62972646 Biochemistry Genetics Important Concepts Q as Dr Kumar Ponnusamy Jegathambigai RN Biochemistry Genetics AIMST University School of Medicine M

1

““DDrr KKuummaarr PPoonnnnuussaammyy && MMss JJeeggaatthhaammbbiiggaaii RRNN,, BBiioocchheemmiissttrryy && GGeenneettiiccss,, AAIIMMSSTT UUnniivveerrssiittyy SScchhooooll ooff MMeeddiicciinnee,, MMaallaayyssiiaa””

Important Concepts in Biochemistry & Biomedical Genetics, USMLE PreparatoryMBBS

Curriculum

““TThhee AAuutthhoorrss AAcckknnoowwlleeddggeess AAllll tthhee BBiioocchheemmiissttrryy TTeexxtt BBooookkss,, OOnn--LLiinnee RReessoouurrcceess””

IInnbboorrnn EErrrroorrss ooff AAAA MMeettaabboolliissmm AAAA ttoo SSppeecciilliizzeedd PPrroodduuccttss PPuurriinnee && PPyyrriimmiiddiinnee HHeemmee SSyynntthheessiiss && DDeeggrraaddaattiioonn BBiilliirruubbiinn MMeettaabboolliissmm,, PPoorrpphhyyrriiaass,, BBiioommeeddiiccaall GGeenneettiiccss:: SSiinnggllee GGeennee DDiissoorrddeerrss,, CChhrroommoossoommaall AAbbnnoorrmmaalliittiieess,, PPooppuullaattiioonn GGeenneettiiccss,, GGeenneettiicc DDiiaaggnnoossiiss,, Presursors of Heme, Purine and Pyrimidine Biosynthesis. SCID, Adenosine Deaminase Deficiency. Coenzymes required for catecholamine, heme, purine and primidine synthesis & degradation pathways. Rate-limiting Step of Heme Biosynthetic pathway and Purine & Pyrimidine pathways. Allosteric Inhibition Lead toxicity Lesch-Nyhan Syndrome, cause Crigler-Najjar Syndrome, cause Dubin-Johnson Syndrome Neonatal Jaundice, causes Vitamin B6 deficiency Hereditary Spherocytosis, cause Isoniazid and Vitamin B6 Nutritional Deficiency & Anemias Bilirubin Conjugation, enzyme catalaysed and site of conjugation & deconjugation. Albinism, enzyme deficiency, signs and symptoms. Phenylketoneuria, enzyme deficiency, Signs & Symptoms. Alkaptonuria, enzyme deficiency. Cystationuria, causes and clinical signs & symptoms. Catecholamine Synthesis & Coenzymes involved Melanin Synthesis Gout, causes

2

Allopurinol, mode of action. PCT, Erythropoietic Porphyria , enzyme deficiencies. HGPRT, function consequences. UDP-GT, Function. Lens dislocation THF deficiency & Methionine metabolism Mode of action of 5-FU and Methotrexate as an anticancer agent. Mode of action of methotrexate as an imuuno suppressor. Mode of action of Mycophenolic acid as a an immunosuppressor. Folate anti-metabolite as an Antibiotic (sulfa drugs) Obstructive Jaundice. What are the precursors require for Heme Biosynthesis?. Glycine + Scccinyl CoA. What is the regulatory and rate-limiting step in the biosynthesis of heme? Reaction catalyzed by the enzyme δ-Amino Levulinic Acid (δ-ALA). What is the Allosteric inhibitor of heme Biosynthesis? Heme. What vitamin co-enzyme is required in the first step catalyzed by the enzyme δ-ALA. Vitamin B6 / Pyridoxal Phosphate. Name an anti-tuberculosis antibiotic?. Isoniazid. Patient on TB therapy with Isoniazid, which vitamin one must supplement? Vitamin B6 / Pyridoxal phosphate. Which one of the common environmental heavy metal toxin leads to anemia? Lead. Name the enzymes inhibited by lead in the heme biosynthetic pathway?.

3

ALA Dehydrase & Ferrochelatase. What is the regulatory and rate-limiting step in the biosynthesis of heme? Reaction catalyzed by the enzyme δ-Amino Levulinic Acid (δ-ALA). What is Bilirubin? Bilirubin is a degradation product of heme. What is meant by jaundice? Accumulation of the yellow color pigment bilirubin in the circulation, sclera and skin. Name the 2 types of Bilirubins? Conjgated Bilirubin = Bilirubin diglucuronide = Direct Bilirubin. Unconjugated Bilirubin = Bilirubin ( No diglucuronide) = Indirect bilirubin. Name the 3 types of jaundice? Hemolytic jaundice Obstructive jaundice. Infective hepatitis. Name the straw yellow colored pigment excreted in the urine> Urobilinogen. Name the brown colored pigment excreted in the stools?. Stergobilinogen. In which type of jaundice one can expect clay-colored stool and WHY?. Obstrutive jaundice. Obstruction of bile duct by galll stone or tumor prevent the flow of bile to the deodenum. Vit B6 Deficiency, iron Deficiency & Lead Poisoning leads to __________ anemia. Microcytic anemia. Vit B6 Deficiency & Lead Poisoning leads to __________ in bone marrow.

4

Ringed sideroblasts. Urobilinogen Decarboxylase deficiency leads to ______. Porphyria Cutanea Tarda (PCT). Proptoporphyria is caused by the deficiency of the enzyme ________. Ferrochelatase. PCT is inherited as an autosomal dominant trait, caused by the congenital deficiency of the enzme ________. Uroporphyrinogen Decarboxylase (UROD). What is meant by Dubin-Johnson Syndrome (DJS)?. Dubin-Johnson Syndrome (DJS) is an autosomal recessive disorder which causes an increase of conjugated-bilirubin without elevation of liver ALT & AST. DJS is associated with a defect in the ability of hepatocytes to secrete conjugated-bilirubin into the bile. In which cells the Bilirubin is synthesized?. Macrophages. What is the organ in which conjugation of bilirubin occurs?. Liver. The enzyme ____________ converts bilirubin into Conjugated bilirubin in liver. UDP-Glucuronyl Transferase (UDP-GT). What laboratory test will be helpful to identify the type of bilirubin? Van Den Berg’s Diazotised sulfanilic acid test. What is the cause of neonatal jaundice? Congenital deficiency of UDP-Glucuronyl Transferase (UDP-GT) causes Neonatal Jaundice.

5

What type of bilirubin is found to be elevated in the case of Hemolytic Jaundice? Unconjugated bilirubin (Bilirubin). What type of bilirubin is found to be elevated in the case of Obstructive Jaundice? Conjugated Bilirubin (Bilirubin Diglucuronide) / Direct Bilirubin. What type of bilirubin is found to be elevated in the case of hepatocellular jaundice?. Both Conjugated & unconjugated Bilirubin. What type of bilirubin is found to be elevated in the case of Neonatal jaundice?. Indirect bilirubin. Name the causes of hemolytic crisis.

v Episode of hemolysis in G-6-PDH deficiency. v Sickle cell crisis. v Rh disease of newborn.

What is the cause of Crigler-Najjar Syndrome?. Bilirubin conjugation is low because of genetic or functional deficiency of the “UDP- Glucuronyl transferase” system, unconjugated & total bilirubin increase. What are the causes of Bile Duct Occlusion?. Occlusion of the bile duct (gallstone, primary biliary cirrhosis, pancreatic cancer) prevents conjugated bilirubin leaving the liver.

IInnbboorrnn EErrrroorrss ooff AAmmiinnoo AAcciidd MMeettaabboolliissmm

6

11.. WWhhiicchh oonnee ooff tthhee ffoolllloowwiinngg ssttaatteemmeennttss ccoonncceerrnniinngg aa oonnee--wweeeekk--oolldd mmaallee iinnffaanntt wwiitthh uunnddeetteecctteedd ccllaassssiicc pphheennyyllkkeettoonnuurriiaa iiss ccoorrrreecctt?? AA.. TTyyrroossiinnee iiss aa nnoonneesssseennttiiaall aammiinnoo aacciidd ffoorr tthhee iinnffaanntt.. BB.. HHiigghh lleevveellss ooff pphheennyyllppyyrruuvvaattee aappppeeaarr iinn hhiiss uurriinnee..√√ CC.. TThheerraappyy mmuusstt bbeeggiinn wwiitthh tthhee ffiirrsstt yyeeaarr ooff lliiffee.. DD.. AA ddiieett ddeevvooiidd ooff pphheennyyllaallaanniinnee sshhoouulldd bbee iinniittiiaatteedd iimmmmeeddiiaatteellyy.. EE.. WWhheenn tthhee iinnffaanntt rreeaacchheess aadduulltthhoooodd,, iitt iiss rreeccoommmmeennddeedd tthhaatt ddiieetttthheerraappyy bbee ddiissccoonnttiinnuueedd.. AAnnsswweerr:: BB.. PPhheennyyllllaaccttaattee,, pphheennyyllaacceettaattee,, aanndd pphheennyyllppyyrruuvvaattee wwhhiicchh aarree nnoott nnoorrmmaallllyy pprroodduucceedd iinn ssiiggnniiffiiccaanntt aammoouunnttss iinn tthhee pprreesseennccee ooff ffuunnccttiioonnaall pphheennyyllaallaanniinnee hhyyddrrooxxyyllaassee,, aarree eelleevvaatteedd iinn PPKKUU,, ttyyrroossiinnee ccaannnnoott bbee ssyynntthheessiizzeedd ffrroomm pphheennyyllaallaanniinnee aanndd,, hheennccee bbeeccoommeess eesssseennttiiaall aanndd mmuusstt bbee ssuupppplliieedd iinn tthhee ddiieett.. TTrreeaattmmeenntt mmuusstt bbeeggiinn dduurriinngg tthhee ffiirrsstt 77--1100 ddaayyss ooff lliiffee ttoo pprreevveenntt mmeennttaall rreettaarrddaattiioonn.. DDiissccoonnttiinnuuaannccee ooff tthhee pphheennyyllaallaanniinnee--rreessttrriicctteedd ddiieett bbeeffoorree 88 yyeeaarrss ooff aaggee iiss aassssoocciiaatteedd wwiitthh ppoooorr ppeerrffoorrmmaannccee oonn IIQQ tteessttss.. AAdduulltt PPKKUU ppaattiieennttss sshhooww ddeetteerriioorraattiioonn ooff aatttteennttiioonn aanndd ssppeeeedd ooff mmeennttaall pprroocceessssiinngg aafftteerr ddiissccoonnttiinnuuaattiioonn ooff tthhee ddiieett.. LLiiffee--lloonngg rreessttrriiccttiioonn ooff ddiieettaarryy pphheennyyllaallaanniinnee iiss,, tthheerreeffoorree,, rreeccoommmmeennddeedd.. 22.. AA nneeww tteesstt iiss ddeevveellooppeedd tthhaatt ccaann nnoonn--rraaddiiooaaccttiivveellyy ““llaabbeell”” ccoommppoouunnddss iinn tthhee hhuummaann bbooddyy.. AAss aa pphhyyssiicciiaann wwiitthh aa bbaacckk--ggrroouunndd IInn tthhee nneeww ffiieelldd ooff mmeettaabboolloommiiccss,, yyoouu aasssseessss aa 2211--yyeeaarr--oolldd wwiitthh ccllaassssiiccaall pphheennyyllkkeettoonnuurriiaa ((PPKKUU)).. PPhheennyyllaallaanniinnee iiss ffeedd wwiitthh aa llaabbeell iinn tthhee pphheennyyll rriinngg.. IInn tthhee uurriinnee,, iinn wwhhiicchh ooff tthhee ffoolllloowwiinngg ccoommppoouunnddss wwoouulldd yyoouu eexxppeecctt ttoo ffiinndd tthhee ggrreeaatteesstt aammoouunntt ooff llaabbeell??..

AA.. TTyyrroossiinnee.. BB.. TTrryyppttoopphhaann.. CC.. EEppiinneepphhrriinnee.. DD.. PPhheennyyllkkeettoonnee..√√ EE.. AAcceettaattee..

AAnnsswweerr:: DD.. PPhheennyyllkkeettoonnuuttrriiaa ((PPKKUU)) iiss aa ddeeffeecctt iinn pphheennyyllaallaanniinnee hhyyddrrooxxyyllaassee,, rreessuullttiinngg iinn aa bblloocckk iinn tthhee ccoonnvveerrssiioonn ooff pphheennyyllaallaanniinnee ttoo ttyyrroossiinnee.. PPhheennyyllaallaanniinnee aaccccuummuullaatteess iinn iinn bbootthh ddiissoorrddeerrss aanndd ttoo ccoonnvveerrtteedd ttoo pphheennyyllkkeettoonneess.. TTyyrroossiinnee iiss tthhee pprroodduucctt wwhhoossee ffoorrmmaattiioonn iiss bblloocckkeedd,, aanndd eeppiinneepphhrriinnee,, aa pprroodduucctt ooff ttyyrroossiinnee,, wwoouulldd nnoott bbee mmaaddee oorr ““llaabbeelllleedd’’.. AAcceettaattee aanndd ttrryyppttoopphhaann aarree vveerryy ffaarr ddoowwnnssttrreeaamm ffrroomm ttyyrroossiinnee..

7

33.. AA 5566--yyeeaarr--oolldd mmaann wwiitthh aa hhiissttoorryy ooff ggeenneettiicc ddiisseeaassee uunnddeerrggooeess hhiipp rreeppllaacceemmeenntt ssuurrggeerryy ffoorr aarrtthhrriittiiss.. DDuurriinngg tthhee ooppeerraattiioonn tthhee ssuurrggeeoonnss nnootteess aa ddaarrkk ppiiggmmeennttaattiioonn ((oocchhrroonnoossiiss)) iinn tthhee mmaann’’ss ccaarrttiillaaggee.. HHiiss oocchhrroonnoottiicc aarrtthhrriittiiss iiss mmoosstt lliikkeellyy ccaauusseedd bbyy ooxxiiddaattiioonn aanndd ppoollyymmeerriizzaattiioonn ooff eexxcceessss ttiissssuuee::

AA.. HHoommooggeennttiissiicc aacciidd..√√ BB.. OOrroottiicc aacciidd.. CC.. MMeetthhyyllmmaalloonniicc aacciidd.. DD.. UUrriicc aacciidd.. EE.. AAssccoorrbbiicc aacciidd..

AAnnsswweerr:: AA.. AAdduullttss wwiitthh aallccaappttoonnuurriiaa sshhooww aa hhiigghh pprreevvaalleennccee ooff ooccrroonnoottiicc aarrtthhrriittiiss dduuee ttoo ddeeffiicciieennccyy ooff hhoommooggeennttiissaattee ooxxiiddaassee.. 44.. AA ffoouurr--yyeeaarr--oolldd bbooyy ooff aa ffiirrsstt--ddeeggrreeee ccoonnssaanngguuiinneeoouuss ccoouuppllee wwaass nnootteedd bbyy tthhee ppaarreennttss ttoo hhaavvee ddaarrkkeenniinngg ooff tthhee uurriinnee ttoo aann aallmmoosstt bblloocckk ccoolloorr wwhheenn iitt wwaass lleefftt ssttaannddiinngg.. HHee hhaadd aa nnoorrmmaall ssiibblliinngg,, aanndd tthheerree wweerree nnoo ootthheerr mmeeddiiccaall pprroobblleemmss.. CChhiillddhhoooodd ggrroowwtthh aanndd ddeevveellooppmmeenntt wweerree nnoorrmmaall.. WWhhiicchh ooff tthhee ffoolllloowwiinngg iiss mmoosstt lliikkeellyy ttoo bbee eelleevvaatteedd iinn tthhiiss ppaattiieenntt?? AA.. MMeetthhyyllmmaalloonnaattee.. BB.. HHoommooggeennttiissaattee..√√ CC.. PPhheennyyllppyyuuvvaattee.. DD.. αα--KKeettooiissoovvaalleerraattee.. EE.. HHoommooccyyssttiinnee..

PhenylketoneuriaPhenylketoneuria (PKU)(PKU)

DeficiencyDeficiency

Congenital deficiency of the Congenital deficiency of the enzyme enzyme ““PhenylalninePhenylalninehydroxylasehydroxylase”” leads to PKU, which leads to PKU, which is characterized by the is characterized by the ↑↑sedsedexcretion of excretion of phenylpuruvatephenylpuruvate, , phenylacetatephenylacetate & & phenyllactatephenyllactate ininUrine (Urine (Phenyl Phenyl ketoketo acidsacids).).

The coenzyme The coenzyme TetrahydroTetrahydrobiopterinbiopterin is required for the is required for the bioconversion of Phenylalanine bioconversion of Phenylalanine into Tyrosine.into Tyrosine.

8

AAnnsswweerr:: BB.. AAllkkaappttoonnuurriiaa iiss aa rraarree mmeettaabboolliicc ddiisseeaassee iinnvvoollvviinngg aa ddeeffiicciieennccyy iinn hhoommooggeennttiissiicc aacciidd ooxxiiddaassee,, aanndd tthhee ssuubbsseeqquueenntt aaccccuummuullaattiioonn ooff hhoommooggeennttiissiicc aacciidd iinn tthhee uurriinnee,, wwhhiicchh ttuurrnnss ddaarrkk oonn ssttaannddiinngg.. TThhee eelleevvaattiioonn ooff mmeetthhyyllmmaalloonnaattee ((dduuee ttoo mmeetthhyyllmmaalloonnyyll CCooAA mmuuttaassee ddeeffiicciieennccyy)),, pphheennyyllppyyrruuvvaattee dduuee ttoo pphheennyyllaallaanniinnee hhyyddrrooxxyyllaassee ddeeffiicciieennccyy)),, αα--kkeettooiissoovvaalleerraattee ((dduuee ttoo bbrraanncchheedd--cchhaaiinn αα--kkeettoo aacciidd ddeehhyyddrrooggeennaassee ddeeffiicciieennccyy)),, aanndd hhoommooccyyssttiinnee ((dduuee ttoo ccyyssttaatthhiioonniinnee ssyynntthhaassee ddeeffiicciieennccyy)) aarree iinnccoonnssiisstteenntt wwiitthh aa hheeaalltthhyy cchhiilldd wwiitthh ddaarrkkeenniinngg ooff tthhee uurriinnee.. 55.. AA--5566--yyeeaarr--oolldd mmaann wwiitthh aa hhiissttoorryy ooff ggeenneettiicc ddiisseeaassee uunnddeerrggooeess hhiipp rreeppllaacceemmeenntt ssuurrggeerryy ffoorr aarrtthhrriittiiss.. DDuurriinngg tthhee ooppeerraattiioonn tthhee ssuurrggeeoonn nnootteess aa ddaarrkk ppiiggmmeennttaattiioonn ((oocchhrroonnoossiiss)) iinn tthhee mmaann’’ss ccaarrttiillaaggee.. HHiiss oocchhrroonnoottiicc aarrtthhrriittiiss iiss mmoosstt lliikkeellyy ccaauusseedd bbyy ooxxiiddaattiioonn aanndd ppoollyymmeerriizzaattiioonn ooff eexxcceessss ttiissssuuee::

AA.. hhoommooggeennttiissiicc aacciidd..√√ BB.. oorroottiicc aacciidd.. CC.. mmeetthhyyllmmaalloonniicc aacciidd.. DD.. uurriicc aacciidd.. EE.. aassccoorrbbiicc aacciidd..

AAnnsswweerr:: AA.. AAdduullttss wwiitthh aallccaappttoonnuurriiaa sshhooww aa hhiigghh pprreevvaalleennccee ooff oocchhrroonnoottiicc aarrtthhrriittiiss dduuee ttoo ddeeffiicciieennccyy ooff hhoommooggeennttiissaattee ooxxiiddaassee..

9

HomogentisicHomogentisic Acid FormationAcid Formation

CH2CHCO2-

NH3+

HO

OH

OH

CH2CO2-

TransaminationTransamination

TyrosineTyrosine pp--HydroxyphenylHydroxyphenyl--PyruvatePyruvate

↑↑ HomogentisateHomogentisate

pp--HydroxyphenylHydroxyphenyl--pyruvatepyruvatedioxygenasedioxygenase((ascorbateascorbate--depdep.).)

OO22

COCO22

CH2CCO2-

O

HO

HomogentisateHomogentisatedioxygenasedioxygenase

OO22

Cleavage of Cleavage of aromatic ringaromatic ring

FumarateFumarate + + AcetoacetateAcetoacetate

Deficient in Deficient in AlkaptonuriaAlkaptonuria

AlkaptonuriaAlkaptonuria

XX

?

77.. AA 77--ddaayy--oolldd ggiirrll hhaass hhaadd aa sseeiizzuurree.. TThhee mmootthheerr eexxppllaaiinnss tthhaatt tthhee bbaabbyy hhaass bbeeeenn vvoommiittiinngg aanndd hhaavviinngg ddiiffffiiccuullttyy ffeeeeddiinngg ffoorr tthhee ppaasstt 22 ddaayyss.. TThheerree iiss aallssoo aa ssttrraannggee,, sswweeeett ssmmeellll ttoo hheerr ddiiaappeerrss.. PPhhyyssiiccaall eexxaammiinnaattiioonn iiss uunnrreemmaarrkkaabbllee,, eexxcceepptt ffoorr iinnddiiccaattiioonnss ooff ddeehhyyddrraattiioonn.. SSeerruumm tteesstt rreessuullttss sshhooww nnoorrmmaall lleevveellss ooff gglluuccoossee aanndd aammmmoonniiaa.. UUnniinnaallyyssiiss rreevveeaallss tthhee pprreesseennccee ooff αα--kkeettoo--iissooccaapprrooaattee aanndd αα--kkeettoo--iissoovvaalleerraattee.. EElleevvaattiioonn ooff tthhiiss ppaattiieennttss lliivveerr wwoouulldd rreevveeaall ddeeffiicciieennccyy ooff wwhhiicchh ooff tthhee ffoolllloowwiinngg eennzzyymmeess?? AA.. AAllaanniinniinnee aammiinnoottrraannssffeerraassee.. BB.. GGlluuttaammiinnee ssyynntthheettaassee.. CC.. CCyyssttaatthhiioonniinnee ββ--ssyynntthhaassee.. DD.. CCaarrbbaammooyyll pphhoosspphhaattee ssyynntthheettaassee.. EE.. αα--KKeettoo aacciidd ddeehhyyddrrooggeennaassee..√√

CCoorrrreecctt AAnnsswweerr:: EE:: TThhee iinnffaanntt aappppeeaarrss ttoo bbee ssuuffffeerriinngg ffrroomm mmaappllee ssyyrruupp uurriinnee ddiisseeaassee ((MMSSUUDD)).. TThhiiss iidd ccoonnssiisstteenntt aallll tthhee ssyymmppttoommss aanndd iiss ssttrroonnggllyy ssuuppppoorrtteedd bbootthh bbyy tthhee ssuubbjjeeccttiivvee,, ““sswweeeett”” ssmmeellll ooff tthhee bbaabbyy’’ss uurriinnee aanndd tthhee ffiinnddiinnggss ooff αα--kkeettoo aacciiddss iinn hheerr uurriinnee.. TThhiiss ccoonnddiittiioonn iiss pprroodduucceedd bbyy iinnhheerriitteedd ddeeffiicciieennccyy ooff αα--kkeettoo aacciidd ddeehhyyddrrooggeennaassee,, aa kkeeyy eennzzyymmee iinn ddeeggrraaddaattiioonn ooff tthhee bbrraanncchheedd--cchhaaiinn aammiinnoo aacciiddss..

10

88.. AA 77--yyeeaarr--oolldd ggiirrll hhaass sseeiizzuurree.. TThhee mmootthheerr eexxppllaaiinnss tthhaatt tthhee bbaabbyy hhaass bbeeeenn vvoommiittiinngg aanndd hhaavviinngg ddiiffffiiccuullttyy ffeeeeddiinngg ffoorr tthhee ppaasstt 22 ddaayyss.. TThheerree iiss aallssoo aa ssttrraannggee sswweeeett ssmmeellll ttoo hheerr ddiiaappeerrss.. PPhhyyssiiccaall eexxaammiinnaattiioonn iiss uunnrreemmaarrkkaabbllee,, eexxcceepptt ffoorr iinnddiiccaattiioonnss ooff ddeehhyyddrraattiioonn.. SSeerruumm tteesstt rreessuullttss sshhooww nnoorrmmaall lleevveellss ooff gglluuccoossee aanndd aammmmoonniiaa.. UUrriinnaallyyssiiss rreevveeaallss tthhee pprreesseennccee ooff αα--kkeettoo--iissooccaapprrooaattee aanndd αα--kkeettoo--iissoovvaalleerraattee.. EEvvaalluuaattiioonn ooff tthhiiss ppaattiieennttss lliivveerr wwoouulldd rreevveeaall ddeeffiicciieennccyy ooff wwhhiicchh ooff tthhee ffoolllloowwiinngg eennzzyymmeess??

AA.. AAllaanniinnee aammiinnoottrraannssffeerraassee ((AALLTT)).. BB.. GGlluuttaammiinnee ssyynntthheettaassee.. CC.. CCyyssttaatthhiioonniinnee ββ--ssyynntthhaassee.. DD.. CCaarrbbaammooyyll pphhoosspphhaattee ssyynntthheettaassee.. EE.. αα--KKeettoo aacciidd ddeehhyyddrrooggeennaassee..√√

AAnnss:: EE.. TThhee iinnffaanntt aappppeeaarrss ttoo bbee ssuuffffeerriinngg ffrroomm MMSSUUDD.. TThhiiss iiss ccoonnssiisstteenntt wwiitthh aallll ssyymmppttoommss aanndd iiss ssttrroonnggllyy ssuuppppoorrtteedd bbyy bbootthh bbyy tthhee ssuubbjjeeccttiivvee,, ““sswweeeett’’ ssmmeellll ooff tthhee bbaabbyy’’ss uurriinnee aanndd hhee ffiinnddiinnggss ooff αα--kkeettooaacciiddss iinn hheerr uurriinnee.. TThhiiss ccoonnddiittiioonn iiss pprroodduucceedd bbyy iinnhheerriitteedd ddeeffiicciieennccyy ooff αα--kkeettoo aacciidd ddeehhyyddrrooggeennaassee,, aa kkeeyy eennzzyymmee iinn ddeeggrraaddaattiioonn ooff tthhee BBCCCCAAss.. NNoonnee ooff tthhee ootthheerr eennzzyymmee ddeeffiicciieenncciieess lliisstteedd ccaann AAccccoouunntt ffoorr tthhiiss uunniiqquuee sseett ooff ssyymmppttoommss.. SSoommee ccaasseess ooff AALLTT ddeeffiicciieennccyy hhaavvee bbeeeenn rreeppoorrtteedd bbuutt oonnllyy iinn aassssoocciiaattiioonn wwiitthh vviirraall iinnffeeccttiioonnss aanndd tthheerree wweerree nnoo ssyymmppttoommss aarrrrttiibbuuttaabbllee ttoo rreedduucceedd AALLTT aaccttiivviittyy.. GGlluuttaammiinnee ssyynntthheettaassee ddeeffiicciieennccyy iiss rraarree,, aauuttoossoommaall rreecceessssiivvee ddiissoorrddeerr tthhaatt hhaass pprroodduucceedd sseevveerree mmaallffoorrmmaattiioonnss ooff tthhee bbrraaiinn,, mmuullttiippllee oorrggaann ffaaiilluurree,, aanndd nneeoonnaattaall ddeeaatthh iinn ccoonnffiirrmmeedd ccaasseess.. CCyyssttaatthhiioonniinnee--ββ--ssyynntthhaassee ddeeffiicciieennccyy iiss kkeeyy ttoo hhoommooccyysstteeiinnuurriiaa.. DDeeffiicciieennccyy ooff ccaarrbbaammooyyll pphhoosspphhaattee ssyynntthheettaassee pprroodduucceess hhyyppeerraammmmoonneemmiiaa,, wwhhiicchh iiss nnoott oobbsseerrvveedd iinn tthhiiss ccaassee..

Degradation of Degradation of LeucineLeucine,,ValineValine & & IsoleucineIsoleucine

☻?

Maple Syrup Urine Maple Syrup Urine DiseaseDisease (MSUD)(MSUD)

Deficiency of Branched Chain Deficiency of Branched Chain αα--KetoKeto Acid Acid DehydrogenaseDehydrogenase ComplexComplex Leads to MSUDLeads to MSUD..

LeucineLeucine, , ValineValine & & IsoleucineIsoleucine are Branched are Branched Chain Amino Acids (BCAA).Chain Amino Acids (BCAA).

11

99.. AA 1111--yyeeaarr--oolldd--ggiirrll bbeeiinngg eevvaalluuaatteedd ffoorr aa ppoossssiibbllee lleeaarrnniinngg ddiissoorrddeerr.. RReecceenntt tteessttiinngg iinnddiiccaatteess hheerr IIQQ iiss 7733.. SShhee rreeppoorrttss hhaavviinngg pprroobblleemmss sseeeeiinngg iinn ccllaassss aanndd ffrreeqquueennttllyy ffiinnddss iitt nneecceessssaarryy ttoo ssqquuiinntt aass sshhee rreeaaddss.. PPhhyyssiiccaall eexxaammiinnaattiioonn rreevveeaallss lleennss ddiissllooccaattiioonn ((ddoowwnnwwaarrdd oorriieennttaattiioonn));; lloonngg,, tthhiinn ffiinnggeerrss aanndd ttooeess ((aarraacchhnnooddaaccttyyllyyll));; hhiigghh aarrcchheedd ppaallaattee;; aanndd mmiilldd ssccoolliioossiiss.. AA sseerriieess ooff rraaddiiooggrraapphhss iinnddiiccaatteess ggeenneerraalliizzeedd oosstteeooppoorroossiiss.. AAnn eelleevvaattiioonn ooff tthhiiss ppaattiieenntt’’ss bblloooodd aanndd uurriinnee wwoouulldd mmoosstt lliikkeellyy rreevveeaall aann eelleevvaatteedd lleevveell ooff wwhhiicchh ooff tthhee ffoolllloowwiinngg ccoommppoouunnddss?? AA.. MMeetthhiioonniinnee..√√ BB.. CCyysseeiinnee CC.. LLaaccttaattee DD.. CCyyssttaatthhiioonniinnee EE.. UUrreeaa.. CCoorrrreecctt AAnnsswweerr:: AA.. TThhee ccoonnsstteellllaattiioonn ooff ssyymmppttoommss eexxhhiibbiitteedd bbyy tthhiiss ppaattiieenntt iiss cchhaarraacctteerriissttiicc ooff hhoommooccyyssttiinnuurriiaa.. TThhee iimmppaaiirrmmeenntt ooff hheerr ccooggnniittiivvee ffuunnccttiioonn ccoouulldd bbee aattttrriibbuutteedd ttoo mmaannyy ccoonnddiittiioonnss,, bbuutt tthhee kkeeyy ffiinnddiinnggss aarree eeccttooppiiaa lleennttiiss wwiitthh ddoowwnnwwaarrdd lleennss ddiissllooccaattiioonn aanndd oosstteeooppoorroossiiss IInn aa ffeemmaallee ooff tthhiiss aaggee.. HHoommooccyysstteeiinnuurriiaa iiss pprroodduucceedd bbyy iinnhheerriitteedd ddeeffiicciieennccyy ooff oonnee ooff tthhee eennzzyymmeess iinn tthhee ppaatthhwwaayy ooff MMeett ccoonnvveerrssiioonn ttoo CCyyss.. TThhee mmoosstt CCoommmmoonn ffoorrmm iiss ccyyssttaatthhiioonniinnee ββ--ssyynntthhaassee ddeeffiicciieennccyy,, wwhhiicchh rreessuullttss iinn aaccccuummuullaattiioonn ooff aallll uuppssttrreeaamm ccoommppoonneennttss ooff tthhee ppaatthhwwaayy,, iinncclluuddiinngg hhoommooccyysstteeiinnee,, wwhhiicchh iiss rreessppoonnssiibbllee ffoorr tthhee ttooxxiicc eeffffeeccttss,, aanndd MMeett,, wwhhiicchh bbeeccoommeess eelleevvaatteedd iinn tthhee bblloooodd.. CCyyssttaatthhiioonniinnee aanndd ccyysstteeiinnee,, wwhhiicchh aarree bbootthh ddoowwnn ssttrreeaamm ooff tthhee bblloocckk iinn tthhee ppaatthhwwaayy CCaauusseedd bbyy ccyyssttaatthhiioonniinnee ββ--ssyynntthhaassee ddeeffiicciieennccyy,, wwoouulldd bbee ddeeccrreeaasseedd.. MMeettaabboolliicc ppaatthhwwaayyss ffoorr llaaccttaattee aanndd uurreeaa aarree nnoott iinnvvoollvveedd iinn tthhiiss mmeecchhaanniissmm.. 1100.. AA 4499--yyeeaarr--oolldd mmaann wwiitthh aa rraarree rreecceessssiivvee ccoonnddiittiioonn iiss aatt hhiigghh rriisskk ffoorr ddeeeepp vveeiinn tthhrroommbboossiiss aanndd ssttrrookkee aanndd hhaass hhaadd rreeppllaacceemmeenntt ooff eeccttooppiicc lleennsseess.. HHee hhaass aa nnoorrmmaall hheemmaattooccrriitt aanndd nnoo eevviiddeennccee ooff mmeeggaalloobbllaassttiicc aanneemmiiaa.. AAmmiinnoo aacciidd aannaallyyssiiss ooff tthhiiss ppaattiieenntt’’ss ppllaassmmaa wwoouulldd mmoosstt lliikkeellyy rreevveeaall aann aabbnnoorrmmaallllyy eelleevvaatteedd lleevveell ooff,,

AA.. llyyssiinnee.. BB.. LLeeuucciinnee.. CC.. mmeetthhiioonniinnee..√√ DD.. oorrnniitthhiinnee.. EE.. ccyysstteeiinnee..

AAnnsswweerr:: CC.. OOnnllyy mmeetthhiioonniinnee iiss ddeeggrraaddeedd vviiaa tthhee HHoommooccyysstteeiinnee // CCyyssttaatthhiioonniinnee ppaatthhwwaayy aanndd wwoouulldd bbee eelleevvaatteedd iinn tthhee ppllaassmmaa ooff aa ccyyssttaatthhiioonniinnee ssyynntthhaassee--ddeeffiicciieenntt ppaattiieenntt vviiaa aaccttiivvaattiioonn ooff hhoommooccyysstteeiinnee mmeetthhyyllttrraannssffeerraassee bbyy eexxcceessss ssuubbssttrraattee..

12

1111.. AA 4499--yyeeaarr--oolldd mmaann wwiitthh aa rraarree rreecceessssiivvee ccoonnddiittiioonn iiss aatt hhiigghh rriisskk ffoorr ddeeeepp vveeiinn tthhrroommbboossiiss aanndd ssttrrookkee aanndd hhaass hhaadd rreeppllaacceemmeenntt ooff eeccttooppiicc lleennsseess.. HHee hhaass aa nnoorrmmaall hheemmaattooccrriitt aanndd nnoo eevviiddeennccee ooff mmeeggaalloobbllaassttiicc aanneemmiiaa.. AA mmuuttaattiioonn iinn tthhee ggeennee eennccooddiinngg wwhhiicchh ooff tthhee ffoolllloowwiinngg iiss mmoosstt lliikkeellyy ttoo ccaauussee tthhiiss ddiisseeaassee??

AA.. CCyyssttaatthhiioonniinnee ssyynntthhaassee..√√ BB.. HHoommooccyysstteeiinnee mmeetthhyyllttrraannssffeerraassee CC.. FFiibbrriilllliinn.. DD.. LLyyssyyll ooxxiiddaassee.. EE.. BBrraanncchheedd cchhaaiinn αα--kkeettoo aacciidd ddeehhyyddrrooggeennaassee..

AAnnsswweerr:: AA.. HHoommooccyysstteeiinnee,, tthhee ssuubbssttrraattee ffoorr tthhee eennzzyymmee,, aaccccuummuullaatteess iinnccrreeaassiinngg tthhee rriisskk ooff ddeeeepp vveeiinn tthhrroommbboossiiss aanndd ddiissrruuppttiinngg tthhee nnoorrmmaall ccrroosssslliinnkkiinngg ooff ffiibbrriilllliinn.. DDeeffffiicciieennccyy ooff hhoommooccyysstteeiinnee mmeetthhyyllttrraannssffeerraassee wwoouulldd ccaauussee hhoommooccyysstteeiinnuurriiaa,, bbuutt wwoouulldd aallssoo pprreeddiissppoossee ttoo mmeeggaalloobbllaassttiicc aanneemmiiaa..

♫?

Dislocated Lens in Dislocated Lens in HomocystinuriaHomocystinuria

13

A Degradation & Degradation & ResynthesisResynthesis of of MethionineMethionine

HomocystinuriaHomocystinuria

CystathionuriaCystathionuria

TransTrans--SulfurationSulfuration PathwayPathwayEnzyme Deficiency in Enzyme Deficiency in HomocystinuriaHomocystinuria

CystathinaseCystathinase

NHNH33PLPPLP

TransTrans--SulfurationSulfuration pathway is pathway is analagousanalagous to to transaminationtransamination for for AAsAAs..

Two Two RXNsRXNs, both use , both use pyridoxalpyridoxalphosphate (phosphate (VitVit BB66) as a cofactor ) as a cofactor (as with (as with transaminationtransamination).).

☻

BB66

14

1122.. AA 4499--yyeeaarr--oolldd mmaann wwiitthh aa rraarree rreecceessssiivvee ccoonnddiittiioonn iiss aatt hhiigghh rriisskk ddeeeepp vveeiinn tthhrroommbboossiiss aanndd ssttrrookkee aanndd hhaass hhaadd rreeppllaacceemmeenntt ooff eeccttooppiicc lleennsseess.. HHee hhaass aa nnoorrmmaall hheemmaattooccrriitt aanndd nnoo eevviiddeennccee ooff mmeeggaalloobbllaassttiicc aanneemmiiaa.. AAmmiinnoo aacciidd aannaallyyssiiss ooff tthhiiss ppaattiieenntt’’ss ppllaassmmaa wwoouulldd mmoosstt lliikkeellyy rreevveeaall aann aabbnnoorrmmaallllyy eelleevvaatteedd lleevveellss ooff,,

AA.. llyyssiinnee.. BB.. lleeuucciinnee.. CC.. mmeetthhiioonniinnee..√√ DD.. oorrnniitthhiinnee.. EE.. ccyysstteeiinnee..

AAnnsswweerr:: CC.. OOnnllyy mmeetthhiioonniinnee iiss ddeeggrraaddeedd vviiaa tthhee hhoommooccyysstteeiinnee // ccyyssttaatthhiioonniinneemmiiaa ppaatthhwwaayy aanndd wwoouulldd bbee eelleevvaatteedd iinn tthhee ppllaassmmaa ooff ccyyssttaatthhiioonniinnee ssyynntthhaassee--ddeeffiicciieenntt ppaattiieenntt vviiaa aaccttiivvaattiioonn ooff hhoommooccyysstteeiinnee mmeetthhyyllttrraannssffeerraassee bbyy eexxcceessss ssuubbssttrraattee.. 1133.. IInn tthhee ssyynntthheessiiss ooff ccyysstteeiinnee,, tthhee ccaarrbboonn aattoommss ((nneeaarreesstt pprreeccuurrssoorr)) aarree pprroovviiddeedd bbyy wwhhiicchh ooff tthhee ffoolllloowwiinngg??

AA.. AAssppaarrttiicc aacciidd.. BB.. MMeetthhiioonniinnee.. CC.. OOxxaallooaacceettiicc aacciidd.. DD.. SSeerriinnee..√√ EE.. HHoommooccyysstteeiinnee..

AAnnsswweerr:: DD.. TThhiiss qquueessttiioonn rreeffeerrss ttoo tthhee pprreeccuurrssoorr ooff tthhee ccaarrbboonn aattoommss ooff ccyysstteeiinnee tthhaatt aarree pprroovviiddeedd bbyy sseerriinnee.. HHoommooccyysstteeiinnee,, aa ddiirreecctt pprreeccuurrssoorr,, oonnllyy ssuupppplliieess ssuullffuurr.. TThheessee ttwwoo mmoolleeccuulleess ffoorrmm ccyyssttaatthhiioonniinnee.. MMeetthhiioonniinnee iiss tthhee pprreeccuurrssoorr ttoo hhoommooccyysstteeiinnee.. AAssppaarrttaattee aanndd ooxxaallooaacceettaattee aarree iinnvvoollvveedd iinn ttrraannssaammiinnaattiioonn aanndd ddoo nnoott ddiirreeccttllyy aaffffeecctt ccyysstteeiinnee ssyynntthheessiiss.. WWhhiicchh ooff tthhee ffoolllloowwiinngg aammiinnoo aacciiddss iiss aa pprreeccuurrssoorr ttoo ccyysstteeiinnee??

AA.. TThhrreeoonniinnee.. BB.. MMeetthhiioonniinnee..√√ CC.. GGlluuttaammiinnee.. DD.. LLyyssiinnee.. EE.. AAllaanniinnee..

AAnnss:: BB..

15

HHeemmee MMaattaabboolliissmm::

1144.. WWhhiicchh ooff tthhee ffoolllloowwiinngg ssttaatteemmeenntt aabboouutt hheemmee aanndd iirroonn mmeettaabboolliissmm iiss ccoorrrreecctt?? AA.. IIrroonn iiss ssttrroorreedd iinn tthhee lliivveerr aass ttrraannssffeerrrriinn.. BB.. IIrroonn ((aass FFee22++)) iiss iinnsseerrtteedd iinnttoo pprroottooppoorrppyyrriinn IIXX iinn tthhee llaasstt sstteepp ooff hheemmee ssyynntthheessiiss CC.. δδ--AALLAA ssyynntthhaassee ccaattaallyyzzeess tthhee rreegguullaatteedd aanndd rraattee--lliimmiittiinngg sstteepp iinn hheemmee bbiioossyynntthheessiiss..√√ DD.. TThhee mmaajjoorr rroouuttee ffoorr bbiilliirruubbiinn eexxccrreettiioonn iiss vviiaa tthhee uurriinnee.. EE.. TThhee iirroonn pprroodduucceedd bbyy hheemmee ddeeggrraaddaattiioonn iiss eexxccrreetteedd iinn tthhee ffeecceess.. AAnnsswweerr:: CC.. TThhee ffiirrsstt rraattee--lliimmiittiinngg sstteepp iinn hheemmee bbiioossyynntthheessiiss iinnvvoollvveess tthhee ccoonnddeennssaattiioonn ooff ggllyycciinnee aanndd ssuucccciinnyyll CCooAA ttoo ffoorrmm DDeellttaa--AALLAA.. IIrroonn iiss ssttoorreedd aass ffeerrrriittiinn && ttrraannssppoorrtteedd iinn tthhee bblloooodd iinn ttrraannssffeerrrriinn.. AAss FFee22++,, iitt iiss iinnsseerrtteedd iinnttoo pprroottooppoorrppyyrriinn IIXX ttoo ffoorrmm hheemmee.. WWhheenn hheemmee iiss ddeeggrraaddeedd ttoo ffoorrmm bbiilliirruubbiinn ((wwhhiicchh iiss eexxccrreetteedd mmaaiinnllyy vviiaa tthhee iinntteessttiinnee)),, iirroonn iiss rreettuurrnneedd ttoo tthhee bbooddyy’’ss iirroonn ssttoorreess aanndd iiss nnoott eexxccrreetteedd.. BBlleeeeddiinngg iiss tthhee oonnllyy ssiiggnniiffiiccaanntt mmeeaannss bbyy wwhhiicchh IIrroonn iiss lloosstt ffrroomm tthhee bbooddyy 1155.. AA 4444--yyeeaarr--oolldd wwoommaann iiss bbrroouugghhtt ttoo tthhee eemmeerrggeennccyy ddeeppaarrttmmeenntt ddoouubblleedd oovveerr wwiitthh aabbddoommiinnaall ppaaiinn.. HHeerr hhuussbbaanndd ssttaatteess tthhaatt tthhee ppaaiinn bbeeggaann sseevveerraall hhoouurrss eeaarrlliieerr,, ccoommeess iinn wwaavveess,, bbuutt hhaass nnoott rreeaallllyy ssuubbssiiddeedd ccoommpplleetteellyy eevveenn ffoorr bbrriieeff ppeerriiooddss ssiinnccee tthheenn.. OOrraall aannttaacciiddss hhaavvee nnoott hheellppeedd tthhee ppaaiinn aatt aallll.. HHeerr ddiissccoommffoorrtt iiss nnoott rreelliieevveedd bbyy ddeeffeeccaattiioonn.. AA ssttooooll ssaammppllee iiss lliigghhtt ggrraayy oorr ccllaayy--ccoolloorreedd.. PPhhyyssiiccaall eexxaammiinnaattiioonn sshhoowwss rriigghhtt uuppppeerr qquuaaddrraanntt aabbddoommiinnaall ppaaiinn.. HHeerr sscclleerraaee aarree sslliigghhttllyy yyeellllooww iinn ccoolloorr.. AA ssoonnooggrraamm sshhoowwss aa 22--ccmm mmaassss iinn tthhee rreeggiioonn ooff tthhee bbiillee dduucctt.. TTeessttiinngg ooff hheerr sseerruumm wwoouulldd bbee eexxppeecctteedd ttoo rreevveeaall eelleevvaatteedd lleevveellss ooff wwhhiicchh ooff tthhee ffoolllloowwiinngg?? AA.. AAllbbuummiinn--bboouunndd bbiilliirruubbiinn.. BB.. PPoorrpphhoobbiilliinnooggeenn.. CC.. FFrreeee,, uunnccoonnjjuuggaatteedd bbiilliirruubbiinn.. DD.. CCoonnjjuuggaatteedd bbiilliirruubbiinn // BBiilliirruubbiinn DDiigglluuccuurroonniiddee // DDiirreecctt BBiilliirruubbiinn.. EE.. BBiilliivveerrddiinn.. AAnnss:: DD..

1166.. AA wwoommaann 77 mmoonntthhss pprreeggnnaanntt wwiitthh hheerr ffiirrsstt cchhiilldd ddeevveellooppss aanneemmiiaa.. LLaabboorraattoorryy eevvaalluuaattiioonn iinnddiiccaatteess aann iinnccrreeaasseedd mmeeaann cceellll vvoolluummee ((MMCCVV)),, hhyyppeerrsseeggmmeenntteedd nneeuuttrroopphhiillss,, aanndd aalltteerreedd mmoorrpphhoollooggyy ooff sseevveerraall ootthheerr cceellll ttyyppeess.. TThhee mmoosstt lliikkeellyy uunnddeerrllyyiinngg ccaauussee ooff tthhiiss wwoommaann’’ss aanneemmiiaa iiss,,

AA.. FFoollaattee ddeeffiicciieennccyy..√√ BB.. IIrroonn ddeeffiicciieennccyy.. CC.. GGlluuccoossee--66--pphhoosspphhaattee ddeehhyyddrrooggeennaassee ddeeffiicciieennccyy.. DD.. CCyyaannooccoobbaallaammiinn ((BB1122)) ddeeffiicciieennccyy.. EE.. LLeeaadd ppooiissoonniinngg..

16

AAnnsswweerr:: AA.. PPrreeggnnaanntt wwoommaann wwiitthh mmeeggaalloobbllaassttiicc aanneemmiiaa aanndd eelleevvaatteedd sseerruumm hhoommooccyysstteeiinnee ssttrroonnggllyy ssuuggggeessttss ffoollaattee ddeeffiicciieennccyy.. IIrroonn ddeeffiicciieennccyy pprreesseennttss aass mmiiccrrooccyyttiicc,, hhyyppoocchhrroommiicc aanneemmiiaa aanndd wwoouulldd nnoott eelleevvaattee hhoommooccyyaatteeiinnee.. BB1122 ddeeffiicciieennccyy iiss nnoott mmoosstt lliikkeellyy iinn tthhiiss pprreesseennttaattiioonn..

1177.. AA 2233--yyeeaarr--oolldd,, ssiinnggllee,, uunneemmppllooyyeedd wwoommaann iinn hheerr eeiigghhtthh mmoonntthh ooff pprreeggnnaannccyy iiss sseeeenn iinn aa vvoolluunntteeeerr--ssttaaffffeedd oobbsstteettrriiccss cclliinniicc.. HHeerr ffiirrsstt cchhiilldd,, bboorrnn aatt hhoommee aanndd eexxcclluussiivveellyy bbrreeaasstt--ffeedd,, hhaadd pprroolloonnggeedd ddiiaarrrrhheeaa aanndd ddiieedd ffrroomm aann iinnttrraaccrraanniiaall hheemmoorrrrhhaaggee aatt 11 mmoonntthh ooff aaggee.. TToo hheellpp pprreevveenntt aa ssiimmiillaarr pprroobblleemm iinn tthhiiss pprreeggnnaannccyy,, tthhee rreessiiddeenntt ggiivveess hheerr aa ffrreeee pprreessccrriippttiioonn ffoorr aa vviittaammiinn aanndd aaddvviisseess hheerr ttoo ttaakkee oonnee 2200--mmgg ttaabblleett eeaacchh ddaayy.. HHee aallssoo iinnffoorrmmss hheerr tthhaatt tthhee iinnffaanntt sshhoouulldd rreecceeiivvee aann iinnjjeeccttiioonn ooff tthhiiss vviittaammiinn ssoooonn aafftteerr bbiirrtthh.. TThhee vviittaammiinn pprreessccrriibbeedd iiss rreeqquuiirreedd aass aa ccooeennzzyymmee bbyy wwhhiicchh ooff tthhee ffoolllloowwiinngg eennzzyymmeess??

AA.. δδ--AAmmiinnoolleevvuulliinnaattee ssyynntthhaassee..√√ BB.. LL--GGlluuttaammyyII ccaarrbbooxxyyllaassee.. CC.. HHoommooccyysstteeiinnee mmeetthhyyllttrraannssffeerraassee.. DD.. PPrroollyyll hhyyddrrooxxyyllaassee.. EE.. TThhrroommbbiinn..

AAnnss:: AA.. 1188.. AA 3366--yyeeaarr--oolldd GGrreeeekk mmaann wwiitthh vviirraall ppnneeuummoonniiaa hhaass aa sseellff--lliimmiittiinngg eeppiissooddee ooff hheemmoollyyssiiss.. OOvveerr tthhee nneexxtt wweeeekk,, hhee hhaass aann iinnccrreeaasseedd rraattee ooff rreettiiccuullooccyyttoossiiss.. WWhhiicchh ooff tthhee ffoolllloowwiinngg ccoommppoouunnddss sseerrvveess aass aa pprreeccuurrssoorr ttoo hheemmee iinn tthhee rreettiiccuullooccyytteess??

AA.. αα--KKeettoogglluuttaarraattee BB.. FFuummaarraattee CC.. IIssoocciittrraattee DD.. OOxxaallooaacceettaattee EE.. SSuucccciinnyyll--CCooAA√√

AAnnss:: EE..

1199.. AA 2233--yyeeaarr--oolldd,, ssiinnggllee,, uunneemmppllooyyeedd wwoommaann iinn hheerr eeiigghhtthh mmoonntthh ooff pprreeggnnaannccyy iiss sseeeenn iinn aa vvoolluunntteeeerr--ssttaaffffeedd oobbsstteettrriiccss cclliinniicc.. HHeerr ffiirrsstt cchhiilldd,, bboorrnn aatt hhoommee aanndd eexxcclluussiivveellyy bbrreeaasstt--ffeedd,, hhaadd pprroolloonnggeedd ddiiaarrrrhheeaa aanndd ddiieedd ffrroomm aann iinnttrraaccrraanniiaall hheemmoorrrrhhaaggee aatt 11 mmoonntthh ooff aaggee.. TToo hheellpp pprreevveenntt aa ssiimmiillaarr pprroobblleemm iinn tthhiiss pprreeggnnaannccyy,, tthhee rreessiiddeenntt ggiivveess hheerr aa ffrreeee pprreessccrriippttiioonn ffoorr aa vviittaammiinn aanndd aaddvviisseess hheerr ttoo ttaakkee oonnee 2200--mmgg ttaabblleett eeaacchh ddaayy.. HHee aallssoo iinnffoorrmmss hheerr tthhaatt tthhee iinnffaanntt sshhoouulldd rreecceeiivvee aann iinnjjeeccttiioonn ooff tthhiiss vviittaammiinn ssoooonn aafftteerr bbiirrtthh.. TThhee vviittaammiinn pprreessccrriibbeedd iiss rreeqquuiirreedd aass aa ccooeennzzyymmee bbyy wwhhiicchh ooff tthhee ffoolllloowwiinngg eennzzyymmeess?? ((AA)).. δδ--AAmmiinnoolleevvuulliinnaattee ssyynntthhaassee..√√ ((BB)).. LL--GGlluuttaammyyII ccaarrbbooxxyyllaassee ((CC)).. HHoommooccyysstteeiinnee mmeetthhyyllttrraannssffeerraassee ((DD)).. PPrroollyyll hhyyddrrooxxyyllaassee ((EE)).. TThhrroommbbiinn.. AAnnss:: AA..

17

2200.. AA 6622--yyeeaarr--oolldd mmaann bbeeiinngg ttrreeaatteedd ffoorr ttuubbeerrccuulloossiiss ddeevveellooppss aa mmiiccrrooccyyttiicc,, hhyyppoocchhrroommiicc aanneemmiiaa.. FFeerrrriittiinn lleevveellss aarree iinnccrreeaasseedd,, aanndd mmaarrkkeedd ssiiddeerroobbllaassttoossiiss iiss pprreesseenntt.. AA ddeeccrreeaassee iinn wwhhiicchh ooff tthhee ffoolllloowwiinngg eennzzyymmee aaccttiivviittiieess iiss mmoosstt ddiirreeccttllyy rreessppoonnssiibbllee ffoorr tthhee aanneemmiiaa iinn tthhiiss mmaann??

AA.. CCyyttoocchhrroommee ooxxiiddaassee.. BB.. CCyyttoocchhrroommee PP445500 ooxxiiddaassee.. CC.. PPyyrruuvvaattee kkiinnaassee.. DD.. δδ--aammiinnoolleevvuulliinnaattee ssyynntthhaassee..√√ EE.. LLyyssyyll ooxxiiddaassee..

AAnnss:: DD.. δδ--aammiinnoolleevvuulliinnaattee ssyynntthhaassee ((δδ--AALLAA SSyynntthhaassee)).. SSiiddeerroobbllaassttiicc aanneemmiiaa iinn aa ppeerrssoonn bbeeiinngg ttrreeaatteedd ffoorr TTuubbeerrccuulloossiiss ((wwiitthh iissoonniiaazziidd)) iiss mmoosstt lliikkeellyy dduuee ttoo vviittaammiinn BB66 ddeeffiicciieennccyy.. δδ --AAmmiinnoolleevvuulliinnaattee ssyynntthhaassee,, tthhee ffiirrsstt eennzzyymmee iinn hheemmee ssyynntthheessiiss,, rreeqquuiirreess vviittaammiinn BB66 ((ppyyrriiddooxxiinnee))..

PLPPLP

18

Pathway of Pathway of PorphyrinPorphyrin Synthesis:Synthesis:Formation of Formation of PorphobilinogenPorphobilinogen

PLP

PLP = Pyridoxal phosphate

Isoniazid = PLP Antagonist

Pathway of Pathway of PorphyrinPorphyrin Synthesis:Synthesis:Formation of Formation of HemeHeme

19

FFoorrmmaattiioonn ooff SSppeecciiaalliizzeedd PPrroodduuccttss FFrroomm AAmmiinnoo AAcciiddss::

2211.. WWhhiicchh ooff tthhee mmeettaabboolliitteess bbeellooww iiss aa pprreeccuurrssoorr ooff ttyyrroossiinnee..

AA.. LL--DDiihhyyddrrooxxyypphheennyyllaallaanniinnee ((ddooppaa)).. BB.. DDooppaammiinnee.. CC.. NNoorreeppiinneepphhrriinnee.. DD.. EEppiinneepphhrriinnee.. EE.. PPhheennyyllaallaanniinnee..√√

AAnnss:: EE..

2222.. AA 4488--yyeeaarr--oolldd mmaann ddeevveellooppeedd aabbddoommiinnaall ccoolliicc,, mmuussccllee ppaaiinn,, aanndd ffaattiigguuee.. FFoolllloowwiinngg aa 33--wweeeekk hhoossppiittaalliizzaattiioonn,, aaccuuttee iinntteerrmmiitttteenntt ppoorrpphhyyrriiaa wwaass iinniittiiaallllyy ddiiaaggnnoosseedd bbaasseedd oonn aa hhiigghh lleevveell ooff uurriinnaarryy δδ--aammiinnoolleevvuulliinniicc aacciidd.. SSuubbsseeqquueenntt aannaallyyssiiss ooff tthhee ppaattiieenntt’’ss cciirrccuullaattiinngg RRBBCCss rreevveeaalleedd tthhaatt 7700%% ccoonnttaaiinneedd eelleevvaatteedd lleevveellss ooff zziinncc pprroottooppoorrpphhyyrriinn,, aanndd tthhee ddiiaaggnnoossiiss wwaass ccoorrrreecctteedd.. TThhee ccoorrrreecctt ddiiaaggnnoossiiss iiss mmoosstt lliikkeellyy ttoo bbee,,

AA.. PPrroottooppoorrpphhyyrriiaa.. BB.. CCoonnggeenniittaall eerryytthhrrooppooiieettiicc ppoorrpphhyyrriiaa.. CC.. LLeeaadd ppooiissoonniinngg..√√ DD.. BBaarrbbiittuurraattee aaddddiiccttiioonn.. EE.. IIrroonn ddeeffiicciieennccyy..

20

AAnnss:: CC.. LLeeaadd ppooiissoonniinngg.. LLeeaadd iinnhhiibbiittss bbootthh ffeerrrroocchheeaattaassee ((iinnccrreeaassiinngg tthhee zziinncc PPrroottooppoorrpphhyyrriinn)) aanndd AALLAA ddeehhyyddrraassee ((iinnccrreeaassiinngg δδ--AALLAA)).. 2233.. WWhhiicchh ooff tthhee ffoolllloowwiinngg ppoorrpphhyyrriinnss ggiivveess ssttoooollss tthheeiirr cchhaarraacctteerriissttiicc bbrroowwnn ccoolloorr?? AA.. BBiilliivveerrddiinn.. BB.. UUrroobbiilliinnooggeenn.. CC.. HHeemmee.. DD.. SStteerrccoobbiilliinn..√√ EE.. UUrroobbiilliinn.. AAnnss:: DD.. SStteerrccoobbiilliinn..

BilirubinBilirubin ExcretionExcretion

BilirubinBilirubin diglucuronidediglucuronide

IntrahepaticIntrahepaticurobilinogenurobilinogen cyclecycle

StercobilinogenStercobilinogen

Bacterial enzymesBacterial enzymes

BilirubinBilirubin

Bacterial enzymeBacterial enzyme2 2 glucuronateglucuronate

Bacterial enzymeBacterial enzyme

UrobilinogenUrobilinogen

8H8H

liverliver

UrobilinUrobilinkidneyskidneys

UrineUrine

StercobilinStercobilin FecesFeces

kidneyskidneys

intestinesintestines

21

PPuurriinnee && PPyyrriimmiiddiinnee MMeettaabboolliissmm

2244.. PPrreeggnnaanntt wwoommeenn ffrreeqquueennttllyy ssuuffffeerr ffrroomm ffoollaattee ddeeffiicciieenncciieess.. AA ddeeffiicciieennccyy ooff ffoollaattee wwoouulldd ddeeccrreeaassee tthhee pprroodduuccttiioonn ooff:: AA.. ccrreeaattiinnee pphhoosspphhaattee ffrroomm ccrreeaattiinnee.. BB.. aallll ooff tthhee ppyyrriimmiiddiinneess rreeqquuiirreedd ffoorr RRNNAA ssyynntthheessiiss.. CC.. tthhee tthhyymmiinnee nnuucclleeoottiiddee rreeqquuiirreedd ffoorr DDNNAA ssyynntthheessiiss..√√ DD.. pphhoosspphhaattiiddyyllcchhoolliimmnnee ffrroomm ddiiaaccyyllggllyycceerrooll aanndd CCDDPP--cchhoolliinnee..

AAnnsswweerr:: CC.. TThhee oonnllyy ppyyrriimmiiddiinnee tthhaatt rreeqquuiirreess ffoollaattee ffoorr iittss ssyynntthheessiiss iiss tthhyymmiinnee ((ddUUMMPP →→ ddTTMMPP)).. FFoollaattee iiss rreeqquuiirreedd ffoorr iinnccoorrppoorraattiioonn ooff ccaarrbboonnss 22 aanndd 88 iinnttoo aallll ppuurriinnee mmoolleeccuulleess.. TThheessyynntthheessiiss ooff ccrreeaattiinnee pphhoosspphhaattee aanndd ooff pphhoosspphhaattiiddyyllcchhoolliinnee ddoo nnoott rreeqquuiirree ffoollaattee.. FFoollaattee ddeeffiicciieenncciieess dduurriinngg pprreeggnnaannccyy ccaann lleeaadd ttoo nneeuurraall ttuubbee ddeeffeeccttss ((ee..gg..,, ssppiinnaa bbiiffiiddaa)) iinn tthhee ffeettuuss..

22

2255.. EExxcceessssiivvee ddeeggrraaddaattiioonn ooff AAMMPP aanndd GGMMPP wwoouulldd rreessuulltt iinn iinnccrreeaassee dduurriinngg eexxccrreettiioonn ooff:: AA.. ccrreeaattiinnee BB.. uurreeaa CC.. uurriicc AAcciidd..√√ DD.. tthhiiaammiinnee EE.. tthhyymmiinnee AAnnsswweerr:: CC.. TThhee ppuurriinnee bbaasseess,, aaddeenniinnee ((AA)) aanndd gguuaanniinniiee ((GG)),, aarree ooxxiiddiizzeedd ttoo uurriicc aacciidd,, wwhhiicchh iiss eexxccrreetteedd iinn tthhee uurriinnee.. EExxcceessssiivvee pprroodduuccttiioonn ooff uurriicc aacciidd ccaann rreessuulltt iinn tthhee ccoonnddiittiioonn kknnoowwnn aass ggoouutt..

26. The component that would be elevated to the greatest extent in the blood of a person suffering from Gout is: A. bilirubin. B. uric acid.√ C. creatine kinase. D. blood urea nitrogen. E. creatinine. Answer: B.

23

27. De novo pyrimidine synthesis requires

A. phosphoribosyl pyrophosphate (PRPP) for the initial step. B. tetrahydrofolate for the incorporation of carbons 2 and 8. C. both carbon and nitrogen of aspartate to form the ring. D. NH4+ as a substrate for carbamoyl phosphatesynthetase II. E. glycine as the source of two nitrogens in the ring.

Ans: C. Options A and B are true for purine but not pyrimidine biosynthesis. During pyrimidine synthesis, the entire aspartate molecule is incorporated into the ring. Glutamine is the substrate for carbamoyl phosphate synthetase II, the enzyme involved in pyrimidine biosynthesis. (NH4+ is the substrate for synthetase I used in urea synthesis.) Glycine supplies one nitrogen for purine synthesis.

28. The component that would be elevated to the greatest extent in the blood of a person suffering from Gout is_______. A. bilirubin.

Sources of the Individual Atoms in Sources of the Individual Atoms in PyrimidinePyrimidine RingRing

De novo De novo pyrimidinepyrimidine synthesis requires: Both carbon & nitrogen of synthesis requires: Both carbon & nitrogen of aspartateaspartate to form the ring.to form the ring.

24

B. uric acid.√ C. creatine kinase. D. blood urea nitrogen. E. ammonia. Answer: B. 29. A 56-year-old diabetic with end-stage renal disease receives a kidney transplant from his son. His nephrologist is concerned for the possibility of transplant rejection and puts the patient on mycophenolic acid, which inhibits which important enzyme in the synthesis of nucleotides?

A. PRPP. B. IMP dehydrogenase√ C. Adenylosuccinate synthase. D. Ribonucleotide reductase. E. Adenylosuccinase.

Answer:B. Mycophenolic acid, a potent immunosuppressant, is an inhibitor of IMP dehydrogenase, which normally converts IMP to xanthosine monophosphate. PRPP synthase catalyses the initial step in nucleotide metabolism, forming PRPP from ATP and ribose. Adenylosuccinate synthase and adenylosuccinase are sequential enzymes in the synthesis of AMP.

25

30. A 58-year-old man is awoken by a throbbing ache in his great toe. He has suffered these symptoms before, usually after indulging in a rich meal. On exam, he is noted to have an angry inflamed great toe; also of note are several small nodules on the anti-helix of his ear. Inhibition of which of the following enzymes might prevent further occurrences of this man's ailments? A. Carbamoyl phosphate synthetase-II. B. Hypoxanthine-guanine phosphoribosyl transferase (HGPRT). C. PRPP synthetase. D. Xanthine oxidase. √ E. Orotate phosphoribosyl transferase. Answer: D. Gout is caused by either the increased production or reduced excretion of uric acid, leading to the deposition of urate crystals. Allopurinol, a xanthine oxidase inhibitor, decreases the production of urate from hypoxanthine and xanthine. Carbamoyl phosphate synthase-II is an enzyme in pyrimidine biosynthesis. HGPRT is an enzyme in the pathway for purine salvage. Orotate phosphoribosyi transferase is important in the synthesis of pyrimidines. PRPP synthetase is an important enzyme in the biosynthesis of purines; overactivity can cause gout.

Conversion of IMP to AMP & GMP Showing Conversion of IMP to AMP & GMP Showing Feedback InhibitionFeedback Inhibition

Mycophenolic acid is an Immunosuppressor used during transplantation / grafting.

26

31. The genetic defect in the hypoxanthine guanine phosphoribosyl transferse (HGPRT) will leads to,

A. Parkinson’s disease. B. Cystinuria. C. Pellagra. D. Lesch-Nyhan syndrome. E. Hartnup’s disease.

Answer: D. The defect in the purine salvage enzyme HGPRT causes Lesch-Nyhan syndrome.

AllopurinolAllopurinol and Hypoxanthineand Hypoxanthine

Allopurinol

Allopurinol

27

32. 5-Fluorouracil (5-FU) is an effective chemotherapeutic agent because interferes with DNA synthesis by directly inhibiting the reaction in which: A. FH2 → FH4. B. Deoxyuridine monophosphate (dUMP) → thymidinemonophosphate (dTMP).√ C. glutamine+ PRPP → Phosphoribosylamine. D. methyl B12 → B12. E. methionine → S-Adenosyl methionine. Answer: B. Methotrexate inhibits the reaction of dihydrofolate (FH2) → tetrahydrofolate (FH4), which is mediated by dihydrofolate reductase. 5-FU inhibits the reaction of deoxyuridine monophosphate (dUMP)→ thymidine monophosphate (dTMP). The remaining reactions are not directly affected by 5-FU. Glutamine to create phosphoribosylamine is the first step in purine biosynthesis. Methyl B12→ vitamin B12 provides the methyl group for the biosynthesis of methionine from homocysteine; and the reverse reaction does not occur in the cell because there is no demethylation for the reaction.

Salvage Pathways of Salvage Pathways of PurinePurineNucleotide SynthesisNucleotide Synthesis

LeschLesch--NyhanNyhan SyndromeSyndrome is characterized by is characterized by the deficiency of the deficiency of ““hypoxanthinehypoxanthine--guanine guanine phosphoribosylphosphoribosyl transferasetransferase (HGPRT)(HGPRT)””,, leads leads to accumulation of to accumulation of PRPP and uric acidPRPP and uric acid, the , the condition is know as condition is know as ““HyperuricemiaHyperuricemia””. .

HyperuricemiaHyperuricemia is the presence of high levels is the presence of high levels of uric acid / sodium of uric acid / sodium urateurate crystals in the crystals in the blood. blood.

The upper end of the normal range of uric acid The upper end of the normal range of uric acid is 360is 360 µµmol/L (6mol/L (6 mg/mg/dLdL) for women and ) for women and 400400 µµmol/L (6.8mol/L (6.8 mg/mg/dLdL) for men. ) for men.

PRPP=PRPP=PhosphoribosylPhosphoribosyl pyrophospatepyrophospate..

28

Synthesis of Synthesis of dTMPdTMP from from dUMPdUMP, , IlustratingIlustratingSites of Action of Sites of Action of AntineoplasticAntineoplastic DrugsDrugs

Methotrexate:Methotrexate: An anticancer drug that acts as a An anticancer drug that acts as a folic acid antagonistfolic acid antagonist to interfere with cellular to interfere with cellular reproduction and is used in the treatment of reproduction and is used in the treatment of psoriasis, certain cancers, and certain inflammatory psoriasis, certain cancers, and certain inflammatory diseases, such as rheumatoid arthritis. diseases, such as rheumatoid arthritis.

55--Fluorouracil:Fluorouracil: An antineoplastic agent, used An antineoplastic agent, used especially in the treatment of cancers of the skin, especially in the treatment of cancers of the skin, breast, and digestive system.breast, and digestive system.

Pregnant womenPregnant women frequently suffer from frequently suffer from folatefolate deficiencies. deficiencies. A deficiency of A deficiency of folatefolate would decrease the production of:would decrease the production of:the thymine nucleotide required for DNA synthesisthe thymine nucleotide required for DNA synthesis

33. Methotrexate is a potent anticancer agent that serves dividing cells of deoxyribonucleotides through direct inhibition of the following enzymes?

A. Ribnucleotide reductase. B. Xanthine oxidase. C. Carbamoyl phosphate synthase II. D. Anemia. E. Dihydrofolate Reductase.√

Answer: E.

29

34. This enzyme recognizes allopurinol as a substrate and is then inhibited by the product of enzyme catalysis. A. PRPP synthetase. B. Hypoxanthine-guanine phosphoribosyl transferase. C. Adenosine deaminase. D. PRPP amidotransferase. E. Xanthine oxidase.√ Answer: E. 35. A 12-week-old infant with a history of persisent diarrhea and candidiasis is seen for a respiratory tract infection with Pneumocystis carinii. A chest x-ray confirms pneumonia and Reveals absence of a thymic shadow. Trace IgG is present in his serum, but IgA and IgM are absent. His red blood cells completely lack an essential enzyme in purine degradation. The product normally formed by this enzyme is: A. Guanine monophosphate. A. hypoxanthine. B. inosine.√ C. xanthine. D. xanthine monophosphate. Answer: C. The child most likely has severe combined immunodefciency (SCID) caused by adenosine deaminase (ADA) deficiency. This enzyme deaminates adenosine (a nucleotide) to form inosine (another nucleoside). Hypoxanthine and xanthine are both purine bases, and the monophosphates are nucleotides.

30

36. A 57-year-old sales representative for a biotechnology firm has a history of alcohol abuse and hyperuricemia, He attends an out-of-town conference and gorges himself on appetizers, including liver pate, caviar, aid sweetbreads before dinner. Early the following morning he develops a painful swelling in his big toe. In addition to the alcohol consumed with his meals, which of the component may have contributed to this episode? A). Carbohydrate B). Cholesterol C). Nucleic acid D). Protein E). Triglyceride. Answer is C. Purines from ingested nucleic acids are converted to uric acid by intestinal epithelial cells and released into the blood for potential excretion by the kidney. Foods rich in DNA (caviar) or RNA (liver pate and sweetbreads [pancreas], derived from organs with active protein synthesis) are particularly rich sources of purines, and their ingestion coupled with excess alcohol consumption presumably increased his plasma urate levels to the point at which uric acid crystallized in a susceptible joint. The resultant painful swelling is gout. The pain is caused by precipitation of uric acid crystals in the joints with attendant inflammation. 37. A 2-year-old boys mother is concerned about his tendency to bite himself to the point of bleeding. The boy’s fingers show scarring and several scabs, and his lips are swollen and bruised. He exhibits poor coordination, poor muscle tone, and frequent jerking movements of his arms and

The importance of The importance of adenosineadenosine deaminasedeaminase((ADAADA)) for the catabolism for the catabolism ofof dAdA,, but not Abut not A,, and the and the resultant accumulation ofresultant accumulation ofdATPdATP when ADA is when ADA is defectivedefective..

Adenine Adenine DDeaminase eaminase (ADA) D(ADA) Deficiencyeficiency

Adenine Adenine DeaminaseDeaminase

31

legs. He is significantly delayed in speech. His urine is orange in color and “gritty”. Which of the following is the most likely diagnosis?

A. Tay-Sachs disease. B. Gout. C. Lesch-Nyhan syndrome.√ D. Severe combined immunodeficiency. E. Cerebral palsy.

Answer: C.

38. A 47-year-old man complains of pain in the joints of his big toe, which are obviously swollen and tender. The pain has been chronic but became intolerable the day after thanksgiving when he had a large meal and several glasses of red wine. He is obese, and his past medical history is significant for removal of kidney stones. Which of the following involved in the pathophysiology of this patient’s condition?

A. Elevated orotic acid. B. Elevated uric acid. √ C. Deficiency of folic acid. D. Anemia. E. Hypoglycemia.

Answer: B. Wether his gout arises from impaired excretion of uric acid or is due to a mutation of PRPP synthase cannot be determined from the data. Analysis of his blood may confirm the gout if high concentrations of uric acid (hyperurecemia) are present.

32

39. Severe combined immunodeficiency (SCID) arises from inhibition of lymphocyte proliferation because B and T cells are particularly sensitive to allosteric inhibition of which of the following enzymes of purine nucleotide metabolism?

A. Xanthine oxidase. B. Dihydrofolate reductase. C. Adenosine deaminase.√ D. Ribonucleotide reductase. E. Hypoxanthine-guanine phosphoribosyltransferase.

Ans: C.

40. Methotrexate is a potent anticancer agent that starves dividing cells of deoxyribonucleotides through direct inhibition of which of the following enzymes? A. Ribonucleotide reductase B. Xanthine oxidase C. Carbamoyl phosphate synthetase II D. Thymidylate synthetase

The importance of The importance of adenosineadenosine deaminasedeaminase((ADAADA)) for the catabolism for the catabolism ofof dAdA,, but not Abut not A,, and the and the resultant accumulation ofresultant accumulation ofdATPdATP when ADA is when ADA is defectivedefective..

Adenine Adenine DDeaminase eaminase (ADA) D(ADA) Deficiencyeficiency

Adenine Adenine DeaminaseDeaminase

SCID

33

E. Dihydrofolate reductase.√ The answer is E. Methotrexate is an analog of folic acid that binds with very high affinity to the substrate-binding site of dihydrofolate reductase, the enzyme that catalyzes conversion of DHF to THF, which is used in various forms by enzymes of both the purine and pyrimidine de novo synthetic pathways. Thus, synthesis of dTMP from dUMP catalyzed by thymldylate synthetase and several steps in purine synthesis catalyzed by formytransferase are indirectly blocked by the action of methotrexate because both those enzymes require THF coenzymes.





41. Methotrexate is a potent anticancer agent that starves dividing cells of deoxyribonucleotides through direct inhibition of which of the following enzymes? A. Ribonucleotide reductase B. Xanthine oxidase C. Carbamoyl phosphate synthetase II D. Dihydrofolatre Reductase.√ E. Adenosine deaminase. Ans: D.

34

42. The genetic defect in the hypoxanthine guanine phosphoribosyl transferse (HGPRT) will leads to,

A. Parkinson’s disease. B. Cystinuria. C. Pellagra. D. Lesch-Nyhan syndrome.√ E. Hartnup’s disease.

Answer: D. The defect in the purine salvage enzyme HGPRT causes Lesch-Nyhan syndrome. 43. Excessive degradation of AMP and GMP would result in increased urinary excretion of, ___________. A. creatine. B. urea. C. uric Acid.√ D. thiamine. E. thymine. Answer: C. The purine bases, adenine (A) and guaninie (G), are oxidized to uric acid, which is excreted in the urine. Excessive Production of uric acid can result in the condition known as gout.

35

44. Which of the following is a compound formed from both a hydroxylation with an enzyme requiring vitamin C and subsequent methylation?

A. Histamine. B. Epinephrine.√ C. GABA. D. Carnitine. E. Creainine.

Answer: B. Epinephrine forms when dopamine is hydroxylated by an enzyme that requires copper and vitamin C, to form norepinephrine, which subsequently methylated. Histamine is derived by decarboxylation of histidine. GABA is decarboxylated glutamate. Creatinine is formed by a SAM methylation, and carnitine is an acyl group acceptor.

Degradation of Degradation of PurinePurine

Nucleotides to Nucleotides to Uric AcidUric Acid

36

Biosynthesis of Biosynthesis of CatecholaminesCatecholamines

CatecholaminsCatecholamins:: include include adrenaline, adrenaline, noradrenalinenoradrenaline & & dopamine dopamine (DOPA),(DOPA), with roles as hormones & neurotransmitters. with roles as hormones & neurotransmitters.

CatecholaminesCatecholamines (epinephrine & (epinephrine & norepinephrinenorepinephrine) are produced ) are produced naturally in the body & functions as key naturally in the body & functions as key neuroneuro--chemicals.chemicals.

BH4

PLP

45. The biosynthetic pathway involves both BH4 and a pyridoxal phosphate (PLP)-dependent decarboxylation reaction to form which of the following?

A. Histamine. B. L-aminobutyric acid (GABA). C. Creatine. D. Epinephrine.√ E. Carnitine.

Answer: D. Epinephrine synthesis requires both BH4 and a pyridoxal phosphate (PLP)-dependent decaroxylation from Phenylalanine→ Tyrosine→DOPA→Dopamine→Epinephrine. Both Histidine→Histamine and Glutamate→L-Aminobutyric acid (GABA) require pyridoxal phosphate (PLP) for decarboxylation (but not BH4). Creatine is produced from glycine, arginine and S-adenosyl methionine (SAM).

37

46. Patients with Lesch-Nyhan syndrome have hyperuricemia, indicating an increased biosynthesis of purine nucleotides, and markedly decreased levels of hypoxanthine phosphoribosyl transferase (HPRT). The hyperuricemia can be explained on the basis of a decrease in which regulator of purine biosynthesis?

A. ATP. B. GDP. C. Glutamine. D. IMP.√ E. PRPP.

Answer: D. IMP is a feedback inhibitor of PRPP amidophospho--ribosyl transferase, the first reaction in the biosynthesis of purines. IMP is formed by the HPRT reaction in the salvage of hypoxanthine.

47. Severe combined immunodeficiency arises from inhibition of lymphocyte proliferation because B and T cells are particularly sensitive to allosteric inhibition of which of the following enzymes of purine nucleotide metabolism?

A. Xanthine oxidase. B. Dihydrofolate reductase. C. Adenosine deaminase. √ D. Ribonucleotide reductase. E. Hypoxanthine-guanine phosphoribosyltransferase.

Ans: C. 48. Pregnant women frequently suffer from folate deficiencies. A deficiency of folate would decrease the production of, A. Creatine phosphate from creatine. B. All of the pyrimidines required for RNA synthesis. C. The thymine nucleotide required for DNA synthesis. √ D. Phosphatidylcholimne from diacylglycerol and CDP-choline. Answer: C. The only pyrimidine that requires folate for its synthesis is thymine (dUMP → dTMP). Folate is required for incorporation of carbons 2 and 8 into all purine molecules. The Synthesis of creatine phosphate and of phosphatidylcholine do not require folate. Folate deficiencies during pregnancy can lead to Neural tube defects (e.g., spina bifida) in the fetus.

38





4499.. AA 6633--yyeeaarr--oolldd wwoommaann rreeppoorrttss aa lloonngg hhiissttoorryy ooff jjooiinntt ppaaiinn.. HHeerr ffiinnggeerrss aarree sseevveerreellyy ddeeffoorrmmeedd sseeccoonnddaarryy ttoo rrhheeuummaattooiidd aarrtthhrriittiiss.. UUppoonn vviissiittiinngg aa rrhheeuummaattoollooggiisstt,, sshhee iiss ssttaarrtteedd oonn mmeetthhoottrreexxaattee.. TThhiiss ddrruugg iinnhhiibbiittss wwhhiicchh ooff tthhee ffoolllloowwiinngg ccoonnvveerrssiioonnss??

AA.. DDooppaammiinnee ttoo nnoorreeppiinneepphhrriinnee.. BB.. TTyyrroossiinnee ttoo ddooppaa.. CC.. FFoollaattee ttoo ddiihhyyddrrooffoollaattee..√√ DD.. HHiissttaammiinnee ttoo ffoorrmm--iimmiinnoogglluuttaammaattee ((FFIIGGLLUU)).. EE.. NNoorreeppiinneepphhrriinnee ttoo vvaanniillllyyllmmaannddeelliicc aacciidd..

AAnnss:: CC.. FFoollaattee ttoo ddiihhyyddrrooffoollaattee..

5500.. AA ccoouuppllee ooff AAffrriiccaann--AAmmeerriiccaann ddeesscceenntt ggiivveess bbiirrtthh ttoo aa bbooyy aafftteerr aann ootthheerrwwiissee uunneevveennttffuull pprreeggnnaannccyy.. TThhee cchhiilldd iiss eexxcceeppttiioonnaallllyy ffaaiirr--sskkiinnnneedd aanndd hhaass aallmmoosstt wwhhiittee hhaaiirr.. FFuurrtthheerr eexxaamm rreevveeaallss rreedd ppuuppiillss.. AA ppoossttnnaattaall ssccrreeeenn iiss lliikkeellyy ttoo ccoonnffiirrmm tthhee ddeeffiicciieennccyy ooff wwhhiicchh ooff tthhee ffoolllloowwiinngg?? AA.. PPeerrooxxiiddaassee.. BB.. IInndduucciibbllee nniittrriiccooxxiiddee ssyynntthhaassee ((iiNNOOSS)).. CC.. GGlluuttaatthhiioonnee rreedduuccttaassee ((GGRR)).. DD.. TTyyrroossiinnaassee..√√ EE.. SS--AAddeennoossyyllmmeetthhiioonniinnee ((SSAAMM))..

39

AAnnss:: DD.. TTyyrroossiinnaassee..

5511.. AA 5599--yyeeaarr--oolldd wwoommaann ddeevveellooppss aa sshhuufffflliinngg ggaaiitt aanndd aa ppiillll--rroolllliinngg ttrreemmoorr.. SShhee iiss rreeffeerrrreedd ttoo aa nneeuurroollooggiisstt ffoorr eevvaalluuaattiioonn.. AAfftteerr aa tthhoorroouugghh wwoorrkkuupp,, aa ddiiaaggnnoossiiss ooff PPaarrkkiinnssoonn ddiisseeaassee iiss mmaaddee..,, aanndd tthhee ppaattiieenntt iiss ppllaacceedd oonn aa mmaannooaammiinnee ooxxiiddaassee iinnhhiibbiittoorr ((MMAAOOII)).. TThhee ddrruugg,, iinn tthhiiss ccaassee,, iiss ggiivveenn ttoo ddeeccrreeaassee tthhee ddeeggrraaddaattiioonn ooff wwhhiicchh ooff tthhee ffoolllloowwiinngg??

AA.. SSeerroottoonniinn.. BB.. NNiiccoottiinnaammiiddee.. CC.. 55--HHyyddrrooxxyy iinnddoollee aacceettiicc aacciidd ((55--HHIIAAAA)).. DD.. EEnnddootthheelliiuumm ddeerriivveedd rreellaaxxiinngg ffaaccttoorr ((EEDDRRFF)).. EE.. DDooppaammiinnee..

5533.. AA nneewwbboorrnn ddeevveellooppss jjaauunnddiiccee ((yyeellllooww sskkiinn aanndd yyeellllooww sscclleerraass)) tthhaatt rreeqquuiirreess llaabboorraattoorryy eevvaalluuaattiioonn.. WWhhiicchh ooff tthhee ffoolllloowwiinngg ppoorrpphhyyrriinn ddeerriivvaattiivveess iiss ccoonnjjuuggaatteedd,, rreeaaccttss ddiirreeccttllyy,, aanndd iiss aa mmaajjoorr ccoommppoonneenntt ooff bbiillee?? AA.. BBiilliirruubbiinn ddiigglluuccuurroonniiddee.. √√

BB.. SStteerrccoobbiilliinn.. CC.. BBiilliivveerrddiinn.. DD.. HHeemmee.. EE.. BBiilliirruubbiinn.. FF.. UUrroobbiilliinnooggeenn.. GG.. UUrroobbiilliinn..

AAnnss:: AA.. BBiilliirruubbiinn ddiigglluuccuurroonniiddee.. ((BBiilliirruubbiinn ccoonnjjuuggaatteedd wwiitthh gglluuccuurroonniicc aacciidd))

40

5544.. AA 1122--yyeeaarr--oolldd bbooyy ddeevveellooppss ccoonnvvuullssiioonnss.. AAfftteerr rruunnnniinngg aann eelleeccttrrooeenncceepphhaallooggrraamm ((EEEEGG)),, aa nneeuurroollooggiisstt ddeetteerrmmiinneess tthhaatt tthhee cchhiilldd hhaass eeppiilleeppssyy.. HHee iiss ssttaarrtteedd oonn aa bbeennzzooddiiaazzeeppiinnee,, wwhhiicchh pprroommootteess tthhee aaccttiivviittyy ooff GGAABBAA.. GGAABBAA iiss ddeerriivveedd ffrroomm tthhee aammiinnoo aacciidd gglluuttaammaattee vviiaa wwhhiicchh ooff tthhee ffoolllloowwiinngg bbiioocchheemmiiccaall rreeaaccttiioonnss??

AA.. DDeeaammiinnaattiioonn.. BB.. DDeeccaarrbbooxxyyllaattiioonn..√√ CC.. HHyyddrrooxxyyllaattiioonn.. DD.. IIooddiinnaattiioonn.. EE.. MMeetthhyyllaattiioonn..

5555.. WWhhiicchh ooff tthhee ffoolllloowwiinngg ccoommppoouunnddss iiss aann aannaalloogguuee ooff hhyyppooxxaanntthhiinnee?? AA.. AArraa CC..

BB.. AAllllooppuurriinnooll.. √√ CC.. RRiibboossee pphhoosspphhaaee.. DD.. 55--pphhoosspphhpprriibboossyyllppyyrroopphhoosspphhaattee ((PPRRRRPPPP)).. EE.. 55--FFUU..

AAnnss:: BB.. AAllllooppuurriinnooll.. 5566.. WWhhiicchh oonnee ooff tthhee ffoolllloowwiinngg ccoonnttrriibbuutteess nniittrrooggeenn aattoommss ttoo bbootthh ppuurriinnee aanndd ppyyrriimmiiddiinnee rriinngg?? AA.. AAssppaarrttaattee..√√

BB.. CCaarrbbaammooyyll pphhoosspphhaattee.. CC.. CCaarrbboonn ddiiooxxiiddee.. DD.. GGlluuttaammiinnee.. EE.. TTeerraahhyyddrrooffoollaattee..

AAnnss:: AA.. AAssppaarrttaattee..

5577.. WWhhiicchh ooff tthhee ffoolllloowwiinngg wwoouulldd rruullee oouutt hhyyppeerruurriicceemmiiaa iinn aa ppaattiieenntt?? AA.. LLeesscchh--MMyyhhaann ssyynnddrroommee..

BB.. GGoouutt.. CC.. XXaanntthhiinnee ooxxiiddaassee hhyyppeerraaccttiivviittyy.. DD.. CCaarrbbaammooyyll pphhoosspphhaattee ssyynntthhaassee ddeeffiicciieennccyy.. EE.. PPuurriinnee oovveerrpprroodduuccttiioonn sseeccoonnddaarryy ttoo VVoonn GGiieerrkkee’’ss ddiisseeaassee..

AAnnss:: DD.. CCaarrbbaammooyyll pphhoosspphhaattee ssyynntthhaassee ddeeffiicciieennccyy ..

41

BBiioommeeddiiccaall GGeenneettiiccss

5588.. HHuunnttiinnggttoonn’’ss ddiisseeaassee iiss dduuee ttoo aa CCAAGG ttrriipplleett rreeppeeaatt eexxppaannssiioonn.. IItt iiss uusseeffuull ttoo kknnooww tthhee nnuummbbeerr ooff rreeppeeaattss iinn aannyy ppeerrssoonn.. TThhee nnuummbbeerr ooff CCAAGG rreeppeeaattss iiss iinnddiiccaattiivvee ooff tthhee sseevveerriittyy ooff tthhee ddiisseeaassee pprrooggrreessssiioonn.. WWhhiicchh ooff tthhee ffoolllloowwiinngg ssttaatteemmeennttss iiss TTRRUUEE rreeggaarrddiinngg tthhee nnuummbbeerr ooff CCAAGG rreeppeeaattss??

AA.. HHiigghheerr tthhee nnuummbbeerr ooff rreeppeeaattss,, lleesssseerr iiss tthhee sseevveerriittyy ooff tthhee ddiissoorrddeerr BB.. HHiigghheerr tthhee nnuummbbeerr ooff rreeppeeaattss,, hhiigghheerr iiss tthhee sseevveerriittyy ooff tthhee ddiissoorrddeerr..√√ CC.. HHiigghheerr tthhee nnuummbbeerr ooff rreeppeeaattss,, tthhee aaggee ooff oonnsseett ooff tthhee ddiisseeaassee iiss ddeellaayyeedd DD.. TThheerree iiss nnoo rreellaattiioonn bbeettwweeeenn tthhee nnuummbbeerr ooff rreeppeeaattss aanndd tthhee aaggee ooff oonnsseett EE.. TThheerree iiss nnoo rreellaattiioonn bbeettwweeeenn aaggee ooff oonnsseett aanndd sseevveerriittyy ooff tthhee ddiissoorrddeerr.. AAnnss:: BB.. 5599.. AA 2200--yyeeaarr--oolldd mmaann hhaass hhaadd nnoo rreettiinnoobbllaassttoommaass bbuutt hhaass pprroodduucceedd ttwwoo ooffffsspprriinnggss wwiitthh mmuullttiippllee rreettiinnoobbllaassttoommaass.. IInn aaddddiittiioonn,, hhiiss ffaatthheerr hhaadd ttwwoo rreettiinnoobbllaassttoommaass aass aa yyoouunngg cchhiilldd,, aanndd oonnee ooff hhiiss ssiibblliinnggss hhaadd tthhrreeee rreettiinnoobbllaassttoommaass.. WWhhaatt iiss tthhee mmoosstt lliikkeellyy eexxppllaannaattiioonn ffoorr tthhee aabbsseennccee ooff rreettiinnoobbllaassttoommaass iinn tthhiiss iinnddiivviidduuaall??

AA.. AA nneeww mmuuttaattiioonn iinn tthhee uunnaaffffeecctteedd iinnddiivviidduuaall,, wwhhiicchh hhaass ccoorrrreecctteedd tthhee ddiisseeaassee--ccaauussiinngg mmuuttaattiioonn..

BB.. HHiigghhllyy vvaarriiaabbllee eexxpprreessssiioonn ooff tthhee ddiissoorrddeerr.. CC.. IInnccoommpplleettee ppeenneettrraannccee..√√ DD.. MMuullttiippllee mmuuttaattiioonnss iinn ootthheerr ffaammiillyy mmeemmbbeerrss.. EE.. PPlleeiioottrrooppyy..

AAnnss:: CC.. IInnccoommpplleettee PPeenneettrraannccee.. BBeeccaauussee mmuullttiippllee ffaammiillyy mmeemmbbeerrss aarree aaffffeecctteedd && bbeeccaauussee mmuuttaattiioonnss aatt tthhee rreettiinnoobbllaassttoommaa ggeenneess aarree kknnoowwnn ttoo bbee ssoommeettiimmeess nnoonn--ppeenneettrraanntt,, tthhee mmaann iinn aann oobblliiggaattee ccaarrrriieerr ooff tthhee mmuuttaattiioonn wwhhoo ddiidd nnoott eexxppeerriieennccee aa sseeccoonndd mmuuttaattiioonn iinn tthhiiss ggeennee dduurriinngg hhiiss ffeettaall ddeevveellooppmmeenntt..

42

v Autosomal Dominant.Autosomal Dominant.

vv No Skipped generations (No Skipped generations (atleastatleast 1 or more will affect in each 1 or more will affect in each

generations).generations).

vv Male to male transmission (Male to male transmission (IIII--3 to 3 to IIIIII--5).5).

vv But But IIIIII--1 and 1 and IIIIII--3 do not have an affected parent.3 do not have an affected parent.

vv IIII--1 1 must have inherited the mutant allelemust have inherited the mutant allele from from II--2 and 2 and has given the mutant allele to has given the mutant allele to IIIIII--1 and 1 and IIIIII--3.3.

vv IIII--1 has the 1 has the disease genotypedisease genotype (Carrier) but does not display the (Carrier) but does not display the disease phenotype: Example of disease phenotype: Example of NonNon--penetrancepenetrance..

Obligate Obligate CarrierCarrier

Incomplete Incomplete PenetrancePenetrance

No PhenotypicNo PhenotypicExpressionExpression

NormalNormal

IIIIII

IIII

II

AffectedAffectedMotherMother

vv The concept that even The concept that even though several members of though several members of a family or population may a family or population may have the same DNA have the same DNA mutation, but not everyone mutation, but not everyone with that mutation will have with that mutation will have or develop the disease.or develop the disease.

6600.. IInn aa ffaammiillyy wwiitthh mmyyoottoonniicc ddyyssttrroopphhyy,, aa cchhiilldd iiss bboorrnn wwiitthh iinnffaannttiillee mmyyoottoonniicc ddyyssttrroopphhyy.. TThhee mmootthheerr oonn eexxaammiinnaattiioonn iiss oobbsseerrvveedd ttoo hhaavvee ppttoossiiss aanndd mmiilldd ffaacciiaall wweeaakknneessss.. TThhee ggrraannddmmootthheerr hhaass bbiillaatteerraall ccaattaarraaccttss aanndd nnoo ddeemmoonnssttrraabbllee mmuussccllee wweeaakknneessss.. TThhee pphheennoommeennoonn iinn tthhiiss ffaammiillyy iiss::

AA.. PPlleeiioottrrooppyy.. BB.. VVaarriiaabbllee eexxpprreessssiioonn.. CC.. AAnnttiicciippaattiioonn..√√ DD.. IInnccoommpplleettee ppeenneettrraannccee.. EE.. DDeellaayyeedd aaggee ooff oonnsseett..

AAnnss:: CC..

43

Fragile X SyndromeFragile X Syndrome

vTriplet repeat expansion (CGG repeat).vCharacteristic features: Mental

retardation, prominent ears, elongated face, macro orchidism (enlarged testis).

vFemales are less severely affected than males.

vShows anticipation in successive generations.

vHigher the number of repeats, greater is the severity of the disease.

AnticipationAnticipation

vv Individuals in the recent generations of a Individuals in the recent generations of a pedigree develop disease at an pedigree develop disease at an earlier age and earlier age and with greater severity.with greater severity.

vv HuntingtonHuntington’’s disease.s disease.vv Triplet repeat expansion: Triplet repeat expansion: CAG repeatCAG repeat..vv Greater the number of repeats, earlier is the Greater the number of repeats, earlier is the

age of onset of symptomsage of onset of symptoms..

57 yrs (40 repeats)57 yrs (40 repeats)

36 yrs (50 repeats)36 yrs (50 repeats)

6611.. AA 3300--yyeeaarr--oolldd mmaann iiss pphheennoottyyppiiccaallllyy nnoorrmmaall,, bbuutt ttwwoo ooff hhiiss ssiibblliinnggss ddiieedd ffrroomm iinnffaannttiillee TTaayy--SSaacchhss ddiisseeaassee,, aann aauuttoossoommaall rreecceessssiivvee ccoonnddiittiioonn tthhaatt iiss lleetthhaall bbyy tthhee aaggee ooff ffiivvee.. WWhhaatt iiss tthhee rriisskk tthhaatt tthhiiss mmaann iiss aa hheetteerroozzyyggoouuss ccaarrrriieerr ooff tthhee ddiisseeaassee--ccaauussiinngg mmuuttaattiioonn??

AA.. 11 // 44..

44

BB.. 11 // 22.. CC.. 22 // 33..√√ DD.. 33 // 44.. EE.. NNoott eelleevvaatteedd aabboovvee tthhaatt ooff tthhee ggeenneerraall ppooppuullaattiioonn..

AAnnss:: CC.. BBeeccaauussee ttwwoo ooff tthhee mmaann’’ss ssiibblliinnggss hhaadd TTaayy--ssaacchhss ddiisseeaassee,, hhiiss ppaarreennttss mmuusstt bbootthh bbee ccaarrrriieerrss.. 6622.. AA mmaann wwhhoo iiss aaffffeecctteedd wwiitthh hheemmoopphhiilliiaa AA ((XX--lliinnkkeedd rreecceessssiivvee)) mmaatteess wwiitthh aa wwoommaann wwhhoo iiss aa hheetteerroozzyyggoouuss ccaarrrriieerr ooff tthhiiss ddiissoorrddeerr.. WWhhaatt pprrooppoorrttiioonn ooff tthhiiss ccoouuppllee’’ss ddaauugghhtteerrss wwiillll bbee aaffffeecctteedd,, aanndd wwhhaatt pprrooppoorrttiioonn ooff tthhee ddaauugghhtteerrss wwiillll bbee hheetteerroozzyyggoouuss ccaarrrriieerrss??

AA.. 00 %% ;; 5500%%.. BB.. 110000%% ;; 00%%.. CC.. 00 %% ;; 110000%%.. DD.. 5500 %% ;; 5500 %%..√√ EE.. 22 // 33 ;; 11//33..

AAnnss:: DD.. 6633.. AA mmaann aanndd wwoommaann aarree bbootthh aaffffeecctteedd bbyy aann aauuttoossoommaall ddoommiinnaanntt ddiissoorrddeerr tthhaatt hhaass 8800%% ppeenneettrraannccee.. TThheeyy aarree bbootthh hheetteerroozzyyggootteess,, ffoorr tthhee ddiisseeaassee--ccaauussiinngg mmuuttaattiioonn.. WWhhaatt iiss tthhee pprroobbaabbiilliittyy tthhaatt tthheeyy wwiillll pprroodduuccee pphheennoottyyppiiccaallllyy nnoorrmmaall ooffffsspprriinngg??

AA.. 2200 %%.. BB.. 2255%%.. CC.. 4400 %%..√√ DD.. 6600 %%.. EE.. 8800%%..

AAnnss:: CC.. 6644.. IInn aasssseessssiinngg aa ppaattiieenntt wwiitthh oosstteeooggeenneessiiss iinnppeerrffeeccttaa,, aa hhiissttoorryy ooff bboonnee ffrraaccttuurreess,, aass wweellll aass bblluuee sscclleerraaee,, aarree nnootteedd.. TThheessee ffiinnddiinnggss aarree aann eexxaammppllee ooff::

AA.. aalllleelliicc hheetteerrooggeenneeiittyy.. BB.. ggaaiinn--ooff--ffuunnccttiioonn mmuuttaattiioonn.. CC.. llooccuuss hheetteerrooggeenneeiittyy.. DD.. mmuullttiippllee mmuuttaattiioonnss.. EE.. pplleeiioottrrooppyy..√√

AAnnss:: EE..

50 X 80 100

45

PleiotropyPleiotropyvv A disease causing A disease causing mutation affects multiple organ systems.mutation affects multiple organ systems.

vv MarfanMarfan syndrome (autosomal dominant).syndrome (autosomal dominant).

vv Mutation in the Mutation in the fibrillinfibrillin gene.gene.

vv Skeletal abnormalities (long limbs, Skeletal abnormalities (long limbs, pectuspectus excavatumexcavatum).).

vv HyperHyper--mobile joints.mobile joints.

vv Ocular abnormalities (myopia, lens dislocation).Ocular abnormalities (myopia, lens dislocation).

vv Cardiovascular disease (Mitral valve Cardiovascular disease (Mitral valve prolapseprolapse, Aortic aneurysm)., Aortic aneurysm).

vv OsteogenesisOsteogenesis imperfectaimperfecta (Bone, Sclera).(Bone, Sclera).

6655.. WWaaaarrddeennbbeerrgg ssyynnddrroommee iiss aann aauuttoossoommaall ddoommiinnaanntt ddiissoorrddeerr iinn wwhhiicchh ppaattiieennttss mmaayy eexxhhiibbiitt aa vvaarriieettyy ooff cclliinniiccaall ffeeaattuurree,, iinncclluuddiinngg ppaattcchheess ooff pprreemmaattuurreellyy ggrreeyy hhaaiirr,, wwhhiittee eeyyeellaasshheess,, aa bbrrooaadd nnaassaall rroooott,, aanndd mmooddeerraattee ttoo sseevveerree hheeaarriinngg iimmppaaiirrmmeennttss.. OOccccaassiioonnaallllyy,, aaffffeecctteedd iinnddiivviidduuaallss ddiissppllaayy ttwwoo eeyyeess ooff ddiiffffeerreenntt ccoolloorrss aanndd aanndd cclleefftt lliipp aanndd//oorr ppaallaattee.. PPaattiieenntt wwhhoo pprrooppoosseess aa mmuuttaattiioonn iinn tthhee PPAAXX33 ggeennee oonn cchhrroommoossoommee 22 ccaann pprreesseenntt wwiitthh aallll ooff tthheessee ddiissppaarraattee ssiiggnnss aanndd ssyymmppttoommss.. WWhhiicchh ooff tthhee ffoolllloowwiinngg cchhaarraacctteerriissttiiccss ooff ggeenneettiicc ttrraaiittss iiss iilllluussttrraatteedd bbyy tthhiiss eexxaammppllee??

AA.. AAnnttiicciippaattiioonn.. BB.. IImmpprriinnttiinngg.. CC.. IInnccoommpplleettee ppeenneettrraannccee.. DD.. LLooccuuss hheetteerrooggeenneeiittyy.. EE.. PPlleeiioottrrooppyy..√√

AAnnss:: EE.. PPlleeiioottrrooppyy:: rreeffeerrss ttoo tthhee aappppeeaarraannccee ooff aappppaarreennttllyy uunnrreellaatteedd cchhaarraacctteerriissttiiccss rreessuullttiinngg ffrroomm aa ssiinnggllee ggeenneettiicc ddeeffeecctt.. IItt iiss oofftteenn tthhee rreessuulltt ooff tthhee pprreesseennccee ooff aa ssiinnggllee aalltteerreedd mmoolleeccuullee iinn mmuullttiippllee llooccaattiioonnss iinn tthhee bbooddyy,, ssoo tthhaatt tthhee ssiinnggllee mmuuttaattiioonn hhaass eeffffeecctt iinn mmuullttiippllee oorrggaann ssyysstteemm.. IInn MMaarrffaann ssyynnddrroommee,, ffoorr ee..gg.. AA ddeeffeecctt iinn tthhee ffiibbrriilllliinn ggeennee ccaauusseess mmaanniiffeessttaattiioonnss ooff tthhee ddiisseeaassee iinn tthhee eeyyee,, aaoorrttaa aanndd jjooiinnttss..

46

MarfanMarfan SyndromeSyndrome

Ocular abnormalities Ocular abnormalities (myopia, lens dislocation(myopia, lens dislocation

Skeletal abnormalities Skeletal abnormalities (long limbs, (long limbs, pectuspectus

excavatumexcavatum).).HyperHyper--mobile jointsmobile joints

Pleotropy

6666.. TThhee sseevveerree ffoorrmm ooff aallpphhaa--11 aannttiittrryyppssiinn ddeeffiicciieennccyy iiss tthhee rreessuulltt ooff aa ssiinnggllee nnuucclleeoottiiddee ssuubbssttiittuuttiioonn tthhuuss pprroodduucceess aa ssiinnggllee aammiinnoo aacciidd ssuubbssttiittuuttiioonn.. TThhiiss iiss bbeesstt ddeessccrriibbeedd aass aa::

AA.. ffrraammeesshhiifftt mmuuttaattiioonn.. BB.. IInn--ffrraammee mmuuttaattiioonn.. CC.. mmiisssseennssee mmuuttaattiioonn..√√ DD.. nnoonnsseennssee mmuuttaattiioonn.. EE.. sspplliiccee--ssiittee mmuuttaattiioonn..

AAnnss:: CC.. AA mmiisssseennccee mmuuttaattiioonn rreessuullttss iinn tthhee cchhaannggee ooff oonnllyy aa ssiinnggllee aammiinnoo aacciidd..

47

Mutation: Mutation: is an alteration in DNA sequence, thus mutations is an alteration in DNA sequence, thus mutations produce new alleles.produce new alleles.

MissenceMissence Mutations: Mutations: result in the substitution of result in the substitution of single AAsingle AA in the in the polypeptide chain.polypeptide chain.

Nonsense Mutations: Nonsense Mutations: produce a stop produce a stop codoncodon →→ premature premature termination of translation & truncated protein.termination of translation & truncated protein.

InIn--frame Mutation:frame Mutation: IfIf the number of the number of inserted or deletedinserted or deleted bases is bases is multiples of 3, the mutation is said to be multiples of 3, the mutation is said to be inin--frameframe. If not multiples . If not multiples of 3 the mutation is a of 3 the mutation is a frameframe--shiftshift , , which alters which alters all all codonscodons down down streamstream →→ truncated / severely altered proteinstruncated / severely altered proteins..

MutationsMutations

MissenceMissence MutationMutationSickle Cell DiseaseSickle Cell Disease

Substitution of Substitution of valinevalinefor glutamine infor glutamine in

ββ--GlobinGlobin polypeptide.polypeptide.

6677.. AAnn 1188 yyeeaarr oolldd ffeemmaallee hhaass pprreesseenntteedd ttoo tthhee pphhyyssiicciiaann wwiitthh pprriimmaarryy aammeennoorrrrhheeaa.. OOnn eexxaammiinnaattiioonn sshhee hhaass aa cchhaarraacctteerriissttiicc wweebbbbiinngg ooff tthhee nneecckk.. KKaarryyoottyyppee aannaallyyssiiss ooff tthhee ssuubbjjeecctt wwoouulldd mmoosstt lliikkeellyy rreevveeaall,,

AA.. 4477,, XXXX,,++2211.. BB.. 4466,, XXXX.. CC.. 4477,, XXXXYY.. DD.. 4477,, XXYYYY.. EE.. 4455,, XX00.. √√

48

6688.. AA nneewwbboorrnn iinnffaanntt wwiitthh aa ssiinnggllee ppaallmmaarr ccrreeaassee aanndd ddeepprreesssseedd nnaassaall bbrriiddggee iiss ssuussppeecctteedd ttoo hhaavvee aa ggeenneettiicc ddiissoorrddeerr.. TThhee kkaarryyoottyyppee aannaallyyssiiss sshhoowwss tthhee pprreesseennccee ooff 4477,, XXXX,,++2211.. TThhee aabbnnoorrmmaalliittyy tthhaatt rreessuullttss iinn tthhiiss kkaarryyoottyyppee iiss,,

AA.. NNoonnddiissjjuunnccttiioonn dduurriinngg ssppeerrmmaattooggeenneessiiss.. BB.. NNoonnddiissjjuunnccttiioonn dduurriinngg ooooggeenneessiiss..√√ CC.. PPrreesseennccee ooff aann eexxttrraa XX cchhrroommoossoommee.. DD.. FFaauullttyy XX––iinnaaccttiivvaattiioonn dduurriinngg eemmbbrryyooggeenneessiiss.. EE.. PPrreesseennccee ooff aann eexxttrraa YY cchhrroommoossoommee..

49

NondisjunctionNondisjunction Leads to Leads to TrisomyTrisomy

Nondisjunction during Nondisjunction during meiosis Imeiosis I: : Homologous chromosomes Homologous chromosomes do do NOT separateNOT separate..

Nondisjunction during Nondisjunction during meiosis IImeiosis II: : Sister Sister chromatidschromatids of a of a chromosome chromosome do NOTdo NOT separate.separate.

Responsible for Responsible for trisomytrisomy after fertilization (after fertilization (oogenesisoogenesis))

6699.. JJaacckk aanndd JJaannee aarree ffiirrsstt ccoouussiinnss.. TThhee pprrooppoorrttiioonn ooff ggeenneess tthhaatt mmaayy bbee ccoommmmoonn iinn tthheemm iiss,,

AA.. ¼¼.. BB.. ½½.. CC.. 11//33.. DD.. 11//88..√√ EE.. 11//3322..

50

ConsanguinityConsanguinity

IIII--1, II1, II--3 share 3 share ½½ of their of their genes genes (Siblings).(Siblings).

IIIIII--1 and III1 and III--5 share 5 share ⅛⅛ of their of their genes (first cousins).genes (first cousins).

IVIV--1 and IV1 and IV--2 share 1/32 of 2 share 1/32 of their genes (second their genes (second cousins). cousins).

MMiicchhaaeell aanndd JJaannee aarree sseeccoonndd ccoouussiinnss.. TThhee pprrooppoorrttiioonn ooff ggeenneess tthhaatt mmaayy bbee ccoommmmoonn iinn tthheemm iiss,,

FF.. ¼¼.. GG.. ½½.. HH.. 11//33.. II.. 11//88.. JJ.. 11//3322..√√

7700.. AA ggiivveenn ppooppuullaattiioonn hhaass 22 aalllleelleess ‘‘aa’’ aanndd ‘‘bb’’ ffoorr aa ssppeecciiffiicc ggeennee.. TThhee ffrreeqquueennccyy ooff aalllleellee ‘‘aa’’ iiss 00..77.. WWhhaatt iiss tthhee ffrreeqquueennccyy ooff aalllleellee ‘‘bb’’??..

AA.. 00..11 BB.. 00..22 CC.. 00..33..√√ DD.. 00..44 EE.. 00..55

51

7711.. AA ggeennee eexxiissttss iinn ttwwoo aalllleelliicc ffoorrmmss iinn tthhee ppooppuullaattiioonn ‘‘aa’’ aanndd ‘‘bb’’.. TThhee ggeennoottyyppeess tthhaatt ccaann bbee pprreesseenntt iinn tthhee ppooppuullaattiioonn aarree,,

AA.. aaaa,, bbbb.. BB.. aaaa,, aabb,, bbbb..√√ CC.. aabb,, bbaa,, aaaa.. DD.. aaaa,, aaaabb,, bbbbaa.. EE.. AAaaaa,, bbbbbb..

AAnnss:: BB..

PPRRAACCTTIICCEE QQUUEESSTTIIOONNSS:: GGEENNEETTIICC DDIIAAGGNNOOSSIISS

11.. AA 5500 yyeeaarr oolldd mmaallee hhaass aa lloossss ooff mmoottoorr ccoonnttrrooll aanndd ttrreemmoorrss ooff aarrmmss.. TThhee pphhyyssiicciiaann ssuussppeeccttss

aa ddiiaaggnnoossiiss ooff HHuunnttiinnggttoonn’’ss ddiisseeaassee.. TThhee ffaammiillyy hhiissttoorryy rreevveeaalleedd tthhaatt hhiiss mmootthheerr hhaadd ssiimmiillaarr ssyymmppttoommss wwhhiicchh bbeeggaann aatt tthhee aaggee ooff 6600 yyeeaarrss.. HHiiss mmaatteerrnnaall ggrraannddffaatthheerr aallssoo hhaadd ssiimmiillaarr ccoommppllaaiinnttss aatt aann aaggee ooff 7755 yyeeaarrss.. PPCCRR aammpplliiffiiccaattiioonn aanndd SSoouutthheerrnn bblloott ooff cchhrroommoossoommee 44 sshhoowwss tthhee ffoolllloowwiinngg rreessuullttss..

TThhee ssuumm ooff ffrreeqquueennccyy ooff tthhee aalllleelleess == 11 AAlllleellee ffrreeqquueennccyy ‘‘aa’’++ AAlllleellee ffrreeqquueennccyy ‘‘bb’’ == 11 pp ++ qq == 11 00..77++00..33 == 11

52

TThhee rreessuullttss iinnddiiccaattee tthhaatt,,

AA.. TThhee ppaattiieenntt hhaass ttrriipplleett rreeppeeaatt eexxppaannssiioonnss oonn bbootthh ccooppiieess ooff cchhrroommoossoommee 44 BB.. TThhee ppaattiieenntt hhaass aa ttrriipplleett rreeppeeaatt eexxppaannssiioonn oonn oonnee ccooppyy ooff tthhee cchhrroommoossoommee 44..√√ CC.. TThhee ppaattiieenntt’’ss DDNNAA iiss ooff ssiimmiillaarr lleennggtthh wwhheenn ccoommppaarreedd ttoo nnoorrmmaall ccoonnttrrooll DD.. TThhee bblloott ddooeess nnoott ggiivvee aann iinnddiiccaattiioonn ooff tthhee ssiizzee ooff tthhee rreeppeeaatt eexxppaannssiioonn EE.. TThhee rreessuullttss aarree iinnccoonncclluussiivvee 22.. JJiimm aanndd JJaannee aarree sseeccoonndd ccoouussiinnss aanndd tthheeyy hhaavvee ddeecciiddeedd ttoo ggeett mmaarrrriieedd.. TThheeyy kknnooww tthhaatt oonnee

ooff tthheeiirr uunncclleess hhaadd ddiieedd ooff ccyyssttiicc ffiibbrroossiiss aatt aann eeaarrllyy aaggee.. TThheeyy wwaanntt ttoo kknnooww tthheeiirr rriisskk ooff bbeeiinngg ccaarrrriieerrss ooff tthhee mmuuttaanntt ccyyssttiicc ffiibbrroossiiss ggeennee.. TThhee ggeenneettiicc ccoouunnsseelloorr ppeerrffoorrmmss aann AASSOO tteesstt ffoorr tthhee mmuuttaanntt ccyyssttiicc ffiibbrroossiiss ggeennee ((DD550088)).. TThhee rreessuullttss ooff tthhee tteesstt aarree ddeeppiicctteedd bbeellooww..

TThhee rreessuullttss iinnddiiccaattee tthhaatt,,

AA.. BBootthh aarree hhoommoozzyyggoouuss nnoorrmmaall BB.. BBootthh aarree ccaarrrriieerrss ooff tthhee mmuuttaanntt ggeennee..√√ CC.. BBootthh aarree hhoommoozzyyggoouuss ffoorr tthhee mmuuttaanntt ggeennee

90 bp

101 bp 104 bp

190 bp

Patient Normal Control

Jim Jane

53

DD.. JJiimm iiss hhoommoozzyyggoouuss ffoorr tthhee nnoorrmmaall ggeennee EE.. JJaannee iiss hhoommoozzyyggoouuss ffoorr tthhee mmuuttaanntt ggeennee

33.. UUssee tthhee AASSOO tteesstt iinn tthhee pprreevviioouuss qquueessttiioonn ttoo aannsswweerr tthhiiss qquueessttiioonn.. WWhhaatt iiss tthhee rriisskk tthhaatt tthhee

cchhiillddrreenn ooff JJiimm aanndd JJaannee wwoouulldd bbee aaffffeecctteedd wwiitthh ccyyssttiicc ffiibbrroossiiss??..

AA.. 110000%% BB.. 5500%% CC.. 2255%%..√√ DD.. 55%% EE.. NNiill 44.. HHeemmoocchhrroommaattoossiiss iiss aann aauuttoossoommaall rreecceessssiivvee ddiissoorrddeerr.. TThhee mmoosstt ccoommmmoonn mmuuttaattiioonn ccaauussiinngg

hheemmoocchhrroommaattoossiiss iiss tthhee CC228822YY mmuuttaattiioonn.. TThhee nnoorrmmaall HHFFEE aalllleellee hhaass tthhee sseeqquueennccee 55’’TTAATTAACCGGTTGGCCCCAAGGGGTTGG33’’.. TThhee CC228822YY aalllleellee hhaass tthhee sseeqquueennccee ((MMuuttaatteedd)) 55’’TTAATTAACCGGTTAAGGCCAAGGGGTTGG55’’ TThhee aalllleellee ssppeecciiffiicc oolliiggoonnuucclleeoottiiddee ((AASSOO)) pprroobbee tthhaatt wwoouulldd bbiinndd ttoo tthhee mmuuttaanntt aalllleellee iiss,,

AA.. 55’’AATTAATTGGCCAACCGGGGTTCCCCAACC33’’ BB.. 55’’AATTAATTGGCCAATTCCGGTTCCCCAACC33’’ CC.. 55’’CCAACCCCTTGGGGCCAACCGGTTAATTAA33’’ DD.. 55’’CCAACCCCTTGGCCTTAACCGGTTAATTAA33’’..√√ EE.. 55’’TTAATTAACCGGTTGGCCCCAAGGGGTTGG33’’

55.. HHuunnttiinnggttoonn’’ss ddiisseeaassee iiss dduuee ttoo aa CCAAGG ttrriipplleett rreeppeeaatt eexxppaannssiioonn.. IItt iiss uusseeffuull ttoo kknnooww tthhee

nnuummbbeerr ooff rreeppeeaattss iinn aannyy ppeerrssoonn.. TThhee nnuummbbeerr ooff CCAAGG rreeppeeaattss iiss iinnddiiccaattiivvee ooff tthhee sseevveerriittyy ooff tthhee ddiisseeaassee pprrooggrreessssiioonn.. WWhhiicchh ooff tthhee ffoolllloowwiinngg ssttaatteemmeennttss iiss TTRRUUEE rreeggaarrddiinngg tthhee nnuummbbeerr ooff CCAAGG rreeppeeaattss??..

FF.. HHiigghheerr tthhee nnuummbbeerr ooff rreeppeeaattss,, lleesssseerr iiss tthhee sseevveerriittyy ooff tthhee ddiissoorrddeerr GG.. HHiigghheerr tthhee nnuummbbeerr ooff rreeppeeaattss,, hhiigghheerr iiss tthhee sseevveerriittyy ooff tthhee ddiissoorrddeerr..√√ HH.. HHiigghheerr tthhee nnuummbbeerr ooff rreeppeeaattss,, tthhee aaggee ooff oonnsseett ooff tthhee ddiisseeaassee iiss ddeellaayyeedd II.. TThheerree iiss nnoo rreellaattiioonn bbeettwweeeenn tthhee nnuummbbeerr ooff rreeppeeaattss aanndd tthhee aaggee ooff oonnsseett JJ.. TThheerree iiss nnoo rreellaattiioonn bbeettwweeeenn aaggee ooff oonnsseett aanndd sseevveerriittyy ooff tthhee ddiissoorrddeerr..

66.. AA ccoouuppllee sseeeekkss ggeenneettiicc ccoouunnsseelliinngg,, aass tthheeyy hhaavvee aa ssoonn,, aaggeedd 1100 yyeeaarrss aaffffeecctteedd wwiitthh ssiicckkllee cceellll

aanneemmiiaa.. TThheeyy aallssoo hhaavvee aa ddaauugghhtteerr,, aaggeedd 88 yyeeaarrss,, wwhhoo iiss pphheennoottyyppiiccaallllyy nnoorrmmaall.. TThhee ppaarreennttss aarree bbootthh ccaarrrriieerrss ooff tthhee ssiicckkllee cceellll ggeennee aanndd aarree nnoott aaffffeecctteedd.. TThhee llaaddyy iiss pprreeggnnaanntt,, aanndd iiss wwoorrrriieedd tthhaatt tthhee uunnbboorrnn cchhiilldd mmaayy hhaavvee tthhee ddiisseeaassee.. AAnn RRFFLLPP aannaallyyssiiss wwaass ddoonnee ttoo cchheecckk wwhheetthheerr tthhee ffeettuuss wwaass ggooiinngg ttoo bbee aaffffeecctteedd.. WWhhiicchh ooff tthhee ffoolllloowwiinngg ccoonncclluussiioonn mmaayy bbee ddrraawwnn ffrroomm tthhee RRFFLLPP ppaatttteerrnn ooff tthhee ffaammiillyy??

54

AA.. TThhee ffaatthheerr iiss nnoott aa ccaarrrriieerr ooff tthhee mmuuttaattiioonn BB.. TThhee ddaauugghhtteerr iiss hheetteerroozzyyggoouuss ffoorr tthhee mmuuttaanntt ggeennee CC.. TThhee ssoonn iiss hheetteerroozzyyggoouuss ffoorr tthhee mmuuttaanntt ggeennee DD.. TThhee uunnbboorrnn ffeettuuss iiss aa ccaarrrriieerr ooff tthhee mmuuttaanntt ggeennee..√√ EE.. TThhee ddaauugghhtteerr iiss aa ccaarrrriieerr ooff tthhee mmuuttaanntt ggeennee

CYTOGENETICS

1. Observe the karyotype below and write the karyotype of the person.

A. 46, XY. B. 45, XO.

55

C. 47, XXY. D. 46, XX.√ E. 47, XX, +21.

2. Observe the karyotype below and write the karyotype of the person.

F. 46, XY. G. 45, XO. H. 47, XXY. I. 46, XY.√ J. 47, XX, +21.

3. An infant has been brought to the outpatient clinic by its mother who is 45 year old. The child has developmental delay. The child also has a depressed nasal bridge, and a prominent epicanthal fold. Karyotyping of the child reveals a 47, XX, +21. Which is the Karyotype you would observe in the child?.

56

A

B

C

57

A. A B. B C. C. D. D

4. A physician observes gynecomastia in a 22 - year old man. On examination, he also notices

that the man has reduced body and facial hair and testicular atrophy. The physician suspects a diagnosis of Klinefelter syndrome and wants a karyotyping to confirm the diagnosis. What is the karyotype that may be expected in the individual?

A. 45, XO. B. 46, XY. C. 47, XYY.√ D. 47, XXX. E. 47, XXY.

D

58

An Extra X An Extra X ChromosomeChromosome

KlinefelterKlinefelter Syndrome (47,XXY)Syndrome (47,XXY)

47,XXY47,XXY Presence of a Barr body in the Presence of a Barr body in the buccal mucosal cellsbuccal mucosal cells

Barr body:Barr body: A microscopic feature of female cells due to the A microscopic feature of female cells due to the presence of two X chromosomes in the female. One of these X presence of two X chromosomes in the female. One of these X chromosomes is chromosomes is inactive and is crumpled up to form the Barr inactive and is crumpled up to form the Barr body. body.

KlinefelterKlinefelter Syndrome (47,XXY)Syndrome (47,XXY)

vv Testicular atrophy.Testicular atrophy.vv GynecomastiaGynecomastia..vv Female distribution of hair.Female distribution of hair.vv Infertility.Infertility.

59

5. Karyotype analysis of a patient with chronic myelogenous leukemia, reveals the presence of an abnormal chromosome 22, which is shorter than the actual chromosome 22. The abnormal Philadelphia chromosome is formed by

A. Reciprocal translocation.√ B. Robertsonian translocation. C. Inversion. D. Chromosomal deletion. E. Chromosomal Imprinting.

6. A 3 month old infant is brought to the clinic by its parents. The child has a peculiar cat-like

cry. The pediatrician notices developmental delay and microcephaly. What chromosomal abnormality would you suspect in the child?

A. Trisomy 21. B. Edward syndrome. C. Deletion of paternal 15q. D. Deletion of chromosome 5p.√ E. Angelman syndrome.

Cri-du-chat syndromeChromosome 5

CriCri--DuDu--ChatChat SyndromeSyndrome46, XX, del(5p) or 46, XY, del(5p).46, XX, del(5p) or 46, XY, del(5p).

vv Chromosome loses some of its genetic material.Chromosome loses some of its genetic material.

vv Deletion of chromosome 5p Deletion of chromosome 5p →→ ““CriCri--dudu--chatchat SyndromeSyndrome””vv 46, XX, del(5p) or 46, XY, del(5p).46, XX, del(5p) or 46, XY, del(5p).vv Features:Features:

ØØ High pitched, High pitched, Cat like cryCat like cry..ØØ Mental retardation, Mental retardation, MicrocephalyMicrocephaly..

7. A 4-year old obese child with a low IQ has been diagnosed to have the Prader–Willi syndrome. This syndrome is due to

60

A. Deletion of maternal chromosome 15q B. Deletion of paternal chromosome 15q.√ C. Deletion of chromosome 5p. D. Robertsonian translocation of chromosome 14 and 21. E. Reciprocal translocation of chromosome 9 and 22.

Chromosome 15

Deletion of 15q11-13

MaternalPaternal

PraderPrader WilliWilli SyndromeSyndrome

p arm

q arm

““AAllll tthhee BBeesstt””

““KKnnoowwlleeddggee iiss PPoowweerr””

TThhaannkk UU

Documents

62972646 Biochemistry Genetics Important Concepts Q as Dr Kumar Ponnusamy Jegathambigai RN Biochemistry Genetics AIMST University School of Medicine M