Upload
others
View
1
Download
0
Embed Size (px)
Citation preview
1
γγγγ-Butyrolactone-Dependent Expression of the SARP Gene srrY Plays a Central Role in the 1
Regulatory Cascade Leading to Lankacidin and Lankamycin Production in Streptomyces 2
rochei 3
4
SHOUJI YAMAMOTO, YUXI HE, KENJI ARAKAWA, AND HARUYASU KINASHI* 5
6
Department of Molecular Biotechnology, Graduate School of Advanced Sciences of Matter, 7
Hiroshima University, Higashi-Hiroshima, Japan 8
9
10
11
12
* Corresponding author. Mailing address: Department of Molecular Biotechnology, Graduate 13
School of Advanced Sciences of Matter, Hiroshima University, 1-3-1 Kagamiyama, 14
Higashi-Hiroshima 739-8530, Japan. Phone: 81-82-424-7869. Fax: 81-82-424-7869. E-mail: 15
ACCE
PTED
Copyright © 2007, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.J. Bacteriol. doi:10.1128/JB.01383-07 JB Accepts, published online ahead of print on 14 December 2007
on April 1, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
http://jb.asm.org/
2
ABSTRACT 17
18
Our previous studies revealed that the srrX and srrA genes coded on the large linear plasmid 19
pSLA2-L constitute a γ-butyrolactone-receptor system in Streptomyces rochei. Extensive 20
transcriptional analysis has now showed that the SARP gene srrY, which is also coded on 21
pSLA2-L, is a target of the receptor/repressor SrrA and plays a central role in lankacidin and 22
lankamycin production. The srrY gene was expressed in a growth-dependent manner, slightly 23
preceding antibiotic production. Expression of srrY was undetectable in the srrX mutant, but was 24
restored in the srrX-srrA double mutant. In addition, SrrA was bound specifically to the promoter 25
region of srrY and this binding was prevented by addition of the S. rochei γ-butyrolactone (SRB) 26
fraction, while the mutant receptor SrrAW119A
was kept bound even in the presence of SRB. 27
Furthermore, introduction of an intact srrY gene under a control of a foreign promoter into the 28
srrX or srrAW119
mutant restored antibiotic production. All of these results confirmed the 29
signaling pathway from srrX through srrA to srrY, leading to lankacidin and lankamycin 30
production. 31
32
33
INTRODUCTION 34
35
Streptomycetes produce many secondary metabolites including antibiotics and also undergo 36
a complex process of morphological development. To regulate these complex cellular processes, 37
the bacteria have evolved an intricate hierarchic regulatory system. γ-Butyrolactone, a diffusible 38
signaling molecule, often governs antibiotic production and/or morphogenesis in streptomycetes 39
(3, 30). Pioneering studies to understand the γ-butyrolactone signaling system have been carried 40
out in Streptomyces griseus, a streptomycin producer. In this bacterium, the γ-butyrolactone 41
known as ‘A-factor’ (2-isocapryloyl-3R-hydroxymethyl-γ-butyrolactone) (6, 12) is synthesized 42
by the afsA gene product (7, 10). In the absence of A-factor, the A-factor receptor protein, ArpA 43
(23), binds to the promoter region of the global transcriptional activator gene, adpA, and 44
represses its transcription (22). When A-factor reaches a critical concentration, it binds to ArpA, 45
dissociates ArpA from the promoter of adpA, and thereby relieves its repression, which in turn 46
triggers streptomycin production and morphological development. ArpA belongs to the TetR 47
family of receptor proteins and contains a helix-turn-helix motif in its N-terminal region and a 48
tryptophan residue at the 119 position. The former has a DNA binding activity, while the latter is 49
necessary for A-factor binding (27). The ArpA-binding site was found within the -35 and -10 50
region of the adpA promoter and contained a 22 bp-palindromic sequence, suggesting that ArpA 51
ACCE
PTED
on April 1, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
http://jb.asm.org/
3
represses the adpA transcription by preventing the binding of RNA polymerase (22, 23). Similar 52
regulatory systems composing of a γ-butyrolactone and its cognate receptor protein have been 53
reported in other streptomycetes; for examples, the barX-barA system for virginiamycin 54
production in Streptomyces virginiae (11), farX-farA for showdomycin and minimycin in 55
Streptomyces lavendulae (17), scbA-scbR for actinorhodin and undecylprodigiosin in 56
Streptomyces coelicolor A3(2) (31). However, their effects on antibiotic production and 57
morphogenesis are different from species to species. 58
The γ-butyrolactone-receptor systems regulate many regulatory genes including the SARP 59
(Streptomyces antibiotic regulatory proteins) family genes (33). Members of this family are 60
characterized by the presence of an OmpR-like DNA-binding domain (19) and regulate 61
biosynthesis of many antibiotics. They are exemplified by actII-orf4 for actinorhodin (2), dnrI 62
for daunorubicin (18), papR1 for pristinamycin (5), tylS for tylosin (4, 25) and kaoO for a 63
hypothetical type I polyketide (32). 64
Streptomyces rochei strain 7434AN4 has three linear plasmids (pSLA2-L, -M, and -S) and 65
produces two different polyketide antibiotics, lankacidin (LC) and lankamycin (LM) (14, 15). 66
We have shown that their biosynthetic gene clusters, lkc (orf4-orf18) for lankacidin and lkm 67
(orf24-orf53) for lankamycin are located on the largest plasmid pSLA2-L (210,614 bp) (20, 29). 68
This plasmid contains two additional biosynthetic gene clusters for a hypothetical type-II 69
polyketide (roc, orf62-orf70) and carotenoid (crt, orf104-orf110). Furthermore, numerous 70
regulatory genes were found on pSLA2-L, including homologues of the A-factor regulatory 71
genes in S. griseus. They are a γ-butyrolactone biosynthetic gene srrX (orf85) similar to afsA, six 72
tetR family receptor genes, srrA (orf82), srrB (orf79), srrC (orf74), orf92, orf99 and orf126, 73
three SARP genes, srrY (orf75), srrW (orf55) and srrZ (orf71), and two transcriptional activator 74
genes, orf116 and orf3, similar to adpA and strR, respectively. Thus, these genes might form a 75
more complex regulatory cascade than those found in other streptomycetes. 76
Our previous studies revealed that srrX and srrA constitute a γ-butyrolactone-receptor system 77
in S. rochei (1, 20). srrX had a positive effect on antibiotic production and a negative effect on 78
spore formation, whereas srrA reversed both effects of srrX. Exogenous addition of the culture 79
extract of the parent strain 51252 to the srrX mutant restored the production of both LC and LM, 80
suggesting that the γ-butyrolactone was enough for restoration without the SrrX protein. Until 81
now, the S. rochei γ-butyrolactone, namely SRB, has not been isolated. In addition to srrA, the 82
srrB gene had a negative effect on LC and LM production, whereas srrC had a positive effect on 83
spore formation. Furthermore, the SARP gene srrY showed positive effects on both antibiotic 84
production and sporulation (we will revise the latter effect; see later). Thus, the srrX-srrA 85
γ-butyrolactone-receptor system may regulate antibiotic biosynthesis and sporulation together 86
ACCE
PTED
on April 1, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
http://jb.asm.org/
4
with several regulatory genes including srrB, srrC and srrY. Therefore, identification of 87
regulators functioning downstream of the srrX-srrA system is of quite interest and may facilitate 88
understanding of the entire picture of the regulatory cascade in S. rochei. 89
Extensive transcriptional analysis in this study has revealed that srrY is a primary target of 90
the receptor/repressor SrrA and the signaling pathway from srrX through srrA to srrY plays a 91
central role in the regulation of antibiotic production. Based on all the results including 92
preliminary ones, we propose at the end a possible regulatory cascade leading to LC and LM 93
production in S. rochei. 94
95
96
MATERIALS AND METHODS 97
98
Bacterial strains, plasmids, media and DNA manipulation. S. rochei strain 51252 carrying 99
only pSLA2-L (14) was used as the parent strain, and mutant strains were constructed as 100
described below and listed in Table 1. Plasmids used in this study are listed in Tables 2, and their 101
construction is described below. S. rochei strains were grown in YM medium (0.4% yeast extract, 102
1.0% malt extract, and 0.4% glucose, pH 7.3) or Tryptic Soy Broth (TSB) medium, and E. coli 103
strains were grown in Luria-Bertani (LB) medium. Antibiotics were used at the following 104
concentrations: ampicillin, 100 µg/ml; apramycin, 25 µg/ml; chloramphenicol, 10 µg/ml; 105
kanamycin, 10 µg/ml; thiostrepton, 10 µg/ml. DNA manipulations for Streptomyces (13) and E. 106
coli (24) were carried out according to standard procedures. PCR amplification was carried out 107
with a 2720 Thermal Cycler (Applied Biosystems) using Thermococcus kodakaraensis DNA 108
polymerase (KOD Plus) (Toyobo). Nucleotide sequences of DNA primers are summarized in 109
Table 3. 110
Targeted mutagenesis. srrY (orf75) disruption. A 1.8-kb BamHI fragment containing the srrY 111
gene was cloned into pUC19 (pKY75-1), and a 1.2-kb SmaI fragment of pUC4-KIXX 112
(Pharmacia) bearing a kanamycin resistance cassette was inserted into the NruI site in the center 113
of srrY to obtain pKY75-2. The vector part of this plasmid was replaced by pRES18, an E. 114
coli-Streptomyces shuttle vector (8), to give a targeting plasmid, pKY75-3 (see Fig. S1 in 115
Supplemental Material). 116
In-frame deletion of srrY. A 1.8-kb EcoRI-PstI fragment of pKY75-1 was cloned into 117
pRSET-B (Invitrogen) to obtain pKAR3053. A 267-bp PvuII fragment of pKAR3053 118
corresponding to the central part of srrY was eliminated to give pKAR3054, the vector part of 119
which was replaced by pRES18 to give a targeting plasmid pKAR3055 (Fig. S2). 120
srrZ (orf71) disruption. A 2.2-kb SphI fragment containing the srrZ gene was cloned into 121
ACCE
PTED
on April 1, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
http://jb.asm.org/
5
pRES18 to obtain pKY71-1. A 0.4-kb BglII fragment at the middle of srrZ in pKY71-1 was 122
replaced by a 1.6-kb BamHI fragment of pUC4-KIXX to give a targeting plasmid, pKY71-2 (Fig. 123
S3). 124
srrW (orf55) disruption. A 1.7-kb Eco47III fragment containing the srrW gene was cloned into 125
the SmaI site of pBluescript SK-plus to obtain pKAR3001. Its 1.7-kb EcoRI-BamHI fragment 126
was recloned into pRSET-B (pTN01), and then a 1.2-kb SmaI fragment of pUC4-KIXX was 127
inserted into the PvuII site at middle of srrW to give pTN02. The vector part of pTN02 was 128
replaced by pRES18 to obtain a targeting plasmid, pTN03 (Fig. S4). 129
srrAW119A
point mutation. A 1·5-kb AgeI fragment of pKAR3012, which contained the 130
C-terminal region of srrA, was inserted into the corresponding site of Litmus 28i (New England 131
Biolabs) to obtain pKAR3023. This plasmid was digested with KpnI and HindIII, and the vector 132
part was replaced by pAlterR-1 (Promega) to obtain pKAR3025. Site-directed mutagenesis was 133
carried out by the Altered sitesR
II in vitro mutagenesis system (Promega) using two 134
oligonucleotides, KAR8201SDM and the Ampicillin Repair Oligonucleotide, to obtain 135
pKAU-8201. This plasmid carried a gene encoding a mutated SrrA protein (SrrAW119A
) with 136
alanine at the 119 position in place of tryptophan. A 1·5-kb AgeI fragment of pKAU-8201 was 137
replaced for that of pKAR3012 to obtain pKAU-8202. The vector part of pKAU-8202 was 138
replaced by pRES18 to obtain a targeting plasmid, pKAU-8203 (Fig. S5). 139
Targeted mutagenesis was performed as follows. The parent strain 51252 was transformed 140
with each of the targeting plasmids constructed above, and thiostrepton-resistant transformants 141
were obtained. Among these transformants, single-crossovered (plasmid-integrated) strains were 142
selected by Southern hybridization analysis. Selected colonies were serially grown in liquid 143
YEME medium containing kanamycin to facilitate a second crossover. Finally, 144
kanamycin-resistant and thiostrepton-sensitive colonies were selected as double-crossovered 145
mutants. When the targeting plasmid did not contain a kanamycin cassette, the second crossover 146
was induced by serially culturing in YEME medium without kanamycin. 147
Extraction and detection of antibiotics. S. rochei strains were grown in 100 ml of YM 148
liquid medium in Sakaguchi flasks at 28 °C for various periods. The broth filtrate was extracted 149
with ethyl acetate, concentrated, and applied to thin layer chromatography (TLC) with 150
chloroform-methanol (15:1). Antibiotic activity was detected by bioautography as described 151
previously (14). The crude extract was dissolved in 1 ml of methanol, 1 µl of which was used as 152
the SRB fraction for SrrA-binding experiments. 153
srrY expression from a foreign promoter. The srrY gene was PCR-amplified using 154
pKAR4002 as a template and primers KAR-75OE01 and KAR-75OE03. The amplified product 155
was digested with NdeI and BamHI, and inserted into the corresponding sites of pIJ8600 (28), an 156
ACCE
PTED
on April 1, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
http://jb.asm.org/
6
E. coli-Streptomyces shuttle vector containing a thiostrepton-inducible tipA promoter, to obtain 157
pKAR3049. This plasmid was transformed into strains KY75, KY85 or KU82. The 158
transformants were grown at 28°C for 24 h in YM liquid medium containing apramycin, and 159
then thiostrepton was added to induce srrY expression. After further 48-h cultivation, the ethyl 160
acetate extracts were analyzed by TLC. 161
RNA preparation. S. rochei strains were cultured in 100 ml of YM liquid medium in 162
Sakaguchi flasks at 28°C for various periods. Cells were harvested from 1 ml of growing 163
cultures by centrifugation at 4℃, homogenized in 1 ml of TRI reagent (Invitrogen), and stored at 164
room temperature for 10 min. The cell suspension was mixed vigorously with 200 µl of 165
chloroform and centrifuged at 4℃. A 500 µl aliquot of the aqueous fraction containing RNA was 166
mixed with 500 µl of isopropyl alcohol, stored at room temperature for 10 min, and centrifuged 167
at 4℃. The pellet containing RNA was washed with 80% ethanol, vacuum-dried, and dissolved 168
in 100 µl of diethylpyrocarbonate-treated H2O. The purified RNA was quantified by UV 169
absorbance at 260 nm. 170
S1 nuclease protection analysis. Uniquely end-labeled DNA probe for S1 analysis was 171
generated by PCR as follows. The primer SRRYr4 was 5’-end labeled using [γ-32
P]ATP (GE 172
healthcare) and T4 polynucleotide kinase (Toyobo), and used for PCR reaction with the 173
unlabeled primer SRRYf2 and the template pKAR4002, which generated a 702-bp product 174
containing the upstream region of srrY (positions -602 to +100 relative to the transcriptional start 175
site of srrY). 30 µg of total RNA was denatured at 75°C for 10 min and hybridized to the 176
32P-labeled probe at 30°C for 3 h in 50 µl of S1 hybridization buffer (80% formamide, 0.4 M 177
NaCl, 1 mM EDTA, 20 mM HEPES (pH6.5)). S1 nuclease reaction mixture (300 µl) contained 178
the hybridization reaction, 500 units of S1 nuclease (Takara), 30 mM sodium acetate (pH4.6), 179
280 mM NaCl, and 1 mM ZnSO4. After incubation for 20 min at 25°C, the reaction was 180
terminated by addition of 300 µl of phenol-chloroform. After centrifugation at 4℃, the aqueous 181
fraction containing DNAs was precipitated by ethanol and separated on a 5% polyacrylamide gel 182
containing 6 M urea. The labeled DNAs were detected by autoradiography. Sequencing ladders 183
were generated by the T7 sequencing kit (USB corporation) using the 32
P-labeled primer 184
SRRYr4 and the template pKAR4002. 185
Preparation of SrrA and SrrAW119A
. Using pKAR3012 as a template, the srrA gene was 186
PCR-amplified with primers KAR8201OE and KAR8202OE. The amplified product was 187
digested with BamHI and SalI, and inserted into the corresponding sites of pET32b to obtain 188
pKAR3035. In this plasmid, SrrA is expressed as a His10-tagged form (His-SrrA). Next, using 189
pKAU-8203 as a template, the mutated srrAW119A
gene was PCR-amplified with primers 190
KAR8201OE and KAR8202OE. The amplified product was digested with BamHI and SalI, and 191
ACCE
PTED
on April 1, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
http://jb.asm.org/
7
inserted into the corresponding sites of pET32b to obtain pET-Amt. In this plasmid, SrrAW119A
is 192
also expressed as a His10-tagged form (His-SrrAW119A
). 193
The His-SrrA (or His-SrrAW119A
) protein synthesized in strain BL21(DE3) harboring both 194
pLysS and pKAR3035 (or pET-Amt) was affinity-purified on Ni+-NTA agarose (QIAGEN) 195
according to the method described previously (34). The purified proteins exhibited a single band 196
of 43.5 kDa after seperation by sodium dodecyl sulfate-polyacrylamide gel electrophoresis 197
(SDS-PAGE) (Fig. S6). These proteins were digested with recombinant enterokinase (Novagen) 198
and their N-terminal portions containing His10-tag (16 kDa) were removed by Ni+-NTA agarose 199
(Fig. S6). Protein concentration was determined by a Bio-Rad protein assay kit (Bio Rad) with 200
bovine serum albumin as a standard. 201
Gel shift assay. A 935-bp DNA fragment containing the upstream region of srrY (positions 202
-602 to +333) was PCR-amplified from pKAR4002 with primers SRRYf2 and SRRYr2, and 203
digested with NaeI and BanI. The resulting 548-bp (probe Y1: positions -452 to +100) and 204
233-bp (probe Y2: positions +101 to +333) DNA fragments were gel-purified and the former 205
was labeled at the 3’ end of the non-template strand with [α-32
P]dCTP (GE healthcare) by 206
Klenow fragment (Toyobo). Binding reaction mixture (20 µl) contained 1 nM labeled DNA and 207
various concentrations of SrrA (or SrrAW119A
) in the binding buffer (20 mM Tris-HCl (pH8.0), 208
100 mM NaCl, 1 mM dithiothreitol, 0.1 mg/ml BSA, 5% glycerol). When necessary, 1 ml of the 209
culture extract of strain 51252 or KY85 was added as the SRB fraction. In competition assay, 210
unlabeled DNA competitors were added to the reaction mixture at a final concentration of 200 211
nM. Reaction mixture was incubated for 30 min at 25°C and subjected to electrophoresis at 4°C 212
on native 5% polyacrylamide gel in 0.5 × TBE buffer (46 mM Tris base, 46 mM boric acid, 1 213
mM EDTA). Labeled DNAs were detected by autoradiography. 214
DNase I footprinting. DNase I footprinting was performed using end-labeled probe Y1 at 215
either non-template or template strand. The former was generated as described in gel shift assay 216
and the latter was as follows. The 32
P-labeled DNA probe used for the S1 analysis was digested 217
with NaeI and the resulting 552-bp DNA fragment was gel-purified. Binding reaction mixture 218
(50 µl) contained 2 nM labeled DNA and various concentrations of SrrA in the binding buffer 219
described above. After incubation for 30 min at 25°C, 50 µl of 5 mM MgCl2-5 mM CaCl2 220
solution containing 0.6 µg DNase I (Roche) was added and incubated for 2 minutes at 25°C. The 221
reaction was terminated by 300 µl of phenol-chloroform. After centrifugation at 4℃, the aqueous 222
fraction containing DNAs was precipitated by ethanol and separated on a 5% polyacrylamide gel 223
containing 6 M urea. Labeled DNAs were detected by autoradiography. Sequencing ladders were 224
generated by the same method as for the S1 mapping (for template strand) or Maxam-Gilbert 225
sequencing of the labeled probe (for non-template strand). 226
ACCE
PTED
on April 1, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
http://jb.asm.org/
8
RESULTS 227
228
Two SARP genes, srrY and srrZ, are involved in antibiotic production. Phenotypic studies 229
of single and double mutants of the afsA-homologue srrX and three arpA-homologues, srrA, 230
srrB and srrC, revealed that srrX and srrA make a γ-butyrolactone-receptor system in S. rochei 231
similar to the A-factor regulatory cascade in S. griseus (1). Additional homologues of S. griseus, 232
an adpA homologue orf116 and an strR homologue orf3, are also located on the linear plasmid 233
pSLA2-L. However, disruption of the latter two genes gave no effect on antibiotic production or 234
morphological differentiation (data not shown). Instead, disruption of the SARP gene srrY 235
(mutant KY75, all the mutants used in this study are listed in Table 1) ceased both antibiotic 236
production and spore formation (Fig. 1A, reference 20, in this paper we focused on antibiotic 237
production, and therefore did not show results of spore formation). 238
To confirm the function of srrY in antibiotic production and spore formation, 239
complementation experiments were carried out. When an intact srrY gene was cloned into 240
plasmid pIJ8600 and expressed from a thiostrepton-inducible tipA promoter in mutant KY75, 241
production of both LC and LM was restored (Fig. 1B), but spore formation was not. This result 242
suggested that SrrY actually acts as an activator for antibiotic production, but the defect of spore 243
formation in mutant KY75 might be caused by a polar effect on the downstream srrC (orf74) 244
gene, encoding a positive regulator for morphological differentiation (1). Because, mutant KY75 245
was constructed by insertion of a kanamycin resistance gene cassette into srrY (20). This 246
speculation has been confirmed very recently by construction of another mutant KA61 with an in 247
frame deletion in srrY, which did not produce either antibiotic (Fig. 1A) but sporulated normally. 248
To reveal the function of two additional SARP genes located on pSLA2-L, srrW (orf55) and 249
srrZ (orf71), we disrupted these genes, too. As shown in Fig. 1A, the srrZ disruptant KY71 250
produced LC but did not produce LM, and sporulated normally. On the other hand, disruption of 251
srrW (mutant TN01) gave no effect on antibiotic production or spore formation. These results 252
indicated that two SARP genes, srrY and srrZ, are involved in antibiotic production, the former 253
possibly being located at an upper level than the latter in the regulatory hierarchy. Thus, we 254
focused at first on the function of srrY in antibiotic production, detailed results of which are 255
described below. 256
Growth-dependent expression of srrY. Production of antibiotics in streptomycetes occurs at 257
a specific stage of growth. Similarly, the antibiotic activity in S. rochei 51252 was 258
growth-dependent, detected at 24 h after inoculation and stably maintained until at least 48 h 259
(Figs. 2A and 2B). To know the correlation between antibiotic production and srrY expression, 260
RNA was extracted at different growth stages and analyzed by high-resolution S1 nuclease 261
ACCE
PTED
on April 1, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
http://jb.asm.org/
9
protection assay. The analysis showed that srrY mRNA increased markedly at 12 to 24 h and 262
disappeared by further cultivation (Fig. 2C). Thus, the expression of srrY also occurred in a 263
growth-dependent manner, slightly preceding antibiotic production. In addition, we identified a 264
transcriptional start site (TSS) 33 nt upstream of the translational start codon of srrY (Fig. 2C 265
and 3A). Immediately upstream of this site, -35 and -10 sequences similar to the σhrdB
and 266
σhrdD
-type promoters of S. coelicolor A3(2) (9) were also found (Fig. 3A). 267
γγγγ-Butyrolactone-receptor system regulates srrY expression. To know whether the 268
srrX-srrA system regulates srrY expression, we analyzed effects of the srrX and srrA mutations 269
on srrY mRNA. Total RNAs were isolated at 24 h and srrY mRNA was quantified by 270
low-resolution S1 nuclease protection assay. As shown in Fig. 4, srrY mRNA was almost 271
undetectable in the srrX mutant KY85, while it was not significantly changed in the srrA mutant 272
KA12. The decrease of srrY mRNA in mutant KY85 was recovered near to the normal level by 273
introduction of a second srrA mutation (KA21). These results suggested that the srrX and srrA 274
genes have a positive and negative effect, respectively, on srrY expression. The effects of the 275
srrX and srrA mutations on srrY expression were similar to those on antibiotic production (1, 20). 276
It is noteworthy that the srrA mutation (or srrX-srrA double mutation) did not lead to the 277
overproduction of srrY mRNA (Fig. 4) or antibiotics (1), which suggests a possible 278
compensative mechanism in the regulatory system (see Discussion). 279
Specific binding of SrrA to the upstream region of srrY and its inhibition by SRB. To 280
test if the SrrA protein binds to the srrY region, gel shift assay was performed using 32
P-labeled 281
probe Y1 that contained the upstream and N-terminal regions of srrY (Fig. 5A) (see Fig. S5 in 282
Supplemental Material for SrrA preparation). Addition of SrrA to the binding reaction mixture 283
gave a shifted band in a concentration-dependent manner (Fig. 5B, lanes 2 to 5). Competition 284
experiments showed that unlabeled probe Y1 behaved as an effective competitor (Fig. 5C, lane 285
3), whereas unlabeled probe Y2 containing the srrY-coding region (Fig. 5A) did not (Fig. 5C, 286
lane 4), indicating a high binding specificity of SrrA to the upstream region of srrY. Moreover, 287
the shifted band disappeared by addition of the culture extract of the parent strain 51252 but not 288
of the srrX mutant KY85 (Fig. 5D, lanes 3 and 4), which indicates that SrrA was dissociated 289
from the DNA by binding of SRB (S. rochei γ-butyrolactone). These results together with gene 290
expression in the mutants (Fig. 4) suggest that the upstream region of srrY is a target of the 291
repressor SrrA and that the srrY transcription is controlled by SrrA together with SRB. 292
SrrA-binding site is located upstream of srrY. DNase I footprinting was carried out to 293
identify an SrrA-binding site(s) in the upstream region of srrY. As shown in Fig. 6, positions -59 294
to -32 of the non-template strand and positions -61 to -35 of the template strand were protected 295
by SrrA. The protected region was slightly overlapped with the -35 sequence of the srrY 296
ACCE
PTED
on April 1, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
http://jb.asm.org/
10
promoter (Fig. 3A) and contained a 26-bp palindromic sequence (Fig. 3B), which is similar to 297
the binding sequences of typical γ-butyrolactone receptors (4, 16, 22, 23, 32). Similar 298
palindromic sequences were also found in the upstream regions of srrB and srrW (Fig. 3B), 299
which suggests their possible function as a target for SrrA binding (see Discussion). In the latter 300
two cases, the palindromic sequences are completely overlapped with the putative promoter 301
regions. 302
Trp119 of SrrA is involved in SRB binding. The tryptophan residue at the 119 position of 303
ArpA is necessary for A-factor binding and this residue is conserved in all of the γ−butyrolactone 304
receptor proteins including SrrA. To analyze the function of Trp119 of SrrA, we constructed a 305
point mutant of srrA (srrAW119A
), in which the Trp residue was replaced by Ala. The srrAW119A
306
mutant KU82 failed to produce either antibiotic (Fig. 1A) or express srrY (Fig. 4), indicating that 307
SrrAW119A
represses srrY expression even in the presence of SRB. To further characterize this in 308
vitro, binding of SrrAW119A
was analyzed by gel shift assay. SrrAW119A
was bound to the labeled 309
probe Y1 at a concentration-dependent manner (Fig. 5B, lanes 6 to 9). Competition experiments 310
showed that unlabeled probe Y1 behaved as an effective competitor (Fig. 5C, lane 6), whereas 311
unlabeled probe Y2 did not (Fig. 5C, lane 7). These results were identical to those obtained from 312
the intact SrrA, suggesting that the Trp119Ala mutation did not affect on the DNA binding 313
affinity or specificity of SrrA. In contrast, SrrAW119A
was kept bound to the DNA even in the 314
presence of SRB (Fig. 5D, lane 6), indicating that Trp119 of SrrA is crucial for binding of SRB. 315
srrY is a target of SrrA essential for antibiotic production. Concerning the antibiotic 316
regulatory cascade in S. rochei, a question if SrrA controls other genes in addition to srrY was 317
raised. To answer this question, we expressed srrY under a foreign promoter in the srrX (KY85) 318
and srrAW119A
(KU82) mutants. If SrrA regulates additional genes essential for antibiotic 319
production, expression of srrY under a constitutive promoter would not be enough to restore 320
antibiotic production. When srrY was expressed from a thiostrepton-inducible tipA promoter, the 321
production of LC and LM occurred in both mutants (Fig. 1B). These results suggested that srrY 322
may be a sole gene that is repressed by SrrA and also is indispensable for antibiotic production. 323
324
325
DISCUSSION 326
327
Extensive transcriptional analysis in this study demonstrated that the srrX-srrA 328
γ-butyrolactone-receptor system in S. rochei regulates LC and LM production through an SARP 329
gene (srrY)-dependent pathway. The srrY gene was expressed in a growth-dependent manner, 330
slightly preceding antibiotic production (Fig. 2). The srrY expression was not observed in the 331
ACCE
PTED
on April 1, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
http://jb.asm.org/
11
srrX mutant and restored in the srrX-srrA double mutant (Fig. 4), which suggested that the 332
transcriptional repression of srrY by SrrA is relieved by binding of SRB synthesized by SrrX. 333
Consistent with this, SrrA was bound specifically to the upstream region of srrY and released by 334
addition of the SRB fraction (Fig. 5). Furthermore, the expression of srrY was always repressed 335
in the SrrAW119A
mutant, and the binding of SrrAW119A
occurred even in the presence of SRB (Fig. 336
4 and 5). All of these results confirmed the signaling pathway from srrX through srrA to srrY, 337
where SrrA functions as a receptor/repressor of SRB and srrY. The conserved Trp-119 residue in 338
SrrA may form a ligand-binding pocket for a γ−butyrolactone molecule, as shown by X-ray 339
crystallography for CprB, an ArpA homologue in S. coelicolor A3(2) (21). Thus, SrrAW119A
lost 340
an SRB binding activity but still kept a DNA-binding activity (Fig. 5), as observed for 341
ArpAW119A
in S. griseus (27). 342
γ−Butyrolactone receptor proteins are bound to a palindromic sequence within the promoter 343
regions of the target genes and repress their transcription (4, 16, 22, 23, 32). The binding site of 344
SrrA overlaps with the -35 sequence of the srrY promoter and contains a 26-bp palindromic 345
sequence with a high similarity to the binding sequences of other γ−butyrolactone receptors (Fig. 346
3B). Therefore, the binding of SrrA to this site may play a critical role in repressing transcription 347
of srrY possibly by preventing the binding of RNA polymerase. 348
In Streptomyces fradiae, the γ−butyrolactone receptor TylP repressed the expression of the 349
SARP gene tylS (4, 25), which in turn resulted in the repression of tylR that encodes a pathway 350
specific activator in tylosin biosynthesis (26). In Streptomyces pristinaespiralis, the receptor 351
SpbR was bound to the promoter of the SARP gene papR1 and regulated pristinamycin synthesis 352
(5). The receptor ScbR in S. coelicolor A3(2) was directly bound to two upstream regions of 353
kasO, a pathway specific SARP gene for a cryptic type I polyketide gene cluster, and repressed 354
its transcription (32). Thus, accumulated data together with the results of this study suggest that 355
the SARP family regulatory genes are often targets of γ-butyrolactone receptors, except for the 356
case of A-factor, whose target is adpA, an araC family transcriptional regulator gene. 357
Introduction of an intact srrY gene under a control of a foreign promoter into the srrX or 358
srrAW119
mutant restored antibiotic production (Fig. 1B), indicating that the derepression of srrY 359
is sufficient for restoration. However, this result did not exclude a possibility that SrrA might 360
repress other gene(s) (such as srrB and/or srrW) dispensable for antibiotic production. Both srrB 361
and srrW contain a consensus palindromic sequence at their upstream regions (Fig. 3B). These 362
regions were actually isolated by nitrocellulose filter binding assay using the SrrA protein, 363
nevertheless the promoter region of srrY has not been obtained until now (unpublished results). 364
Furthermore, disruption of srrB caused an increased production of LC and LM (1), whereas 365
disruption of srrW did not show any effects (Fig. 1A). Our preliminary data showed that SrrB 366
ACCE
PTED
on April 1, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
http://jb.asm.org/
12
binds to the upstream region of srrY and negatively regulates its expression (unpublished results). 367
These results suggest a possibility that SrrA may also positively regulate srrY through the 368
transcriptional repression of srrB, which could explain why the srrA mutation did not 369
significantly affect on srrY expression or antibiotic production (Fig. 4, reference 1). 370
Different from the srrY mutant, which did not produce LC or LM, the srrZ mutant produced 371
only LC (Fig. 1A), suggesting its lower location than srrY in the regulatory cascade. Based on all 372
the results hitherto obtained including preliminary ones, we could depict a possible regulatory 373
cascade leading to LC and LM production in S. rochei (Fig. 7). In this scheme, the signaling 374
pathway from srrX through srrA to srrY has been confirmed by extensive transcriptional analysis. 375
Similar analysis around srrB and under srrY is necessary to confirm this scheme and reveal the 376
entire picture of the complex regulatory cascade in S. rochei. 377
378
379
ACKNOWLEDGEMENTS 380
381
We thank M. Bibb, John Innes Centre, for plasmid pIJ8600, and K. Inada, Hiroshima 382
University, for his help in transcriptional experiments. This work was supported by Grant-in-Aid 383
for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology 384
of Japan, as well as by that from Japan Society for the Promotion of Science. 385
ACCE
PTED
on April 1, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
http://jb.asm.org/
13
REFERENCES 386
387
1. Arakawa, K., S. Mochizuki, K. Yamada, T. Noma, and H. Kinashi. 2007. γ-Butyrolactone 388
autoregulator-receptor system involved in lankacidin and lankamycin production and 389
morphological differentiation in Streptomyces rochei. Microbiology, 153:1817-1827. 390
2. Arias, P., M. A. Fernádez-Moreno, and F. Malpartida. 1999. Characterization of the 391
pathway-specific positive transcriptional regulator for actinorhodin biosynthesis in 392
Streptomyces coelicolor A3(2) as a DNA-binding protein. J. Bacteriol. 181:6958-6968. 393
3. Bibb, M. J. 2005. Regulation of secondary metabolism in streptomycetes. Curr. Opin. 394
Microbiol. 8: 208-215. 395
4. Bignell, D. R. D., N. Bate, E. Cundliffe. 2007. Regulation of tylosin production: role of a 396
TylP-interactive ligand. Mol. Microbiol. 63:838-847. 397
5. Folcher, M., H. Gaillard, L. T. Nguyen, K. T. Nguyen, P. Lacroix, N. Bamas-Jacques, M. 398
Rinkel, and C. J. Thompson. 2001. Pleiotropic functions of a Streptomyces pristinaespiralis 399
autoregulator receptor in development, antibiotic biosynthesis, and expression of a superoxide 400
dismutase. J. Biol. Chem. 276: 44297-44306. 401
6. Hara, O., and T. Beppu. 1982. Mutants blocked in streptomycin production in Streptomyces 402
griseus - the role of A-factor. J. Antibiot. 35: 349-358. 403
7. Horinouchi S, Kumada Y, Beppu T. 1984. Unstable genetic determinant of A-factor 404
biosynthesis in streptomycin-producing organisms: cloning and characterization. J. Bacteriol. 405
1582: 481-487. 406
8. Ishikawa, J., Y. Niino, and K. Hotta. 1996. Construction of pRES18 and pRES19, 407
Streptomyces-Escherichia coli shuttle vectors carrying multiple cloning sites. FEMS 408
Microbiol. Lett. 145:113-116. 409
9. Kang, J. G., M. Y. Hahn, A. Ishihama, and J. H. Roe. 1997. Identification of sigma factors 410
for growth phase-related promoter selectivity of RNA polymerase from Streptomyces 411
coelicolor A3(2). Nucleic Acids Res. 25:2566-2573. 412
10. Kato, J., N. Funa, H. Watanabe, Y. Ohnishi, and S. Horinouchi. 2007. Biosynthesis of 413
γ-butyrolactone autoregulators that switch on secondary metabolism and morphological 414
development in Streotomyces. Proc. Natl. Aca. Sci. 104:2378-2383. 415
11. Kawachi, R., T. Akashi, Y. Kamitani, A. Sy, U. Wangchaisoonthorn, T. Nihira, and Y. 416
Yamada. 2000. Identification of an AfsA homologue (BarX) from Streptomyces virginiae as a 417
pleiotropic regulator controlling autoregulator biosynthesis, virginiamycin biosynthesis and 418
virginiamycin M1 resistance. Mol. Microbiol. 36:302-313. 419
12. Khokhlov, A. S., L. N. Anisova, I. I. Tovarova, E. M. Kleiner, I. V. Kovalenko, O. I. 420
ACCE
PTED
on April 1, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
http://jb.asm.org/
14
Krasilnikova, E. Y. Kornitskaya, and S. A. Pliner. 1973. Effect of A-factor on the growth of 421
asporogenous mutants of Streptomyces griseus, not producing this factor. Z. Allg. Mikrobiol. 422
13:647-655. 423
13. Kieser, T., M. J. Bibb, M. J. Buttner, K. F. Chater, and D. A. Hopwood. 2000. Practical 424
Streptomyces Genetics. Norwich: John Innes Foundation. 425
14. Kinashi, H., E. Mori, A. Hatani, and O. Nimi. 1994. Isolation and characterization of large 426
linear plasmids from lankacidin-producing Streptomyces species. J. Antibiot. 47:1447-1455. 427
15. Kinashi, H., S. Fujii, A. Hatani, T. Kurokawa, and H. Shinkawa. 1998. Physical mapping 428
of the linear plasmid pSLA2-L and localization of the eryAI and actI homologs. Biosci. 429
Biotech. Biochem. 62:1892-1897. 430
16. Kinoshita, H., T. Tsuji, H. Ipposhi, T. Nihira, and Y. Yamada. 1999. Characterization of 431
binding sequences for butyrolactone autoregulator receptors in streptomycetes. J. Bacteriol. 432
181:5075-5080. 433
17. Kitani, S., Y. Yamada, and T. Nihira. 2001. Gene replacement analysis of the butyrolactone 434
autoregulator receptor (FarA) reveals that FarA acts as a novel regulator in secondary 435
metabolism of Streptomyces lavendulae FRI-5. J. Bacteriol. 183:4357-4363. 436
18. Madduri, K., and C. R. Hutchinson. 1995. Functional characterization and transcriptional 437
analysis of the dnrR1 locus, which controls daunorubicin biosynthesis in Streptomyces 438
peucetius. J. Bacteriol. 177:1208-1215. 439
19. Mizuno, T., and I. Tanaka. 1997. Structure of the DNA-binding domain of the OmpR 440
family of response regulators. Mol. Microbiol. 24:665-667. 441
20. Mochizuki, S., K. Hiratsu, M. Suwa, T. Ishii, F. Sugino, K. Yamada, and H. Kinashi. 442
2003. The large linear plasmid pSLA2-L of Streptomyces rochei has an unusually condensed 443
gene organization for secondary metabolism. Mol. Microbiol. 48:1501-1510. 444
21. Natsume, R., Y. Ohnishi, T. Senda, and S. Horinouchi. 2004. Crystal structure of a 445
γ-butyrolactone autoregulator receptor protein in Streptomyces coelicolor A3(2). J. Mol. Biol. 446
336:409-419. 447
22. Ohnishi, Y., S. Kameyama, H. Onaka, and S. Horinouchi. 1999. The A-factor regulatory 448
cascade leading to streptomycin production in Streptomyces griseus: identification of a target 449
gene of the A-factor receptor. Mol. Microbiol. 34:102-111. 450
23. Onaka, H., and S. Horinouchi. 1997. DNA-binding activity of the A-factor receptor ptotein 451
and its recognition DNA sequences. Mol. Microbiol. 24:991-1000. 452
24. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular Cloning: A Laboratory 453
Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. 454
25. Stratigopoulos, G., A. R. Gandecha, and E. Cundliffe. 2002. Regulation of tylosin 455
ACCE
PTED
on April 1, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
http://jb.asm.org/
15
production and morphological differentiation in Streptomyces fradiae by TylP, a deduced 456
γ-butyrolactone receptor. Mol. Microbiol. 45:735-744. 457
26. Stratigopoulos, G., N. Bate, N., and E. Cundliffe. 2004. Positive control of tylosin 458
biosynthesis: pivotal role of TylR. Mol. Microbiol. 54:1326-1334. 459
27. Sugiyama, M., H. Onaka, T. Nakagawa, and S. Horinouchi. 1998. Site-directed 460
mutagenesis of the A-factor receptor protein: Val-41 important for DNA-binding and Trp-119 461
important for ligand-binding. Gene 222:133-144. 462
28. Sun, J., G. H. Kelemen, J. M. Fernandez-Abalos, M. J. Bibb. 1999. Green fluorescent 463
protein as a reporter for spatial and temporal gene expression in Streptomyces coelicolor A3(2). 464
Microbiology 145:2221-2227. 465
29. Suwa, M., H. Sugino, A. Sasaoka, E. Mori, S. Fujii, H. Shinkawa, O. Nimi, and H. 466
Kinashi. 2000. Identification of two polyketide synthase gene clusters on the linear plasmid 467
pSLA2-L in Streptomyces rochei. Gene 246:123-131. 468
30. Takano, E. 2006. γ-Butyrolactones: Streptomyces signaling molecules regulating antibiotic 469
production and differentiation. Curr Opin Microbiol 9:287-294. 470
31. Takano, E., R. Chakaraburtty, T. Nihira, Y. Yamada, and M. J. Bibb. 2001. A complex 471
role for the γ-butyrolactone SCB1 in regulating antibiotic production in Streptomyces 472
coelicolor A3(2). Mol. Microbiol. 41:1015-1028. 473
32. Takano, E., H. Kinoshita, V. Mersinias, G. Bucca, G. Hotchkiss, T. Nihira, C. P. Smith, 474
M. Bibb, W. Wohlleben, and K. Chater. 2005. A bacterial hormone (the SCB1) directly 475
controls the expression of a pathway-specific regulatory gene in the cryptic type I polyketide 476
biosynthetic gene cluster of Streptomyces coelicolor. Mol. Microbiol. 56:465-479. 477
33. Wietzorrek, A., and M. Bibb. 1997. A novel family of proteins that regulates antibiotic 478
production in streptomycetes appears to contain an OmpR-like DNA-binding fold. Mol. 479
Microbiol. 25:1181-1184. 480
34. Yamamoto, S., and K. Kutsukake. 2006. FliT acts as an anti-FlhD2C2 factor in the 481
transcriptional control of the flagellar regulon in Salmonella enterica serovar Typhimurium. J. 482
Bacteriol. 188:6703-6708.483
ACCE
PTED
on April 1, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
http://jb.asm.org/
16
FIGURE LEGENDS 484
485
FIG. 1. (A) Effects of regulatory mutations on antibiotic production. The culture extracts of S. 486
rochei strains were assayed by bioaoutography. Strains used were 51252 (parent), KY75 (srrY 487
mutant), KY71 (srrZ mutant), TN01 (srrW mutant), and KU82 (srrAW119A
mutant). (B) 488
Restoration of antibiotic production in the regulatory mutants by introduction of an intact srrY 489
gene. Three regulatory mutants, KY75, KY85 (srrX mutant) and KU82, carrying pKAR3049 490
(intact srrY gene) or pIJ8600 (control), were analyzed. The culture extracts were separated by 491
TLC and detected by baking with vanillin-H2SO4. 492
493
FIG. 2. Growth-dependent antibiotic production and srrY expression in S. rochei 51252. (A) 494
Growth curve of strain 51252. OD600 values were obtained from triplicate cultures. (B) 495
Bioautography of the culture extracts. (C) High-resolution S1 nuclease protection analysis of 496
srrY mRNA (upper panel). Lanes G, A, T, and C are sequencing ladders derived from the same 497
labeled primer used for probe preparation. The transcriptional start site (TSS) of srrY, was 498
indicated. Lane P contains only the probe. The lower panel shows the ethidium bromide-stained 499
total RNA pattern on 1% agarose gel. 500
501
FIG. 3. (A) Characterization of the upstream region of srrY. The srrY promoter (-35 and -10), 502
transcriptional start site (TSS), Shine-Dalgarno sequence (SD) and initiation codon are boxed. 503
The SrrA-binding site deduced from Fig. 6 is indicated by bold letters. (B) Comparison of the 504
binding sequences of SrrA and typical γ-butyrolactone receptor proteins. Possible SrrA-binding 505
sites upstream of srrB and srrW were deduced from sequence data. Identical bases to the first 506
SrrA-binding sequence are indicated by bold letters. Complementary bases in the top three 507
palindromes are asterisked. The center of palindorome is shown by a vertical dotted line. 508
509
FIG. 4. Effects of regulatory mutations on srrY expression. srrY mRNAs from various strains 510
were analyzed by low-resolution S1 nuclease protection assay (upper panel). The lower panel 511
indicates the ethidium bromide-stained total RNA pattern on 1% agarose gel. Strains used were 512
51252 (parent), KY85 (srrX mutant), KA12 (srrA mutant), KA21 (srrX-srrA double mutant), and 513
KU82 (srrAW119A
mutant). 514
515
FIG. 5. Gel shift assay of the binding of SrrA and SrrAW119A
. (A) Location of the two probes Y1 516
and Y2. The transcriptional start site of srrY is numbered +1. (B) Concentration-dependent 517
binding of SrrA or SrrAW119A
to the upstream region of srrY. 1 nM labeled probe Y1 was mixed 518
ACCE
PTED
on April 1, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
http://jb.asm.org/
17
with various concentrations of SrrA (lanes 2 to 5) or SrrAW119A
(lanes 6 to 9). Positions of bound 519
(B) and free (F) DNAs are shown by arrows on the right. (C) Specific binding of SrrA to the 520
upstream region of srrY. Each reaction mixture contained 1 nM labeled probe Y1 and 500 nM 521
protein (lanes 2 to 7). Then, 200 nM unlabeled probe Y1 (lanes 3 and 6) or unlabeled probe Y2 522
(lanes 4 and 7) was added. (D) Effect of the SRB fraction on the binding of SrrA or SrrAW119A
. 523
To the same reaction mixture used in (B), the culture extract of strain 51252 (lanes 3 and 6) or 524
KY85 (lanes 4 and 7) was added. 525
526
FIG. 6. DNase I footprinting analysis of SrrA-binding site. Probe Y1 was end-labeled at either 527
the non-template (A) or the template (B) strand. Each reaction mixture contained 2 nM labeled 528
DNA and 0-2 µM SrrA. Sequencing ladders were generated by Maxam-Gilbert sequencing of 529
the labeled probe Y1 (A) or cycle sequencing using the labeled primer for probe preparation (B). 530
The sequences protected from DNase I digestion were indicated on the right. 531
532
FIG. 7. Possible γ-butyrolactone-dependent regulatory cascade leading to LC and LM production 533
in S. rochei. The signaling pathway from srrX via srrA to srrY (solid lines) has been confirmed 534
by extensive transcriptional analysis in this study. Additional pathways (dotted lines) were 535
suggested based on various data including unpublished ones. 536
activation; inhibition. 537
538
539
540 ACCE
PTED
on April 1, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
http://jb.asm.org/
18
TABLE 1. Streptomyces rochei strains used in this study 541
542
Antibiotic production Strains Description
LC LM
Source/
references
51252 pSLA2-L+, pSLA2-M
-, pSLA2-S
- + + 14
KY85 51252 srrX::kan – – 20
KA12 51252 ∆srrA + + 1
KA21 KY85 ∆srrA + + 1
KU82 51252 srrAW119A
– – This study
KY75 51252 srrY::kan – – 20, this
study
KA61 51252 ∆srrY – – This study
KY71 51252 srrZ::kan + – This study
TN01 51252 srrW::kan + + This study
543
ACCE
PTED
on April 1, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
http://jb.asm.org/
19
TABLE 2. Plasmids used in this study 544
545
Plasmids Description Source/reference
pUC4-KIXX pUC derivative vector containing kan
cassette, Aprr
Pharmacia
pUC19 Cloning vector, Ampr
pKY75-1 pUC19 1.8-kb BamHI fragment
containing srrY
This study
pKY75-2 pKY75-1 srrY::kan This study
pKAR4002 pUC19 9.2-kb PstI fragment containing
srrY
This study
pKAR3012 pUC19 srrA 1
pKAU8202 pUC19 srrAW119A
This study
pRES18 E. coli-Streptomyces shuttle vector,
Ampr, Tsr
r
8
pKY75-3 pRES18 srrY::kan This study
pKAR3055 pRES18 1.5-kb EcoRI-PstI fragment
from pKAR3054
This study
pKY71-1 pRES18 2.2-kb SphI fragment
containing srrZ
This study
pKY71-2 pKY71-1 srrZ::kan This study
pTN03 pRES18 srrW::kan This study
pKAU8203 pRES18 srrAW119A
This study
Litmus28i Cloning vector, Ampr New England Biolabs
pKAR3023 Litmus28i 1·5-kb AgeI fragment
containing srrA from pKAR3012
This study
pBluescript SK-plus Cloning vector, Ampr Stratagene
pKAR3001 pBluescript SK-plus 1.7-kb Eco47III
fragment containing srrW
This study
pRSET-B Cloning vector, Ampr Invitrogen
pKAR3053 pRSET-B 1.8-kb EcoRI-PstI fragment
from pKY75-1
This study
pKAR3054 pKAR3053 267-bp PvuII fragment
deleted in srrY
This study
pTN01 pRSET-B 1.7-kb EcoRI-BamHI
fragment containing srrW from
pKAR3001
This study
pTN02 pTN01 srrW::kan This study
pAlterR-1 Cloning vector for site-directed
mutagenesis, Tetr
Promega
pKAR3025 pAlterR-1 KpnI and HindIII fragment of
srrA from pKAR3023
This study
pKAU-8201 pAlterR-1 srrA
W119A This study
pET32b(+) T7 expression vector for His10 tagging,
Ampr
Novagen
pKAR3035 pET32b(+) srrA This study
pET-Amt pET32b(+) srrAW119A
This study
pIJ8600 Integrative E. coli-Streptomyces shuttle
vector for PtipA expression, Aprr, Tsr
r
28
pKAR3049 pIJ8600 srrY This study
ACCE
PTED
on April 1, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
http://jb.asm.org/
20
TABLE 3. Primers used in this study 546
547
Primer name Sequence (5’ to 3’)
Ampicillin Repair Oligonucleotide GTTGCCATTGCTGCAGGCATCGTGGTG
KAR-75OE01 GCGCATATGGACATCGACGTACTGGGCAC
KAR-75OE03 CCAGCGGATCCTCGCGCAGC
SRRYf2 GGCGTCGTCTGCCTGCTGCC
SRRYr2 ATATCCGCCGGGGGCGGTGG
SRRYr4 GCGCCCGCGGCGTCACCGAGA
KAR8201OE CTAGGATCCGCATATGGCACAGCAGGAAC
KAR8201SDM GCCTTCCCCACCGCGATCGCCTTCTCG
KAR8202OE GAAGAATTCGGCGCGCCGCCCATGAC
548
ACCE
PTED
on April 1, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
http://jb.asm.org/
ACCE
PTED
on April 1, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
http://jb.asm.org/
ACCE
PTED
on April 1, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
http://jb.asm.org/
ACCE
PTED
on April 1, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
http://jb.asm.org/
ACCE
PTED
on April 1, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
http://jb.asm.org/
ACCE
PTED on April 1, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
http://jb.asm.org/
ACCE
PTED
on April 1, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
http://jb.asm.org/
ACCE
PTED
on April 1, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
http://jb.asm.org/
/rrdata/pdfconv/queue01/tmp/tifFig1.tif- 1/rrdata/pdfconv/queue01/tmp/tifFig2.tif- 1/rrdata/pdfconv/queue01/tmp/tifFig3.tif- 1/rrdata/pdfconv/queue01/tmp/tifFig4.tif- 1/rrdata/pdfconv/queue01/tmp/tifFig5.tif- 1/rrdata/pdfconv/queue01/tmp/tifFig6.tif- 1/rrdata/pdfconv/queue01/tmp/tifFig7.tif- 1