2 Melt Analysis 3 ACCEPTED...2008/11/12 · 8 Affiliations: 9 1Respiratory Disease Branch, Centers for Disease Control and Prevention, Atlanta, GA 10 2Infectious Diseases Laboratory,

DRAFT: NOT FOR DISSEMINATION OR ATTRIBUTION

1

Genotyping of Chlamydophila psittaci using Real-Time PCR and High Resolution 1

Melt Analysis 2

3

Running title: Genotyping of C. psittaci using HRM 4

Authors 5

Stephanie L. Mitchell1, Bernard J. Wolff

1, W. Lanier Thacker

1, Paula G. Ciembor

2, 6

Christopher R. Gregory2, Karin D.E. Everett, Branson W. Ritchie

2, Jonas M. Winchell

1,3 7

Affiliations: 8

1Respiratory Disease Branch, Centers for Disease Control and Prevention, Atlanta, GA 9

2Infectious Diseases Laboratory, College of Veterinary Medicine, University of Georgia, 10

Athens, GA 11

12

13

3Corresponding Author: 14

Centers for Disease Control and Prevention 15

1600 Clifton Rd. N.E. 16

MS: G-03 17

Atlanta, GA 30333 18

(404)639-4921 19

(404)639-4215 fax 20

Email: [email protected] 21

22

23

ACCEPTED

Copyright © 2008, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.J. Clin. Microbiol. doi:10.1128/JCM.01851-08 JCM Accepts, published online ahead of print on 12 November 2008

on June 13, 2020 by guesthttp://jcm

.asm.org/

Dow

nloaded from

http://jcm.asm.org/


2

Abstract 24

Human infection with Chlamydophila (Chlamydia) psittaci can lead to psittacosis, 25

a disease that occasionally results in severe pneumonia and other medical complications. 26

C. psittaci is currently grouped into 7 avian genotypes: A-F and E/B. Serological testing, 27

outer membrane protein A (ompA) gene sequencing, and restriction fragment length 28

polymorphism (RFLP) analysis are currently used for distinguishing these genotypes. 29

Although accurate, these methods are time-consuming and require multiple confirmatory 30

tests. By targeting the ompA gene, a real-time PCR assay has been developed to rapidly 31

detect and genotype C. psittaci using “Light Upon eXtension” (LUX™) chemistry and 32

high resolution melt (HRM) analysis. Using this assay, we screened 169 animal 33

specimens; 98 were positive for C. psittaci (71.4% genotype A, 3.1% genotype B, 4.1% 34

genotype E, and 21.4% were unable to be typed). This test may provide insight into the 35

distribution of each genotype among specific hosts and provide epidemiological and 36

epizootiological data in human and mammalian/avian cases. This diagnostic assay may 37

also have veterinary applications during Chlamydial outbreaks, particularly with respect 38

to identifying sources and tracking movements of a particular genotype when multiple 39

animal facilities are affected. 40

ACCEPTED


.asm.org/

Dow

nloaded from

http://jcm.asm.org/


3

Key Words: C. psittaci, High Resolution Melt, Real-time PCR, genotyping, psittacosis 41

ACCEPTED


.asm.org/

Dow

nloaded from

http://jcm.asm.org/


4

Introduction 42

Chlamydophila (Chlamydia) psittaci is an intracellular pathogen and a member of 43

the Chlamydiaceae family that is most frequently associated with Psittaciformes but can 44

also infect many other avian orders and species as well as a wide range of mammalian 45

hosts (9). C. psittaci has the ability to remain infectious in the environment for months, 46

presenting a variety of public health issues including economically devastating outbreaks 47

in poultry farms and occasionally severe pneumonia in humans (3,4,10,20,24,25). 48

Transmission of this atypical respiratory pathogen can occur through direct contact with 49

infected birds, bird feces, nasal discharges, and aerosols, causing respiratory disease in 50

both mammals and birds (14,19). Zoonotic infections in humans usually result from close 51

contact with infected captive birds or free-ranging birds; human-to-human transmission 52

has also been suggested (1,8,17,19,20). Regardless of the transmission method, infection 53

may lead to psittacosis, a primarily respiratory disease complex that may result in severe 54

pneumonia and a wide spectrum of other medical complications (14). Individuals with 55

occupations associated with commercial poultry as well as those with routine contact 56

with companion or aviary birds, are considered most at risk of infection. Furthermore, 57

laboratory-acquired infections remain a concern (13). 58

C. psittaci is currently grouped into 7 avian genotypes (A-F and a newly 59

identified genotype E/B) and 2 non-avian genotypes (M56 and WC) (5). Recent 60

reclassification of C. psittaci has resulted in both C. abortus and C. caviae being 61

separated into distinct species, although both are genetically closely related (2,22). 62

Identification and genotyping of C. psittaci in avian samples and isolates is currently 63

achieved by serological testing and molecular methods such as outer membrane protein A 64

ACCEPTED


.asm.org/

Dow

nloaded from

http://jcm.asm.org/


5

(ompA) gene sequencing, restriction fragment length polymorphism (RFLP), and 65

cumbersome real-time PCR assays and microarray analysis (6,16,18,23). For human 66

diagnosis, culture is rarely performed because the procedure is labor-intensive and 67

requires specialized laboratory expertise and equipment. Thus, accurate diagnosis is 68

often delayed or missed and may result in improper treatment for patients (3). Diagnosis 69

by molecular techniques, such as real-time PCR, is not readily available in most public 70

health laboratories, forcing them to rely upon insensitive complement fixation (CF) or 71

microimmunofluorescence (MIF) tests for detecting C. psittaci antibodies in suspect 72

cases (14). Since both CF and MIF require acute and convalescent sera, they are 73

retrospective assays considered inadequate for a timely diagnosis. A reliable and rapid 74

assay to detect and genotype C. psittaci strains would greatly enhance the diagnostic 75

capability for this agent and facilitate timely treatment. 76

This study reports the development of a real-time PCR assay followed by high 77

resolution melt (HRM) analysis using Light Upon eXtension (LUX™

) chemistry to 78

specifically detect and genotype C. psittaci. This assay may be useful for epidemiological 79

studies and provide valuable information for designing public health measures during 80

outbreaks. This method may also offer greater insight into the heterogeneity of this 81

species. To our knowledge, this is the first report of a HRM-based real-time PCR assay 82

that simultaneously detects and genotypes this species. 83

84

ACCEPTED


.asm.org/

Dow

nloaded from

http://jcm.asm.org/


6

Materials and Methods 85

C. psittaci Strains and Specimens. Reference strain isolates DD-34 (ATCC# 86

VR-854), CP3 (ATCC# VR-574), CT1, NJ1, MN (ATCC# VR-122), and VS-225 were 87

tested along with 169 specimens acquired from companion and aviary birds and 88

mammals. These specimens were previously submitted to the Infectious Diseases 89

Laboratory at the College of Veterinary Medicine, University of Georgia and tested 90

positive at the time of collection (2004-2007) for C. psittaci or other Chlamydophila 91

species using a PCR-based assay. All specimens were obtained from a recommended 92

specimen source: conjunctival, choanal, cloacal swabs or whole blood. 93

C. psittaci culture. C. psittaci reference strains were propagated in VERO cell 94

monolayers grown in 25cm2 culture flasks in Eagle’s Minimal essential medium (MEM) 95

supplemented with MEM non-essential amino acids, 2µM L-glutamine, 20µM HEPES 96

buffer, 10% fetal calf serum, 20µg/ml streptomycin, and 25µg/ml vancomycin. Confluent 97

VERO cell monolayers were inoculated by replacing the growth medium with 1ml of 98

stock C. psittaci culture diluted 1:10 in MEM containing 1µg/ml of cycloheximide. The 99

inoculated monolayers were placed at 37ºC for 2 hr before an additional 4ml of MEM 100

containing cycloheximide was added to each flask. Cultures were incubated for 7 days at 101

37ºC or until the monolayers demonstrated approximately 70% cytopathic effect (CPE), 102

and the remaining VERO cells were scraped from the flask into the medium. One ml of 103

each culture was centrifuged at 20,000 x g for 60 min, and the pellet was resuspended in 104

nuclease-free water (Promega, cat #P1193) and used for DNA extraction. The remaining 105

culture was dispensed into aliquots and frozen at -70ºC. Titration of cultures was 106

performed as previously described with 96-well flat bottom microtiter plates containing 107

ACCEPTED


.asm.org/

Dow

nloaded from

http://jcm.asm.org/


7

VERO cells (21). Frozen C. psittaci cultures of 50 µl quantities at 10-fold dilutions were 108

used to inoculate wells of VERO cells in triplicate. After incubation for 72 hr at 37ºC in a 109

5% CO2 atmosphere, the medium was removed and the cells were fixed with methanol 110

and stained with a Chlamydia genus-specific monoclonal antibody (BioRad, cat #30701). 111

Inclusions (inclusion forming units, IFU/ml) were counted using an inverted fluorescence 112

microscope. 113

DNA extraction. DNA from C. psittaci cultures were extracted using the 114

QiaAmp DNA mini kit (Qiagen Inc., cat # 51304) according to the manufacture’s 115

instructions. The DNA was eluted into 200µl of Qiagen elution buffer and stored at -70ºC 116

until tested. 117

LUX Primer Design and Optimization. Three primer sets were designed 118

targeting the variable regions of the C. psittaci ompA gene. LUX™ chemistry 119

(Invitrogen) utilizes a 5’-carboxy-fluorescein (FAM)-labeled primer and an unlabeled 120

primer. All primer sets were designed using the C. psittaci 6BC ompA gene (GenBank: 121

X56980), 90/105 ompA gene (GenBank: AY762608), and 7778B15 ompA gene 122

(GenBank: AY762612). All C. psittaci primer sequences and expected amplicon sizes are 123

listed in Table 1. Ppac was designed to amplify all C. psittaci genotypes while GTpc 124

specifically amplifies C. psittaci genotypes. The Ppac assay demonstrated a 96% 125

efficiency while GTpc displayed a >99% efficiency, calculated using a standardized 126

dilution series of quantitated DNA of C. psittaci tested in triplicate over six logs (200pg-127

2fg). The average from these data is reported as the square of the coefficient of regression 128

values (efficiency); both assays had a lower limit of detection of 200 fg. A specific C. 129

caviae marker was designed targeting the ompA gene of C. caviae (GenBank: AF269282) 130

ACCEPTED


.asm.org/

Dow

nloaded from

http://jcm.asm.org/


8

using the above chemistry: unlabeled C.cav-F (5’-CCGTTGCAGACAGGAATAACA-3’ 131

and FAM labeled C.cav-R (5’-cacaaaGCTAAGAAAGCCGCGTTTG”t”G-3’). The 132

expected amplicon size is 78bp. 133

Real-time PCR and HRM analysis. The utilization of LUX™ chemistry and 134

HRM analysis is previously described (26). The reaction mix for all primer sets was 135

prepared using the Platinum Quantitative PCR SuperMix-UDG Kit (Invitrogen, cat 136

#11730-025) containing the following components per reaction: 12.5µl of 2X Master 137

mix, a final concentration of 100nM of the forward and reverse primer, 0.15µl of 138

platinum taq polymerase (5U/µl), 5ng of template and nuclease-free water (Promega, cat 139

#P1193) to a final volume of 25µl. Real-time PCR was performed on the Corbett Rotor-140

Gene 6000 (Corbett Life Sciences, cat #65H0) under the following cycling conditions: 1 141

cycle of 95ºC for 2 min followed by 45 cycles of 95ºC for 5 s, 62ºC for 15 s with data 142

acquired at the 62ºC step in the green channel. HRM was performed between 75°C-85ºC 143

in 0.05°C increments with fluorescence normalization regions between 75.5ºC-76ºC 144

before separation and at 84ºC-84.5ºC after the separation. All isolates were tested in 145

triplicate. All specimens (avian and mammalian) were screened for the presence of C. 146

psittaci, followed by genotyping, if applicable. 147

Sequencing. Amplification of the ompA gene from isolate strains (DD34, CP3, 148

CT1, NJ1, Vr-122, and VS-225) and specimens (3, 5, 25, 30, 31, 83) was performed 149

using previously published primers and newly developed primers: ompA-F (5'-150

ACTATGTGGGAAGGTGCT-3') and ompA-R (5'-151

TAGACTTCATTTTGTTGATCTGA-3') (11). The PCR reaction mix was prepared 152

using Platinum Quantitative PCR SuperMix-UDG Kit (Invitrogen, cat #11730-025) 153

ACCEPTED


.asm.org/

Dow

nloaded from

http://jcm.asm.org/


9

containing the following components per reaction: 5µl 10X PCR-MgCl2, 1.5µl 50mM 154

MgCl2, a final concentration of 100nM of forward and reverse primers, 0.5µl of platinum 155

taq polymerase (5U/µl), 1µl of 10 µM PCR Nucleotide Mix (Promega, cat #C1141), 5ng 156

of template, and nuclease-free water (Promega, cat # P1193) to a final volume of 50µl. 157

The DNA Engine Dyad®

Peltier Thermocycler (Bio-Rad, cat # PTC-0220G) was used for 158

amplification under the following cycling conditions: 1 cycle of 95°C for 2 min, followed 159

by 50 cycles of 95°C for 1 min, 59°C 1 min, and 72°C 2 min. Samples were then purified 160

using QIAquick Gel Extraction Kit (Qiagen, cat # 28706) after separation on a 1% 161

agarose gel. Sequencing was performed on the ABI 3130XL (Applied Biosystems® 162

Inc., cat # 3130XL) instrument using standard conditions for an 80 cm capillary. 163

Consensus sequences were generated using DNAstar Lasergene SeqMan Pro software 164

and aligned with published ompA gene sequences for each genotype using ClustalW 165

software. The GenBank accession numbers used for alignment are as follows: 166

AY762608, AY762609, AF269261, AY762610, AY762611, AY762612 and AY762613. 167 ACCEPTED


.asm.org/

Dow

nloaded from

http://jcm.asm.org/


10

Results 168

Real-time PCR and HRM analysis. All markers (Ppac, GTpc, and GT-F) were 169

tested against reference strains using the real-time PCR and HRM analysis. Each was 170

screened for specificity with a variety of bacterial and viral agents at 15 ng each and 171

displayed no cross-reactivity (Table 2). The results of the HRM analysis for Ppac yielded 172

similar melt curves for each genotype (Figure 1a). Ppac also amplifies C. caviae and can 173

easily be distinguished from C. psittaci by HRM analysis with a dissociation curve 174

occurring prior to that of C. psittaci (Figure 1a), while C. abortus is indistinguishable. 175

The HRM analysis for GTpc produces distinct melt curve profiles for all C. 176

psittaci genotypes except genotypes D and F, which are separated using the F genotype 177

specific marker, GT-F (Figure 1c). Separation among the genotypes occurs in 178

incremental shifts, with genotype E being farthest right followed by A, B, D/F and C 179

(Figure 1b). Additionally, C. caviae can again be distinguished from C. psittaci 180

genotypes by GTpc HRM analysis, where C. caviae melts between genotypes D/F and B; 181

further verification is achieved by an additional specific C. caviae marker (data not 182

shown). Interestingly, C. abortus cannot be differentiated from C. psittaci with Ppac. 183

However, GTpc does not amplify C. abortus. 184

Specimen Testing. 169 specimens obtained from birds and companion mammals 185

were screened along with reference strains. Of these archived nucleic acid preparations, 186

107 (63.3%) were positive for Chlamydial DNA, 98 (91.6%) were positive for C. psittaci 187

and 9 (8.4%) were positive for C. caviae. Of the positive C. psittaci samples, 70 (71.4%) 188

were genotype A, 3 (3.1%) were genotype B, 4 (4.1%) were genotype E, and 21 (21.4%) 189

were positive for C. psittaci (positive amplification for both Ppac and GTpc markers) but 190

ACCEPTED


.asm.org/

Dow

nloaded from

http://jcm.asm.org/


11

could not be typed using this assay due to inconclusive melt curve data (Table 3). The 191

remaining specimens were negative. All C. caviae strains were obtained from guinea pig 192

specimens, as expected. 193

Sequencing analysis. The ompA gene was sequenced for all available reference 194

strains and a subset of chlamydial positive specimens that contained nucleic acid of 195

sufficient amount and quality acquired from the Infectious Diseases Laboratory, 196

University of Georgia, as described above. The sequences of the target regions for this 197

assay within the ompA gene are shown in Figure 2. Primers are underscored and shown in 198

bold. The data show this assay correctly identified DD34 and specimens 25 and 83 as 199

genotype A; CP3 and specimens 30 and 31 as genotype B; CT1 as genotype C; NJ1 as 200

genotype D; Vr-122 and specimens 3 and 5 as genotype E; and VS-225 as genotype F. 201

ACCEPTED


.asm.org/

Dow

nloaded from

http://jcm.asm.org/


12

Discussion 202

Newly developed molecular methods such as DNA microarrays, a real-time PCR 203

assay detecting amplified product using minor groove binding probes and competitor 204

oligonucleotides, and multilocus VNTR analysis have greatly improved upon the 205

traditional approaches of ompA sequencing and RFLP for genotyping C. psittaci. 206

However a simple, rapid and inexpensive assay is still lacking and would be ideal 207

(6,7,12,16). 208

The current study reports the development and implementation of a novel 209

diagnostic assay that is capable of rapidly genotyping C. psittaci. A three marker panel 210

(Ppac, GTpc and GT-F), using standard cycling conditions followed by a HRM, is able to 211

reliably differentiate A-F genotypes and detect the closely related C. abortus and C. 212

caviae (2,22). The Ppac signature sequence serves as a pan-marker, able to amplify all C. 213

psittaci genotypes as well as C. caviae and C. abortus, while GTpc separates C. caviae 214

and all C. psittaci genotypes except D/F. The GT-F marker is used to specifically amplify 215

genotype F, thus providing a comprehensive algorithm for identifying and typing these 216

agents. All three markers also demonstrate specificity for their respective target and a 217

sensitivity to 200 fg with C. psittaci reference strain DNA. Further, this assay has been 218

successfully used on clinical specimens and displays 100% concordance with sequence 219

data generated from both reference isolates and clinical extracts. Numerous avian 220

specimens screened for this study were positive for C. psittaci. Genotype A was the most 221

frequently identified genotype, present in 71.4% of the C. psittaci-positive specimens that 222

could be typed. Reportedly, this type is commonly identified in Chlamydial-positive 223

psittacine birds such as parrots, cockatoos, and cockatiels and is consistent with our 224

ACCEPTED


.asm.org/

Dow

nloaded from

http://jcm.asm.org/


13

findings (9). Both B and E genotypes were rarely present, accounting for only 7.2% of 225

specimens. Historically, these genotypes have been most commonly identified in pigeons 226

and doves, again consistent with our data (9). Notably, genotypes C, D, and F were not 227

found in any of the specimens tested, supporting the claim by others that the vast majority 228

of naturally occurring genotypes belong to the ABE cluster (16). C. caviae was detected 229

only in guinea pig specimens (Table 3) where it is known to exist. No specimens tested 230

positive for C. abortus, an agent typically found in mammals, although a few psittacine 231

infections have been reported (2,15). Neither C. caviae nor C. abortus are considered 232

classic respiratory pathogens and would not likely be present in respiratory samples being 233

tested for C. psittaci in humans (2). However, if Ppac yields a positive amplification 234

curve while GTpc is negative, C. abortus should be considered and ompA sequencing 235

should be performed for verification. Collectively, the experimental data underscore the 236

utility of this assay. 237

The reliability of HRM analysis is dependent upon both sufficient quantity and 238

quality of starting template. As such, specimens with amplification curves that are not 239

sigmoidal or have Ct values of 40 or above should be interpreted with care due to the 240

possibility of inaccurate melt curve data. If possible, these samples should be 241

concentrated and re-tested for verification. When Ct values of <40 are achieved, the 242

HRM data is remarkably consistent, reproducible and reliable, as evidenced by the 243

virtually identical melt curves generated in each of the triplicate wells assayed on 244

numerous occasions and verified by subsequent sequence analysis. The quality and 245

amount of template are inherent limitations in any real-time PCR assay, but are especially 246

critical when HRM analysis is performed. These limitations may account for the 21.4% 247

ACCEPTED


.asm.org/

Dow

nloaded from

http://jcm.asm.org/


14

of the specimens that were unable to be definitively genotyped since some older 248

specimens may not have been properly stored after submission (data not shown). 249

Unfortunately, genotype E/B has only recently been described and was unavailable for 250

analysis with this assay (5). 251

Currently, no rapid and simple procedure exists which can discriminate the known 252

genotypes of C. psittaci and have the capability of identifying new strains among the 253

extraordinary genetic heterogeneity found within this species. The current study reports a 254

real-time PCR assay that is able to detect and identify 6 known C. psittaci genotypes 255

along with identifying C. caviae and C. abortus. This assay may aid in determining the 256

existence of variants within this species using the exquisite discriminatory ability of LUX 257

chemistry followed by HRM analysis. The versatility of this assay makes it useful in 258

many applications such as: (i) improving the timely reporting of results, aiding in 259

epidemiological investigations; (ii) possible pathogenicity and transmission studies; (iii) 260

prospective screening of companion birds; (iv) current and retrospective analysis of 261

specimens collected during an outbreak; and (v) a greater characterization of this 262

infectious agent leading to a better understanding of C. psittaci infection within human 263

and avian populations. This procedure can also contribute to the development of an all-264

inclusive molecular typing system for this agent. 265

ACCEPTED


.asm.org/

Dow

nloaded from

http://jcm.asm.org/


15

Acknowledgments. 266

We thank Carolyn Black and Joseph Igietseme of the Centers for Disease 267

Control and Prevention, Atlanta, GA and also the National Animal Disease Center, Ames 268

Iowa, for providing C. psittaci strains used in this study. 269

ACCEPTED


.asm.org/

Dow

nloaded from

http://jcm.asm.org/


16

Reference List 270

271

1. Branley, J. M., B.Roy, D.E.Dwyer, and T.C.Sorrell. 2008. Real-time PCR 272

detection and quantitation of Chlamydophila psittaci in human and avian specimens 273

from a veterinary clinic cluster. European journal of clinical microbiology & 274

infectious diseases 27:269-273. 275

2. Bush, R. M. and K. D. Everett. 2001. Molecular evolution of the Chlamydiaceae. 276

Int J Syst Evol Microbiol 51:203-220. 277

3. Centers for Disease Control and Prevention. 2000. Compendium of measures to 278

control Chlamydia psittaci infection among humans (psittacosis) and pet birds 279

(avian chlamydiosis), 2000. MMWR 49:3-17. 280

4. Gaede, W., K. Reckling, B. Dresenkamp, S. Kenklies, E. Schubert, U. Noack, 281

H. Irmscher, C. Ludwig, H. Hotzel, and K. Sachse. 2008. Chlamydophila psittaci 282

infections in humans during an outbreak of psittacosis from poultry in Germany. 283

Zoonoses and Public Health 55:184-188. 284

5. Geens, T., A. Desplanques, M. Van Loock, B. M. Bonner, E. F. Kaleta, S. 285

Magnino, A. A. Andersen, K. D. E. Everett, and D. Vanrompay. 2005. 286

Sequencing of the Chlamydophila psittaci ompA Gene Reveals a New Genotype, 287

E/B, and the Need for a Rapid Discriminatory Genotyping Method. Journal of 288

Clinical Microbiology 43:2456-2461. 289

ACCEPTED


.asm.org/

Dow

nloaded from

http://jcm.asm.org/


17

6. Geens, T., A. Dewitte, N. Boon, and Vanrompay.D. 2005. Development of a 290

Chlamydophila psittaci species-specific and genotype-specific real-time PCR. 291

Veterinary research 36:787-797. 292

7. Heddema, E. R., E. J. van Hannen, B. Duim, C. M. J. E. Vandenbroucke-293

Grauls, and Y. Pannekoek. 2006. Genotyping of Chlamydophila psittaci in 294

Human Samples. Emerging infectious diseases 12:1989-1990. 295

8. Hughes, C., P. Maharg, P. Rosario, M. Herrell, D. Bratt, J. Salgado, and D. 296

Howard. 1997. Possible nosocomial transmission of psittacosis. Infection control 297

and hospital epidemiology 18:165-168. 298

9. Kaleta, E. F. and E. M. A. Taday. 2003. Avian host range of Chlamydophila spp. 299

based on isolation, antigen detection and serology. Avian pathology 32:435-461. 300

10. Kaltenboeck, B., K. G. Konstantin, and J. Storz. 1991. Detection and strain 301

differentiation of Chlamydia psittaci mediated by a two-step polymerase chain 302

reaction. Journal of Clinical Microbiology 29:1969-1975. 303

11. Kaltenboeck, B., K. G. Kousoulas, and J. Storz. 1993. Structures of and allelic 304

diversity and relationships among the major outer membrane protein (ompA) genes 305

of the four chlamydial species. The Journal of Bacteriology 175:487-502. 306

12. Laroucau, K., S. Thierry, F. Vorimore, K. Blanco, E. Kaleta, R. Hoop, S. 307

Magnino, D. Vanrompay, K. Sachse, G. Myers, PM. Bavoil, G. Vergnaud, and 308

C. Pourcel. 2008. High resolution typing of Chlamydophila psittaci by multilocus 309

VNTR analysis (MLVA). Infection, Genetics and Evolution 8:171-181. 310

ACCEPTED


.asm.org/

Dow

nloaded from

http://jcm.asm.org/


18

13. Miller, C. D., J. R. Songer, and J. F. Sullivan. 1987. A twenty-five year review of 311

laboratory-acquired human infections at the National Animal Disease Center. AIHA 312

Journal 48:271-275. 313

14. National Association of State Public Health Veterinarians. Compendium of 314

Measures To Control Chlamydophila psittaci Infection Among Humans 315

(Psittacosis) and Pet Birds (Avian Chlamydiosis), 2008. 3-15. 2008. 316

Ref Type: Generic 317

15. Pantchev, A., R. Sting, R. Bauerfeind, J. Tyczka, and K. Sachse. 2008. New 318

real-time PCR tests for species-specific detection of Chlamydophila psittaci and 319

Chlamydophila abortus from tissue samples. The Veterinary Journal In Press, 320

Corrected Proof. 321

16. Sachse, K., K. Laroucau, H. Hotzel, E. Schubert, R. Ehricht, and P. Slickers. 322

2008. Genotyping of Chlamydophila psittaci using a new DNA microarray assay 323

based on sequence analysis of ompA genes. BMC microbiology 8:63. 324

17. Saito, T., J. Ohnishi, Y. Mori, Y. Iinuma, S. Ichiyama, and F. Kohi. 2005. 325

Infection by Chlamydophilia avium in an elderly couple working in a pet shop. 326

Journal of Clinical Microbiology 43:3011-3013. 327

18. Sayada, C., A. A. Andersen, C. Storey, A. Milon, F. Eb, N. Hashimoto, K. 328

Hirai, J. Elion, and E. Denamur. 1995. Usefulness of omp1 restriction mapping 329

for avian Chlamydia psittaci isolate differentiation. Research in microbiology 330

146:155-165. 331

ACCEPTED


.asm.org/

Dow

nloaded from

http://jcm.asm.org/


19

19. Smith, K. A., K. K. Bradley, M. G. Stobierski, and L. A. Tengelsen. 2005. 332

Compendium of measures to control Chlamydophila psittaci (formerly Chlamydia 333

psittaci) infection among humans (psittacosis) and pet birds, 2005. Journal of the 334

American Veterinary Medical Association 226:532-539. 335

20. Telfer, B. L., S. A. Moberley, K. P. Hort, J. M. Branley, D. E. Dwyer, D. J. 336

Muscatello, P. K. Correll, J. England, and J. M. McAnulty. 2005. Probable 337

psittacosis outbreak linked to wild birds. Emerging infectious diseases 11:391-397. 338

21. Tondella, M. L., D. F. Talkington, B. P. Holloway, S. F. Dowell, K. Cowley, M. 339

Soriano-Gabarro, M. S. Elkind, and B. S. Fields. 2002. Development and 340

Evaluation of Real-Time PCR-Based Fluorescence Assays for Detection of 341

Chlamydia pneumoniae. Journal of Clinical Microbiology 40:575-583. 342

22. Van Loock, M., D. Vanrompay, B. Herrmann, J. Vander Stappen, G. 343

Volckaert, B. M. Goddeeris, and K. D. E. Everett. 2003. Missing links in the 344

divergence of Chlamydophila abortus from Chlamydophila psittaci. International 345

Journal of Systematic and Evolutionary Microbiology 53:761-770. 346

23. Vanrompay, D., P. Butaye, C. Sayada, R. Ducatelle, and F. Haesebrouck. 1997. 347

Characterization of avian Chlamydia psittaci strains using omp1 restriction 348

mapping and serovar-specific monoclonal antibodies. Research in microbiology 349

148:327. 350

ACCEPTED


.asm.org/

Dow

nloaded from

http://jcm.asm.org/


20

24. Vanrompay, D., E. Cox, J. Mast, B. Goddeeris, and G. Volckaert. 1998. High-351

Level Expression of Chlamydia psittaci Major Outer Membrane Protein in COS 352

Cells and in Skeletal Muscles of Turkeys. Infection and immunity 66:5494-5500. 353

25. Verminnen, K., B. Duquenne, D. De Keukeleire, B. Duim, Y. Pannekoek, L. 354

Braeckman, and D. Vanrompay. 2008. Evaluation of a Chlamydophila psittaci 355

Infection Diagnostic Platform for Zoonotic Risk Assessment. Journal of Clinical 356

Microbiology 46:281-285. 357

26. Wolff, B. J., W. L. Thacker, S. B. Schwartz, and J. M. Winchell. 2008. 358

Detection of Macrolide Resistance in Mycoplasma pneumoniae by Real-Time PCR 359

and High Resolution Melt Analysis. Antimicrobial agents and chemotherapy 360

AAC.00582-08v1 361

ACCEPTED


.asm.org/

Dow

nloaded from

http://jcm.asm.org/


21

Figure Legends 362

Figure 1. HRM analysis. Real-time PCR with HRM was performed in triplicate on all 363

reference strains. HRM is shown in the normalization graph function. (a) Ppac. All C. 364

psittaci genotypes and C. abortus melt together; while C. caviae is distinct (b) GTpc. All 365

C. psittaci genotypes are clearly distinguished from each other with the exception of 366

genotypes D and F (c) GT-F. Genotype F is clearly separated from all other C. psittaci 367

genotypes via positive/negative amplification. 368

Figure 2. Sequence Data. (a) Sequence alignment of Ppac amplicons. (b) Sequence 369

alignment of GTpc amplicons. * Indicates no consensus; dash (-) indicates identical 370

sequences. **Each genotype is represented by reference strains and, when applicable, 371

specimen sequences. Genotype A includes DD34, and specimens 25, 83. B includes CP3 372

and specimens 30, 31. C includes CT1; D includes NJ1; E includes Vr122 and specimens 373

3, 5; and F includes VS225 only. Underscored and bold portions of the sequences are 374

primer binding locations. Genotype E/B is excluded due to unavailability of the strain. 375

Table 1. Chlamydial spp. Oligo Sequences. DNA sequences are listed for each oligo 376

set for the detection of C. psittaci. * Denotes oligos labeled with FAM bound to the “t”. 377

5’ lower cased letters are not part of the primer itself, but correspond to a self-quenching 378

complementary tail. 379

Table 2. Specificity Panel. Bacterial and viral species screened for cross-reactivity 380

using the real-time PCR assay. All agents listed were undetected (no amplification). 381

Table 3. Real-time PCR and HRM Genotyping Results of Avian and Mammalian 382

Specimens. Results of real-time PCR testing and HRM analysis for 86 Chlamydial 383

positive avian and mammalian specimens that were able to be typed. * Indicates C. 384

ACCEPTED


.asm.org/

Dow

nloaded from

http://jcm.asm.org/


22

psittaci.385

ACCEPTED


.asm.org/

Dow

nloaded from

http://jcm.asm.org/


23

Figure 2a. 386

Genotype** Sequence 387 A ------------------------------------------------------------ 388 B ------------------------------------------------------------ 389 C ------------A----------------------------------------------- 390 D ------------------------------------------------------------ 391 E ------------------------------------------------------------ 392 F ------------------------------------------------------------393 Consensus ATCGGCATTATTGTTTGCCGCTACGGGTTCCGCTCTCTCCTTACAAGCCTTGCCTGTAGG 394 395 396 397 A ------------------------------------------------------------ 398 B ------------------------------------------------------------ 399 C ---------------------------------------------------------T-- 400 D ------------------------------------------------------------ 401 E ------------------------------------------------------------ 402 F ------------------------------------------------------------403 Consensus GAACCCAGCTGAACCAAGTTTATTAATCGATGGCACTATGTGGGAAGGTGCTTCAGGAGA 404 405

ACCEPTED


.asm.org/

Dow

nloaded from

http://jcm.asm.org/


24

Figure 2b. 406

Genotype** Sequence 407 A ----------------------------------------------------------G- 408 B ----------------------------------------------------------G- 409 C -------------C-----------------A--------------------------A- 410 D ----------------G-----------C-----------------------------A- 411 E ----------------------------------------------------------G- 412 F -------------------------------A-----G—-T-----------------A-413 Consensus GGGAATGTGGTTGTGCAACTTTAGGAGCTGAGTTCCAATACGCTCAATCTAATCCTAA*A 414 415 416 A -------------C--C------------------------------------------- 417 B -------A-----C--C------------------------------------------- 418 C --------T-G—-T--A-TC--C------------------G-------G--T-----A- 419 D -------------T--A------------------------------------------- 420 E -----G-------C--C------------------------------------------- 421 F ----------G—-T--A-TC--C------A----------AG-------G--T-----A-422 Consensus TTGAAATGCTCAA*GT*ACTTCAAGCCCAGCACAATTTGTGATTCACAAACCAAGAGGCT 423 424 425 A --------G--A-------------------------G-----A---ACA-AA------- 426 B --------G--A-------------------------G-----A---ACA-AA------- 427 C -C--G---A-GTC-G-C--C------------GC--AT--A--C---GAG-CT-----G- 428 D --------A--G-----------------------GAC--G--T---GAG-CT------- 429 E --------G--A-------------------------G-----A---ACA-AA------- 430 F -C--G---A-AG-A-----C------------C----A-----T---GAT-GT-------431 Consensus ATAAAGGA*CT*GCTCGAATTTTCCTTTACCTATAAC*GCTGG*ACA***G**GCTACAG 432 433 434 435 A -C--C-----A--T---A-T-----C--------------A--C--C--C--G------- 436 B -C--C-----A--T---A-T-----C--------------A--C--C--C--G------- 437 C -T--T-----T--A---C-C-----T--------------T--T--A--A--C------- 438 D -T--T--G--T--A---C-C-----T--------------T--T--A--A--C------- 439 E -C--C-----A--T---A-T-----C--------------A--C--C--C--G------- 440 F -T--T-----T--A---C-C-----T--------------T--TT-A--G--C------- 441 Consensus A*AC*AAATC*GC*ACA*T*AAATA*CATGAATGGCAAGT*GG*CT*GC*CT*TCTTACA 442 443 444 A -------T-----------A--T------------------------------------- 445 B -------T-----------A--T------------------------------------- 446 C -------C---T-A-----T--C------------------C----------------C- 447 D -------C-----------T--C------------------------------------- 448 E -------T-----------A--T------------------------------------- 449 F -------C-----------T--C-------------------------------------450 Consensus GATTGAA*ATGCTTGTTCC*TA*ATTGGCGTAAACTGGTCAAGAGCAACTTTTGATGCTG 451 452

ACCEPTED


.asm.org/

Dow

nloaded from

http://jcm.asm.org/


25

Table 1. 453

454

Sequence Amplicon Size (bp)

Forward Labeled* 5'-gaacccTATTGTTTGCCGCTACGGGT"t"C-3'

Reverse Unlabeled 5'-TCCTGAAGCACCTTCCCACA-3'

Forward Labeled* 5'-gaactcaTGTGCAACTTTAGGAGCTGAG"t"TC-3'

Reverse Unlabeled 5'-GCTCTTGACCAGTTTACGCCAATA-3'

Forward Labeled* 5'-gacgcCATTCGTGAACCACTCAGCG"t"C-3'

Reverse Unlabeled 5'-CTCCTACAGGAAGCGCAGCA-3'GT-F

109

274

98

Ppac

GTpc

Primer Set

ACCEPTED


.asm.org/

Dow

nloaded from

http://jcm.asm.org/


26

Table 2. 455

Candida albicans Mycoplasma penetrans

Bordetella pertussis Mycoplasma pirum

Chlamydia felis Mycoplasma salivarium

Chlamydia pecorum Mycobacterium tuberculosis

Chlamydia pneumoniae Neisseria elongata

Chlamydia trachomatis Neisseria meningitidis

Corynebacterium diphtheriae Pseudomonas aeruginosa

Coxiella burnetii Staphylococcus aureus

Escherichia coli Staphylococcus epidermidis

Haemophilus influenzae Streptococcus pneumoniae

Lactobacillus planitarium Streptococcus pyogenes

Legionella longbeachae Streptococcus salivarius

Legionella pneumophila Ureaplasma urealyticum

Moraxella catarrhalis Human DNA Mycoplasma arginini Adenovirus

Mycoplasma buccale Coronavirus

Mycoplasma faucium Parainfluenza virus 2

Mycoplasma fermentans Parainfluenza virus 3

Mycoplasma genitalium Rhinovirus

Mycoplasma hominis Influenza virus A

Mycoplasma hyorhinis Influenza virus B

Mycoplasma lipophilum Respiratory syncytial virus A

Mycoplasma orale Respiratory syncytial virus B

ACCEPTED


.asm.org/

Dow

nloaded from

http://jcm.asm.org/


27

Table 3. 456

Specimen # Specimen Origin Bacterial

Spp. Genotype Specimen # Specimen Origin

Bacterial Spp.

Genotype

1 Lovebird C. psittaci* A 44 Guinea Pig C. caviae -

2 Cockatiel * A 45 Guinea Pig C. caviae -

3 Macaw * E 46 Lori * B

4 Lovebird * A 47 Lovebird * A

5 Amazon * E 48 Amazon * A

6 Cockatiel * A 49 Hawkhead * A

7 Sun Conure * A 50 Ringneck * A

8 Sun Conure * A 51 Conure * A

9 Sun Conure * A 52 Macaw * A

10 Sun Conure * A 53 African Grey * A

11 Sun Conure * A 54 Cockatiel * A

12 Sun Conure * A 55 Cockatiel * A

13 Cockatiel * A 56 Cockatiel * A


15 Parakeet * A 58 Guinea Pig C. caviae -

16 Cockatiel * A 59 Sun Conure * A

17 Not given * A 60 Guinea Pig C. caviae -

18 Amazon * A 61 Pigeon * E

19 Macaw * A 62 Cockatiel * A

20 Parakeet * A 63 Guinea Pig C. caviae -

21 Green Cheek * A 64 Cockatiel * A

22 Green Cheek * A 65 Amazon * A

23 Cockatiel * A 66 DYH Amazon * A

24 Pooled Cockatiels * A 67 Cockatiel * A



27 Amazon * A 70 Cockatiel * A

28 Cockatiel * A 71 Amazon * A

29 Lovebird * A 72 Amazon * A

30 Pigeon * B 73 Amazon * A

31 Pigeon * B 74 Cockatiel * A


33 Cockatiel * A 76 Brown Crown * A


35 Cockatiel * A 78 Lovebird * A

36 Guinea Pig C. caviae - 79 Cockatiel * A

37 Yellow Nape

Amazon * A 80 Cockatiel * A

38 Pionus * A 81 Cockatiel * E

39 Cockatiel * A 82 Macaw * A

40 Guinea Pig C. caviae - 83 Parrotlet * A




457

ACCEPTED


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

ACCEPTED


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

ACCEPTED


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

ACCEPTED


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

Documents

2 Melt Analysis 3 ACCEPTED...2008/11/12 · 8 Affiliations: 9 1Respiratory Disease Branch, Centers for Disease Control and Prevention, Atlanta, GA 10 2Infectious Diseases Laboratory,