a synergistic effect of 2 materials (16).

In clinical use, pulp capping materials are in direct contact with pulp tissue. Mostof thestudies investigating theeffects of pulp capping materialson dentalstem cells usedplate inserts or conditioned medium obtained by incubation with materials. In ourstudy, it was aimed to investigate the direct interaction between cells and the pulpcapping materials by directly culturing the cells on the materials. We also tested theeffects of combination of EMDwith DYCAL andMTA on hTGSCs, which might be consid-ered a new approach for pulp capping applications.

From the*Department of Endodontics, Faculty of Dentistry,and Department of Genetics and BioEngineering, College ofEngineering and Architecture, Yeditepe University, Istanbul,Turkey; and Department of Genetics, Faculty of Biology and

Soil Sciences, Kazan State University; Core Research Labora-tory, Kazan State Medical University; and kRepublic ClinicalHospital, Kazan, Russia.

This study was supported by Yeditepe University (Turkey),grants from the Russian Foundation for Basic Research, RussianFederal Agency for Science and Innovations governmentcontracts FCP. A.A.R. was supported in part by NATO reintegra-tion grant NR.RIG.983007.

Address requests for reprints to Dr Esra Pamukcu Guven,Department of Endodontics, Faculty of Dentistry, YeditepeUniversity, TR-34728, Istanbul, Turkey. E-mail address:[email protected]/$ - see front matter

Copyright 2011 American Association of Endodontists.doi:10.1016/j.joen.2011.02.008

Basic ResearchBiology

650 Guven et al. JOEVolume 37, Number 5, May 2011
mailto:[email protected]://dx.doi.org/10.1016/j.joen.2011.02.008http://dx.doi.org/10.1016/j.joen.2011.02.008mailto:[email protected]


2/7

We studied interactions between materials and cells by directlyculturing cells on materials. In our model we used human tooth germstemcells (hTGSCs), which are multipotent featured, capable of prolifer-ation and odontogenic differentiation. We also tested combinations ofDYCAL andMTA with EMD that might increase efficiencyof capping treat-ments. Odontogenic differentiationof cells wasmonitored by detectionofalkaline phosphatase (ALP) activity and mRNA expression of odonto-blastic markers, such as dentin sialophosphoprotein (DSPP) and

collagen type I, by real-timepolymerase chain reaction (PCR) andimmu-nofluorescence analyses. Calcified nodule structures were evaluated byusing von Kossa method. Attachment of hTGSCs on the surfaces of mate-rials was visualized by scanning electron microscopy (SEM).

Materials and MethodsCell Culture

Isolation of hTGSCs from human impacted third molar tooth germof a 14-year-old healthy patient was performed as described previously(17). Established cell line was maintained in growthmedium consistingof Dulbecco modified essential medium (DMEM) (Inv-itrogen,Carlsbad, CA) supplemented with 10% fetal bovine serum (FBS),2 mmol/L of l-glutamine (Invitrogen), and 1% of penicillin, strepto-

mycin, and Fungizone solution (PSF) (Invitrogen), and incubatedat 37C in a humidified atmosphere of 5% CO2. hTGSCs weresubcultured by using trypsinethylenediaminetetraacetic acid solution(1) (Invitrogen). All tissue culture plates and flasks were purchasedfrom TPP (Winiger, AG Wohlen, Switzerland).

Flow Cytometry AnalysisThe surface antigens of hTGSCs were analyzed by flow cytometry.

Cells were trypsinized and incubated in phosphate-buffered saline(PBS) for 45 minutes with primary antibodies against CD14 (cat#SC-7328), CD29 (cat# BD556049), CD34 (cat# SC-51540), CD45(cat# SC-70686), CD90 (cat# SC-53456), CD105 (cat# SC-71043),CD133 (cat# SC-65278), CD166 (cat# SC-53551) (Santa Cruz

Biotechnology Inc, Santa Cruz, CA), and CD73 (cat# 550256)(Zymed, San Francisco, CA). After washing off the excess primaryantibodies, cells were incubated with fluorescein isothiocyanateconjugated secondary antibodies (cat# SC-2989) at 4C for 45minutes, except for CD29, against which phycoerythrin, red lightharvesting protein containing chromophore, conjugated monoclonalantibody was used for budgetary reasons only. The flow cytometryanalysis of the cells was carried out by using Becton Dickinson FACS-Calibur flow cytometry system (Becton Dickinson, San Jose, CA), with10,000 events being counted for each case.

Material Preparation and Cell SeedingMTA (Dentsply Tulsa Dental, Tulsa, OK) and DYCAL (Dentsply

Caulk, Milford, DE) were purchased and prepared according to themanufacturers instructions. They were applied to the bottom of96-well plate and 4-well chamber slides (Nunc; Thermo Fisher Scien-tific, Waltham, MA), forming 32 mm2 plugs with 2.5-mm thicknessand 200 mm2 plugs with 10-mm thickness, respectively (Fig. 1). Slideswere incubatedat 37C for4 days fordrying andstored at room temper-ature until EMD preparation and application were completed for a day.Original stock of EMD (Emdogain; Biora AB,Malmo,Sweden)at30mg/mL wasdissolved in 10 mmol/L acetic acid to obtain final concentrationof 200 mg/mL. For EMD coating, wells were covered with diluted EMDsolution and incubated overnight at 4C. Before seeding cells, platesand chamber slides were sterilized under UV light for 30 minutes. Cellswere seeded at 3000 cells/well for 96-well plates and 25,000 cells/wellfor chamber slides.

Cell Viability AssayAfter 48-hour incubation on various materials, cell viability was

measured by MTS assay (CellTiter96 Aqueous One Solution; Promega,Southampton, UK) according to the manufacturers instructions.MTS (3-(4, 5-dimethyl-thiazol-2-yl)-5-(3-carboxy-methoxy-phenyl)-2-(4-sulfo-phenyl)-2H-tetrazolium) is a tetrazolium saltbasedcolorimetric assay for detecting the activity of enzymes (mostly in themitochondria) that reduces MTS to formazan, giving a purple colorwhose absorbance was read by a 96-well plate reader (Bio-Tek Instru-ments, Winooski, VT).

SEM AnalysisCells cultured on chamber slideswere used forSEM analysis.First,

cells were fixed by using 2% paraformaldehyde and air-dried at roomtemperature for 1 hour. Visualization of the cells on chamber slideswasperformed by using a Karl Zeiss EVO 40 model SEM instrument (Dres-den, Germany). The slides were coated with a gold layer (10-nm thick-ness) by using a sputter coater (Model BAL-TEC SCD 005 SputterCoater, Balzers, Liechtenstein) to impart electrical conductivity. Theaccelerating voltage was 5 kV for all experiments. SEM images wereobtained from specific areas of interest at various magnifications

(

200 and

5000).

Differentiation of hTGSCs on MaterialsCells were induced to differentiate into odontogenic cells by incu-

bating with odontogenic differentiation medium consisting of DMEMsupplemented with 10% FBS, PSF, 2 mmol/L L-glutamine, 50 mg/mLascorbic acid (Sigma, St Louis, MO), and 2 mmol/L 2-glycerolphos-phate (Sigma) for 14 days, with medium change every other day.

Immunocytochemistry AnalysishTGSCs induced for odontogenic differentiation were fixed with

2% paraformaldehyde and permeabilized by incubation with 0.1%Triton-X100/PBS for 5 minutes. Nonspecific binding of antibodies

Figure 1. Coatings of tissue culture plastic with dental materials. (A) Four-well shamber slides; (B) 96-well plates. M, MTA; D, DYCAL; E, EMD; ME,MTA + EMD; DE, DYCAL + EMD.


JOEVolume 37, Number 5, May 2011 Effect of Dental Materials on hTGSCs 651


3/7

was blocked by adding 2% goat serum (diluted in PBS) for 20 minutes.Samples were incubated with primary anticollagen type-I antibody(cat# SC-80565) and anti-DSPP antibody (cat# SC-33586) overnightat 4C. Each sample was washed twice for 5 minutes with PBS to removeunbound primary antibodies. After washing, goat polyclonal anti-rabbitimmunoglobulin GAlexa 488 conjugate (Invitrogen) secondaryantibodies were added and incubated for 1 hour. DAPI (60-di-ami-dino-2-phenyl-indole) (Sigma Chemical Co) was used as a nuclear

counterstain. Stained cells were visualized by using Leica TCS SP2 SEconfocal microscope (Leica, Bensheim, Germany).

Reverse TranscriptasePCR and Quantitative ReverseTranscriptasePCR Analysis

Total RNA from hTGSCs was isolated by using High Pure RNA Isola-tion Kit (Roche Applied Science, Indianapolis, IN) according to themanufacturers instructions. cDNA synthesis was performed by usingrandom hexamer primers and the Transcriptor First Strand cDNASynthesis Kit (Roche Applied Science). Relative expression of DSPP

mRNAs was analyzed by using SYBR green reverse transcriptase(RT)-PCR method. The PCR primers were as follows: glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (sense: 50TAT CGT GGA AGG ACTCA30, antisense: 50GCA GGG ATG ATG TTC TGG A 30) (18), DSPP (sense:50 GAGGATAAAGGACAACATGG3 0, antisense: 50AAGAAGCATCTCCTCGGC30) (19). cDNAs were mixed with primers and SYBR Premix Ex Taq(including TaKaRa Ex Taq HS, dNTP Mixture, Mg2+, SYBR green-I)in a final volume of 20 mL. GAPDH gene was used as the reference

housekeeping gene for normalization of the data. All RT-PCRexperiments were done by using iCycler RT-PCR detection system(Bio-Rad, Hercules, CA).

ALP ActivityAfter 24-day incubation with odontogenic differentiation medium,

the cells were trypsinized and collected by centrifugation at 1200 rpmfor 5 minutes, followed by resuspension of the cell pellets in 500 mL oflysis buffer (0.2% Triton-X 100 in PBS). Suspension was incubated for30 minutes with agitation (300 rpm). Twenty-five microliters of cell

Figure 2. Immunophenotypic characteristics of hTGSCs. Flow cytometry analyses revealed that hTGSCs were positive for cell surface antigens CD29, CD73, CD90,CD105, and CD166, but negative for hematopoietic markers such as CD14, CD34, CD45, and CD133. FITC, fluorescein isothiocyanate; PE, phycoerythrin.




4/7

lysate was mixed with 75 mL Randox ALP commercial reagent (RandoxLaboratories, Crumlin, UK) in 96-well plate and incubated for 1 hour,measuring absorbance at 15-minute intervals by using 96-well platereader (Bio-Tek Instruments).

Von Kossa StainingAfter 14-day incubation with odontogenic differentiation medium,

cells were fixed with 2% paraformaldehyde at 4C for30 minutes. Then,cells were stained by using von Kossa staining kit (Bio-optica, Milano,Italy), and calcified mineralization was observed by using phasecontrast light microscope (Nikon TS100, Minnesota, MN).

Statistical AnalysisFor statistical analysis, Mann-WhitneyUtest wasused.Pvalue


5/7

EMD was able to induce expression of DSPP during odontogenic differ-entiation of hTGSCs (Fig. 6B). EMD-coated DYCAL and MTA exertedcytotoxic effect on cells during long-term culture; therefore, we couldnot assay ALP activity or expression of odontogenic markers after odon-togenic induction for 14 days.

DiscussionRecent studies demonstrated that human tooth germs contain

multipotent stem cells that are able to differentiate into cells of all 3germ layers: ectoderm, mesoderm, and endoderm (20). hTGSCs iso-lated from third molars of young adults include cells originated fromboth dental pulp and dental follicle because germ tissues are not fullydeveloped into adult tooth yet (21). Dental pulp stem cells are ableto differentiate into odontogenic cells, which is very important forregenerative endodontics (22, 23). In our experiments, we usedhTGSCs to study proliferation and odontogenic differentiation of cellson different pulp capping materials. We demonstrated that hTGSCsare able to differentiate into odontogenic cells, which was confirmed

by analysis of DSPP and increased ALP activity. Immunocytochemistryanalysis showed that on induction of differentiation, hTGSCs expressDSPP and collagen type I forming nodule-like structures and calciumdepositions, suggesting that hTGSCs can be used as a source of stemcells for studying odontogenesis. Thus, the use of HTGSCs might not

only mimic the behavior of dominant cell type in pulp (fibroblasts)but also represent stem cell population, which is essential for regener-ative capacity of the tooth.

Pulp capping materialsaimedto protect exposed vital pulp by seal-ing and inducing healing process in wounded region. In this regard,DYCAL and MTA are widely used materials with distinct advantagesand disadvantages (24, 25). DYCAL has antibacterial property;however, it causes necrosis and inflammation when in contact withpulp tissue (26). On the other hand, MTA has been reported to causelittle inflammation and supports odontogenesis, resulting in more effi-cient pulp tissue regeneration (27). Tissue regeneration is a multidirec-tional subject includingcellular responses such as migration, adhesion,and proliferation. Migration effect of MTA on mesenchymal stem cellswas first shown under in vitro conditions (28). Inducing effect for

Figure 5. SEM analysis of hTGSCs cultured on various surfaces. hTGSCs were grown on different surfaces for 48 hours: (A) DYCAL, (B) DYCAL + EMD, (C) MTA,(D) MTA + EMD, (E) EMD, (F) TCP. Cells demonstrated highest proliferation on EMD-coated surface and TCP. DYCAL exerted cytotoxic effect, resulting in very fewcells attached to the surface. EMD-coated DYCAL demonstrated reduced cytotoxicity and increased number of viable cells.




6/7

angiogenic factor secretion(23) and granulation tissue formation (29),which was related with wound healing, were also noted. MTA supportshealing of pulp by being a biocompatible barrier that protects pulp from

exposure to different physical and chemical stress conditions andprovides calcium ions that are necessary for mineralization (3032).Enamel extracellular matrix proteins in the form of EMD have beenused for the regeneration of periodontal tissues because it triggersosteogenesis and mineralization of the tissues at the site of ap-plication (33). EMD contains proteins that are targeting receptors onthe periodontal stemcells, inducing themto proliferate and differentiateinto osteogenic cells (34). Currently, there are no reports questioningclinical safety of EMD (35). A recent study has shown that EMDincreases effect of MTA in formation of hard tissue, which mightincrease the efficiency of pulp capping treatment (16).

Most of the studies investigating the effect of pulp capping mate-rials on hard tissue formation and proliferation of dental pulp cells

used systems with no direct contact between materials and cells, whichmight not accurately model clinical setting. Developing a model thatwould allow studying the effect of direct interaction between materialsand pulp cells would be important for developing novel procedures forregenerative endodontics. In our study we cultured hTGSCs directly onEMD, MTA, and DYCAL coated surfaces that provided direct contactbetween materials and cells. In addition, the effects of EMD + MTAand EMD + DYCAL combinations on hTGSCs were also analyzed.

After 48-hour incubationon materials, we checked the cytotoxicityof materials by using MTS test. Our results suggest that EMD coating ofsurfaces increased cell proliferation of hTGSCs. DYCAL caused cellulartoxicity that was reduced by additional coating with EMD. This findingsuggests that DYCAL canbe applied with EMD in pulp capping treatmentwith the aim of reducing cellular toxicity and inducing hard tissue

formation. The number of viable cells decreased on EMD-coatedMTA, which wasprobably notdue to EMDbut dueto changes to physicalproperties of MTA as a result of coating with EMD, dissolved in 1 mmol/L acetic acid. EMD-coated MTA did not form a suitable surface for cellsto attach, suggesting a new protocol has to be developed to evaluate theeffect of EMD coating of MTA on hTGSC proliferationand differentiation.

Comparing odontogenic differentiation of hTGSCs on varioussurfaces, it was shown that EMD was highly efficient at increasing

ALP activity and mRNA expression of odontogenic marker DSPP.We could not study the effect of DYCAL on odontogenic differentiationof hTGSCs because of excessive cell death during 14-day incubation.Although EMD-coated DYCAL showed much higher cellular viabilitythan DYCAL itself after 48-hour incubation, it still demonstrated cyto-toxicity during long-term incubation with hTGSCs. Increasing theamount of EMD used in coating of DYCAL might reduce cellulartoxicity and increase pulp regeneration. In summary, for the firsttime we tested the effects of EMD, MTA, and DYCAL on proliferationand odontogenic differentiation of hTGSCs in a direct contact system.Our data support the evidence that EMD increases hard tissue regen-eration and suggests that EMD can be used as one of the componentsin pulp capping procedure along with MTA and DYCAL to increase theefficiency of the therapy.

AcknowledgmentsWe would like to thank Burcin Keskin for her great help in

preparation of cells for flow cytometry analysis.The authors deny any conflicts of interest related to this study.

References1. Hasegawa N, Kawaguchi H, Hirachi A, et al. Behavior of transplanted bone marrow-

derived mesenchymal stem cells in periodontal defects. J Periodontol 2006;77:10037.

2. Lindroos B, Maenpaa K, Ylikomi T, Oja H, Suuronen R, Miettinen S. Characterisation

of human dental stem cells and buccal mucosa fibroblasts. Biochem Biophys ResCommun 2008;368:32935.3. Nakashima M, Nagasawa H, Yamada Y, Reddi AH. Regulatory role of transforming

growth factor-beta, bone morphogenetic protein-2, and protein-4 on gene expres-sion of extracellular matrix proteins and differentiation of dental pulp cells. Dev Biol1994;162:1828.

4. Shiba H, Fujita T, Doi N, et al. Differential effects of various growth factors and cyto-kines on the syntheses of DNA, type I collagen, laminin, fibronectin, osteonectin/secreted protein, acidic and rich in cysteine (SPARC), and alkaline phosphataseby human pulp cells in culture. J Cell Physiol 1998;174:194205.

5. Kim SJ, Min KS, Ryu HW, Lee HJ, Kim EC. The role of heme oxygenase-1 in the prolif-eration and odontoblastic differentiation of human dental pulp cells. J Endod 2010;36:132631.

6. Yasuda Y, Ogawa M, Arakawa T, Kadowaki T, Saito T. The effect of mineral trioxideaggregate on the mineralization ability of rat dental pulp cells: an in vitro study.J Endod 2008;34:105760.

7. Zarrabi MH, Javidi M, Jafarian AH, Joushan B. Histologic assessment of human pulpresponse to capping with mineral trioxide aggregate and a novel endodonticcement. J Endod 2010;36:177881.

8. Min KS, Kim HI, Park HJ, Pi SH, Hong CU, Kim EC. Human pulp cells response toPortland cement in vitro. J Endod 2007;33:1636.

9. Takita T, Hayashi M, Takeichi O, et al. Effect of mineral trioxide aggregate onproliferation of cultured human dental pulp cells. Int Endod J 2006;39:41522.

10. Guven G, Cehreli ZC, Ural A, Serdar MA, Basak F. Effect of mineral trioxideaggregate cements on transforming growth factor beta1 and bone morphoge-netic protein production by human fibroblasts in vitro. J Endod 2007;33:44750.

11. Pistorius A, Willershausen B, Briseno Marroquin B. Effect of apical root-end fillingmaterials on gingival fibroblasts. Int Endod J 2003;36:6105.

12. Gestrelius S, Andersson C, Lidstrom D, Hammarstrom L, SomermanM. In vitro studieson periodontal ligament cells andenamelmatrix derivative. J ClinPeriodontol1997;24(Pt 2):68592.

Figure 6. (A) Analysis of ALP activity in hTGSC extracts after odontogenicdifferentiation. EMD coating of culture surfaces was more efficient atincreasing ALP activity than MTA during odontogenic differentiation. (B)Real-time PCR analysis of DSPP. EMD and MTA induced expression of DSPPmRNA in HTGSCs. Control group: hTGSCs that were not induced to differen-tiate. *P < .05 in comparison with control group.


JOEVolume 37, Number 5, May 2011 Effect of Dental Materials on hTGSCs 655


7/7

13. Suzuki N, Ohyama M, Maeno M, Ito K, Otsuka K. Attachment of human periodontalligament cells to enamel matrix-derived protein is mediated via interaction betweenBSP-like molecules and integrin alpha(v)beta3. J Periodontol 2001;72:15206.

14. Johnson DL, Carnes D, Steffensen B, Cochran DL. Cellular effects of enamel matrixderivative are associated with different molecular weight fractions following separa-tion by size-exclusion chromatography. J Periodontol 2009;80:64856.

15. He J, Jiang J, Safavi KE, Spangberg LS, Zhu Q. Emdogain promotes osteoblast prolif-eration and differentiation and stimulates osteoprotegerin expression. Oral SurgOral Med Oral Pathol Oral Radiol Endod 2004;97:23945.

16. Min KS, Yang SH, Kim EC. The combined effect of mineral trioxide aggregate and

enamel matrix derivative on odontoblastic differentiation in human dental pulpcells. J Endod 2009;35:84751.17. Yalvac ME, Ramazanoglu M, Rizvanov AA, et al. Isolation and characterization of

stem cells derived from human third molar tooth germs of young adults: implica-tions in neo-vascularization, osteo-, adipo- and neurogenesis. PharmacogenomicsJ 2010;10:10513.

18. Lisignoli G, Cristino S, Piacentini A, et al. Cellular and molecular events during chon-drogenesis of human mesenchymal stromal cells grown in a three-dimensional hy-aluronan based scaffold. Biomaterials 2005;26:567786.

19. Alliot-Licht B, Bluteau G, Magne D, et al. Dexamethasone stimulates differentiation ofodontoblast-like cells in human dental pulp cultures. Cell Tissue Res 2005;321:391400.

20. Ikeda E, Yagi K, Kojima M, et al. Multipotent cells from the human third molar: feasi-bility of cell-based therapy for liver disease. Differentiation 2008;76:495505.

21. Yalvac ME, Ramazanoglu M, Tekguc M, et al. Human tooth germ stem cells preserveneuro-protective effects after long-term cryo-preservation. Curr Neurovasc Res2010;7:4958.

22. Yu J, Wang Y, Deng Z, et al. Odontogenic capability: bone marrow stromal stem cellsversus dental pulp stem cells. Biol Cell 2007;99:46574.

23. Paranjpe A, Zhang H, Johnson JD. Effects of mineral trioxide aggregate on humandental pulp cells after pulp-capping procedures. J Endod 2010;36:10427.

24. Isermann GT, Kaminski EJ. Pulpal response to minimal exposure in presence ofbacteria and Dycal. J Endod 1979;5:3227.

25. Barrieshi-Nusair KM, Qudeimat MA. A prospective clinical study of mineral trioxideaggregate for partial pulpotomy in cariously exposed permanent teeth. J Endod2006;32:7315.

26. Kuratate M, Yoshiba K, Shigetani Y, Yoshiba N, Ohshima H, Okiji T. Immunohisto-chemical analysis of nestin, osteopontin, and proliferating cells in the reparativeprocess of exposed dental pulp capped with mineral trioxide aggregate. J Endod2008;34:9704.

27. Shin SY, Albert JS, Mortman RE. One step pulp revascularization treatment of animmature permanent tooth with chronic apical abscess: a case report. Int EndodJ 2009;42:111826.

28. D Anto V, Di Caprio MP, Ametrano G, Simeone M, Rengo S, Spagnuolo G. Effect ofmineral trioxide aggregate on mesenchymal stem cells. J Endod 2010;11:183943.

29. Dammaschke T, Stratmann U, Wolff P, Sagheri D, Schofer E. Direct pulp cappingwith mineral trioxide aggregate: an immunohistologic comparison with calciumhydroxide in rodents. J Endod 2010;36:8149.

30. Simon S, Cooper P, Smith A, Picard B, Ifi CN, Berdal A. Evaluation of a new labo-ratory model for pulp healing: preliminary study. Int Endod J 2008;41:78190.

31. Nair PN, Duncan HF, Pitt Ford TR, Luder HU. Histological, ultrastructural and quan-titative investigations on the response of healthy human pulps to experimentalcapping with mineral trioxide aggregate: a randomized controlled trial. Int EndodJ 2008;41:12850.

32. Tecles O, Laurent P, Aubut V, About I. Human tooth culture: a study model for repar-ative dentinogenesis and direct pulp capping materials biocompatibility. J BiomedMater Res B Appl Biomater 2008;85:1807.

33. Schlueter SR, Carnes DL, Cochran DL. In vitro effects of enamel matrix derivative onmicrovascular cells. J Periodontol 2007;78:14151.

34. Kaida H, Hamachi T, Anan H, Maeda K. Wound healing process of injured pulptissues with emdogain gel. J Endod 2008;34:2630.

35. Garrocho-Rangel A, Flores H, Silva-Herzog D, Hernandez-Sierra F, Mandeville P,Pozos-Guillen AJ. Efficacy of EMD versus calcium hydroxide in direct pulp cappingof primary molars: a randomized controlled clinical trial. Oral Surg Oral Med OralPathol Oral Radiol Endod 2009;107:7338.



Documents

1vital pulp therapy