This report is submitted in partial fulfilment of the requirements of the University of

Westminster for the award of BSc (Hons) Human and Medical Science.

Investigating novel actions of the Pregnane X

Receptor (PXR) using Berberine Chloride as a

non-canonical ligand

Callum M Allison

3SBS671

Abstract

The pregnane X receptor (PXR) is a nuclear receptor primarily found in the liver and intestinal tissues. It has a major role in the detoxification of xenobiotics and endobiotics via the up-regulation of genes coding for drug metabolising enzymes (DMEs). Since the discovery of the unique promiscuity of PXR due to its unusually large and flexible ligand binding domain, it has been revealed that the receptor plays a broad ‘sensing’ role in the body. Owing to the wide range of PXR agonists and the specific post-transcriptional events that occur due to its activation, it has been elucidated that adverse drug-drug interactions occur between mutual compounds sharing an affinity for the receptor. Recent in silico investigation into PXR and its interaction with the isoquinoline alkaloid, berberine chloride, has indicated that the receptor may cause changes in gene expression of not only DMEs, but also genes having vital roles in cell growth, development and apoptosis. Berberine chloride is administered as a herbal remedy in the east, with some evidence of efficacy in treating conditions such as hypertension, diabetes and cancer. Further research into the cell signalling and transcriptional modification surrounding PXR using the compound as an agonist, may elucidate novel research avenues towards better understanding a major participant in health and disease. This study aims to demonstrate the role of PXR in the expression of specific genes for detoxification and cell growth and also to lay evidence-based foundations for further research into the novel signalling activity of the receptor.

Table of Contents

Acknowledgements

1. Introduction……………………………………………………………………………………………… ….1-7

1.1. PXR Background……………………………………………………………………………1-3

1.2. Berberine………………………………………………………………………………………3-5

1.3. Evaluation of in silico PXR Analysis…………………………………………………..5

1.4. Hypothesis……………………………………………………………………………………5-6

1.5. Aims and Objectives..……………………………………………………………………6-7

2. Materials and Methods……………………………………………………………..………………..7-13

2.1. Materials………………………………………………………………………………………….7

2.2. Gene Selection and Oligonucleotide Primer Design………………………7-8

2.3. Cell Culture………………………………………………………………………………………8

2.4. Cell Treatment………………………………………………………………………………8-9

2.5. Compound Cytotoxicity Profiling………………………………………………………9

2.6. RNA Extraction……………………………………………………………………………9-10

2.7. cDNA Synthesis from RNA………………………………………………………………10

2.8. Quantification of cDNA……………………………………………………………..10-11

2.9. Optimisation PCR………………………………………………………………………11-12

2.10. Optimisation PCR – Gel Electrophoresis and Analysis …………...........12

2.11. Analytical PCR……………………………………………………………………………12-13

2.12. Analytical PCR – Gel Electrophoresis and Analysis………………………….13

3. Results……………………………………………………………………………………………………….13-21

3.1. Cell Culture……………………………………………………………………………….13-14

3.2. Cytotoxicity Profile of Berberine Chloride…………………………………14-16

3.3. cDNA Quantification………………………………………………………………………16

3.4. Optimisation PCR………………………………………………………………………17-19

3.5. Analytical PCR……………………………………………………………………………19-21

3.5.1. CYP3A4 Expression Analysis………………………………………………………. 19

3.5.2. CYP2B6 Expression Analysis………………………………………………………. 19

3.5.3. SULT1A1 Expression Analysis………………………………………………………20

3.5.4. VEGFA Expression Analysis…………………………………………………………20

3.5.5. CDK2 Expression Analysis………………………………………………………20-21

3.5.6. CDKN1A and MMP2 Expression Analysis……………………………………21

4. Discussion…………………………………………………………………………………………….......21-25

4.1. Post-Treatment Cytotoxicity……………………………………………………..21-22

4.2. PCR Optimisation…………………………………………………………………………..22

4.3. Analytical PCR……………………………………………………………………………22-25

4.3.1. CYP3A4 Expression……………………………………………………………………..23

4.3.2. CYP2B6 Expression……………………………………………………………………..23

4.3.3. SULT1A1 Expression……………………………………………………………………24

4.3.4. VEGFA Expression………………………………………………………………………24

4.3.5. CDK2 Expression……………………………………………………………………24-25

5. Conclusion………………………………………………………………………………………………………25

References

Appendices

Acknowledgements

I would like to extend my sincere gratitude to Dr. Ian Bailey for his unerring

supervision, direction and support throughout the entire process of my

undergraduate research. His willingness to give time in order to provide generous

advice and assistance throughout this project is very much appreciated. Likewise,

many thanks to my colleagues in the C5.14 laboratory for their guidance during a

few unfamiliar protocols.

1

1. Introduction

1.1 PXR Background

The pregnane X receptor (PXR) is an adopted orphan nuclear receptor (NR) of

subfamily 1, group I, member 2 (NR1I2); located on the chromosome 3q12-q13.3

(Cheng et al., 2010). It is approximately 434 amino acids in length, with a molecular

weight of 50 kDa (Tolson and Wang, 2010). PXR was isolated in 1998 by Blumberg

and colleagues. It was initially named the steroid X receptor (SXR) due to its affinity

for steroid compounds (Xie and Evans, 2001). NRs are described as ligand-activated

transcription factors, as in they either upregulate or downregulate the transcription

of genes in response to appropriate binding of a ligand to the NR ligand binding

domain (LBD). Alongside the LBD, the nuclear receptor is made up of an N-terminal

domain (contains AF1), a double zinc-finger DNA binding domain (DBD), a hinge

region (hinge) and the C-terminal domain (contains AF2), all located between the N

and C amide terminals as depicted in figure 1. AF1 is ligand-independent, whereas

AF2, being part of the LBD is ligand dependent. Together, AF1 and 2 synergise to

increase overall NR gene expression (Warnmark et al., 2003). The hinge region

connects the DBD and LBD and is thought to regulate DNA binding, nuclear

translocation and transactivation of NRs (Haelens et al., 2007). There is slight

variation between the sequence lengths of PXR domains among various species as

demonstrated in figure 2.

Figure 1 – Generalised structure of the nuclear receptor family (Adapted from Kortagere et al., 2002).

AF1

2

Further structural investigation of PXR demonstrated that the three-

dimensional structure of the NR depicts a large, spherical LBD that provides PXR

with means to bind with a vast variety of hydrophobic compounds (Kliewer et al,

2002). Due to this structural arrangement, PXR has an unusual ability over other

NRs. NRs normally hold a binding specificity to their physiological ligands, however,

PXR has a general binding affinity and therefore provides a general ‘sensor’ of

hydrophobic toxic compounds (Kliewer et al, 2002). Upon ligand-binding of PXR, the

receptor forms an obligate heterodimer with the 9-cis retinoic acid receptor

(NR2B1, NR2B2; RXR-α + β). This PXR/RXR complex then proceeds to bind to the

specific response element in the promoter region of the DNA. In the absence of an

appropriate ligand, it is thought that PXR is bound to unconfirmed corepressor

proteins, via a protein-protein interaction (Johnson et al, 2006). In the presence of a

ligand, corepressor proteins are suspected to dissociate and in their place,

coactivator proteins are recruited (Johnson et al, 2006). Upon binding of the

PXR/RXR complex to the response element in the promotor region of the

appropriate gene; hereafter specific gene expression is upregulated.

The main function of PXR lies within the detoxification of xenobiotics and

endobiotics via the induction of various genes, most notably those coding for drug-

metabolising enzymes (DMEs) (Wang et al., 2012). PXR is primarily expressed in the

hepatic and intestinal tissues (Hartley et al., 2004; Lehmann et al., 1998). PXR is

Figure 2 – Comparison of PXR genetic sequence across species (DBD of pig, dog and fish PXR is unknown, alongside rhesus N-terminal domain). (Adapted from Kliewer et al., 2002).

3

known to primarily induce phase I and phase II metabolism enzymes. The ‘first-pass’

enzymes involve the cytochrome P450 (CYP) enzymes, more specifically but not

limited to, the CYP2B and CYP3A families (Kliewer et al., 2002). Phase II metabolism

enzymes are also related to PXR activation, such as the sulfotransferases (SULTs)

and uridine diphosphate-glucuronyltransferases (UGTs); (Niemira et al., 2013).

Human PXR agonists are inclusive of a variety of structurally diverse compounds,

hence the attribution of promiscuity (Tolson and Wang, 2010). Such activators

include herbal supplements (e.g. St. John’s wort; hyperforin) (Wentworth et al.,

2000), prescription drugs, endogenous hormones (Kliewer et al., 1998), and also

chemicals in the environment (e.g. pesticides) (Coumoul et al., 2002). Well

established xenobiotic agonists of PXR include Pregnenalone-16α-Carbonitrile

(Bailey et al, 2010).

1.2 Berberine

Berberine is an isoquinoline alkaloid obtained from the root and bark of various

plants including, but not exclusively, Hydrastis Canadensis, Berberis aristata and

Coptis chinensis (Chatuphonprasert et al., 2012). Compounds containing berberine

as an active ingredient have been reported to have been used widely

predominantly in Asia for conditions such as gastrointestinal infection,

hypertension, hypercholesterolemia and diabetes (Guo, et al., 2011). Berberine has

also been alluded to as a potential anti-cancer therapy (Tang et al., 2009), an

antidepressant (Kulkarni and Dhir, 2008), and also as a complementary therapeutic

compound for HIV infection (Zha et al., 2010). Berberine has been well established

over the last five years as an efficacious agonist of PXR with a large affinity for the

receptor (Yu et al., 2011).

An in silico study carried out by McGuinness and Bailey (2012) demonstrated

various gene expression changes in the presence of berberine with and without PXR

activation. Information regarding gene interactions from the National Centre for

Biotechnology Information (NCBI), visualised in Cytoscape (Cytoscape, USA)

produced a gene network consisting of various nodes demonstrating gene up-

4

regulation, down-regulation or ‘further information needed’ (figure 3). The study

concentrated on genes involved in the control of cell cycle, cell signalling and

metabolism and cell death.

5

Figure 3 - Cytoscape gene network showing gene expression changes in the presence of berberine. (Red – down-regulation, Green – up-regulation, Yellow and Navy Blue - More Information Needed); (From: McGuinness and Bailey (2010)).

6

1.3 Evaluation of in silico PXR analysis

It has been well established throughout literature surrounding PXR activity, that

CYP3A4 up-regulation is a marker of PXR activation; henceforth, it is useful in vitro

as a control gene. Of the SULT genes, increased expression of SULT2A is a well-

known PXR activation marker; however it remains to be established as to whether

SULT1A1 is activated in the same situations as that of the control genes. The results

of the in silico analysis carried out by McGuinness and Bailey (2012) show further

potential candidate genes for PXR activity. CYP2B6 activity is closely related,

however unknown to be affected the same as its sibling, CYP3A4, upon PXR

activation. Vascular endothelial growth factor A (VEGFA) is a gene involved in cell

growth, more specifically, angiogenesis. In silico analysis shows reduced expression

of VEGFA following introduction of berberine and PXR analysis, therefore

demonstrating a candidate gene for in vitro analysis as it is a potential marker of

anti-metastatic properties of berberine and novel PXR signalling activity. Similarly,

matrix metalloproteinase 2 (MMP2) expression was shown to decrease following

berberine addition. Due to their paramount role of breaking down cellular matrix

glycoproteins and proteoglycans, in essence, aiding paraneoplastic metastasis, this

finding needs to be investigated in vitro as it shows potential therapeutic qualities

of berberine and/or PXR activation. Likewise for both MMP2 and VEGFA, reduced

expression of cyclin-dependent kinase 2 (CDK2) and increased expression of cyclin-

dependent kinase inhibitor 1A (CDKN1A), both cell growth assistants and inhibitors,

respectively; demonstrates interesting avenues of research for novel roles of PXR

and therapeutic berberine in disease.

1.4 Hypothesis

This study hypothesises that the gene expression changes observed in response to

berberine chloride are mediated by PXR. Therefore, expression changes in canonical

PXR target genes will be observed following a dose-dependent treatment with

berberine chloride.

7

1.5 Aims and Objectives

To demonstrate that the hypothesised gene expression changes are reflected in

vitro

To demonstrate that it is through PXR activity that these transcription changes

occur

To provide evidence-base for further research into novel signalling activity of

the pregnane X receptor

2. Materials and Methods

2.1 Materials

For cell treatment, berberine chloride (#B3251) was supplied by Sigma-Aldrich (St.

Louis, MO); as was MTT reagent (#M5655) for cytotoxicity testing. Dulbecco’s

Modified Eagle’s Medium (DMEM) (#D5546) and 10x Trypsin-EDTA solution

(#T3924) were also obtained from Sigma. Moloney Murine Leukemia Virus Reverse

Transcriptase (M-MLV RT) (#M1701) and Random Primers (#C1181) for cDNA

synthesis was purchased from Promega (Madison, WI). The GoTaq Flexi DNA

polymerase (#M8301) and 5x Green GoTaq Flexi buffer (#M891A) used for PCR

were too obtained from Promega. RNA extraction was achieved by using the

NucleoSpin® RNA kit (#740955.50) obtained from Macherey-Nagel (Düren,

Germany). All custom-made oligonucleotide primers for PCR were purchased from

Eurofins Genomics (Ebersberg, Germany). All other chemicals and reagents of

molecular biology standard, unless otherwise stated were obtained from Promega.

Control of Substances Hazardous to Health (COSHH) risk assessment forms for all

procedures performed can be seen in appendix 1.

2.2 Gene Selection and Oligonucleotide Primer Design

Primers are short nucleotide sequences needed for the successful analysis of gene

expression within a sample of cDNA via polymerase chain reaction (PCR). Once both

control and genes of interest had been chosen by interrogation of the gene

interaction network, each homo sapiens variant of the gene sequence was found on

8

the National Centre for Biotechnology Information’s (NCBI) (Bethesda, MD) ‘Gene’

database. Gene sequences were then recorded whist excluding intronic sequences

and compiled as one document of purely exonic data. The gene sequence was then

compiled into Primer3 (Untergrasser et al., 2012) (Koressar and Remm, 2007), and

both forward and reverse primers were output following the specification of an

amplicon length of ~200-300bp. Primer sequences are as follows:

Gene Forward (Upstream) Primer Reverse (Downstream) Primer Amplicon Length (bp)

CYP3A4 5’-GCACCACCCACCTATGATACT-3’ 5’-CTTTCAGGGAGGAACTTCTCAG-3’ 227

CYP2B6 5’-GGAGATTGAACAGGTGATTGG-3’ 5’-GGATGATGTACCCTCGGAAG-3’ 170

SULT1A1 5’-CCGAAAAGGGAGATTCAAAAG-3’ 5’-ATGAAGGGGGAGATGCTGT-3’ 170

VEGFA 5’-TGGTGAAGTTCATGGATGTCTA-3’ 5’-CTGCATGGTGATGTTGGACT-3’ 197

MMP2 5’-GTCCACTGTTGGTGGGAAC-3’ 5’-CTTGGTCAGGGCAGAAGC-3’ 170

CDK2 5’-AGCTATCTGTTCCAGCTGCTC-3’ 5’-CTCATGGGTGTAAGTACGAACAGG-3’ 171

CDKN1A 5’-GAGCGATGGAACTTCGACTT -3’ 5’- AGGTCCACATGGTCTTCCTCT -3’ 200

Table 1 - Oligonucleotide primers designed for PCR using Primer3 (Untergrasser et al., 2012) (Koressar and Remm, 2007).

2.3 Cell Culture

Initially, HepG2 and HuH7 (human hepatocellular carcinoma) were taken out of

liquid nitrogen cryopreservation and incubated to thaw (37.5˚C (in 5% CO2/95%

air)). Cells were then seeded into two respective 12-well culture plates containing

2mL of complete DMEM and then incubated at 37.5˚C until ~80% confluent. When

confluent, to prevent cell death the cells were sub-cultured by removing the

existing media, washing the cells with phosphate-buffered saline (PBS) and then

adding trypsin-EDTA solution and incubating at 37.5˚C for 5 minutes to release the

adherent monolayer cells from the well. The cells were then added to fresh DMEM

and introduced to a new culture flask. This process was continued every three days

until the cell lines were ready to be treated with the compounds.

2.4 Cell Treatment

It was decided that 0, 0.1, 0.5, 1, 1.5 and 2 mM stock solutions of berberine chloride

were within the concentration range in which to treat both the HepG2 and HuH7

cell lines. Berberine chloride in its powder form was added to DMSO to form a stock

solution of 2mM, and from this the 4 other working solution concentrations were

9

created using DMSO as the 0mM vehicle control. The cells were plated at

approximately 2x105 cells per well; the counting was performed using a light

microscope and a haemocytometer. After 24 hour incubation at 37.5˚C (in 5%

CO2/95% air), the cells were treated with the 5 varying concentrations of berberine

chloride solution with n=3 respectively. Due to a 100-fold decrease in concentration

needed for dosing in the culture wells, the actual concentrations added to cells for

purposes of the cell viability assay (section 2.5) were 0, 1, 5, 10, 15 and 20µM.

2.5 Compound Cytotoxicity Profiling

In order to confirm the level of toxicity imposed by the cell treatment, cell viability

assays must be carried out. MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-

tetrazolium bromide] was dissolved in DMEM to provide a 1.5 mg/ml solution.

Following this, the DMEM was removed from one of the culture plates containing

the cell lines at 24 hours, and it was replaced with the MTT solution. The plate was

then incubated at 37.5˚C for 1 hour, and then the absorbance of the wells was

measured using a spectrophotometer at a wavelength of 620nm. This process was

repeated again twice at 48 and 72 hours. Following this, more cells were treated

with the stock concentrations of 0, 0.1 and 0.5 mM berberine chloride in DMSO,

with final concentrations in the cell culture well totalling a 1:100 dilution of 0, 1 and

5 µM.

2.6 RNA Extraction

For the extraction of RNA, the Macherey-Nagel NucleoSpin® RNA II kit protocol was

followed. Briefly, all media was removed from the culture plate wells, and the cell

lines were washed with PBS. Each sample was then homogenised via pipette. Lysis

buffer and β-mercaptoethanol were subsequently added to each well in order to

lyse the treated samples and following this, each lysate is then passed through a

filter via centrifugation. The RNA binding conditions are modified by the addition of

ethanol, and then the sample RNA are bound via further filtration and

centrifugation. Each sample subsequently undergoes silica membrane desalination

by the addition of ‘membrane desalting buffer’ and further centrifugation. The

10

DNA is digested from each treated sample following the addition of DNase, then

the membrane is washed and dried and finally, pure RNA is eluted via

centrifugation.

2.7 cDNA Synthesis from RNA

In order to synthesise complementary DNA for PCR from the RNA obtained from

the lysed samples, they underwent reverse transcription. Each RNA sample, along

with random primers and nuclease-free H2O was placed into a sterile, RNase-free

microcentrifuge tube and then the mixture was heated at 70˚C for 5 minutes in a

PCR thermocycler, then immediately placed on ice. In the second stage of reverse

transcription, the following were added to the annealed primer and template

solution from part 1:

Reagents Volume Used

M-MLV Reaction Buffer (5x) 5 µl

dATP, dCTP, dGTP, dTTP (10Mm) 1.25 µl (of each)

Recombinant RNasin Ribonuclease Inhibitor 1 µl

M-MLV Reverse Transcriptase 1 µl

Nuclease-free H2O 10 µl

Table 2 - Volumes of reagents used for 1 reverse transcription reaction.

(Note: M-MLV RT was used as opposed to Avian Myeblastosis Virus RT (AMV-RT)

due to its preference in long mRNA templates because its RNase H activity is

weaker)

The reaction mixture was mixed by flicking and then incubated for 1 hour at 37˚C.

2.8 Quantification of cDNA

Following first strand cDNA synthesis, quantification of the cDNA obtained was

performed using a NanoDrop spectrophotometer (NanoDrop Technologies,

Wilmington, DE) at 260 nm. Each sample was individually placed on the reader and

measured using an attached computer terminal which subsequently produced an

11

absorbance curve over a range of wavelengths, a cDNA measurement and also a

260/280nm value quantifying the purity of the cDNA sample.

2.9 Optimisation PCR

For each of the genes of investigation, an optimisation process must occur in order

to discover the most suitable gene-specific annealing temperature in order to prove

the most accurate analysis results. For each gene, using the sample G53 (HepG2,

0.5mM treatment, sample 3) as a source of cDNA, the following were added to a

sterile eppendorf tube to form a master mix:

Reagents Volumes Used

Green GoTaq® Reaction Buffer (5x) 20 µl

dATP, dCTP, dGTP, dTTP (10Mm) 2 µl

Gene-specific Upstream Primer 2 µl

Gene-specific Downstream Primer 2 µl

Sample (G53) cDNA (200ng/µl) 2 µl

Magnesium Chloride (25mM) 10 µl

DNA Polymerase (5 u/µl) 0.5 µl

Nuclease-free H2O 60 µl

Table 3 - Volumes of reagents used to create master mix for 10 PCR reactions.

The master mix for each gene was then divided into 10 microcentrifuge tubes and

placed into the PCR thermocycler gradient block and the following sequence was

performed (annealing temperatures were from 55˚C – 63.6˚C in 10 0.8˚C

increments):

12

PCR Stage Temperature Stage Duration Number of

Cycles

Initial Denaturation 95˚C 2 mins 1

Denaturation 95˚C 1 min 35

Annealing 55˚C – 63.6˚C 1 min

Extension 72˚C 30 secs 1

Final Extension 72˚C 5 mins 1

Soak 4˚C Indefinitely N/A

Table 4 - Stages of Optimisiation PCR to discover optimal annealing temperatures for target genes.

Following the soaking period, the sample tubes (n=10/gene) were placed on ice

until analysis could occur.

2.10 Optimisation PCR – Gel Electrophoresis and Analysis

In order to analyse the results of the PCR gene-specific optimisation, the samples

must undergo agarose gel electrophoresis. Agarose was dissolved in distilled H2O at

a ratio of 1:10 by heating and following a cooling period, was poured into a 40-well

gel tray with pre-placed combs and allowed to set in order to form a 1% agarose

gel. Once set, the samples were loaded into the wells abreast a 100bp ladder for

visual comparison. The gel electrophoresis tank was filled with 1x TBE (Tris-Borate-

EDTA) buffer and the gel tray was subsequently placed within the tank. The tank

was connected to a direct current (DC) power supply and was then ‘run’ for

approximately one hour at 120v.

Following electrophoresis, the gels were stained with ethidium bromide for 10

minutes, and the analysed on a computer terminal connected to an ultraviolet

stained-DNA visualiser in order to collect results.

2.11 Analytical PCR

Following the gene-specific optimisation PCR, all samples instead of an individual

treatment were then analysed for gene expression. The protocol for PCR analysis is

identical to that described previously in 2.8, except for:

13

Instead of 10 reactions per gene with the same sample, there were 18 reactions

per gene with all samples (H01-H53 & G01-G53).

Instead of a range of annealing temperatures per gene group, there were gene-

specific annealing temperatures as were obtained from the optimisation PCR

(Gene-specific annealing temperatures for analysis PCR were as per table 2 in

3.3).

There were 40 denaturation and annealing PCR cycles instead of 35 in order to

increase likelihood of clear bands upon gel electrophoresis.

Due to weak results for 2.9, the concentration of cDNA added to each master

mix was doubled.

2.12 Analytical PCR – Gel Electrophoresis and Analysis

Protocol and procedures for analysis of samples from 2.10 are identical to those in

2.10.

3. Results

3.1 Cell Culture

Both HepG2 and HuH7 cells were subcultured successfully throughout the study,

with no infections or unexpected cell death. Figure 3 and 4 show light microscopy

images of both confluent cell lines previous to splitting.

14

Figure 4 - Confluent HuH7 cell line previous to subculture (40x)

Figure 5 - Confluent HepG2 cell line previous to subculture (40x)

3.2 Cytotoxicity Profile of Berberine Chloride

Following treatment of both HepG2 and HuH7 cell lines with varying concentrations

of berberine chloride, as stated previously it was vital to obtain the amount of cell

death that had occurred due to the treatment. For time reasons, the assays were

only performed on the HuH7 cell line. Results of 24, 48 and 72 hour cell viability

assays are shown:

15

Contr

ol 1 5 10 15 20

0

50

100

150

Concentration of Berberine Chloride (M)%

Cell V

iab

ilit

y

Figure 6 - 24-hour treatment of HuH7 cells with Berberine Chloride results in amoderate increase of cell death with larger concentrations of the compound,

determined by MTT. Data is presented as mean SEM with concenentrationgroups of n=4. (p=0.055, one-way ANOVA with Bonferroni, multiple

comparisons demonstrate no significance).

Contr

ol 1 5 10 15 20

0

50

100

150

Concentration of Berberine Chloride (M)

%C

ell V

iab

ilit

y

*** **

Figure 7- 48-hour treatment of HuH7 cells with Berberine Chloride results in afurther increase of cell death with increased concentrations of the compound, as

determined by MTT. Data is presented as mean SEM with concenentrationgroups of n=4. (p<0.05, one-way ANOVA with Bonferroni)

(* = p0.05; ** = p0.01).

Contr

ol 1 5 10 15 20

0

50

100

150

Concentration of Berberine Chloride (M)

%C

ell V

iab

ilit

y

*

Figure 8 - 72-hour treatment of HuH7 cells with Berberine Chloride results in aninviability of cells due to a large proportion of cell death, as determined by MTT.

Data is presented as mean SEM with concenentration groups of n=4. (p=0.0005,

one-way ANOVA with Bonferroni) (* = p0.05).

16

At 24 hours post-treatment (figure 6), there is no statistically significant decrease in

cell viability. Cell viability at 48 hours post-treatment (figure 7) demonstrates a

significant reduction in cell viability at 10, 15 and 20µM treatments of berberine

chloride. Maximum decrease in viability occurs at 20µM with approximately 60%

viability of that of DMSO control. The 72-hour assay (figure 8) shows no significance

in cell viability changes except at 15µM which demonstrates a reduced viability.

Due to the results from the cell viability assays, it was decided that out of the

concentrations used, 0, 0.1 and 0.5 mM would be taken forward for analysis in this

study.

3.3 cDNA Quantification

As alluded to previously, following lysing of the samples and RNA extraction, cDNA

synthesis via reverse transcription was performed. Quantification of cDNA was

performed by NanoDrop Spectrophotometry.

Treatment (Cell Line – Concentration)

1 (ng/µl)

2 (ng/µl)

3 (ng/µl)

HepG2 - 0.0mM 2607.3 2613.2 3033.7

HepG2 - 0.1mM 2705.7 2636.4 2607.9

HepG2 - 0.5mM 2323.2 2621.4 2016.4

HuH7 - 0.0mM 2419.7 2519.3 2500.2

HuH7 - 0.1mM 2510.9 2605.9 2239.5

HuH7 - 0.5mM 2526.7 2657.6 2596.6 Table 5 - Quantification of cDNA following NanoDrop Spectrophotometry

As can be observed from table 5, the amount of cDNA obtained from RNA

extraction and reverse transcription is adequate for all samples.

17

Figure 9 - Agarose Gel showing gene expression at various annealing temperatures following the first round of Optimisation PCR

3.4 PCR Optimisation

Figure 9 depicts the results of the first round of PCR aiming to determine the most

appropriate annealing temperatures for gene expression analysis. Overall, weak

bands were observed with the exception of CDK2, SULT1A1 and VEGFA. Due to this,

it was decided to repeat the reactions in order to achieve more appropriate results.

Due to sample evaporation and reduced quantity, all genes except CYP3A4 and

CYP2B6 have reduced results.

18

Figure 10- Agarose Gel showing gene expression at various annealing temperatures following the second round of Optimisation PCR

As can be inferred from figure 10, three of the seven genes were not analysed for

optimal annealing temperature due to faults with the agarose gel. Due to this error,

the excluded genes will have to be re-repeated. As for figure 9, SULT1A1 yielded

only 9 results due to sample evaporation.

Figure 11 - Agarose Gel showing gene expression at various annealing temperatures following the third round of Optimisation PCR

Figure 11 shows the repeated PCR of those genes not analysed in PCR round two.

Bands from the third round proved to be vague and relatively indistinguishable. In

light of all results from the three rounds of optimisation PCR and gel analysis of

each gene, the optimal annealing temperatures can be decided on and are as

shown in table 3.

19

Gene Optimal Annealing Temperature (˚C)

CYP3A4 59.8

CYP2B6 60.8

SULT1A1 59.8

CDK2 59.8

VEGFA 60.8

MMP2 59.8

CDKN1A 60.8 Table 6 - Optimal gene-specific annealing temperature for PCR analysis as determined from optimisation PCR

3.5 PCR Analysis

3.5.1 CYP3A4 Expression Analysis

Figure 12 - Agarose Gel showing analysis of CYP3A4 gene expression in all samples. (*G53 sample not present due to a lack of cDNA following optimisation PCR)

Bands obtained from gene analysis of CYP3A4 (figure 12) show a range of varying

brightness. With the exception of the G53 sample notably dim bands involve the

samples G03, H01, H02 and H11. Remarkably bright bands are shown by G02, G12,

H12, H13 and H51. Overall, in absence of quantification, brightness increases with

concentration of treatment.

3.5.2 CYP2B6 Expression Analysis

Figure 13 - Agarose Gel showing analysis of CYP2B6 gene expression in all samples. (*G53 sample not present due to a lack of cDNA following optimisation PCR)

CYP2B6 expression analysis (figure 13) demonstrates results very similar to that of

CYP3A4, except with an overall brightness increase across all samples (excluding the

previously mentioned G53). The main difference that can be observed here is that

even in the well of G53, a band can be observed. Less correlation between band

brightness and concentration can also be seen.

20

3.5.3 SULT1A1 Expression Analysis

Figure 14 - Agarose Gel showing analysis of SULT1A1 gene expression in all samples. (*G53 sample not present due to a lack of cDNA following optimisation PCR)

Expression of SULT1A1 (figure 14) appears to be almost uniform across all samples.

Brightness very slightly increases with concentration of treatment in the HepG2 cell

line; however this is not seen in the HuH7. Similar to CYP2B6, a band can also be

seen in the negative control of G53. .

3.5.4 VEGFA Expression Analysis

Figure 15 - Agarose Gel showing analysis of VEGFA gene expression in all samples. (*G53 sample not present due to a lack of cDNA following optimisation PCR)

Analysis of VEGFA expression (figure 15) shows samples relating to the HepG2 cell

line show increasing brightness as concentration increases, whereas HuH7 does

not, as all bands are of the same brightness. There is also slight variance between

displacements of the samples along the gel.

3.5.5 CDK2 Expression Analysis

Figure 16 - Agarose Gel showing analysis of CDK2 gene expression in all samples. (*G53 sample not present due to a lack of cDNA following optimisation PCR)

Figure 16 shows that the expression of CDK2 when the HepG2 cell lines are treated

with berberine chloride is similar to that of VEGFA, with an average increased

brightness as concentration increases. Brightness appears uniform for HuH7 cells.

Overall, all bands are crisp and show uniform displacement under current.

21

3.5.6 CDKN1A and MMP2 Expression Analysis

Due to time allowances, there were no results obtained for the gene-specific

analysis of either CDKN1A or MMP2.

4. Discussion

4.1 Post-Treatment Cytotoxicity

Following a review of the literature surrounding PXR and evaluation of recent in

silico data, it was determined that berberine chloride was the most suitable choice

of agonist for the receptor in this study. Before analysis of gene expression change

was performed; cell viability at 24, 48 and 72 hours had to be experimentally

assessed following treatment of both HepG2 and HuH7 cell lines. Cell viability at 24

hours post-treatment (figure 6) initially demonstrates predicted results, as cell

viability decreases as a response to an increase in concentration. Despite the

results, there appears to be no statistically significant decrease in cell viability at 24-

hours. Due to this conclusion, we can assume that after 24 hours has elapsed,

concentrations of berberine chloride in this range prove not to be significantly

cytotoxic.

Figure 7 demonstrates the cell viability across the concentration range at 48-hours

post treatment. In this assay, a significant decrease in cell viability can be seen in

10, 15 and 20µM treatments (p≤0.01, p≤0.05 and p≤0.05 respectively). As can be

predicted, the largest reduction of cell viability can be observed in the two largest

concentrations (15 and 20µM). In the lower concentrations of 1 and 5µM, there is

no significant decrease in viability and henceforth, we can deduce that at 48 hours,

the treatments of the lowest two concentrations of berberine chloride do not

demonstrate significant cell death of that above vehicle control.

Post-72 hour treatment analysis of the HepG2 and HuH7 cell lines showed no

significant decreases in cell viability values for all ranges of concentrations, with no

overall correlation, except for 15µM. In this group a statistically significant

reduction in cell viability is observed, even in light of the more concentrated

treatment of 20µM, is surprising. It is probable that explanations for the broad

22

insignificance across the range of treatments lie with the cell death within the

DMSO control group and the overall cytotoxicity seen throughout all

concentrations. It can be determined that for all groups, post-72-hour treatment

results in a pronounced reduction in overall cell viability.

Following analysis, it appeared that berberine chloride in concentrations of 1 and 5

µM at 24-hours were the most suitable in order to investigate PXR activity with

regards to gene expression. It appears, purely based on results across all

concentrations, that berberine chloride, in small concentrations may cause the

same cell death as DMSO, or even provides an element of cytoprotection.

4.2 PCR Optimisation

Results following the PCR optimisation to determine the most appropriate gene-

specific annealing temperatures are, in general, quite poor. However, in spite of this

result, an adequate temperature for each gene was established following three

attempts at optimisation. It is most probable that these results could be attributed

to a of various reasons due to specific PCR components, such as cDNA quantity per

reaction, enzyme activity from using pre-used nuclease-free water or a low primer

concentration. Due to this, more care should be taken to reduce nuclease activity,

such as pre-cleaned benches and UV treatment of all equipment. Nonetheless,

vague, yet informative bands were distinguishable, indicating gene-specific

annealing temperatures.

4.3 Analytical PCR

As a hallmark of nuclear receptor-mediated gene expression, the first pattern

expected to be observed following analytical PCR is a dose-dependent change in

band brightness, to show either gene up-regulation or down-regulation. As

mentioned previously, for all analyses, the sample used in PCR optimisation

(HepG2, 0.5mM, sample 3) was not present due to a lack of sample. This could have

been avoided by further diluting the stock sample, however assumptions for results

regarding that particular cell line and concentration, must be based on the two

remaining samples (G51 and G52). Furthermore, the G53 sample provided an

23

otherwise not included negative loading control of which to compare the other gel

bands. In light of the inadvertent negative control, analysis could have been

performed to more precision by the inclusion of a positive loading control, such as

glyceraldehyde 3-phosphate dehydrogenase (GADPH) or β-actin; used for their

sustained cellular expression.

4.3.1 CYP3A4 Expression

The expression of CYP3A4 following treatment of berberine chloride was predicted

to be greatly up-regulated, as this gene is used as a classical positive control for PXR

activation following the link between the receptor and its induction of CYP3A4 in

2002 (Luo et al., 2002). In this study, expression appeared to be minimal. Dose-

dependent expression was observed for the HuH7 cell line, however for the HepG2

samples, expression appeared to be consistent throughout. It has been reported

that the chemosensitivity among hepatocarcinoma cell lines isn’t constant, and this

can be seen here in this expression response to berberine chloride (Lee et al.,

2002).

4.3.2 CYP2B6 Expression

CYP2B6, despite in silico data stating more research is needed on the specific

activity of the gene in response to both PXR and berberine, was strongly predicted

to express almost identically to CYP3A4. Following PCR, results demonstrate

CYP2B6 being expressed in a similar pattern to CYP3A4, however 2B6 appears to be

more up-regulated, as seen by the much brighter bands, such as those in samples

G12, G13 and G51. Inferences could possibly determine that the CYP2B family is

expressed more than CYP3A in response to PXR activation by berberine chloride. It

was noted that in both PCR for both 3A4 and 2B6, pipetting errors occurred in

master mix creation, leading to an overly large quantity of cDNA being introduced

to each reaction tube. This is a possible result of PCR inhibition by impurities and

therefore, the vague bands in samples G03, H01, H02, H11 and H52.

24

4.3.3 SULT1A1 Expression

Expression of SULT1A1 appeared to be increased, yet uniform throughout all

concentrations of treatment in the HuH7 cell line; however in HepG2 cells,

expression of the gene appears to be strongly dose-dependent. Expression of

SULT1A1 is to be expected due to the role of sulfotransferase 1A1 being one of

detoxification, similar to the cytochrome P450 enzymes. In the agarose gel analysis

of SULT1A1, a band can be seen in the well of the G53 sample, which is intended to

contain no genetic material; this indicates a possible contamination of the PCR

master mix which is possible due to human contact with the experimental area.

4.3.4 VEGFA Expression

Vascular endothelial growth factor A (VEGFA) expression was expected to be

reduced following in silico analysis, giving mild rationale for berberine chloride as a

chemotherapeutic agent acting through PXR. In this study, the results

demonstrated upregulation of VEGFA for the HepG2 cell line, however mild

expression for HuH7. Expression was not dose-dependent in either cell-type,

however was much more prominent in HepG2. This proposes that in response to

berberine chloride, VEGFA expression is surprisingly up-regulated, or indeed

unaffected by PXR activation.

4.3.5 CDK2 Expression

Cyclin-dependent kinase 2 (CDK2) yielded the most clear picture of gene expression

in all results obtained in the study. CDK2 has a major role in cell growth, as its up-

regulation is essential for the transition from the G1 to the S phase of the cell cycle.

The rationale for the choice of CDK2 as a gene of interest relating to PXR activation

was due to the presence of the gene in the in silico analysis of interactions between

berberine chloride and PXR. There was a dose-dependent increase in CDK2

expression in the HepG2 cell line, whereas the HuH7 cell-type demonstrated an

expression not based on the concentration of treatment. CDK2 as a gene

influencing cell growth was hypothesised by previous in silico work as being

25

reduced in response to berberine chloride due to its possible anti-cancer qualities.

In this study we can see a contradiction of this proposed CDK2 response.

With all results collated, this study confirms the role of PXR as a facilitator of

xenobiotic detoxification. The role of berberine chloride has also been investigated

by proxy, not only as an activator of PXR, but as a compound in its own right.

Berberine chloride has been used extensively as a herbal remedy, even in cases of

cancer. This study demonstrates that in spite of in silico investigation, the role of

berberine as a therapeutic compound needs to be investigated further, as there is

no clear evidence of its anti-cancer properties as a result of this in vitro study. With

that mentioned, all transcriptional effects seen in vitro which are not dose

dependent, are more than likely the result of sub-lethal toxicity, demonstrating that

further investigation is needed to prove conclusively the exact gene expression

changes in response to PXR activation.

5. Conclusion

In light of this limited, yet revealing study we can see definite changes in expression

of the genes under investigation, from those of detoxification, to those of cell

growth, development and apoptosis. This data has demonstrated that berberine

chloride is reconfirmed as an agonist of PXR and therefore can be used in research

as a compound to further investigate the activity of this receptor. This study further

elucidates the role of PXR by showing that the receptor holds influence over the

transcription of various essential genes, not only those involved in detoxification,

but those holding vital roles in cell growth. Furthermore, revealing the exciting and

emerging field of nuclear receptor biology and toxicology as a source of multiple

avenues towards the investigation of various disorders of health, and disease.

26

References

Bailey I, Gibson G.G, Plant K, Graham M, Plant N. (2011) “A PXR-Mediated Negative

Feedback Loop Attenuates the Expression of CYP3A in Response to the PXR Agonist

Pregnenalone-16a-Carbonitrile”. PLoS ONE 6(2): e16703

Chatuphonprasert W, Nemoto N, Sakuma T, Jarukamjorn K. (2012) “Modulations of

cytochrome P450 expression in diabetic mice by berberine”. Chemico-Biological

Interactions 196 (1-2): 23-29.

Cheng J, Ma X, Gonzalez F.J. (2010) “Pregnane X receptor and CYP3A4-humanized

mouse models and their applications”. British Journal of Pharmacology 163; 461-

468.

Coumoul X, Diry M, Barouki R. (2002) “PXR-dependent induction of human CYP3A4

gene expression by organochlorine pesticides”. Biochemical Pharmacology 64; 1513-

19.

Cytoscape. (2012) ‘www.cytoscape.org’ ed. USA: Cytoscape.

Guo Y, Pope C, Cheng X, Zhou H, Klaassen C.D. (2011) “Dose-response of Berberine

on Hepatic Cytochromes P450 mRNA Expression and Activities in Mice”. J

Ethnopharmacol. 138(1): 111-18.

Haelens A, Tanner T, Denayer S, Callewaert L, Claessens F. (2007) “The Hinge Region

Regulates DNA Binding, Nuclear Translocation and Transactivation of the Androgen

Receptor”. Cancer Res 67: 4514-23.

Hartley D.P, Dai X, He Y.D, Carlini E.J, Wang B, Huskey S.E, Ulrich R.G, Rushmore T.H,

Evers R, Evans D.C. (2004) “Activators of the rat pregnane X receptor differentially

modulate hepatic and intestinal gene expression”. Mol Pharmacol. 65(5); 1159-71.

Johnson D.R, Li C.W, Chen L.Y, Ghosh J.C, Chen J.D. (2006) “Regulation and binding

of pregnane X receptor by nuclear receptor corepressor silencing mediator of

retinoid and thyroid hormone receptors (SMRT)”. Mol Pharmacol. 69(1); 99-108.

27

Kliewer S.A, Goodwin B, Willson T.M (2002) “The Nuclear Pregnane X Receptor: A

Key Regulator of Xenobiotic Metabolism”. Endocrine Reviews 23(5); 687-702.

Kliewer S.A, Moore J.T, Wade L, Staudinger J.L, Watson M.A, Jones S.A, McKee D.D.

Oliver B.B, Willson T.M, Zetterström R.H, Perlmann T, Lehmann J.M. (1998) “An

orphan nuclear receptor activated by pregnanes defines a novel steroid signalling

pathway”. Cell 92; 73-82.

Koressaar T, Remm M. (2007) “Enhancements and modifications of primer design

program Primer3” Bioinformatics 23(10): 1289-91.

Kortagere S, Krasowski M.D, Ekins S. (2012) “Ligand and Structure-based Pregnane

X Receptor Models”. Methods in Molecular Biology 929; 359-75.

Kulkarni S.K. and Dhir A. (2008). "On the mechanism of antidepressant-like action of

berberine chloride". Eur J Pharmacol 589 (1–3): 163–72.

Lee T.K, Lau T.C, Ng I.O. (2002) “Doxorubicin-induced apoptosis and

chemosensitivity in hepatoma cell lines”. Cancer Chemother Pharmacol 49(1): 78-

86.

Lehmann J.M, McKee D.D, Watson M.A, Willson T.M, Moore J.T, Kliewer S.A. (1998)

“The human orphan nuclear receptor PXR is activated by compounds that regulate

CYP3A4 gene expression and cause drug interactions.” J. Clin. Investig. 102; 1016-

23.

Luo G, Cunningham M, Kim S, Burn T, Lin J, Sinz M, Hamilton G, Rizzo C, Jolley S,

Gilbert D, Downey A, Mudra D, Graham R, Carroll K, Xie J, Madan A, Parkinson A,

Christ D, Selling B, LeCluyse E, Gan L.S. (2002) “CYP3A4 induction by drugs:

correlation between a pregnane X receptor reporter gene assay and CYP3A4

expression in human hepatocytes”. Drug Metab Dispos 30(7): 795-804.

McGuinness H. and Bailey I. (2012) “A network analysis approach to identify novel

nuclear receptor interactions”. Unpublished report. University of Westminster.

28

Niemira M, Dastych J, Mazerska Z (2013) “Pregnane X receptor dependent up-

regulation of CYP2C9 and CYP3A4 in tumor cells by antitumor acridine agents, C-

1748 and C-1305, selectively diminished under hypoxia”. Biochemical Pharmacology

86; 231-241.

Tang J, Feng Y, Tsao S, Wang N, Curtain R, Wang Y. (2009). "Berberine and Coptidis

Rhizoma as novel antineoplastic agents: a review of traditional use and biomedical

investigations". J Ethnopharmacol 126 (1): 5–17.

Tolson A.H. and Wang H. (2010) “Regulation of drug-metabolizing enzymes by

xenobiotic receptors: PXR and CAR.” Advanced Drug Delivery Reviews 62; 1238-49.

Untergrasser A, Cutcutache I, Koressaar T, Ye J, Faircloth B.C, Remm M, Rozen S.G.

(2012) “Primer3 - new capabilities and interfaces”. Nucleic Acids Research 40(15):

115.

Wang Y-M, Ong S.S, Chai S.C, Chen T (2012) “Role of CAR and PXR in Xenobiotic

Sensing and Metabolism”. Expert Opin Drug Metab Toxicol. 8(7); 803-817.

Warnmark A, Treuter E, Wright A.P.H, Gustafsson J. (2003) “Activation Functions 1

and 2 of Nuclear Receptors: Molecular Strategies for Transcriptional Activation”.

Molecular Endocrinology 17(10): 1901-09.

Wentworth J.M, Agostini M, Love J, Schwabe J.W, Chatterjee V.K. (2000) “St. John’s

wort, a herbal antidepressant, activates the steroid X receptor.” Journal of

Endocrinology 166; R11-16.

Willson T.M. and Kliewer S.A. (2002) “PXR, CAR and drug metabolism”. Nature

Reviews Drug Discovery 1; 259-266.

Zha W, Liang G, Xiao J, Studer E, Hylemon P.B, Pandak W.M, Wang G, Li X, Zhou H.

(2010) “Berberine Inhibits HIV Protease Inhibitor-InducedInflammatory Response by

Modulating ER Stress Signaling Pathways in Murine Macrophages”. PLoS ONE 5(2):

e9069.

29

Appendix 1: Control of Substances

Hazardous to Health (COSHH) Risk

Assessment Forms for All Protocols

Performed Throughout Study