A Biodiversity Content Management System for Research, Education, and Outreach

Cynthia Sims ParrUniversity of Maryland, College Park

Co-authors Roger Espinosa, Tanya Dewey, George Hammond, Phil Myers, of University of Michigan

University of Michigan University of Michigan Museum of ZoologyMuseum of Zoology

BiodiversityBiodiversity is the extraordinary variety of all life on Earth - from genes to species to entire ecosystems.

-- Smithsonian Institution Monitoring and Assessment of Biodiversity Program

Access

Access

Change

Change

Problems in Biodiversity DatabasesDiverse users

Policy makers Land-use planners Educators, students Laypersons Biologists

Complex databases Organism names Habitats Conservation status Reproductive parameters Interactions, etc. Specimen-level and

aggregated

Changes over time and in different locationsChanges in our view of what scale is importantEcological dataset volume rapidly increasingChanges in technology

Who will maintain these knowledgebases?

More general scientific data management questions

How to design a back-end so that contributors can easily enter data, and end-users can easily retrieve what they want, data managers can make big and small changes

How to use the same system for multiple constituent groups research education on different levels outreach to the public

Animal Diversity Web introduction

http://www.animaldiversity.org

From educational outreach science

High traffic, 70,000 pages per day

Geographically and taxonomically global

Animal Diversity Web challengesData entry Student contributors Lack domain expertise, technical expertise Few repeat contributors Completeness, Structuring Single template covering all animal phyla would have unnecessary

keywords and sections for most taxa

Data retrieval To support inquiry education or science, must be able to get data out

via queries Users diverse so may not have knowledge of controlled vocabulary

What happens when underlying data model changes?

ADW’s “loosely coupled” architectureWeinberger, 2002Nodes separately managed from

identifiers used to relate and display them•Template•Taxonomic names•Stylesheets

Taxonomic MySQL database

ITIS

Howard & Moore birds

EMBL reptiles

Sources

SI mammals

CAS fishes

Walks Common names

Creating content

Register for workspaceIdentify subjectReceive customized template (increasingly more structured)Text, keywords, data fieldsAttach referencesReview, edit, publish

Taxon Filtering for customized templatese.g. template section customized for Aves

XML template

Taxon filter

Workflow, legacy contentChange template elements

If new content: receives new template

Legacy objects remain semantically tagged for display and search

New template elements available for ADW editors

http://www.animaldiversity.org

http://biokids.umich.edu

Content display for different audiences

A multi-use database supporting maximum access and minimum barriers to change

Content all managed in the same system, with multiple displays(loose coupling, taxon filtering, customized stylesheets)

Complex object templates can be created or modified, but legacy data remains semantically marked up and thus

available for display and querying

New style sheets, updated taxon data

Where do we go next?

Vertical integration

Example: Biologist studying genetic basis of a behavioral trait that varies across Animalia.

ACCTTGAGATAGACCTTGAGATAG

ACCTTGAGACAG

+ SEEK ecological ontologies+ Animal Behavior ontology (for more information, see me)+ Gene Ontology ….

Natural history ontology from Animal Diversity Web

Contribution model scales well

User involvement fosters engagement

Accessible resource for science

Scaling, engagement, and interoperability

Acknowledgements

ADW team: particularly Phil Myers, Roger Espinosa, Tricia Jones, Tanya Dewey George Hammond

BioKIDS team: particularly Nancy Songer Ontologies: Peter Midford and Jennifer Golbeck NSF IERI (UMich) and ITR (UMd) grants

Ontologies, manuscript, and presentation can be found at

http://www.animaldiversity.org/site/about/technology/