2/2/16

1

BY 2208 Mani Ramaswami 896 8400 Room 4.39 Lloyd Building

Mani.ramaswami@tcd.ie

DNA is the genetic material

Frederick Griffith’s Transformation Experiment - 1928

“transforming principle” (smooth to rough colonies) in Streptococcus pneumoniae

Griffith hypothesized that the transforming agent was a “IIIS” protein. This was only a guess, and Griffith turned out to be wrong. It was DNA.

Peter J. Russell, iGenetics: Copyright © Pearson Education, Inc., publishing as Benjamin Cummings.

Oswald T. Avery’s Transformation Experiment - 1944

Determined that “IIIS” DNA was the genetic material responsible for Griffith’s results (not RNA).

2/2/16

2

DNA - ACGTACGT… (polymer of 4 deoxynucleotide bases)

RNA - ACGUACGU… (polymer of 4 ribonucleotide bases)

Protein - Thr-Tyr-Val… (polymer of 20 aminoacids).

Central Dogma of Molecular Biology

DNA encodes enzymes/ proteins

How?

Elucidation of the Genetic Code

1)  Genetic mutations alter protein sequences 2)  The demonstration of colinearity between

genes and protein 3) The demonstration of triplet codons 4) Deciphering the genetic code (matching

specific triplets with specific aminoacids or stop codons).

4 major advances helped figure out the code

!  What is the general nature of the code?

mRNA (nucleotides) 4 different types (A,C,G,U)

Protein (amino acids) 20 different types

•  A doublet code only allows 4 X 4 = 16 different combinations

•  A triplet code (groups of 3) allows ? 4 X 4 X 4 = 64 combinations

More than enough to code for 20 amino acids

•  Therefore the concept of a triplet codon (coding unit) was born!

(George Gamow – Origin of Chemical Elements from the Big Bang Theory. Ralph Alpher with Hans Bethe)

2/2/16

3

A point mutation alters one aminoacid.

Linus Pauling, Vernon Ingrahm (and James Neel)

A mutation in a gene alters the protein sequence Sickle cell anemia

Inherited in semidominant fashion in African Americans.

James Neel (Human Clinical Geneticist)

Affects red blood cells which have very few proteins

Linus Pauling

Sickle cell anemia affects hemoglobin

+/+

+/m

m/m

Hemoglobin run out on a protein gel

!  How is the code organized?

•  Is the code overlapping or non-overlapping?

•  If code is overlapping :

•  Is the code continuous or punctuated?

2/2/16

4

Ingram, V. M. Genetics 2004;167:1-7

Figure 1. Fingerprints of hemoglobins A and S (improved method); photograph of ninhydrin-positive peptide spots on filter paper

(BAGLIONI 1961 )

Vernon Ingram

Single amino-acid substitutions occur in sickle cell hemoglobin! !  Single aminoacid changes in β-globin cause Sickle cell anemia

Sickle cell anemia

Nonsynonymous mutation

- Argues very strongly against an overlapping genetic code - - says that: one codon, specifies one aminoacid.

Genes and proteins are colinear.

Charles Yanofsky

m1 chromosome

m2 chromosome

m1

m2

+

+

m1 m2

+ +

Ordering mutations on a chromosome (or within a gene)

Recombination

2/2/16

5

Charles Yanofsky, 1964

Trytophan synthetase gene: many mutations mapped and ordered.

a1 c9 q3 h3

m1 e12

Purified mutant protein and identified the position of every a.a. substitution!

aa-substitutions occurred in the same linear order as genetic mutations.

What is the code for each aminoacid?

Nirenberg, Khorana (Severo Ochoa) Brenner, Crick.

Which codons specify which amino acids - 1

Marshall Nirenberg Heinrich Matthaei

“1961, The dependence of cell free protein synthesis upon natural and cell free RNA*. “

Cell extract + *AA " No protein! (37C for 1 hr)

Cell extract + RNA + *AA " * protein! (37C for 1 hr)

Cell extract + *AA " * protein

E.Coli cell-free system for in vitro translation

(*presented in the International Union of Biochemistry in Moscow)

!  The first experiments: translation of homopolymeric synthetic mRNAs

Hypothesis: a code based on RNA sequence specifies amino acid sequence

In vitro translation extract from E. coli

•  Use the enzyme polynucleotide phosphorylase to make homopolymeric RNA

Matthaei

2/2/16

6

Matthaei’s Notebook

1. Monday May 22, 1961 13:30 EDT (NIH)

Extract +Time + Poly U + 16*aa ----- " * protein

Tuesday – Friday narrowed it down to Phe* or Tyr*

Saturday night in the lab 3:30 AM

*Tyr *Phe --------------------------------------------------------- - PolyA 60cpm 50cpm - Poly C 45cpm 38cpm -Poly U 70cpm 38,800cpm

A (continuous) triplet code!

Francis Crick, Sydney Brenner,

!  But is it continuous? and is it a triplet code?

•  This was shown by by Francis Crick Sydney Brenner and and colleagues (mid-1960s)

Experimental strategy: use a chemical mutagen (proflavin) to create ‘point mutations’ in a coding sequence (T4 phage rIIb gene).

(i) Insert one additional base

Or (ii) Delete a single base

After making the mutants, examine function of the proteins coded by the mutant sequences in isolation and in combinations created by recombination

Either

Conclusion: The code is continuous, without spaces or internal punctuation

!  Base insertion mutants indicate a continuous code (and more)

As we shall see, insertion of a single base changes all the following amino acids

If the code is continuous:

If the code is interrupted by punctuation:

Insertion of a single base would not change the amino acids that follow

2/2/16

7

!  Experimental proof that the code is a triplet code

Mutants in which a single base had either been inserted or deleted

Imagine the sequence -CAT- repeated many times (CAU in RNA code):

CATCATCATCATCATCATCATCATCATCATCAT………

it would code for:

HIS HIS HIS HIS HIS HIS HISHIS HISHISHIS HIS……..

CATCATCATCATCATCATCATGCATCATCATCAT…….

it would now code for:

HIS HIS HIS HIS HIS HIS HIS ALA SER SER SER……..

Imagine that a ‘G’ is inserted:

Result: All the amino acids ‘downstream’ of the inserted base are changed

CATCATCATCATCAATCACTCATGCATCATCATCAT…….

it would now code for:

HIS HIS HIS HIS GLN SER LEU METHIS HIS HIS HIS…….

Crick reasoned:

If the reading frame is based on triplets and 2 more single base additions are introduced into the mutant, the reading frame should be restored

•  Imagine that we add an A and a C to the original mutant:

!  What happens if you make more single base additions?

We have restored the reading frame after MET and are back to decoding HIS, thus proving that the code consists of triplet codons

Although the protein has been altered, some proteins can tolerate such small changes and function almost normally (pseudowild)

Conclusion: Since only triple mutants were pseudowild, the code must be organized as triplet codons

One bp insertion + Mutant

Two bp insertion ++ Mutant

Three bp insertion +++ Pseudowild

Likewise: One bp deletion - Mutant

Two bp deletion - - Mutant

Three bp deletion - - - Pseudowild

One bp insertion and one deletion + - Pseudowild

!  Summary of Crick’s results:

Also:

Or multiples of triplets

Deciphering the code for each aminoacid

Ochoa, Khorana, Leder

2/2/16

8

!  The experimental assault on the code: Phase 2

Severo Ochoa HG Khorana

!  The 2nd phase: translation of mixed composition synthetic mRNAs

Polynucleotide phosphorylase can also be used to make synthetic

mRNA mixed co-polymers (e.g. poly(U,G))

•  Pioneered by Severo Ochoa (Nobel prize: 1959)

Poly (U,G): UGUGUGUGUGUGUGUGUGUGUG……..

Has 2 possible alternating codons: UGUGUGUGUGUG…....

•  In a protein synthesis assay: 2 amino acids should be incorporated:

Result: Ochoa and colleagues observed: cysteine and valine

•  Similarily: CUCUCUCUCUCUCUC…….. leucine and serine

ACACACACACACACA……… threonine and histidine

!  The 3rd phase: investigations using codon-sized RNAs (trinucleotides)

•  Nirenberg and Leder cracked the entire code except STOP codons in 1964

•  They showed that a synthetic RNA corresponding to a single codon (trinucleotide)

could direct the binding of specific aminoacyl-tRNAs to ribosomes in vitro

Synthetic RNA triplet codon

+ +

The RNA triplet and a matching aminoacylated tRNA bind to the ribosome, where they form a large ‘ternary’ complex that can’t pass through a filter

(Building on Hoagland and Zamecnik’s work)

!  Determination of all possible matches between codon and amino acid

•  For each synthetic triplet RNA set up 20 reactions; only one contains a specific 14C-labelled amino acid

•  Ask which reaction causes radioactivity to be retained on the filter

•  That’s the one encoded by the triplet codon!

•  The Nirenberg and Leder strategy:

Unbound aminoacylated tRNAs

Val

Ribosome binds RNA triplet and the aminoacylated tRNA it specifies

•  Anything not bound to ribosomes …will flow through the nitrocellulose filter

C14 Valine is bound.

So GUU codes for Val

2/2/16

9

•  By using 14C-labelled amino acids with all possible trinucleotide codons they

showed that 61 (of the 64 possible) codons could code for the 20 amino acids

•  Therefore a given amino acid can be coded for by more than 1 codon

In other words: the genetic code is degenerate

THE REMAINING THREE: UAA UGA UAG

You Are Away; You Go Away; You Are Gone

!  Nonsense mutations led to discovery of the STOP codons

The study of ‘Nonsense’ mutations led to the discovery of the codons that act as STOP codons

Result: A shortened, inactive form of the phosphatase protein is synthesized

Amber mutation causes premature termination of translation i.e. ‘STOP’ signal

The full-length form of the phosphatase protein is synthesized

‘STOP’ signal is suppressed

Nonsense mutation

(amber, after Harris Bernstein)

Phosphatase gene

Wild-type E. coli Suppressor strain Ochre UAA Amber UAG Opal UGA

Which codons can most easily mutate into stop codons?

Which tRNAs can most easily mutate into suppressor t-RNAs !  Summary: features of the Genetic Code

•  All the codons have meaning: 61 specify amino acids;

the other 3 are ‘nonsense’ or STOP codons

•  The code is unambiguous – only one amino acid is indicated by each codon

•  The code is degenerate: except for Trp and Met, each amino acid is encoded ….. by two or more codons

e.g. GGA GGC GGG GGT each code for Glycine (4-fold degeneracy)

2/2/16

10

The Vertebrate Mitochondrial Code (species specific)

Codon usage and variations in the genetic code

http://www.ncbi.nlm.nih.gov/Taxonomy/Utils/wprintgc.cgi#SG2

•  Codons representing the same or similar amino acids are often similar in sequence

•  Where 2nd base is a pyrimidine (C, U): usually codes for a nonpolar amino acid

•  Where 2nd base is a purine (A, G): usually codes for a polar or charged amino acid

EVOLUTION OF THE GENETIC CODE

!  Verification of the code in vivo

•  Compare amino acid sequences of wild-type and mutant proteins

•  The great majority can be explained by single base changes

- exactly as predicted by the in vitro code

•  Of particular importance was evidence from analysis of Hemoglobin α-chain variants

•  Changes in amino acid sequence are consistent with the Code:

Gly Asp: GGU GAU

His Tyr: CAU UAU

Normal: Val Lys Gly His Gly Lys

Mutant 1: Val Lys Asp His Gly Lys Hb Norfolk

Mutant 2: Val Lys Gly Tyr Gly Lys HbM Boston