1

γγγγ-Butyrolactone-Dependent Expression of the SARP Gene srrY Plays a Central Role in the 1

Regulatory Cascade Leading to Lankacidin and Lankamycin Production in Streptomyces 2

rochei 3

4

SHOUJI YAMAMOTO, YUXI HE, KENJI ARAKAWA, AND HARUYASU KINASHI* 5

6

Department of Molecular Biotechnology, Graduate School of Advanced Sciences of Matter, 7

Hiroshima University, Higashi-Hiroshima, Japan 8

9

10

11

12

* Corresponding author. Mailing address: Department of Molecular Biotechnology, Graduate 13

School of Advanced Sciences of Matter, Hiroshima University, 1-3-1 Kagamiyama, 14

Higashi-Hiroshima 739-8530, Japan. Phone: 81-82-424-7869. Fax: 81-82-424-7869. E-mail: 15

kinashi@hiroshima-u.ac.jp. 16

ACCE

PTED

Copyright © 2007, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.J. Bacteriol. doi:10.1128/JB.01383-07 JB Accepts, published online ahead of print on 14 December 2007

on April 1, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

2

ABSTRACT 17

18

Our previous studies revealed that the srrX and srrA genes coded on the large linear plasmid 19

pSLA2-L constitute a γ-butyrolactone-receptor system in Streptomyces rochei. Extensive 20

transcriptional analysis has now showed that the SARP gene srrY, which is also coded on 21

pSLA2-L, is a target of the receptor/repressor SrrA and plays a central role in lankacidin and 22

lankamycin production. The srrY gene was expressed in a growth-dependent manner, slightly 23

preceding antibiotic production. Expression of srrY was undetectable in the srrX mutant, but was 24

restored in the srrX-srrA double mutant. In addition, SrrA was bound specifically to the promoter 25

region of srrY and this binding was prevented by addition of the S. rochei γ-butyrolactone (SRB) 26

fraction, while the mutant receptor SrrAW119A

was kept bound even in the presence of SRB. 27

Furthermore, introduction of an intact srrY gene under a control of a foreign promoter into the 28

srrX or srrAW119

mutant restored antibiotic production. All of these results confirmed the 29

signaling pathway from srrX through srrA to srrY, leading to lankacidin and lankamycin 30

production. 31

32

33

INTRODUCTION 34

35

Streptomycetes produce many secondary metabolites including antibiotics and also undergo 36

a complex process of morphological development. To regulate these complex cellular processes, 37

the bacteria have evolved an intricate hierarchic regulatory system. γ-Butyrolactone, a diffusible 38

signaling molecule, often governs antibiotic production and/or morphogenesis in streptomycetes 39

(3, 30). Pioneering studies to understand the γ-butyrolactone signaling system have been carried 40

out in Streptomyces griseus, a streptomycin producer. In this bacterium, the γ-butyrolactone 41

known as ‘A-factor’ (2-isocapryloyl-3R-hydroxymethyl-γ-butyrolactone) (6, 12) is synthesized 42

by the afsA gene product (7, 10). In the absence of A-factor, the A-factor receptor protein, ArpA 43

(23), binds to the promoter region of the global transcriptional activator gene, adpA, and 44

represses its transcription (22). When A-factor reaches a critical concentration, it binds to ArpA, 45

dissociates ArpA from the promoter of adpA, and thereby relieves its repression, which in turn 46

triggers streptomycin production and morphological development. ArpA belongs to the TetR 47

family of receptor proteins and contains a helix-turn-helix motif in its N-terminal region and a 48

tryptophan residue at the 119 position. The former has a DNA binding activity, while the latter is 49

necessary for A-factor binding (27). The ArpA-binding site was found within the -35 and -10 50

region of the adpA promoter and contained a 22 bp-palindromic sequence, suggesting that ArpA 51

ACCE

PTED

on April 1, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

3

represses the adpA transcription by preventing the binding of RNA polymerase (22, 23). Similar 52

regulatory systems composing of a γ-butyrolactone and its cognate receptor protein have been 53

reported in other streptomycetes; for examples, the barX-barA system for virginiamycin 54

production in Streptomyces virginiae (11), farX-farA for showdomycin and minimycin in 55

Streptomyces lavendulae (17), scbA-scbR for actinorhodin and undecylprodigiosin in 56

Streptomyces coelicolor A3(2) (31). However, their effects on antibiotic production and 57

morphogenesis are different from species to species. 58

The γ-butyrolactone-receptor systems regulate many regulatory genes including the SARP 59

(Streptomyces antibiotic regulatory proteins) family genes (33). Members of this family are 60

characterized by the presence of an OmpR-like DNA-binding domain (19) and regulate 61

biosynthesis of many antibiotics. They are exemplified by actII-orf4 for actinorhodin (2), dnrI 62

for daunorubicin (18), papR1 for pristinamycin (5), tylS for tylosin (4, 25) and kaoO for a 63

hypothetical type I polyketide (32). 64

Streptomyces rochei strain 7434AN4 has three linear plasmids (pSLA2-L, -M, and -S) and 65

produces two different polyketide antibiotics, lankacidin (LC) and lankamycin (LM) (14, 15). 66

We have shown that their biosynthetic gene clusters, lkc (orf4-orf18) for lankacidin and lkm 67

(orf24-orf53) for lankamycin are located on the largest plasmid pSLA2-L (210,614 bp) (20, 29). 68

This plasmid contains two additional biosynthetic gene clusters for a hypothetical type-II 69

polyketide (roc, orf62-orf70) and carotenoid (crt, orf104-orf110). Furthermore, numerous 70

regulatory genes were found on pSLA2-L, including homologues of the A-factor regulatory 71

genes in S. griseus. They are a γ-butyrolactone biosynthetic gene srrX (orf85) similar to afsA, six 72

tetR family receptor genes, srrA (orf82), srrB (orf79), srrC (orf74), orf92, orf99 and orf126, 73

three SARP genes, srrY (orf75), srrW (orf55) and srrZ (orf71), and two transcriptional activator 74

genes, orf116 and orf3, similar to adpA and strR, respectively. Thus, these genes might form a 75

more complex regulatory cascade than those found in other streptomycetes. 76

Our previous studies revealed that srrX and srrA constitute a γ-butyrolactone-receptor system 77

in S. rochei (1, 20). srrX had a positive effect on antibiotic production and a negative effect on 78

spore formation, whereas srrA reversed both effects of srrX. Exogenous addition of the culture 79

extract of the parent strain 51252 to the srrX mutant restored the production of both LC and LM, 80

suggesting that the γ-butyrolactone was enough for restoration without the SrrX protein. Until 81

now, the S. rochei γ-butyrolactone, namely SRB, has not been isolated. In addition to srrA, the 82

srrB gene had a negative effect on LC and LM production, whereas srrC had a positive effect on 83

spore formation. Furthermore, the SARP gene srrY showed positive effects on both antibiotic 84

production and sporulation (we will revise the latter effect; see later). Thus, the srrX-srrA 85

γ-butyrolactone-receptor system may regulate antibiotic biosynthesis and sporulation together 86

ACCE

PTED

on April 1, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

4

with several regulatory genes including srrB, srrC and srrY. Therefore, identification of 87

regulators functioning downstream of the srrX-srrA system is of quite interest and may facilitate 88

understanding of the entire picture of the regulatory cascade in S. rochei. 89

Extensive transcriptional analysis in this study has revealed that srrY is a primary target of 90

the receptor/repressor SrrA and the signaling pathway from srrX through srrA to srrY plays a 91

central role in the regulation of antibiotic production. Based on all the results including 92

preliminary ones, we propose at the end a possible regulatory cascade leading to LC and LM 93

production in S. rochei. 94

95

96

MATERIALS AND METHODS 97

98

Bacterial strains, plasmids, media and DNA manipulation. S. rochei strain 51252 carrying 99

only pSLA2-L (14) was used as the parent strain, and mutant strains were constructed as 100

described below and listed in Table 1. Plasmids used in this study are listed in Tables 2, and their 101

construction is described below. S. rochei strains were grown in YM medium (0.4% yeast extract, 102

1.0% malt extract, and 0.4% glucose, pH 7.3) or Tryptic Soy Broth (TSB) medium, and E. coli 103

strains were grown in Luria-Bertani (LB) medium. Antibiotics were used at the following 104

concentrations: ampicillin, 100 µg/ml; apramycin, 25 µg/ml; chloramphenicol, 10 µg/ml; 105

kanamycin, 10 µg/ml; thiostrepton, 10 µg/ml. DNA manipulations for Streptomyces (13) and E. 106

coli (24) were carried out according to standard procedures. PCR amplification was carried out 107

with a 2720 Thermal Cycler (Applied Biosystems) using Thermococcus kodakaraensis DNA 108

polymerase (KOD Plus) (Toyobo). Nucleotide sequences of DNA primers are summarized in 109

Table 3. 110

Targeted mutagenesis. srrY (orf75) disruption. A 1.8-kb BamHI fragment containing the srrY 111

gene was cloned into pUC19 (pKY75-1), and a 1.2-kb SmaI fragment of pUC4-KIXX 112

(Pharmacia) bearing a kanamycin resistance cassette was inserted into the NruI site in the center 113

of srrY to obtain pKY75-2. The vector part of this plasmid was replaced by pRES18, an E. 114

coli-Streptomyces shuttle vector (8), to give a targeting plasmid, pKY75-3 (see Fig. S1 in 115

Supplemental Material). 116

In-frame deletion of srrY. A 1.8-kb EcoRI-PstI fragment of pKY75-1 was cloned into 117

pRSET-B (Invitrogen) to obtain pKAR3053. A 267-bp PvuII fragment of pKAR3053 118

corresponding to the central part of srrY was eliminated to give pKAR3054, the vector part of 119

which was replaced by pRES18 to give a targeting plasmid pKAR3055 (Fig. S2). 120

srrZ (orf71) disruption. A 2.2-kb SphI fragment containing the srrZ gene was cloned into 121

ACCE

PTED

on April 1, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

5

pRES18 to obtain pKY71-1. A 0.4-kb BglII fragment at the middle of srrZ in pKY71-1 was 122

replaced by a 1.6-kb BamHI fragment of pUC4-KIXX to give a targeting plasmid, pKY71-2 (Fig. 123

S3). 124

srrW (orf55) disruption. A 1.7-kb Eco47III fragment containing the srrW gene was cloned into 125

the SmaI site of pBluescript SK-plus to obtain pKAR3001. Its 1.7-kb EcoRI-BamHI fragment 126

was recloned into pRSET-B (pTN01), and then a 1.2-kb SmaI fragment of pUC4-KIXX was 127

inserted into the PvuII site at middle of srrW to give pTN02. The vector part of pTN02 was 128

replaced by pRES18 to obtain a targeting plasmid, pTN03 (Fig. S4). 129

srrAW119A

point mutation. A 1·5-kb AgeI fragment of pKAR3012, which contained the 130

C-terminal region of srrA, was inserted into the corresponding site of Litmus 28i (New England 131

Biolabs) to obtain pKAR3023. This plasmid was digested with KpnI and HindIII, and the vector 132

part was replaced by pAlterR-1 (Promega) to obtain pKAR3025. Site-directed mutagenesis was 133

carried out by the Altered sitesR

II in vitro mutagenesis system (Promega) using two 134

oligonucleotides, KAR8201SDM and the Ampicillin Repair Oligonucleotide, to obtain 135

pKAU-8201. This plasmid carried a gene encoding a mutated SrrA protein (SrrAW119A

) with 136

alanine at the 119 position in place of tryptophan. A 1·5-kb AgeI fragment of pKAU-8201 was 137

replaced for that of pKAR3012 to obtain pKAU-8202. The vector part of pKAU-8202 was 138

replaced by pRES18 to obtain a targeting plasmid, pKAU-8203 (Fig. S5). 139

Targeted mutagenesis was performed as follows. The parent strain 51252 was transformed 140

with each of the targeting plasmids constructed above, and thiostrepton-resistant transformants 141

were obtained. Among these transformants, single-crossovered (plasmid-integrated) strains were 142

selected by Southern hybridization analysis. Selected colonies were serially grown in liquid 143

YEME medium containing kanamycin to facilitate a second crossover. Finally, 144

kanamycin-resistant and thiostrepton-sensitive colonies were selected as double-crossovered 145

mutants. When the targeting plasmid did not contain a kanamycin cassette, the second crossover 146

was induced by serially culturing in YEME medium without kanamycin. 147

Extraction and detection of antibiotics. S. rochei strains were grown in 100 ml of YM 148

liquid medium in Sakaguchi flasks at 28 °C for various periods. The broth filtrate was extracted 149

with ethyl acetate, concentrated, and applied to thin layer chromatography (TLC) with 150

chloroform-methanol (15:1). Antibiotic activity was detected by bioautography as described 151

previously (14). The crude extract was dissolved in 1 ml of methanol, 1 µl of which was used as 152

the SRB fraction for SrrA-binding experiments. 153

srrY expression from a foreign promoter. The srrY gene was PCR-amplified using 154

pKAR4002 as a template and primers KAR-75OE01 and KAR-75OE03. The amplified product 155

was digested with NdeI and BamHI, and inserted into the corresponding sites of pIJ8600 (28), an 156

ACCE

PTED

on April 1, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

6

E. coli-Streptomyces shuttle vector containing a thiostrepton-inducible tipA promoter, to obtain 157

pKAR3049. This plasmid was transformed into strains KY75, KY85 or KU82. The 158

transformants were grown at 28°C for 24 h in YM liquid medium containing apramycin, and 159

then thiostrepton was added to induce srrY expression. After further 48-h cultivation, the ethyl 160

acetate extracts were analyzed by TLC. 161

RNA preparation. S. rochei strains were cultured in 100 ml of YM liquid medium in 162

Sakaguchi flasks at 28°C for various periods. Cells were harvested from 1 ml of growing 163

cultures by centrifugation at 4℃, homogenized in 1 ml of TRI reagent (Invitrogen), and stored at 164

room temperature for 10 min. The cell suspension was mixed vigorously with 200 µl of 165

chloroform and centrifuged at 4℃. A 500 µl aliquot of the aqueous fraction containing RNA was 166

mixed with 500 µl of isopropyl alcohol, stored at room temperature for 10 min, and centrifuged 167

at 4℃. The pellet containing RNA was washed with 80% ethanol, vacuum-dried, and dissolved 168

in 100 µl of diethylpyrocarbonate-treated H2O. The purified RNA was quantified by UV 169

absorbance at 260 nm. 170

S1 nuclease protection analysis. Uniquely end-labeled DNA probe for S1 analysis was 171

generated by PCR as follows. The primer SRRYr4 was 5’-end labeled using [γ-32

P]ATP (GE 172

healthcare) and T4 polynucleotide kinase (Toyobo), and used for PCR reaction with the 173

unlabeled primer SRRYf2 and the template pKAR4002, which generated a 702-bp product 174

containing the upstream region of srrY (positions -602 to +100 relative to the transcriptional start 175

site of srrY). 30 µg of total RNA was denatured at 75°C for 10 min and hybridized to the 176

32P-labeled probe at 30°C for 3 h in 50 µl of S1 hybridization buffer (80% formamide, 0.4 M 177

NaCl, 1 mM EDTA, 20 mM HEPES (pH6.5)). S1 nuclease reaction mixture (300 µl) contained 178

the hybridization reaction, 500 units of S1 nuclease (Takara), 30 mM sodium acetate (pH4.6), 179

280 mM NaCl, and 1 mM ZnSO4. After incubation for 20 min at 25°C, the reaction was 180

terminated by addition of 300 µl of phenol-chloroform. After centrifugation at 4℃, the aqueous 181

fraction containing DNAs was precipitated by ethanol and separated on a 5% polyacrylamide gel 182

containing 6 M urea. The labeled DNAs were detected by autoradiography. Sequencing ladders 183

were generated by the T7 sequencing kit (USB corporation) using the 32

P-labeled primer 184

SRRYr4 and the template pKAR4002. 185

Preparation of SrrA and SrrAW119A

. Using pKAR3012 as a template, the srrA gene was 186

PCR-amplified with primers KAR8201OE and KAR8202OE. The amplified product was 187

digested with BamHI and SalI, and inserted into the corresponding sites of pET32b to obtain 188

pKAR3035. In this plasmid, SrrA is expressed as a His10-tagged form (His-SrrA). Next, using 189

pKAU-8203 as a template, the mutated srrAW119A

gene was PCR-amplified with primers 190

KAR8201OE and KAR8202OE. The amplified product was digested with BamHI and SalI, and 191

ACCE

PTED

on April 1, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

7

inserted into the corresponding sites of pET32b to obtain pET-Amt. In this plasmid, SrrAW119A

is 192

also expressed as a His10-tagged form (His-SrrAW119A

). 193

The His-SrrA (or His-SrrAW119A

) protein synthesized in strain BL21(DE3) harboring both 194

pLysS and pKAR3035 (or pET-Amt) was affinity-purified on Ni+-NTA agarose (QIAGEN) 195

according to the method described previously (34). The purified proteins exhibited a single band 196

of 43.5 kDa after seperation by sodium dodecyl sulfate-polyacrylamide gel electrophoresis 197

(SDS-PAGE) (Fig. S6). These proteins were digested with recombinant enterokinase (Novagen) 198

and their N-terminal portions containing His10-tag (16 kDa) were removed by Ni+-NTA agarose 199

(Fig. S6). Protein concentration was determined by a Bio-Rad protein assay kit (Bio Rad) with 200

bovine serum albumin as a standard. 201

Gel shift assay. A 935-bp DNA fragment containing the upstream region of srrY (positions 202

-602 to +333) was PCR-amplified from pKAR4002 with primers SRRYf2 and SRRYr2, and 203

digested with NaeI and BanI. The resulting 548-bp (probe Y1: positions -452 to +100) and 204

233-bp (probe Y2: positions +101 to +333) DNA fragments were gel-purified and the former 205

was labeled at the 3’ end of the non-template strand with [α-32

P]dCTP (GE healthcare) by 206

Klenow fragment (Toyobo). Binding reaction mixture (20 µl) contained 1 nM labeled DNA and 207

various concentrations of SrrA (or SrrAW119A

) in the binding buffer (20 mM Tris-HCl (pH8.0), 208

100 mM NaCl, 1 mM dithiothreitol, 0.1 mg/ml BSA, 5% glycerol). When necessary, 1 ml of the 209

culture extract of strain 51252 or KY85 was added as the SRB fraction. In competition assay, 210

unlabeled DNA competitors were added to the reaction mixture at a final concentration of 200 211

nM. Reaction mixture was incubated for 30 min at 25°C and subjected to electrophoresis at 4°C 212

on native 5% polyacrylamide gel in 0.5 × TBE buffer (46 mM Tris base, 46 mM boric acid, 1 213

mM EDTA). Labeled DNAs were detected by autoradiography. 214

DNase I footprinting. DNase I footprinting was performed using end-labeled probe Y1 at 215

either non-template or template strand. The former was generated as described in gel shift assay 216

and the latter was as follows. The 32

P-labeled DNA probe used for the S1 analysis was digested 217

with NaeI and the resulting 552-bp DNA fragment was gel-purified. Binding reaction mixture 218

(50 µl) contained 2 nM labeled DNA and various concentrations of SrrA in the binding buffer 219

described above. After incubation for 30 min at 25°C, 50 µl of 5 mM MgCl2-5 mM CaCl2 220

solution containing 0.6 µg DNase I (Roche) was added and incubated for 2 minutes at 25°C. The 221

reaction was terminated by 300 µl of phenol-chloroform. After centrifugation at 4℃, the aqueous 222

fraction containing DNAs was precipitated by ethanol and separated on a 5% polyacrylamide gel 223

containing 6 M urea. Labeled DNAs were detected by autoradiography. Sequencing ladders were 224

generated by the same method as for the S1 mapping (for template strand) or Maxam-Gilbert 225

sequencing of the labeled probe (for non-template strand). 226

ACCE

PTED

on April 1, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

8

RESULTS 227

228

Two SARP genes, srrY and srrZ, are involved in antibiotic production. Phenotypic studies 229

of single and double mutants of the afsA-homologue srrX and three arpA-homologues, srrA, 230

srrB and srrC, revealed that srrX and srrA make a γ-butyrolactone-receptor system in S. rochei 231

similar to the A-factor regulatory cascade in S. griseus (1). Additional homologues of S. griseus, 232

an adpA homologue orf116 and an strR homologue orf3, are also located on the linear plasmid 233

pSLA2-L. However, disruption of the latter two genes gave no effect on antibiotic production or 234

morphological differentiation (data not shown). Instead, disruption of the SARP gene srrY 235

(mutant KY75, all the mutants used in this study are listed in Table 1) ceased both antibiotic 236

production and spore formation (Fig. 1A, reference 20, in this paper we focused on antibiotic 237

production, and therefore did not show results of spore formation). 238

To confirm the function of srrY in antibiotic production and spore formation, 239

complementation experiments were carried out. When an intact srrY gene was cloned into 240

plasmid pIJ8600 and expressed from a thiostrepton-inducible tipA promoter in mutant KY75, 241

production of both LC and LM was restored (Fig. 1B), but spore formation was not. This result 242

suggested that SrrY actually acts as an activator for antibiotic production, but the defect of spore 243

formation in mutant KY75 might be caused by a polar effect on the downstream srrC (orf74) 244

gene, encoding a positive regulator for morphological differentiation (1). Because, mutant KY75 245

was constructed by insertion of a kanamycin resistance gene cassette into srrY (20). This 246

speculation has been confirmed very recently by construction of another mutant KA61 with an in 247

frame deletion in srrY, which did not produce either antibiotic (Fig. 1A) but sporulated normally. 248

To reveal the function of two additional SARP genes located on pSLA2-L, srrW (orf55) and 249

srrZ (orf71), we disrupted these genes, too. As shown in Fig. 1A, the srrZ disruptant KY71 250

produced LC but did not produce LM, and sporulated normally. On the other hand, disruption of 251

srrW (mutant TN01) gave no effect on antibiotic production or spore formation. These results 252

indicated that two SARP genes, srrY and srrZ, are involved in antibiotic production, the former 253

possibly being located at an upper level than the latter in the regulatory hierarchy. Thus, we 254

focused at first on the function of srrY in antibiotic production, detailed results of which are 255

described below. 256

Growth-dependent expression of srrY. Production of antibiotics in streptomycetes occurs at 257

a specific stage of growth. Similarly, the antibiotic activity in S. rochei 51252 was 258

growth-dependent, detected at 24 h after inoculation and stably maintained until at least 48 h 259

(Figs. 2A and 2B). To know the correlation between antibiotic production and srrY expression, 260

RNA was extracted at different growth stages and analyzed by high-resolution S1 nuclease 261

ACCE

PTED

on April 1, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

9

protection assay. The analysis showed that srrY mRNA increased markedly at 12 to 24 h and 262

disappeared by further cultivation (Fig. 2C). Thus, the expression of srrY also occurred in a 263

growth-dependent manner, slightly preceding antibiotic production. In addition, we identified a 264

transcriptional start site (TSS) 33 nt upstream of the translational start codon of srrY (Fig. 2C 265

and 3A). Immediately upstream of this site, -35 and -10 sequences similar to the σhrdB

and 266

σhrdD

-type promoters of S. coelicolor A3(2) (9) were also found (Fig. 3A). 267

γγγγ-Butyrolactone-receptor system regulates srrY expression. To know whether the 268

srrX-srrA system regulates srrY expression, we analyzed effects of the srrX and srrA mutations 269

on srrY mRNA. Total RNAs were isolated at 24 h and srrY mRNA was quantified by 270

low-resolution S1 nuclease protection assay. As shown in Fig. 4, srrY mRNA was almost 271

undetectable in the srrX mutant KY85, while it was not significantly changed in the srrA mutant 272

KA12. The decrease of srrY mRNA in mutant KY85 was recovered near to the normal level by 273

introduction of a second srrA mutation (KA21). These results suggested that the srrX and srrA 274

genes have a positive and negative effect, respectively, on srrY expression. The effects of the 275

srrX and srrA mutations on srrY expression were similar to those on antibiotic production (1, 20). 276

It is noteworthy that the srrA mutation (or srrX-srrA double mutation) did not lead to the 277

overproduction of srrY mRNA (Fig. 4) or antibiotics (1), which suggests a possible 278

compensative mechanism in the regulatory system (see Discussion). 279

Specific binding of SrrA to the upstream region of srrY and its inhibition by SRB. To 280

test if the SrrA protein binds to the srrY region, gel shift assay was performed using 32

P-labeled 281

probe Y1 that contained the upstream and N-terminal regions of srrY (Fig. 5A) (see Fig. S5 in 282

Supplemental Material for SrrA preparation). Addition of SrrA to the binding reaction mixture 283

gave a shifted band in a concentration-dependent manner (Fig. 5B, lanes 2 to 5). Competition 284

experiments showed that unlabeled probe Y1 behaved as an effective competitor (Fig. 5C, lane 285

3), whereas unlabeled probe Y2 containing the srrY-coding region (Fig. 5A) did not (Fig. 5C, 286

lane 4), indicating a high binding specificity of SrrA to the upstream region of srrY. Moreover, 287

the shifted band disappeared by addition of the culture extract of the parent strain 51252 but not 288

of the srrX mutant KY85 (Fig. 5D, lanes 3 and 4), which indicates that SrrA was dissociated 289

from the DNA by binding of SRB (S. rochei γ-butyrolactone). These results together with gene 290

expression in the mutants (Fig. 4) suggest that the upstream region of srrY is a target of the 291

repressor SrrA and that the srrY transcription is controlled by SrrA together with SRB. 292

SrrA-binding site is located upstream of srrY. DNase I footprinting was carried out to 293

identify an SrrA-binding site(s) in the upstream region of srrY. As shown in Fig. 6, positions -59 294

to -32 of the non-template strand and positions -61 to -35 of the template strand were protected 295

by SrrA. The protected region was slightly overlapped with the -35 sequence of the srrY 296

ACCE

PTED

on April 1, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

10

promoter (Fig. 3A) and contained a 26-bp palindromic sequence (Fig. 3B), which is similar to 297

the binding sequences of typical γ-butyrolactone receptors (4, 16, 22, 23, 32). Similar 298

palindromic sequences were also found in the upstream regions of srrB and srrW (Fig. 3B), 299

which suggests their possible function as a target for SrrA binding (see Discussion). In the latter 300

two cases, the palindromic sequences are completely overlapped with the putative promoter 301

regions. 302

Trp119 of SrrA is involved in SRB binding. The tryptophan residue at the 119 position of 303

ArpA is necessary for A-factor binding and this residue is conserved in all of the γ−butyrolactone 304

receptor proteins including SrrA. To analyze the function of Trp119 of SrrA, we constructed a 305

point mutant of srrA (srrAW119A

), in which the Trp residue was replaced by Ala. The srrAW119A

306

mutant KU82 failed to produce either antibiotic (Fig. 1A) or express srrY (Fig. 4), indicating that 307

SrrAW119A

represses srrY expression even in the presence of SRB. To further characterize this in 308

vitro, binding of SrrAW119A

was analyzed by gel shift assay. SrrAW119A

was bound to the labeled 309

probe Y1 at a concentration-dependent manner (Fig. 5B, lanes 6 to 9). Competition experiments 310

showed that unlabeled probe Y1 behaved as an effective competitor (Fig. 5C, lane 6), whereas 311

unlabeled probe Y2 did not (Fig. 5C, lane 7). These results were identical to those obtained from 312

the intact SrrA, suggesting that the Trp119Ala mutation did not affect on the DNA binding 313

affinity or specificity of SrrA. In contrast, SrrAW119A

was kept bound to the DNA even in the 314

presence of SRB (Fig. 5D, lane 6), indicating that Trp119 of SrrA is crucial for binding of SRB. 315

srrY is a target of SrrA essential for antibiotic production. Concerning the antibiotic 316

regulatory cascade in S. rochei, a question if SrrA controls other genes in addition to srrY was 317

raised. To answer this question, we expressed srrY under a foreign promoter in the srrX (KY85) 318

and srrAW119A

(KU82) mutants. If SrrA regulates additional genes essential for antibiotic 319

production, expression of srrY under a constitutive promoter would not be enough to restore 320

antibiotic production. When srrY was expressed from a thiostrepton-inducible tipA promoter, the 321

production of LC and LM occurred in both mutants (Fig. 1B). These results suggested that srrY 322

may be a sole gene that is repressed by SrrA and also is indispensable for antibiotic production. 323

324

325

DISCUSSION 326

327

Extensive transcriptional analysis in this study demonstrated that the srrX-srrA 328

γ-butyrolactone-receptor system in S. rochei regulates LC and LM production through an SARP 329

gene (srrY)-dependent pathway. The srrY gene was expressed in a growth-dependent manner, 330

slightly preceding antibiotic production (Fig. 2). The srrY expression was not observed in the 331

ACCE

PTED

on April 1, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

11

srrX mutant and restored in the srrX-srrA double mutant (Fig. 4), which suggested that the 332

transcriptional repression of srrY by SrrA is relieved by binding of SRB synthesized by SrrX. 333

Consistent with this, SrrA was bound specifically to the upstream region of srrY and released by 334

addition of the SRB fraction (Fig. 5). Furthermore, the expression of srrY was always repressed 335

in the SrrAW119A

mutant, and the binding of SrrAW119A

occurred even in the presence of SRB (Fig. 336

4 and 5). All of these results confirmed the signaling pathway from srrX through srrA to srrY, 337

where SrrA functions as a receptor/repressor of SRB and srrY. The conserved Trp-119 residue in 338

SrrA may form a ligand-binding pocket for a γ−butyrolactone molecule, as shown by X-ray 339

crystallography for CprB, an ArpA homologue in S. coelicolor A3(2) (21). Thus, SrrAW119A

lost 340

an SRB binding activity but still kept a DNA-binding activity (Fig. 5), as observed for 341

ArpAW119A

in S. griseus (27). 342

γ−Butyrolactone receptor proteins are bound to a palindromic sequence within the promoter 343

regions of the target genes and repress their transcription (4, 16, 22, 23, 32). The binding site of 344

SrrA overlaps with the -35 sequence of the srrY promoter and contains a 26-bp palindromic 345

sequence with a high similarity to the binding sequences of other γ−butyrolactone receptors (Fig. 346

3B). Therefore, the binding of SrrA to this site may play a critical role in repressing transcription 347

of srrY possibly by preventing the binding of RNA polymerase. 348

In Streptomyces fradiae, the γ−butyrolactone receptor TylP repressed the expression of the 349

SARP gene tylS (4, 25), which in turn resulted in the repression of tylR that encodes a pathway 350

specific activator in tylosin biosynthesis (26). In Streptomyces pristinaespiralis, the receptor 351

SpbR was bound to the promoter of the SARP gene papR1 and regulated pristinamycin synthesis 352

(5). The receptor ScbR in S. coelicolor A3(2) was directly bound to two upstream regions of 353

kasO, a pathway specific SARP gene for a cryptic type I polyketide gene cluster, and repressed 354

its transcription (32). Thus, accumulated data together with the results of this study suggest that 355

the SARP family regulatory genes are often targets of γ-butyrolactone receptors, except for the 356

case of A-factor, whose target is adpA, an araC family transcriptional regulator gene. 357

Introduction of an intact srrY gene under a control of a foreign promoter into the srrX or 358

srrAW119

mutant restored antibiotic production (Fig. 1B), indicating that the derepression of srrY 359

is sufficient for restoration. However, this result did not exclude a possibility that SrrA might 360

repress other gene(s) (such as srrB and/or srrW) dispensable for antibiotic production. Both srrB 361

and srrW contain a consensus palindromic sequence at their upstream regions (Fig. 3B). These 362

regions were actually isolated by nitrocellulose filter binding assay using the SrrA protein, 363

nevertheless the promoter region of srrY has not been obtained until now (unpublished results). 364

Furthermore, disruption of srrB caused an increased production of LC and LM (1), whereas 365

disruption of srrW did not show any effects (Fig. 1A). Our preliminary data showed that SrrB 366

ACCE

PTED

on April 1, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

12

binds to the upstream region of srrY and negatively regulates its expression (unpublished results). 367

These results suggest a possibility that SrrA may also positively regulate srrY through the 368

transcriptional repression of srrB, which could explain why the srrA mutation did not 369

significantly affect on srrY expression or antibiotic production (Fig. 4, reference 1). 370

Different from the srrY mutant, which did not produce LC or LM, the srrZ mutant produced 371

only LC (Fig. 1A), suggesting its lower location than srrY in the regulatory cascade. Based on all 372

the results hitherto obtained including preliminary ones, we could depict a possible regulatory 373

cascade leading to LC and LM production in S. rochei (Fig. 7). In this scheme, the signaling 374

pathway from srrX through srrA to srrY has been confirmed by extensive transcriptional analysis. 375

Similar analysis around srrB and under srrY is necessary to confirm this scheme and reveal the 376

entire picture of the complex regulatory cascade in S. rochei. 377

378

379

ACKNOWLEDGEMENTS 380

381

We thank M. Bibb, John Innes Centre, for plasmid pIJ8600, and K. Inada, Hiroshima 382

University, for his help in transcriptional experiments. This work was supported by Grant-in-Aid 383

for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology 384

of Japan, as well as by that from Japan Society for the Promotion of Science. 385

ACCE

PTED

on April 1, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

13

REFERENCES 386

387

1. Arakawa, K., S. Mochizuki, K. Yamada, T. Noma, and H. Kinashi. 2007. γ-Butyrolactone 388

autoregulator-receptor system involved in lankacidin and lankamycin production and 389

morphological differentiation in Streptomyces rochei. Microbiology, 153:1817-1827. 390

2. Arias, P., M. A. Fernádez-Moreno, and F. Malpartida. 1999. Characterization of the 391

pathway-specific positive transcriptional regulator for actinorhodin biosynthesis in 392

Streptomyces coelicolor A3(2) as a DNA-binding protein. J. Bacteriol. 181:6958-6968. 393

3. Bibb, M. J. 2005. Regulation of secondary metabolism in streptomycetes. Curr. Opin. 394

Microbiol. 8: 208-215. 395

4. Bignell, D. R. D., N. Bate, E. Cundliffe. 2007. Regulation of tylosin production: role of a 396

TylP-interactive ligand. Mol. Microbiol. 63:838-847. 397

5. Folcher, M., H. Gaillard, L. T. Nguyen, K. T. Nguyen, P. Lacroix, N. Bamas-Jacques, M. 398

Rinkel, and C. J. Thompson. 2001. Pleiotropic functions of a Streptomyces pristinaespiralis 399

autoregulator receptor in development, antibiotic biosynthesis, and expression of a superoxide 400

dismutase. J. Biol. Chem. 276: 44297-44306. 401

6. Hara, O., and T. Beppu. 1982. Mutants blocked in streptomycin production in Streptomyces 402

griseus - the role of A-factor. J. Antibiot. 35: 349-358. 403

7. Horinouchi S, Kumada Y, Beppu T. 1984. Unstable genetic determinant of A-factor 404

biosynthesis in streptomycin-producing organisms: cloning and characterization. J. Bacteriol. 405

1582: 481-487. 406

8. Ishikawa, J., Y. Niino, and K. Hotta. 1996. Construction of pRES18 and pRES19, 407

Streptomyces-Escherichia coli shuttle vectors carrying multiple cloning sites. FEMS 408

Microbiol. Lett. 145:113-116. 409

9. Kang, J. G., M. Y. Hahn, A. Ishihama, and J. H. Roe. 1997. Identification of sigma factors 410

for growth phase-related promoter selectivity of RNA polymerase from Streptomyces 411

coelicolor A3(2). Nucleic Acids Res. 25:2566-2573. 412

10. Kato, J., N. Funa, H. Watanabe, Y. Ohnishi, and S. Horinouchi. 2007. Biosynthesis of 413

γ-butyrolactone autoregulators that switch on secondary metabolism and morphological 414

development in Streotomyces. Proc. Natl. Aca. Sci. 104:2378-2383. 415

11. Kawachi, R., T. Akashi, Y. Kamitani, A. Sy, U. Wangchaisoonthorn, T. Nihira, and Y. 416

Yamada. 2000. Identification of an AfsA homologue (BarX) from Streptomyces virginiae as a 417

pleiotropic regulator controlling autoregulator biosynthesis, virginiamycin biosynthesis and 418

virginiamycin M1 resistance. Mol. Microbiol. 36:302-313. 419

12. Khokhlov, A. S., L. N. Anisova, I. I. Tovarova, E. M. Kleiner, I. V. Kovalenko, O. I. 420

ACCE

PTED

on April 1, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

14

Krasilnikova, E. Y. Kornitskaya, and S. A. Pliner. 1973. Effect of A-factor on the growth of 421

asporogenous mutants of Streptomyces griseus, not producing this factor. Z. Allg. Mikrobiol. 422

13:647-655. 423

13. Kieser, T., M. J. Bibb, M. J. Buttner, K. F. Chater, and D. A. Hopwood. 2000. Practical 424

Streptomyces Genetics. Norwich: John Innes Foundation. 425

14. Kinashi, H., E. Mori, A. Hatani, and O. Nimi. 1994. Isolation and characterization of large 426

linear plasmids from lankacidin-producing Streptomyces species. J. Antibiot. 47:1447-1455. 427

15. Kinashi, H., S. Fujii, A. Hatani, T. Kurokawa, and H. Shinkawa. 1998. Physical mapping 428

of the linear plasmid pSLA2-L and localization of the eryAI and actI homologs. Biosci. 429

Biotech. Biochem. 62:1892-1897. 430

16. Kinoshita, H., T. Tsuji, H. Ipposhi, T. Nihira, and Y. Yamada. 1999. Characterization of 431

binding sequences for butyrolactone autoregulator receptors in streptomycetes. J. Bacteriol. 432

181:5075-5080. 433

17. Kitani, S., Y. Yamada, and T. Nihira. 2001. Gene replacement analysis of the butyrolactone 434

autoregulator receptor (FarA) reveals that FarA acts as a novel regulator in secondary 435

metabolism of Streptomyces lavendulae FRI-5. J. Bacteriol. 183:4357-4363. 436

18. Madduri, K., and C. R. Hutchinson. 1995. Functional characterization and transcriptional 437

analysis of the dnrR1 locus, which controls daunorubicin biosynthesis in Streptomyces 438

peucetius. J. Bacteriol. 177:1208-1215. 439

19. Mizuno, T., and I. Tanaka. 1997. Structure of the DNA-binding domain of the OmpR 440

family of response regulators. Mol. Microbiol. 24:665-667. 441

20. Mochizuki, S., K. Hiratsu, M. Suwa, T. Ishii, F. Sugino, K. Yamada, and H. Kinashi. 442

2003. The large linear plasmid pSLA2-L of Streptomyces rochei has an unusually condensed 443

gene organization for secondary metabolism. Mol. Microbiol. 48:1501-1510. 444

21. Natsume, R., Y. Ohnishi, T. Senda, and S. Horinouchi. 2004. Crystal structure of a 445

γ-butyrolactone autoregulator receptor protein in Streptomyces coelicolor A3(2). J. Mol. Biol. 446

336:409-419. 447

22. Ohnishi, Y., S. Kameyama, H. Onaka, and S. Horinouchi. 1999. The A-factor regulatory 448

cascade leading to streptomycin production in Streptomyces griseus: identification of a target 449

gene of the A-factor receptor. Mol. Microbiol. 34:102-111. 450

23. Onaka, H., and S. Horinouchi. 1997. DNA-binding activity of the A-factor receptor ptotein 451

and its recognition DNA sequences. Mol. Microbiol. 24:991-1000. 452

24. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular Cloning: A Laboratory 453

Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. 454

25. Stratigopoulos, G., A. R. Gandecha, and E. Cundliffe. 2002. Regulation of tylosin 455

ACCE

PTED

on April 1, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

15

production and morphological differentiation in Streptomyces fradiae by TylP, a deduced 456

γ-butyrolactone receptor. Mol. Microbiol. 45:735-744. 457

26. Stratigopoulos, G., N. Bate, N., and E. Cundliffe. 2004. Positive control of tylosin 458

biosynthesis: pivotal role of TylR. Mol. Microbiol. 54:1326-1334. 459

27. Sugiyama, M., H. Onaka, T. Nakagawa, and S. Horinouchi. 1998. Site-directed 460

mutagenesis of the A-factor receptor protein: Val-41 important for DNA-binding and Trp-119 461

important for ligand-binding. Gene 222:133-144. 462

28. Sun, J., G. H. Kelemen, J. M. Fernandez-Abalos, M. J. Bibb. 1999. Green fluorescent 463

protein as a reporter for spatial and temporal gene expression in Streptomyces coelicolor A3(2). 464

Microbiology 145:2221-2227. 465

29. Suwa, M., H. Sugino, A. Sasaoka, E. Mori, S. Fujii, H. Shinkawa, O. Nimi, and H. 466

Kinashi. 2000. Identification of two polyketide synthase gene clusters on the linear plasmid 467

pSLA2-L in Streptomyces rochei. Gene 246:123-131. 468

30. Takano, E. 2006. γ-Butyrolactones: Streptomyces signaling molecules regulating antibiotic 469

production and differentiation. Curr Opin Microbiol 9:287-294. 470

31. Takano, E., R. Chakaraburtty, T. Nihira, Y. Yamada, and M. J. Bibb. 2001. A complex 471

role for the γ-butyrolactone SCB1 in regulating antibiotic production in Streptomyces 472

coelicolor A3(2). Mol. Microbiol. 41:1015-1028. 473

32. Takano, E., H. Kinoshita, V. Mersinias, G. Bucca, G. Hotchkiss, T. Nihira, C. P. Smith, 474

M. Bibb, W. Wohlleben, and K. Chater. 2005. A bacterial hormone (the SCB1) directly 475

controls the expression of a pathway-specific regulatory gene in the cryptic type I polyketide 476

biosynthetic gene cluster of Streptomyces coelicolor. Mol. Microbiol. 56:465-479. 477

33. Wietzorrek, A., and M. Bibb. 1997. A novel family of proteins that regulates antibiotic 478

production in streptomycetes appears to contain an OmpR-like DNA-binding fold. Mol. 479

Microbiol. 25:1181-1184. 480

34. Yamamoto, S., and K. Kutsukake. 2006. FliT acts as an anti-FlhD2C2 factor in the 481

transcriptional control of the flagellar regulon in Salmonella enterica serovar Typhimurium. J. 482

Bacteriol. 188:6703-6708.483

ACCE

PTED

on April 1, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

16

FIGURE LEGENDS 484

485

FIG. 1. (A) Effects of regulatory mutations on antibiotic production. The culture extracts of S. 486

rochei strains were assayed by bioaoutography. Strains used were 51252 (parent), KY75 (srrY 487

mutant), KY71 (srrZ mutant), TN01 (srrW mutant), and KU82 (srrAW119A

mutant). (B) 488

Restoration of antibiotic production in the regulatory mutants by introduction of an intact srrY 489

gene. Three regulatory mutants, KY75, KY85 (srrX mutant) and KU82, carrying pKAR3049 490

(intact srrY gene) or pIJ8600 (control), were analyzed. The culture extracts were separated by 491

TLC and detected by baking with vanillin-H2SO4. 492

493

FIG. 2. Growth-dependent antibiotic production and srrY expression in S. rochei 51252. (A) 494

Growth curve of strain 51252. OD600 values were obtained from triplicate cultures. (B) 495

Bioautography of the culture extracts. (C) High-resolution S1 nuclease protection analysis of 496

srrY mRNA (upper panel). Lanes G, A, T, and C are sequencing ladders derived from the same 497

labeled primer used for probe preparation. The transcriptional start site (TSS) of srrY, was 498

indicated. Lane P contains only the probe. The lower panel shows the ethidium bromide-stained 499

total RNA pattern on 1% agarose gel. 500

501

FIG. 3. (A) Characterization of the upstream region of srrY. The srrY promoter (-35 and -10), 502

transcriptional start site (TSS), Shine-Dalgarno sequence (SD) and initiation codon are boxed. 503

The SrrA-binding site deduced from Fig. 6 is indicated by bold letters. (B) Comparison of the 504

binding sequences of SrrA and typical γ-butyrolactone receptor proteins. Possible SrrA-binding 505

sites upstream of srrB and srrW were deduced from sequence data. Identical bases to the first 506

SrrA-binding sequence are indicated by bold letters. Complementary bases in the top three 507

palindromes are asterisked. The center of palindorome is shown by a vertical dotted line. 508

509

FIG. 4. Effects of regulatory mutations on srrY expression. srrY mRNAs from various strains 510

were analyzed by low-resolution S1 nuclease protection assay (upper panel). The lower panel 511

indicates the ethidium bromide-stained total RNA pattern on 1% agarose gel. Strains used were 512

51252 (parent), KY85 (srrX mutant), KA12 (srrA mutant), KA21 (srrX-srrA double mutant), and 513

KU82 (srrAW119A

mutant). 514

515

FIG. 5. Gel shift assay of the binding of SrrA and SrrAW119A

. (A) Location of the two probes Y1 516

and Y2. The transcriptional start site of srrY is numbered +1. (B) Concentration-dependent 517

binding of SrrA or SrrAW119A

to the upstream region of srrY. 1 nM labeled probe Y1 was mixed 518

ACCE

PTED

on April 1, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

17

with various concentrations of SrrA (lanes 2 to 5) or SrrAW119A

(lanes 6 to 9). Positions of bound 519

(B) and free (F) DNAs are shown by arrows on the right. (C) Specific binding of SrrA to the 520

upstream region of srrY. Each reaction mixture contained 1 nM labeled probe Y1 and 500 nM 521

protein (lanes 2 to 7). Then, 200 nM unlabeled probe Y1 (lanes 3 and 6) or unlabeled probe Y2 522

(lanes 4 and 7) was added. (D) Effect of the SRB fraction on the binding of SrrA or SrrAW119A

. 523

To the same reaction mixture used in (B), the culture extract of strain 51252 (lanes 3 and 6) or 524

KY85 (lanes 4 and 7) was added. 525

526

FIG. 6. DNase I footprinting analysis of SrrA-binding site. Probe Y1 was end-labeled at either 527

the non-template (A) or the template (B) strand. Each reaction mixture contained 2 nM labeled 528

DNA and 0-2 µM SrrA. Sequencing ladders were generated by Maxam-Gilbert sequencing of 529

the labeled probe Y1 (A) or cycle sequencing using the labeled primer for probe preparation (B). 530

The sequences protected from DNase I digestion were indicated on the right. 531

532

FIG. 7. Possible γ-butyrolactone-dependent regulatory cascade leading to LC and LM production 533

in S. rochei. The signaling pathway from srrX via srrA to srrY (solid lines) has been confirmed 534

by extensive transcriptional analysis in this study. Additional pathways (dotted lines) were 535

suggested based on various data including unpublished ones. 536

activation; inhibition. 537

538

539

540 ACCE

PTED

on April 1, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

18

TABLE 1. Streptomyces rochei strains used in this study 541

542

Antibiotic production Strains Description

LC LM

Source/

references

51252 pSLA2-L+, pSLA2-M

-, pSLA2-S

- + + 14

KY85 51252 srrX::kan – – 20

KA12 51252 ∆srrA + + 1

KA21 KY85 ∆srrA + + 1

KU82 51252 srrAW119A

– – This study

KY75 51252 srrY::kan – – 20, this

study

KA61 51252 ∆srrY – – This study

KY71 51252 srrZ::kan + – This study

TN01 51252 srrW::kan + + This study

543

ACCE

PTED

on April 1, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

19

TABLE 2. Plasmids used in this study 544

545

Plasmids Description Source/reference

pUC4-KIXX pUC derivative vector containing kan

cassette, Aprr

Pharmacia

pUC19 Cloning vector, Ampr

pKY75-1 pUC19 1.8-kb BamHI fragment

containing srrY

This study

pKY75-2 pKY75-1 srrY::kan This study

pKAR4002 pUC19 9.2-kb PstI fragment containing

srrY

This study

pKAR3012 pUC19 srrA 1

pKAU8202 pUC19 srrAW119A

This study

pRES18 E. coli-Streptomyces shuttle vector,

Ampr, Tsr

r

8

pKY75-3 pRES18 srrY::kan This study

pKAR3055 pRES18 1.5-kb EcoRI-PstI fragment

from pKAR3054

This study

pKY71-1 pRES18 2.2-kb SphI fragment

containing srrZ

This study

pKY71-2 pKY71-1 srrZ::kan This study

pTN03 pRES18 srrW::kan This study

pKAU8203 pRES18 srrAW119A

This study

Litmus28i Cloning vector, Ampr New England Biolabs

pKAR3023 Litmus28i 1·5-kb AgeI fragment

containing srrA from pKAR3012

This study

pBluescript SK-plus Cloning vector, Ampr Stratagene

pKAR3001 pBluescript SK-plus 1.7-kb Eco47III

fragment containing srrW

This study

pRSET-B Cloning vector, Ampr Invitrogen

pKAR3053 pRSET-B 1.8-kb EcoRI-PstI fragment

from pKY75-1

This study

pKAR3054 pKAR3053 267-bp PvuII fragment

deleted in srrY

This study

pTN01 pRSET-B 1.7-kb EcoRI-BamHI

fragment containing srrW from

pKAR3001

This study

pTN02 pTN01 srrW::kan This study

pAlterR-1 Cloning vector for site-directed

mutagenesis, Tetr

Promega

pKAR3025 pAlterR-1 KpnI and HindIII fragment of

srrA from pKAR3023

This study

pKAU-8201 pAlterR-1 srrA

W119A This study

pET32b(+) T7 expression vector for His10 tagging,

Ampr

Novagen

pKAR3035 pET32b(+) srrA This study

pET-Amt pET32b(+) srrAW119A

This study

pIJ8600 Integrative E. coli-Streptomyces shuttle

vector for PtipA expression, Aprr, Tsr

r

28

pKAR3049 pIJ8600 srrY This study

ACCE

PTED

on April 1, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

20

TABLE 3. Primers used in this study 546

547

Primer name Sequence (5’ to 3’)

Ampicillin Repair Oligonucleotide GTTGCCATTGCTGCAGGCATCGTGGTG

KAR-75OE01 GCGCATATGGACATCGACGTACTGGGCAC

KAR-75OE03 CCAGCGGATCCTCGCGCAGC

SRRYf2 GGCGTCGTCTGCCTGCTGCC

SRRYr2 ATATCCGCCGGGGGCGGTGG

SRRYr4 GCGCCCGCGGCGTCACCGAGA

KAR8201OE CTAGGATCCGCATATGGCACAGCAGGAAC

KAR8201SDM GCCTTCCCCACCGCGATCGCCTTCTCG

KAR8202OE GAAGAATTCGGCGCGCCGCCCATGAC

548

ACCE

PTED

on April 1, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

ACCE

PTED

on April 1, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

ACCE

PTED

on April 1, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

ACCE

PTED

on April 1, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

ACCE

PTED

on April 1, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

ACCE

PTED on April 1, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

ACCE

PTED

on April 1, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

ACCE

PTED

on April 1, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

/rrdata/pdfconv/queue01/tmp/tifFig1.tif- 1/rrdata/pdfconv/queue01/tmp/tifFig2.tif- 1/rrdata/pdfconv/queue01/tmp/tifFig3.tif- 1/rrdata/pdfconv/queue01/tmp/tifFig4.tif- 1/rrdata/pdfconv/queue01/tmp/tifFig5.tif- 1/rrdata/pdfconv/queue01/tmp/tifFig6.tif- 1/rrdata/pdfconv/queue01/tmp/tifFig7.tif- 1