Results and discussion

Introduction Mildew damage is a grain degrading factor that is assessed because it can have detrimental effects on the quality of grain end products such as flours, breads and pastas. This can affect a producer’s compensation. The presence of mildew can be attributed to two major fungal species: Alternaria and Cladosporium (Clear, 1987).

The predominant Alternaria species, Alternaria alternata, has been the dominant contributing fungus to mildew and produces a variety of mycotoxins including alternariol, alternariol monomethyl ether (AME), altenuene and tentoxin.

Currently, mildew damage in Canada Western Red Spring (CWRS) wheat is assessed on a visual inspection by trained inspectors from the Canadian Grain Commission (CGC). Inspectors will assign each sample a grade (1, 2, 3, or feed) and each grade will reflect the frequency of various degrees of damage: light, moderate, heavy and hard.

Application of bio-molecular methods for the quantification of mildew damage and its causal agents in hard red spring wheat from western Canada

M. Tran, S.K. Patrick, J. Bamforth, M. Roscoe, S.A. Tittlemier, T. Gräfenhan

Grain Research Laboratory • Canadian Grain Commission • Winnipeg, Manitoba, Canada

Species Primer Sequence (5’-3’) Sequence source

Alternaria alternata AaltdAlta1 (F)AinflAlta1 (R)

CGCATCCTGCCCTGTCAGTTGGTAGCCTTGATGTTGAAGC Pavon et al., 2010

Alternaria infectoria AinfDAlta1 (F)AinflAlta1 (R)

CGCATCCTGCCCAGTTGGTGGTAGCCTTGATGTTGAAGC Pavon et al., 2010

Cladosporium sp. Cclad1F1 (F)CcladR1 (R)

CATTACAAGTGCCCCGGTCTAACCCCCGGAGGCAACAGAG

EPA public domain (http://www.epa.gov/mi-crobes/moldtech.htm)

Wheat Tritprglut_3_F (F)Tritprglut_3_R (R)

CCTCTTTGCGGCAGTAGTYGTCTCGCRCTCACABTGTAGTTG Zeltner et al., 2009

Table 1. Species, primer, and primer sequences used for qPCR. F = forward, R = reverse.

Side by side comparison of light mildew damage and hard mildew damage

Material and methods• Canadian Western Red Spring wheat

samples were collected and forwarded to the Grain Research Laboratory following an in-house inspection by the Industry Services division of the Canadian Grain Commission (CGC) to assess the degree of mildew damage. Samples were graded based on mildew damage according to the standards and regulations set by the Official Grading Guide. Samples chosen contained mildew damage as the primary degrading factor.

• Composite samples were prepared to represent wheat variety and grade, as well as region and grade.

• The extraction of fungal biomass utilized a modified PEX extraction method (Jhingan, 1992).

• Samples were then quantified through bio-molecular methods employing real time polymerase chain reaction (qPCR) to determine fungal biomass.

• Composite samples were analyzed and quantified for the following factors: Alternaria alternata, Alternaria infectoria, Cladosporium species as well as the mycotoxins alternariol, alternariol monomethyl ether (AME), altenuene, and tentoxin.

• Mycotoxin levels were assessed using a LC-MS/MS method developed for the detection of several mycotoxins (Roscoe et al., 2016) and then compared to results of the fungal qPCR analyses.

References1. Clear, R. M. (1987). The frequency and distribution of the fungi associated with western hard

red spring wheat seed degraded due to mildew.2. Jhingan, A. K. (1992). A novel technology for DNA isolation. Methods in molecular and cellular

biology, 3(1), 15-22.3. Official Grain Grading Guide, Canadian Grain Commission, 20144. Pavón, M. Á., González, I., Pegels, N., Martín, R., & García, T. (2010). PCR detection and

identification of Alternaria species-groups in processed foods based on the genetic marker Alt a 1. Food control, 21(12), 1745-1756.

5. Roscoe, M., Blagden, R., & Tittlemier, S. A. (2016). Analysis of mycotoxins in cereals using a simple extraction and LC-ESI/MS/MS with fast polarity switching and scheduled MRMs (Multiple Reaction Monitoring).

6. Zeltner, D., Glomb, M. A., & Maede, D. (2009). Real-time PCR systems for the detection of the gluten-containing cereals wheat, spelt, kamut, rye, barley and oat. European Food Research and Technology, 228(3), 321-330.

PurposeInternal CGC reports have indicated a higher recorded incidence of mildew in CWRS across the prairies in 2014. Additionally, many CWRS samples have kept their natural red colour but also possessed a washed out brush end resulting in many producers being heavily penalized.

Due to the frequency at which mildew is occurring, there is a need to assess the visual nature of the grading guide on mildew to ensure accurate and fair grading assessments.

The present study investigated the relationships between grain grade of CWRS wheat and quantities of Alternaria biomass and mycotoxins.

Light mildew damage Severe mildew damage

• Alternaria alternata was consistently the most commonly found fungal species associated with mildew damaged wheat.

• Mycotoxin levels of altenuene were below limit of quantitation in all samples tested.

• Alberta displays levels of mycotoxin below the limit of quantitation in almost all samples tested, including samples graded as feed quality.

• As we move east from Alberta, the amount of fungi biomass and mycotoxin increases with Manitoba displaying the highest levels.

→ Data suggests a geographical relationship between Alternaria biomass/mycotoxin and grade.

• Correlations were found between grade and the concentration of mycotoxins and biomass found in samples.

• Initial results indicate that some varieties are more susceptible to seed infection by different Alternaria species.

• In western parts of the Canadian Prairies, A. infectoria and other closely related species were also frequently detected.

• Cladosporium species were detected only at low levels across western Canada.