A broad-range yeast expression system reveals Arxula adeninivorans expressing a fungal self-sufficient cytochrome P450 monooxygenase as an excellent whole-cell biocatalyst

R E S EA RCH AR T I C L E

A broad-range yeast expression system reveals Arxulaadeninivorans expressing a fungal self-sufficient cytochrome

P450 monooxygenase as an excellent whole-cell biocatalyst

Chrispian W. Theron1,2, Michel Labuschagn�e1, Ramakrishna Gudiminchi1,2, Jacobus Albertyn1 &Martha S. Smit1,2

1Department of Microbial, Biochemical and Food Biotechnology, University of the Free State, Bloemfontein, South Africa; and 2South African

DST-NRF Centre of Excellence in Catalysis, University of Cape Town, Cape Town, South Africa

Correspondence: Martha S. Smit,

Department of Microbial, Biochemical and

Food Biotechnology, University of the Free

State, PO Box 339, Bloemfontein 9300,

South Africa. Tel.: +27 51 401 2219;

fax: +27 51 401 9376;

e-mail: [email protected]

Received 24 October 2013; revised 4

December 2013; accepted 2 February 2014.

Final version published online 5 March 2014.

DOI: 10.1111/1567-1364.12142

Editor: Jens Nielsen

Keywords

self-sufficient cytochrome P450

monooxygenases; heterologous expression;

ascomycetous yeasts; broad-range expression

vector; co-expression; whole-cell biocatalysis.

Abstract

The feasibility of using a single vector to clone a cytochrome P450 monooxy-

genase (P450) in different yeasts and then compare whole-cell hydroxylase

activity was investigated. A broad-range yeast expression vector using the

ylTEFp to drive expression of the cloned gene and the scTEFp to drive the

hygromycin resistance marker gene was used to clone the genes encoding two

self-sufficient P450s, CYP102A1 and CYP505A1. Both genes were cloned into

Saccharomyces cerevisiae, Kluyveromyces marxianus, Yarrowia lipolytica (two

strains) and Arxula adeninivorans. 4-Hexylbenzoic acid (HBA), which is subter-

minally hydroxylated by both CYP102A1 and CYP505A1, was used to compare

whole-cell hydroxylase activity of transformants. Kluyveromyces marxianus and

A. adeninivorans exhibited activity with both CYP102A1 and CYP505A1, while

S. cerevisiae only displayed CYP102A1 activity and Y. lipolytica only CYP505A1

activity. The highest CYP102A1 activity (0.8 mM HBA converted in 24 h) was

observed with concentrated resting-cell suspensions of S. cerevisiae. The

CYP505A1 activity observed with growing cultures of A. adeninivorans was

however at least 12 times higher than the CYP102A1 activity of S. cerevisiae

with up to 2 mM HBA converted within 6 h. The use of K. marxianus and

A. adeninivorans for P450 expression has not previously been reported.

Introduction

The cytochrome P450 monooxygenases (P450s) are

diverse, ubiquitous enzymes which catalyse the hydroxyl-

ation of nonactivated carbons with exceptional specificity

using molecular oxygen and reduced cofactors. Much of

the research on P450s has been dedicated to their roles in

drug metabolism and their use for drug design, but these

enzymes are also of interest in the fields of chemical syn-

thesis and bioremediation. Large-scale applications of

these enzymes are however limited by their requirement

for supply and regeneration of expensive cofactors. In

most cases, they also require co-proteins for transfer of

electrons to the P450, and they are further limited by

poor stability (for reviews on P450s and their biotechno-

logical applications see Kumar, 2010; Urlacher & Girhard,

2012). These limiting factors can be greatly improved by

employing whole-cell systems for bioconversions (Geier

et al., 2012; Urlacher & Girhard, 2012). Therefore, the

identification of appropriate hosts for heterologous

expression of P450s is necessary.

Escherichia coli has been widely used as a host for

expression of P450s, but problems with substrate uptake

(Cornelissen et al., 2013), insufficient available heme and

lack of P450-reductase systems limit the use of this

host for whole-cell biocatalysis (Z€ollner et al., 2010).

Additionally, eukaryotic P450 expression in E. coli is

often limited by misfolding of the recombinant proteins,

leading to aggregation in inclusion bodies (Z€ollner et al.,

2010).

Yeasts are promising hosts for eukaryotic P450s as they

combine prokaryotic simplicity of growth and manipula-

tion with eukaryotic complexity of protein machinery.

Thus far the use of yeasts as hosts for expression of

FEMS Yeast Res 14 (2014) 556–566ª 2014 Federation of European Microbiological Societies.Published by John Wiley & Sons Ltd. All rights reserved

YEA

ST R

ESEA

RC

H

recombinant P450s has been focused on the improvement

of protein integrity, rather than the improvement of

activities, and as such, whole-cell systems have been scar-

cely used (Z€ollner et al., 2010). Therefore, the use of

yeasts expressing P450s as whole-cell biocatalysts is an

underdeveloped field of research. Only relatively few yeast

species have established expression vectors, hence using

species-specific expression systems would limit the num-

ber of candidates and potentially favour hosts with the

better established expression systems. To facilitate an

unbiased comparison of the heterologous expression and

whole-cell hydroxylation capabilities of various yeasts

simultaneously, a common vector system and consistent

set of cultivation conditions should be used. A broad-

range vector system was developed in our research group

for such applications (Smit et al., 2012a). Broad-range

vector systems have previously led to successful compari-

sons of recombinant protein production by different

hosts (Steinborn et al., 2006), but to our knowledge,

P450 expression among different hosts using a common

expression system has not previously been reported,

although different hosts have been compared using host-

specific vectors (Geier et al., 2012).

Self-sufficient P450s are natural fusions between P450

domains and their corresponding cytochrome P450

reductase (CPR) domains (Narhis & Fulcoq, 1987). This

arrangement simplifies and enhances transport of elec-

trons to the active site, allowing these enzymes to have

increased reaction rates. The increased reaction rates and

self-sufficient nature of these P450s make them the most

promising for industrial application (Kumar, 2010;

Urlacher & Girhard, 2012).

The aim of this study was to use a newly constructed

broad-range vector system to investigate several yeasts for

their potential as hosts for heterologous expression of

self-sufficient P450s, and their capabilities as recombinant

whole-cell biocatalysts. Two self-sufficient subterminal

fatty acid hydroxylases were selected as reporter

enzymes, CYP505A1 from the fungus Fusarium oxysporum

(Nakayama et al., 1996) and CYP102A1 from the bacte-

rium Bacillus megaterium (Narhis & Fulcoq, 1987), the

latter being the most extensively studied P450 to date

(Urlacher & Girhard, 2012). The employed vector system

allowed expression of the tested P450s, detected as whole-

cell hydroxylase activity towards a model compound 4-

hexylbenzoic acid (HBA), to be evaluated in Saccharomy-

ces cerevisiae, Kluyveromyces marxianus, Yarrowia lipolytica

(two strains) and Arxula adeninivorans. This is to our

knowledge the first direct interspecies comparison of

P450 expression using a common vector system and a set

of cultivation and biotransformation conditions.

Materials and methods

Chemicals, plasmids and microbial strains

Chemicals and antibiotics were obtained from Sigma–Aldrich, Fluka, Merck and HyClone. DNA modification

enzymes were obtained from Fermentas, New England Bi-

olabs, Lucigen and Kapa Biosystems. BioFlux Biospin gel

extraction kits and Biospin plasmid DNA extraction kits

for DNA extraction and purification were supplied by

Separations Scientific.

Escherichia coli XL-10 Gold (Stratagene) was used for

cloning and plasmid propagation. Yeast strains used as

hosts for heterologous expression are listed in Table 1

and were all obtained from the University of the Free

State (UFS) yeast culture collection.

The coding sequence for CYP505A1 from F. oxysporum

was artificially synthesized by GeneArt and provided in a

pMK-RQ plasmid. The B. megaterium CYP102A1 gene

was generously provided by Professor Vlada Urlacher,

Heinrich-Heine-University, D€usseldorf, Germany, in a

pET28a plasmid. The broad-range yeast expression vec-

tors pKM118, pKM173 and pKM177 (Fig. 1) were con-

structed in our group from components derived from

yeast strains from the UFS culture collection (Smit et al.,

2012b).

Table 1. Yeast strains tested with pKM118 for expression of self-sufficient P450s

Yeast Strain Genotype

Arxula adeninivorans UOFS Y1220 Wild-type strain

Kluyveromyces marxianus UOFS Y1185 Wild-type strain

Saccharomyces cerevisiae W3031A(a) MATa leu2-3/112 ura3-1 trp1-1 his3-11/15 ade2-1 can1-100 GAL SUC2

Yarrowia lipolytica CTY029* MatA ura3-302 leu2-270 URA3 LEU2 xpr2-322 pox1-6::lox pJMP21::pPOX2-CPR

Yarrowia lipolytica CTY003† MatB his1 ura3-302 leu2-270 URA3 LEU2 xpr2-322

*Derived from strain FT-120 (MatA ura3-302 leu2-270 xpr2-322 pox1-6::lox pJMP21::pPOX2-CPR) by transformation with two empty vectors

derived from JMP62 and JMP21 (Nthangeni et al., 2004) to restore uracil and leucine prototrophy. FT-120 is a W29 derivative with disrupted

b-oxidation pathway (Nicaud et al., 2010).†Derived from strain E150 (MatB his1 ura3-302 leu2-270 xpr2-322) by transformation with two empty vectors derived from pJMP62 and pJMP21

(Nthangeni et al., 2004) to restore uracil and leucine prototrophy. This strain has intact b-oxidation pathway.

FEMS Yeast Res 14 (2014) 556–566 ª 2014 Federation of European Microbiological Societies.Published by John Wiley & Sons Ltd. All rights reserved

A broad-range yeast expression system for P450s 557

Construction of expression vectors

Standard molecular biology techniques were carried out as

described by Sambrook and Russel (2001), and enzymes

were applied according to the specifications of the manu-

facturers. CYP505A1 was transferred from pMK-RQ into

pET28b and pET22a to yield pET28b_His-CYP505A1 and

pET22a_CYP505A1 by the NdeI and HindIII restriction

sites in the plasmids, while it was transferred from pMK-

RQ into pKM118 to yield pKM118_CYP505A1 by the XhoI

and AvrII restriction sites. His-tagged CYP505A1 was

cloned into pKM173 and pKM177 using restriction sites

XhoI and AfeI after amplification from pET28b_His-

CYP505A1 with primers CTCGAGATGGGCAGCAGC

CATCATCATC (to introduce XhoI site) and CGCTAATC

GAAAACATCAGTAGCAAAACGC (to add blunt end).

The expression cassette containing His-CYP505A1 was

removed from pKM177 by I-SceI digestion, and ligated

into pKM173 which had been linearized by digestion with

I-SceI, resulting in pKM173_2xHis-CYP505A1. To create

pKM118_His-CYP102A1, the blunt-ended NcoI – SacI

fragment from pET28a_CYP102A1 was ligated with the

blunt-ended AvrII – XhoI fragment from pKM118.

Transformation of yeasts

Yeasts listed in Table 1 were transformed with

pKM118_CYP505A1 and pKM118_His-CYP102A1 as well

as empty pKM118. Arxula adeninivorans UOFS Y1220 was

also transformed with pKM173_His-CYP505A1 and

pKM173_2xHis-CYP505A1. All yeast strains were trans-

formed according to a modification of the method

described by Lin-Cereghino et al. (2005), except K. marxi-

anus, which was transformed according to a modification

of the method of Chen et al. (1997). Prior to transforma-

tion, the relevant vectors were digested with NotI to sepa-

rate the yeast integration cassette from the bacterial moiety

of the vector. After transformation, the cells were streaked

on selective yeast extract-peptone broth (YPD) plates [yeast

extract 1% (w/v), peptone 2% (w/v), glucose 2% (w/v),

agar 2% (w/v)] supplemented with 400 mg L�1 hygromy-

cin B and incubated until colonies appeared. Colonies were

re-streaked on selective YPD before being frozen with 15%

(v/v) glycerol at �80 °C. Chromosomal integration of the

expression cassette was confirmed by PCR using genomic

DNA as template.

Biotransformations using yeasts

Strains were revived from frozen stocks by streaking onto

YPD selective plates. Cells from selective plates were used

to inoculate YPD medium [yeast extract 1% (w/v), peptone

2% (w/v), glucose 2% (w/v)]. Culture volumes were 5 mL

per 25-mL test tube for initial screening, and 50 mL per

500-mL flask for subsequent biotransformations. Inocu-

lated cultures were incubated on a rotary shaker

(180 r.p.m.) at 28 °C for 48 h. For biotransformations

using growing cells, HBA dissolved in dimethylsulfoxide

was added to final concentrations of 5 mM HBA and 1%

(v/v) dimethylsulfoxide directly to the cultures after 48 h

cultivation. Cultures were again incubated further and

samples collected over time. To inhibit induction of wild-

type P450s by HBA 1 mM 1,10-phenanthroline (250 lL of

a 100 mM dimethylsulfoxide solution) was added 1 h prior

to the addition of HBA in one experiment to a culture of

an A. adeninivorans transformant-expressing CYP505A1.

For growth on chemically defined medium (CDM), cells

were transferred from overnight growth on selective plates

to YPD broth (25 mL in 250-mL flasks), and incubated at

28 °C on a rotary shaker (130 r.p.m.). Cultures were grown

for 24 h before they were used as inoculums (10% v/v) for

a CDM, consisting of 20 g L�1 glucose, 10 g L�1

(NH4)2�SO4, 0.8 g L�1 MgSO4�7H2O, 0.1 g L�1 NaSO4,

0.4 g L�1 CaCl2�2H2O, 2.7 mg L�1 KI, 0.27 g L�1 (NH4)2FeSO4�6H2O, 0.11 g L�1 MnSO4�H2O, 0.53 mg L�1 NiCl�6H2O, 11 mg L�1 CuSO4�5H2O, 0.08 g L�1 ZnSO4�7H2O,

2.7 mg L�1 NiSO4�6H2O, 2.7 mg L�1 CoCl4�6H2O,

2.7 mg L�1 Na2Mo2�2H2O, 2.7 mg L�1 boric acid,

0.8 mg L�1 D(+)-Biotin, 0.53 g L�1 thiamine-HCl, and

200 mM potassium phosphate buffer (pH 8); (modified

from Knoll et al., 2007).

Fig. 1. A map of the broad-range expression vector pKM118. Genes

to be cloned are inserted between the Yarrowia lipolytica TEF promoter

(ylTEFp) and the Kluyveromyces marxianus inulinase terminator

(kmINUt) using the XhoI, AfeI and AvrII restriction sites. The selection

marker is the hygromycin phosphotransferase gene (hph) from

Escherichia coli which is flanked by the Saccharomyces cerevisiae TEF

promoter (scTEFp) and terminator (scTEFt). The yeast casette, released

by digestion with NotI, is integrated into the genome by a region of the

K. marxianus rDNA which includes the one internal transcribed spacer

(ITS), 5.8S rRNA gene, 18S rRNA gene and external transcribed spacer

(ETS). The variant pKM173 contains a I-SceI site immediately prior to

the ylTEFp sequence, while the pKM177 variant contains an additional

I-SceI site immediately after the kmINUt sequence.


558 C.W. Theron et al.

For biotransformations using resting cells, 48 h YPD

cultures or 24 h CDM cultures were harvested by centri-

fugation. The pellets were washed with 50 mM potassium

phosphate buffer, pH 8, and resuspended in a resuspen-

sion buffer [200 mM potassium phosphate buffer, pH 8;

16% (v/v) glycerol, 100 lg mL�1 FeSO4�7H2O] in a ratio

of 3 mL buffer per 1 gWCW. Two millilitre reaction mix-

tures were set up in 40-mL amber bottles, containing

200 mM potassium phosphate buffer (pH 8), 36 mM glu-

cose, 5 mM HBA, 1% (v/v) dimethylsulfoxide, 8% (v/v)

glycerol, 50 lg mL�1 FeSO4�7H2O and 42 gDCW L�1

(A. adeninivorans) or 34 gDCW L�1 (all other yeasts) bio-

mass. Reaction mixtures were incubated for 24 h on a

rotary shaker at 28 °C and 180 r.p.m.

Investigation of subcellular localization of

CYP505A1 in A. adeninivorans

Transformants of A. adeninivorans-expressing CYP505A1

were cultivated in CDM. After harvesting the cells by cen-

trifugation, the pellet was washed with 10 mM Tris-HCl

buffer (pH 7.5) containing 0.65 M sorbitol, 0.1 mM dith-

iothreitol and 0.1 mM ethylenediaminetetraactetic acid

(EDTA). The cells were then resuspended in a lysis buffer

consisting of 10 mM Tris buffer (pH 7.5), 2 M sorbitol,

0.1 mM dithiothreitol, 1 mM EDTA and 0.25 mM phen-

ylmethylsulfonyl fluoride.

The resuspended cells were disrupted using three pas-

sages through a Constant Systems Cell Disrupter using

15 kPsi. The lysate was centrifuged for 10 min at 4000 g.

The supernatant was then ultracentrifuged at 12 000 g for

30 min. The resultant pellet fraction represented the

mitochondrial fraction, and the supernatant was further

ultracentrifuged at 87 000 g for 2 h. The resultant super-

natant represented the soluble fraction, with the pellet

representing the microsomal fraction. Pellets were resus-

pended in a resuspension buffer consisting of 100 mM

Tris-HCl buffer (pH 7.5), 20% (v/v) glycerol and 0.1 mM

dithiothreitol. All fractions were used for activity assays

in amber bottles, with the reaction mixtures containing

50 mM Tris-HCl buffer (pH 7.5), 1 mM NADPH,

250 lM hexylbenzoic acid (HBA), 6 U glucose 6-phos-

phate dehydrogenase, 8 mM glucose 6-phosphate and

50% (v/v) relevant fraction. Reaction mixtures (2 mL)

were incubated in 40-mL amber bottles for 24 h on a

rotary shaker at 28 °C and 130 r.p.m.

Sample extraction and product analysis

Samples (500 lL) were taken at regular intervals and

acidified using hydrochloric acid (5 M) to below pH 3.

Samples were extracted twice with ethyl acetate (300 lL)containing myristic acid (0.5 mM), as an internal

standard and the extracts combined. For the assays car-

ried out in amber vials using resting cells, the entire reac-

tion mixture volume (2 mL) was extracted using ethyl

acetate (2 9 1.2 mL) containing myristic acid (0.5 mM)

as an internal standard. The collected organic extracts

were pooled, and aliquots were concentrated using an

Eppendorf Concentrator Plus, prior to further analysis.

Analysis was performed using TLC and/or GC. For

TLC, aliquots (5–10 lL) of organic extracts of samples

and standards were spotted on Alugram� silica gel F254TLC plates (Merck) developed using a mobile phase-con-

taining di-n-butyl ether, formic acid, distilled water

(90 : 7 : 3 v/v/v). HBA and its products appeared as

UV-absorbing spots.

Organic acids were methylated prior to GC analysis

using equal volumes of a trimethylsulfonium hydroxide

(TMSH) preparation (Butte, 1983). GC analyses were per-

formed on samples (1 lL) using a Hewlett-Packard 5890

series II gas chromatograph equipped with a

30 m 9 0.53 mm Chrompack� CP wax 52 CB column

and a flame ionization detector. GC–MS analysis was per-

formed on a Thermo Trace GC ultra chromatograph with

DSQ MS fitted with a 30 m 9 0.25 mm 9 0.25 lmVarian Factor Four VF-5 ms column.

Results and discussion

Design of a broad-range vector system

rDNA regions, mainly consisting of the 18S rRNA gene

subunit from K. marxianus (‘18S rRNA gene’, Fig. 1)

were selected for chromosomal integration of the yeast

cassette of the broad-range vector pKM118. Most yeast

species do not maintain plasmids, or when they do the

plasmid stability is generally poor (Juretzek et al., 2001;

Gellissen et al., 2005). Therefore, chromosomal integra-

tion is preferred when designing vectors for yeasts, as it is

applicable to most yeasts and it improves the stability of

the introduced genes (Juretzek et al., 2001; Iwata et al.,

2004). Ribosomal DNA is a universal target for gene inte-

gration, due to its conserved function within all cells. It

has regions that are highly conserved between species,

and is generally present in high copy number within the

genome, potentially allowing multiple integrations of the

same or different genes without significantly affecting

the original function, due to the multicopy nature of the

target region (Juretzek et al., 2001; Terentiev et al., 2004;

Steinborn et al., 2005).

The use of a constitutive promoter allows expression in

different yeasts under the same set of conditions, without

the requirement for special induction conditions that

might naturally favour some yeasts more than others. The

Y. lipolytica translation elongation factor (TEF) promoter



was selected as the promoter for the pKM118 vector

(‘ylTEFp’, Fig. 1), as it is known to be a strong constitu-

tive promoter, with significant homology to TEF promot-

ers from other species such as A. adeninivorans and

S. cerevisiae (M€uller et al., 1998). The choice of termina-

tor seems to be less strict, and the K. marxianus inulinase

terminator was chosen for this vector, because it was

available and easy to transfer from another vector from

our collection (kmINUt, Fig. 1).

Dominant antibiotic resistance markers are advanta-

geous over auxotrophic markers in that they do not

require auxotrophic strains. This is particularly beneficial

for interspecies screening and when various strains are to

be tested. As many strains are sensitive to hygromycin B

(Terentiev et al., 2004), a hygromycin phosphotransferase

gene (hph) conferring resistance to hygromycin B was

used (hph, Fig. 1) to select transformants. Expression of

this gene was driven by the TEF promoter from S. cerevi-

siae (scTEFp, Fig. 1).

As a shuttle vector, the vector contains a bacterial moi-

ety for replication, maintenance and selection during sub-

cloning in E. coli. The bacterial portion is separated from

the yeast expression cassette prior to yeast transformation

by digestion using NotI, the recognition sites for which

flank the 18S rRNA gene homology regions (Fig. 1).

In preliminary studies, representative strains of S. cere-

visiae, Hansenula polymorpha, K. marxianus, Y. lipolytica,

A. adeninivorans, Debaromyces hansenii, Schwaniomyces

occidentalis and Kluyveromyces lactis as well as various

strains of Candida spp. and Pichia spp. were tested with

different antibiotic resistance markers and promoters

(Smit et al., 2012a; Theron, 2012). These early investiga-

tions decreased the list of yeasts that gave promising

results with the pKM118 vector to S. cerevisiae, K. marxi-

anus, Y. lipolytica, A. adeninivorans, Candida deformans

and K. lactis. Candida deformans and K. lactis were not

included in the present study because they are very clo-

sely related to Y. lipolytica and K. marxianus, respectively.

Biotransformations of HBA using yeasts in

growth cultures

Initial screening of transformants with CYP102A1 or

CYP505A1 was performed by adding HBA, a confirmed

substrate of CYP102A1 (Gudiminchi & Smit, 2011) and

CYP505A1 (Fig. S1, Supporting information) that is not

degraded by b-oxidation, directly to the growth cultures

after 48 h of cultivation. Four to five transformants of

each yeast strain transformed with pKM118_His-

CYP102A1 or pKM118_CYP505A1 were tested for

biotransformation of HBA using 24 and 48-h biotransfor-

mation periods. Very low levels of activity were

detected with His-CYP102A1 carrying transformants of

S. cerevisiae and His-CYP102A1 and CYP505A1 carrying

transformants of K. marxianus. Wild-type CYP52s (termi-

nal alkane and fatty acid hydroxylases) in transformants

of Y. lipolytica CTY003 (E150-derivative with intact

b-oxidation), rapidly hydroxylated HBA and further oxi-

dized the product, preventing any activity of cloned

enzymes to be detected.

With CYP505A1-containing transformants of A. adeni-

nivorans and the b-oxidation deficient Y. lipolytica

CTY029 (FT-120-derivative), different product profiles

were observed, consisting of predominantly the two prod-

ucts, x-2 OH-HBA and x-1 OH-HBA (Fig. 2), previously

observed with E. coli strains expressing CYP102A1

(Gudiminchi & Smit, 2011) and CYP505A1 (Fig. S1),

produced in a 2 : 1 ratio in contrast to the 7 : 1 x-2OH-HBA: x-1 OH-HBA ratio observed with CYP102A1.

These higher activities were easily distinguished from the

minimal activities towards HBA exhibited by the empty

vector controls of these strains. The activity was higher in

the A. adeninivorans transformants than in Y. lipolytica

transformants with complete conversion of 5 mM HBA

by the A. adeninivorans strains within 24 h, while < 20%

HBA was converted by the Y. lipolytica transformants

during this time.

Thin layer chromatography (TLC), gas chromatography

(GC) and gas chromatography–mass spectrometry (GC–MS) were used to monitor HBA conversion by A. adeni-

nivorans transformants expressing CYP505A1 over 48 h

(Fig. 3, Fig. S2). Over time x-1 OH-HBA disappeared

while a number of additional over oxidized products

accumulated (Fig. 3). These products were identified by

MS analysis (Fig. S2) of the methyl esters as the ketones

of the two hydroxylated products as well as the C6, C4,

C3 and C2 diacids of HBA (Fig. 2). The ketones are most

likely formed by the dehydrogenases present in the yeast

but they might also result from over oxidation by

CYP505A1. The fact that these products only appeared

when almost all of the HBA was consumed, supports the

idea that they might be produced through overoxidation

by CYP505A1. It is of interest to note that no diacids had

been observed in extracts from biotransformations of

HBA by wild-type A. adeninivorans (C.W. Theron & M.S.

Smit, unpublished). Biotransformation of HBA by a wild-

type Y. lipolytica strain with intact b-oxidation yielded

the C6 diacid as the major product as well as small

amounts of the C3 and C2 diacids, but the C4 diacid was

not observed (C.W. Theron & M.S. Smit, unpublished).

In the case of the A. adeninivorans transformants, the rel-

ative amounts of the C4, C3 and C2 diacids compared to

C6-diacid were much higher than observed with the wild-

type Y. lipolytica. The C4 and C3 diacids can in principle

also be formed from the x-1 and x-2 ketones, if

A. adeninivorans would possess enzymes that can perform



Bayer-Villiger-type oxidations or if CYP505A1 possess

this type of activity. The latter has not been described for

CYP505A1 although P450s are known to catalyse Bayer-

Villiger oxidations (Schroer et al., 2010).

The detection of C6-diacid produced by hydroxylation

of HBA by the wild-type P450s (most likely CYP52s) in

A. adeninivorans was surprising and disappointing, as

very little products (not detectable by GC–MS) were

observed with the wild-type strain (C.W. Theron & M.S.

Smit, unpublished). Addition of 1,10-phenanthroline

(1 mM), an established inhibitor of transcription (Grigull

et al., 2004) which completely inhibited induction of the

wild-type CYP52s in Y. lipolytica (C.W. Theron & M.S.

Smit, unpublished), largely abolished formation of addi-

tional products by an A. adeninivorans transformant

expressing CYP505A1 (Fig. S3). Activity of the cloned

CYP505A1 was however also reduced to the extent that

HBA was not completely consumed after 30 h, thereby

leaving the question whether products formed upon com-

plete consumption of substrate are due to CYP505A1

activity or wild-type activities.

Biotransformations of HBA using resting cells

In an attempt to improve activities, concentrated suspen-

sions of harvested resting cells suspended in a phosphate

buffer containing glucose (36 mM) and glycerol (8% v/v)

were also tested. Biomass was generated by growing the

cultures in either YPD or CDM, and cells were resus-

pended to the same wet weight concentration (1 gWCW in

3 mL buffer). Only the x-2 OH-HBA product was used

to calculate conversions shown in Fig. 4, because its con-

centration remained constant between 24 and 48 h in

biotransformations carried out with A. adeninivorans

transformants. Thus, these values represent about 66% of

the total products for CYP505A1, but nearly 90% of the

total products for CYP102A1. This needs to be taken into

account when comparing relative whole-cell activities

between the two enzymes tested. It does not however

affect interstrain comparisons for the separate enzymes.

The use of concentrated resting-cell suspensions

improved the activity observed with transformants of all

the yeasts except A. adeninivorans. Only K. marxianus and

A. adeninivorans exhibited activity with both CYP102A1

and CYP505A1, with S. cerevisiae only displaying

CYP102A1 activity and Y. lipolytica only CYP505A1 activ-

ity. The use of harvested cells suppressed the wild-type

CYP52 activities which had previously prevented detection

of the CYP505A1 activity in transformants of the Y. lipoly-

tica strain with intact b-oxidation. The best activity

for CYP102A1 (0.8 lmol h�1 gDCW�1) was obtained

using S. cerevisiae, which was six- to sevenfold higher than

Fig. 2. Products produced during

biotransformation of HBA by Arxula

adeninivorans-expressing CYP505A1. Only

products detected by GC-MS analysis of

methylated samples are shown. x-1 OH-HBA

and x-2 OH-HBA are the only products

detected when HBA was converted by

Escherichia coli-expressing CYP102A1 or

CYP505A1. WT indicates activities due to

enzymes present in the wild-type organism.

BVO, Bayer-Villiger oxidation.



activities with K. marxianus and A. adeninivorans transfor-

mants expressing this gene. CYP102A1 activity observed

with S. cerevisiae was however variable with no activity

detected in some experiments including those with CDM.

The best overall activity was obtained with A. adeninivo-

rans-expressing CYP505A1, in which case more than 1 mM

of product was observed. This was however less than

half the amount of x-2 OH-HBA produced by

growing cells. Using resting cells, a specific activity of

1.3 lmol h�1 gDCW�1 was obtained after 24 h, compared

to 6.1 lmol h�1 gDCW�1 using growing cells. This means

that while activity of the other species benefitted when

increased cell concentrations were used, it was actually det-

rimental to A. adeninivorans activity. However, A. adeni-

nivorans transformants expressing CYP505A1 still gave the

highest conversions.

(a)

(c)

(b)

Fig. 3. Conversion of HBA (5 mM) by a

transformant of Arxula adeninivorans-

expressing CYP505A1 after 48 h growth in

YPD broth. The reactions were carried out in

different experiments and followed by (a) TLC

analyses, (b) GC analyses and (c) GC-MS

analyses. Structures of HBA, x-1 OH-HBA, x-2

OH-HBA, x-1 keto HBA, x-2 OH-HBA, C6-

diacid, C4-diacid, C3-diacid and C2-diacid are

shown in Fig. 2. Mass spectra of products not

previously detected as products of wild-type

activity in alkane-degrading yeasts are shown

in Fig. S2. MA, myristic acid (used as internal

standard).



Differences in hydroxylase activities

Surprisingly, little variation was observed each time four

or five independent transformants of A. adeninivorans

transformed with plasmids carrying CYP505A1 were

screened for activity (Fig. S4a). This was also the case

with the other yeasts which showed activity, although

activities were more difficult to detect (Fig. S4b). It is

very unlikely that all transformants contained the same

number of copies, unless it was one copy each. If that is

the case, copy number cannot be the reason for the supe-

rior activity observed with A. adeninivorans, as no tested

transformant could have had less than one copy. R€osel &

Kunze (1998) had reported 1–3 copies stably integrated

into the genome of A. adeninivorans when using an

rDNA-based integrative cassette with a hygromycin resis-

tance marker and a TEF promoter driving expression. In

work done with two other fungal enzymes, vanillyl-alco-

hol oxidase and an extracellular xylanase, transformants

with approximately double the activity of the majority

were occasionally observed, suggesting integration of two

copies of the expression cassette. However, even if there

were two or perhaps three copies of the CYP505A1-

encoding gene integrated in the A. adeninivorans transfor-

mant selected for quantitative studies, the activities

observed were still far more than double or even triple

the activities of the other strains.

It was expected that the ylTEFp should function equally

well in A. adeninivorans, K. marxianus and Y. lipolytica and

perhaps better in S. cerevisiae, because transformation effi-

ciency was similar in the first three (11–100 cfu lg�1

DNA) and better in S. cerevisiae (> 101 cfu lg�1 DNA)

when it was evaluated in the different yeasts using a rDNA-

based integrative cassette carrying the hygromycin resis-

tance marker under control of the ylTEFp (Smit et al.,

2012b). However, in the case of the vanillyl-alcohol oxidase

and extracellular xylanase enzymes, cloned using the same

integrative cassette as used in this study, activities were in

each case the worst in the S. cerevisiae transformants, while

the differences between A. adeninivorans, K. marxianus and

Y. lipolytica were not as large as in the present study. Yarr-

owia lipolytica performed the best in the case of the extracel-

lular xylanase and single copy transformants of

A. adeninivorans and K. marxianus performed the best

(equally well) in the case of the vanillyl-alcohol oxidase

(Smit et al., 2012a; M. Labuschagn�e & J. Albertyn, unpub-

lished). Southern, Northern and Western blot analyses,

which fell outside the scope of this present study, will be

required to establish whether the differences in activities

observed in the present and other studies were due to differ-

ences in copy numbers, transcription, translation or simply

whole-cell activity. The latter two seems at this stage more

likely. It should be noted that the CYP505A1 gene was not

codon optimized, but still contained the codons used in

F. oxysporum. It might thus be that A. adeninivorans is

more versatile with regard to codon usage or more suited

for the translation of fungal genes. Differences in whole-cell

activity can be due to differences in the ability to take up

the substrate or in differences in the ability to supply and

regenerate cofactors. All of these might also have contrib-

uted to the differences in activities observed with YPD and

CDM grown cells as well as growing and resting cells.

Subcellular localization of CYP505A1 in

A. adeninivorans

Subcellular localization of CYP505A1 has been demon-

strated to be host-dependent. While in its natural host,

F. oxysporum, CYP505A1 is loosely membrane bound,

heterologous expression in S. cerevisiae resulted in pri-

marily localization in the soluble fraction (Kitazume

et al., 2002). Due to the highest activity being obtained

with A. adeninivorans-expressing CYP505A1, it was

decided to investigate the subcellular localization of the

recombinant protein in this yeast.

Fig. 4. Production of x-2 OH-HBA by resting cells of transformants

expressing CYP102A1 and CYP505A1. Cultures were grown in YPD

broth (green bars) and CDM (dark blue bars), harvested and

resuspended in 200 mM potassium phosphate buffer with reaction

mixtures finally containing 42 gDCW L�1 (Arxula adeninivorans) or

34 gDCW L�1 (all other yeasts) biomass and 5 mM HBA. Reaction

mixtures were incubated for 24 h. Values are averages of ten

reactions (duplicate reactions carried out with cells from three or two

different flasks in two separate experiments) in the case of YPD

grown cells and six reactions (duplicate reactions carried out with cells

from one and two flasks in two separate experiments) in the case of

CDM grown cells.



Broken cells of A. adeninivorans-expressing CYP505A1

and an empty vector control strain were fractionated into

mitochondrial, microsomal and cytosolic (soluble) frac-

tions by ultracentrifugation. Activity assays were per-

formed for each fraction (Fig. S5). Similar to

heterologous expression in S. cerevisiae (Kitazume et al.,

2002), CYP505A1 was localized in the soluble fraction of

A. adeninivorans. Wild-type hydroxylase activity, which

was unexpectedly high, could be observed in the micro-

somal fraction, as would be expected for yeast CYP52s.

These results indicated that this recombinant strain under

these conditions did not require HBA to induce wild-type

P450s. The high substrate conversions obtained with

whole cells of A. adeninivorans thus confirm that

membrane association is not essential for activity of a

self-sufficient P450.

Expression of one and two copies of His-tagged

CYP505A1 in A. adeninivorans

We have also developed two vectors (pKM173 and

pKM177), variants of the broad-range vector pKM118,

which allow cloning of two (or more) genes using a single

vector. These vectors contain one and two I-SceI sites,

respectively, and we could thus create a vector containing a

double CYP505A1 expression cassette, meaning that the in-

tegrant itself would contain two CYP505A1 expression cas-

settes rather than one. To test these plasmids, His-tagged

CYP505A1 amplified from His-tagged CYP505A1 previ-

ously expressed in E. coli was cloned into pKM173 and

pKM177. Arxula adeninivorans transformants transformed

with either pKM173_2xHis-CYP505A1 or pKM173_His-

CYP505A1 were screened for HBA conversion. Activity was

significantly improved in transformants containing the

double expression cassette when compared with ones con-

taining a single cassette (Fig. S6). Further improvements in

P450 activities can thus in future be obtained by using the

pKM173 and pKM177 plasmids to construct vectors with

two (or possibly more) copies of the cloned genes.

His-CYP505A1 was used in these experiments with a

view to using Western blot analyses to compare expres-

sion levels of the P450s, given that it was not possible to

obtain CO difference spectra with whole cells or cell-free

extracts of A. adeninivorans transformants or to detect

expressed P450s with SDS-Page analyses. Unfortunately,

addition of the His-tag caused a significant decrease in

hydroxylase activity, when results for the single His-

CYP505A1 were compared with earlier results, although

earlier experiments had indicated that CYP505A1 activity

in E. coli had not been affected by the His-tag (Fig. S1).

The decrease in activity caused by the His-tag made this

approach to compare levels of protein expression in the

different yeasts unfeasible, because hydroxylase activity in

the other yeasts would most likely be too low for detec-

tion. This result might also explain the lower activities

observed with transformants expressing CYP102A1, which

was cloned with a His-tag. However, the His-tag did not

negatively affect activity of CYP102A1 when activities of

CYP102A1 with and without His-tag were initially com-

pared in K. marxianus, after cloning with a vector specific

for K. marxianus (Theron, 2012). This was the reason

why only His-CYP102A1 was tested with the broad-range

vector.

Conclusions

This study proved the ability of the broad-range vector

system to facilitate interspecies comparison of P450

expression. Application of these broad-range vectors is

not limited to P450 expression and has also been used for

other enzymes (Smit et al., 2012a; M. Labuschagn�e &

J. Albertyn, unpublished). This is to our knowledge the

first time that two of the species, K. marxianus and

A. adeninivorans, have been shown to express cloned

P450s, thus demonstrating the usefulness of such a vector

system to test novel yeasts for which expression systems

are not available. Among the yeasts tested, A. adeninivo-

rans-expressing CYP505A1 proved to be an excellent

whole-cell biocatalyst and it was shown to also be the

case for A. adeninivorans transformants expressing a ben-

zoate para-hydroxylase (CYP53B1; Smit et al., 2012b;

Theron, 2012) as well as fungal vanillyl-alcohol oxidases

(Smit et al., 2012a; Van Rooyen, 2012). By increasing the

gene dosage by doubling gene number within the integra-

tion cassette, activity in A. adeninivorans was improved, a

further advantage of this vector system and a promising

potential start to further optimizations.

Various possibilities for further research exist. Options

for an A. adeninivorans-specific vector could be explored

to further improve activities. More strains of the tested

yeast species can be tested or more yeast species can be

tested. It will be of particular interest to identify yeasts

that display high whole-cell hydroxylase activities, but

that do not have large numbers of their own P450s, that

might give unwanted reactions with substrates. Addition-

ally, Southern, Northern and Western blot analyses can

be used to find explanations for the differences in activi-

ties observed with the different yeasts.

Acknowledgements

Financial support by the University of the Free State, the

South African National Research Foundation and the

South African Department of Science and Technology/

National Research Foundation Centre of Excellence in

Catalysis is gratefully acknowledged. We thank Prof.



Vlada B. Urlacher for providing the pET28a_His-

CYP102A1 plasmid and Dr. Jean-Marc Nicaud for the

Yarrowia lipolytica strains E150 and FT-120. We also thank

Sarel Marais for technical assistance, Dr. Jacqueline van

Marwijk for cloning CYP505A1 into pET vectors and Dr.

Dirk Opperman for critical reading of the manuscript.

References

Butte W (1983) Rapid method for the determination of fatty

acid profiles from fats and oils using trimethylsulphonium

hydroxide for transesterification. J Chromatogr A 261: 142–145.

Chen DC, Beckerich JM & Gaillardin C (1997) One-step

transformation of the dimorphic yeast Yarrowia lipolytica.

Appl Microbiol Biotechnol 48: 232–235.Cornelissen S, Julsing MK, Volmer J, Riechert O, Schmid A &

B€uhler B (2013) Whole-cell-based CYP153A6-catalyzed

(S)-limonene hydroxylation efficiency depends on host

background and profits from monoterpene uptake via AlkL.

Biotechnol Bioeng 110: 1282–92.Geier M, Braun A, Emmerstorfer A, Pichler H & Glieder A

(2012) Production of human cytochrome P450 2D6 drug

metabolites with recombinant microbes – a comparative

study. Biotechnol J 7: 1346–1358.Gellissen G, Kunze G, Gaillardin C, Cregg JM, Berardi E,

Veenhuis M & van der Klei I (2005) New yeast expression

platforms based on methylotrophic Hansenula polymorpha

and Pichia pastoris and on dimorphic Arxula adeninivorans

and Yarrowia lipolytica – a comparison. FEMS Yeast Res 5:

1079–1096.Grigull J, Mnaimneh S, Pootoolal J, Robinson MD & Hughes

TR (2004) Genome-wide analysis of mRNA stability using

transcription inhibitors and microarrays reveals

posttranscriptional control of ribosome biogenesis factors.

Mol Cell Biol 24: 5534–47.Gudiminchi RK & Smit MS (2011) Identification and

characterization of 4-hexylbenzoic acid and

4-nonyloxybenzoic acid as substrates of CYP102A1. Appl

Microbiol Biotechnol 90: 117–26.Iwata T, Tanaka R, Suetsugu M, Ishibashi M, Kikuchi M &

Tokunaga M (2004) Efficient secretion of human lysozyme

from the yeast, Kluyveromyces lactis. Biotechnol Lett 1: 1803–1808.

Juretzek T, Le Dall M-T, Mauersberger S, Gaillardin C, Barth

G & Nicaud J-M (2001) Vectors for gene expression and

amplification in the yeast Yarrowia lipolytica. Yeast 18: 97–113.

Kitazume T, Tanaka A, Takaya N, Nakamura A, Matsuyama S,

Suzuki T & Shoun H (2002) Kinetic analysis of

hydroxylation of saturated fatty acids by recombinant

P450foxy produced by an Escherichia coli expression system.

Eur J Biochem 269: 2075–2082.Knoll A, Bartsch S, Husemann B, Engel P, Schroer K, Ribeiro

B, St€ockmann C, Seletzky J & B€uchs J (2007) High cell

density cultivation of recombinant yeasts and bacteria under

non-pressurized and pressurized conditions in stirred tank

bioreactors. J Biotechnol 132: 167–79.Kumar S (2010) Engineering cytochrome P450 biocatalysts for

biotechnology, medicine and bioremediation. Expert Opin

Drug Metab Toxicol 6: 115–31.Lin-Cereghino J, Wong WW, Xiong S, Giang W, Luong LT,

Vu J, Johnson SD & Lin-Cereghino GP (2005) Condensed

protocol for competent cell preparation and transformation

of the methylotrophic yeast Pichia pastoris. Biotechniques 38:

44–48.M€uller S, Sandal T, Kamp-Hansen P & Dalbøge H (1998)

Comparison of expression systems in the yeasts Yarrowia

lipolytica. Cloning of two novel promoters from Yarrowia

lipolytica. Yeast 14: 1267–1283.Nakayama N, Takemae A & Shoun H (1996) Cytochrome

P450foxy, a catalytically self-sufficient fatty acid hydroxylase

of the fungus Fusarium oxysporum. J Biochem 119: 435–440.Narhis LO & Fulcoq J (1987) Identification and

characterization of two functional domains in a

catalytically self-sufficient monooxygenase. J Biol Chem

262: 6683–6690.Nicaud J-M, Thevenieau F, Le Dall M-T & Marchal R (2010)

Production of dicarboxylic acids by improved mutant

strains of Yarrowia lipolytica. USA Patent Nr. US 2010/

0041115 A1. Available from http://www.patentlens.net

Nthangeni MB, Urban P, Pompon D, Smit MS & Nicaud

J-M (2004) The use of Yarrowia lipolytica for the

expression of human cytochrome P450 CYP1A1. Yeast 21:

583–92.R€osel H & Kunze G (1998) Integrative transformation of the

dimorphic yeast Arxula adeninivorans LS3 based on

hygromycin B resistance. Curr Genet 33: 157–63.Sambrook J & Russel D (2001) Molecular Cloning: A

Laboratory Manual. Cold Spring Harbor Laboratory Press,

New York.

Schroer K, Kittelmann M & L€utz S (2010) Recombinant

human cytochrome P450 monooxygenases for drug

metabolite synthesis. Biotechnol Bioeng 106: 699–706.Smit MS, Albertyn J, Van Rooyen N, Labuschagn�e M &

Maseme MJ (2012a) Expression construct for the

co-expression of vanillyl alcohol oxidase encoding genes.

South African patent Nr. 2011/06445. Available from

South African Companies and Intellectual Property

Commission at http://patentsearch.cipc.co.za/patents/

patentsearch.aspx.

Smit MS, Theron CW, Albertyn J & Labuschagn�e M (2012b)

Novel expression construct. South African patent Nr. 2011/

04652. Available from South African Companies and

Intellectual Property Commission at http://patentsearch.cipc.

co.za/patents/patentsearch.aspx.

Steinborn G, Gellissen G & Kunze G (2005) Assessment of

Hansenula polymorpha and Arxula adeninivorans-derived

rDNA-targeting elements for the design of Arxula

adeninivorans expression vectors. FEMS Yeast Res 5: 1047–1054.



Steinborn G, B€oer E, Scholz A, Tag K, Kunze G & Gellissen G

(2006) Application of a wide-range yeast vector (CoMed)

system to recombinant protein production in dimorphic

Arxula adeninivorans, methylotrophic Hansenula polymorpha

and other yeasts. Microb Cell Fact 5: 33.

Terentiev Y, Pico AH, B€oer E, Wartmann T, Klabunde J,

Breuer U, Babel W, Suckow M, Gellissen G & Kunze G

(2004) A wide-range integrative yeast expression vector

system based on Arxula adeninivorans-derived elements. J

Ind Microbiol Biotechnol 31: 223–8.Theron CW (2012) Heterologous expression of different

cytochrome P450 monooxygenases in different

ascomycetous yeasts. PhD Thesis. University of the Free

State. Available from http://etd.uovs.ac.za/cgi-bin/

ETD-browse/view_etd?URN=etd-05172013-153148.

Urlacher VB & Girhard M (2012) Cytochrome P450

monooxygenases: an update on perspectives for synthetic

application. Trends Biotechnol 30: 26–36.Van Rooyen N (2012) Identification, cloning and heterologous

expression of fungal vanillyl-alcohol oxidases. PhD Thesis.

University of the Free State. Available from http://etd.uovs.

ac.za/ETD-db//theses/available/etd-08162012-112452/

unrestricted/VanRooyenN.pdf.

Z€ollner A, Buchheit D, Meyer M, Maurer H, Peters F & Bureik

M (2010) Production of human phase 1 and 2 metabolites

by whole-cell biotransformation with recombinant microbes.

Bioanalysis 2: 1277–1290.

Supporting Information

Additional Supporting Information may be found in the

online version of this article:

Fig. S1. Biotransformation of HBA by Escherichia coli

BL21 cells carrying pET28b_His-CYP505A1 (marked H)

and pET22a_CYP505A1 (marked F).

Fig. S2. Mass spectra of the methyl esters of the products

produced from HBA by a Arxula adeninivorans transfor-

mant-expressing CYP505A1.

Fig. S3. TLC analysis demonstrating the effect of addition

of 1,10-phenanthroline (1 mM) added 1 h before HBA

on HBA conversion by a transformant of Arxula adeni-

nivorans-expressing CYP505A1.

Fig. S4. TLC analysis demonstrating the similar activities

observed with different transformants (T1–T5) of (a)

Arxula adeninivorans carrying CYP505A1 and (b) Sac-

charomyces cerevisiae carrying His-CYP102A1.

Fig. S5. TLC analysis demonstrating CYP505A1 activity

in different cellular fractions of Arxula adeninivorans.

Fig. S6. Conversion of HBA by different transformants of

Arxula adeninivorans transformed with pKM173 carrying

one or two copies of His-CYP505A1.



Documents

A broad-range yeast expression system reveals Arxula adeninivorans expressing a fungal self-sufficient cytochrome P450 monooxygenase as an excellent whole-cell biocatalyst