exn

hu

n UnnanJiang

a r t i c l e i n f o

Due to the limited safety proles of chemical preservatives andefciency of natural antimicrobial agents, there is a need for themto be improved.

enic microorgan-ut specic recep-ance (Fjell, Hiss,electivity cations. Curapplied as

preservative against Gram-positive bacteria (Cleveland, MoNes, & Chikindas, 2001; Delves-Broughton, Blackburn, EvHugenholtz, 1996). Due to these potential advantages of AMPs, theycould be promising candidates for the development of new foodpreservatives.

In our previous study, we derived a cell-penetrating peptide(CPP) analogue, P7, by replacing Phe and Trp with the Arg in theparent peptide, ppTG20, based on the structureactivity relation-ship of AMP and CPP (Li, Shi, Su, & Le, 2012). It showed potent

Corresponding author at: The State Key Laboratory of Food Science andTechnology, Jiangnan University, Wuxi, Jiangsu Province, China. Tel./fax: +86 51085917789 (G. Le).

E-mail addresses: lirong.lily@gmail.com (L. Li), lgw@jiangnan.edu.cn (G. Le).1 Tel./fax: +86 0871 65920171 (L. Li)

Food Chemistry 166 (2015) 231239

Contents lists availab

Food Che

journal homepage: www.elsefood safety problems caused by harmful microorganisms thatinduce food contamination and deterioration. Microorganismsfrom polluted foods may cause a number of infections and thespread of diseases. Minimally processed and safe foods are in highdemand. Such demands call for better, more efcient antimicrobialsources of biological preservatives that inhibit food contamination.

have a broad spectrum of activity against pathogisms, are interactive with cell membranes withotors, thus they seldom induce antibiotic resistHancock, & Schneider, 2011). Their activities and sute to their important role in their practical applicNisin is the only antimicrobial peptide widelyhttp://dx.doi.org/10.1016/j.foodchem.2014.05.1130308-8146/ 2014 Elsevier Ltd. All rights reserved.ontrib-rently,a foodntville,ans, &1. Introduction

Food preservation plays an important role in the food industry.Food preservatives are used to secure food quality and extend theirshelf life. Microorganisms are one of the important factors thatinuence the safety of the food. Great concerns have arisen from

Antimicrobial peptides (AMPs) are defensivemolecules in higherorganisms that provide innate immunity against invading organ-isms (Splith & Neundorf, 2011). AMPs show potential antimicrobialactivities against Gram-positive and Gram-negative bacteria, fungi,protozoa, viruses and tumour cells, but do not bring about cytotoxiceffects in normal cells. Compared with traditional antibiotics, AMPsArticle history:Received 21 September 2013Received in revised form 9 April 2014Accepted 20 May 2014Available online 6 June 2014

Keywords:Escherichia coliAntimicrobial peptidePenetrate cell membraneDNA bindinga b s t r a c t

The antibacterial activities and mechanism of a new P7 were investigated in this study. P7 showed anti-microbial activities against ve harmful microorganisms which contaminate and spoil food (MIC = 432 lM). Flow cytometry and scanning electron microscopy analyses demonstrated that P7 inducedpore-formation on the cell surface and led to morphological changes but did not lyse cell. Confocal uo-rescence microscopic observations and ow cytometry analysis expressed that P7 could penetrate theEscherichia coli cell membrane and accumulate in the cytoplasm. Moreover, P7 possessed a strong DNAbinding afnity. Further cell cycle analysis and change in gene expression analysis suggested that P7induced a decreased expression in the genes involved in DNA replication. Up-regulated expression genesencoding DNA damage repair. This study suggests that P7 could be applied as a candidate for the devel-opment of new food preservatives as it exerts its antibacterial activities by penetrating cell membranesand targets intracellular DNA.

2014 Elsevier Ltd. All rights reserved.dHuman Nutrition Department, Egerton University, PO Box 536, Egerton, KenyaA cell-penetrating peptide analogue, P7,against Escherichia coli ATCC25922 via peand targeting intracellular DNA

Lirong Li a,b,c,1, Yonghui Shi a,c, Xiangrong Cheng a,c, SGuowei Le a,c,a Institute of Food Nutrition and Safety, School of Food Science and Technology, Jiangnab Institute of Food Safety, Kunming University of Science and Technology, Kunming, Yunc The State Key Laboratory of Food Science and Technology, Jiangnan University, Wuxi,erts antimicrobial activityetrating cell membrane

fang Xia a,c, Maureen Jepkorir Cheserek a,c,d,

iversity, Wuxi, Jiangsu Province, ChinaProvince, Chinasu Province, China

le at ScienceDirect

mistry

vier .com/locate / foodchem

2. Materials and methods

phase high-performance liquid chromatography (RP-HPLC) on aC18 column. Peptides were characterized by mass spectroscopy

inhibitory concentration (MIC) of the peptide was dened as thelowest peptide concentration that completely inhibited bacterial

2.4. Scanning electron microscopy

lysed by the confocal laser-scanning microscopy. The uorescentimages were obtained with a 488 nm bandpass lter for excitation

washed and resuspended in 1 ml buffer before analysis.

by electrophoresis using 0.8% agarose gel in 1 TAE buffer anddetected by the uorescence of EB. Gel retardation was visualized

istryThe Escherichia coli cell suspension (1 106 CFU/ml) was incu-bated with P7 (nal concentration 8 lM) at 37 C for 0.5 h. A con-trol was incubated in 10 mM sodium phosphate (pH 7.4). The cellswere collected by centrifugation (2000 rpm for 5 min), washedthree times with 10 mM sodium phosphate (pH7.4) and xed with2.5% glutaraldehyde in sodium phosphate buffer at 4 C overnight.growth.

2.3. Cell membrane integrity analysis

The experiment was performed according to Joshi et al. withsome modications (Joshi et al., 2010). The peptide was added tothe E. coli cells suspension (1 106 CFU/ml) to give a nal concen-tration of 8 lM, and the mixtures were incubated at 37 C for 0.5 h.Then the cells were xed with PI (nal concentration 10 lg/ml) for15 min at 4 C in the dark. A FACS Calibur ow cytometer (BectonDickinson, USA) was used for analysis. Data were analysed usingWinMDI 2.9 software.and amino acid analysis.

2.2. Antimicrobial activity

The antimicrobial activities of the peptides were determined bya microdilution assay (Yang, Shin, Hahm, & Kim, 2006). Bacterialcells were collected in the mid-logarithmic growth phase,washed three times with physiological saline and suspended at2 106 CFU/ml in fresh LuriaBertani (LB) culture medium.Aliquots of 100 ll of a set of twofold serial dilutions of peptides(concentrations range from 640.031 lM) in 1% peptonewas addedto 100 ll of bacteria together in 96-well plates. After incubation at37 C for 18 h, the inhibition of bacterial growth in each wellwas determined by measuring absorbance at 630 nmwith a micro-plate reader (Multiskan MK3, Thermo China). The minimal2.1. Materials

Propidium iodide (PI) and uorescein isothiocyanate (FITC)were purchased from Sigma (St. Louis, MO, USA). Gram-negative(E. coli ATCC25922, Shigella dysenteriae CMCC51302 and Salmonellatyphimurium CMCC50013) and Gram-positive (Listeria monocytoge-nes CMCC54002 and Staphylococcus aureus ATCC25923) wereobtained from the Centre for Disease Control and Prevention(Wuxi, China). Peptides were chemically synthesized on a solid-phase synthesizer and puried (>98% homogeneity) by reversed-bactericidal activities against pathogenic and spoilage microorgan-isms pertinent to food and possessed good selectivity. This studywas aimed to investigate the antimicrobial mechanism of P7against Escherichia coli. Insights into the mechanism employed byP7 will facilitate new approaches to discover and guide thedevelopment of efcient food preservatives.

232 L. Li et al. / Food ChemThereafter, the cells were dehydrated with a graded series of etha-nol and dried. Cells were coated with gold and observed under ascanning electron microscope (S-3000 N, Hitachi Japan).under UV illumination using a Gel imaging system (Bio-Rad, USA).

2.8. Cell cycle analysis

The cell cycle assays were carried out as described by Steen andBoye (1980), with some modications. The peptide (nal concen-tration 8 lM) was added to the E. coli cell (1 108 CFU/ml) suspen-sion and incubated at 37 C for 0.5 h. The cells were centrifuged(2000 rpm for 5 min) and washed three times with phosphate buf-fered saline and xed in 1.5 ml 70% ice cold ethanol for 3 h. Cellswere collected and washed three times again. The pellet was resus-pended in PI solution (containing Rnase) and incubated at 4 C for15 min in the dark. The cell cycle was tested using a FACS calibur2.7. Electrophoretic mobility shift assay

E. coli genomic DNA was extracted using the CTAB extractionmethod. The purity of the extracted genomic DNA was evaluatedby the optical density ratio at 260 nm and 280 nm (OD260/OD280 = 1.92). The concentration of genomic DNA was determinedby measuring the absorbance at 260 nm (One Drop Spectropho-tometer, China) at room temperature.

The assay was described by Imura et al. with some modica-tions (Imura, Nishida, & Matsuzaki, 2007). DNA (250 ng, in10 mM Tris, 1 mM EDTA buffer, pH 8.0) was mixed with increasingamounts of peptides in 12 ll at room temperature for 10 min. Afteradding 2 ll of loading buffer, the migration of DNA was assessedof FITC.

2.6. Cell-penetrating efciency analysis

The inux of the FITC-labelled peptides into the bacterial cellswas investigated using a FACS Calibur ow cytometer (Becton Dick-inson, USA). The cell penetrating efciency was analysed accordingto previously reportedmethods by Park et al. and Richard et al. withsome minor modications (Park, Yi, Matsuzaki, Kim, & Kim, 2000;Richard et al., 2003). 1 ml of the E. coli cell suspension(1 106 CFU/ml) was incubated with the FITC-labelled peptide (ata nal concentration of 8 lM) at 37 C for 0.5 h. The cells werecollected, washed three times with phosphate buffer saline andincubated with trypsin (1 mg/ml) for 15 min at 37 C to removeextracellular, surface-bound peptide. The cells were collected,2.5. Confocal laser-scanning microscopy

Localization of the peptide onto the E. coli cells was determinedwith the FITC-labelled peptide by employing a Zeiss LSM-710 con-focal microscope with 40X lens. The experiment was performedaccording to Park et al. with slight modications (Park, Kim, &Kim, 1998). The Escherichia coli cell suspension (1 106 CFU/ml)was incubated in the absence and presence of the FITC-labelledpeptide (nal concentration 8 lM) at 37 C for 0.5 h. After incuba-tion, the cells were centrifuged with 10 mM sodium phosphate(pH7.4). The cells were then immobilized on a glass slide and ana-

166 (2015) 231239ow cytometer (Becton Dickinson, San Jose, CA, USA) and the datawas analysed by ModFit LT 3.0 software (Verity Software House,ME, USA).

form (200 ll) was added to each tube, shaken for 15 s and thenincubated on ice for 5 min. Separation of the aqueous and organic

forward AGCAGTCCATTGATATTATTAAGG, reverse GATGAGTTACCA

AGCGTAA; 16s rRNA (16S ribosomal RNA) forward CGGACGGGTGAGTAATGTCTG, reverse AGGTCCCCCTCTTTGGTCTTG.

measured using confocal laser-scanning microscopy. The FITC-labelled ppTG20 (Fig. 2A) and FITC-labelled P7 (Fig. 2B) were foundto penetrate the cell membrane and accumulated in the cytoplasmof the E. coli cells after 30 min of incubation at 37 C. This was sim-ilar to what occurred in the positive control buforin II (521)(Fig. 2C), a truncated N-terminal region of buforin II with 5 to 21residues, which exhibits cell-penetrating properties and kills bac-teria by binding to DNA (Park et al., 2000). This result demon-strated that the cytoplasm was the major site of action in theE. coli by P7.

3.5. Cell-penetrating efciency

Table 2 and Supplementary Fig. S4 showed the results of the

istryThe PCR conditions consisted of activation at 95 C for 5 min,followed by 45 cycles of denaturation at 95 C for 20 s, annealingat 62 C for 30 s and extension of 72 C for 20 s. A melting curvestep of 95 C for 15 s, 60 C for 15 s and 95 C for 15 s was alsoincluded to verify the specicity of the PCR amplied productsusing the software provided with the 7900 real time PCR system(Applied Biosystems, Foster City, CA, USA). The relative expressionlevels of the interest genes were calculated as the ratio to thehousekeeping 16S rRNA gene.

3. Results

3.1. Antibacterial activities of peptides

Compared to ppTG20, P7 exhibited higher antibacterial activityagainst all the tested bacterial strains with MIC values between 4and 32 lM (Table 1). The antibacterial activity against the Gram-negative bacteria was better than the Gram-positive bacteria.GCCACAG; dnaB (replicative DNA helicase) forward CAACAAACAGCAGGCTGAACC, reverse CTACATCATCCCAGCGTTCGT; dnaG (DNAprimase) forward CGGTCGGGTGATTGGTTTTG, reverse CACAAGCAGACGATTGGGTTCA; ssb (single-stranded DNA-binding protein) for-ward CCAGCAGAGGCGTAAACAAGGT, reverse GATTCGGAAGTAGCCphase was done by centrifugation at 10,000 rpm for 10 min at4 C. The supernatant (400 ll) was transferred to a new tube andmixed with aliquots isopropanol. The RNA was collected by centri-fugation 10,000 rpm at 4 C for 10 min. The RNA pellets werewashed twice in 70% ethanol (in DEPC-treated water). The superna-tant was discarded, and then the RNA pellets were air-dried on icefor approximately 10 min and resuspended in 30 ll DEPC-treatedwater. The purity of the RNA was evaluated by the optical densityratio of 260 nm and 280 nm.

2.9.2. Synthesis of cDNAFirst-strand cDNAs were synthesized in a reverse transcription

system containing RNA (2 lg), dNTP (10 mM), random hexamerprimer (100 lM), reverse transcription buffer, Rnase inhibitor(50 U/ll) and M-MLV reverse transcriptase (200 U/ll).

2.9.3. RT-PCRQuantitative real-time PCRs were performed using the same

cDNA for both the gene of interest and 16S rRNA, using the Green-star qPCR Master Mix (Bioneer, Korea). Each reaction contained0.5 ll cDNA, 5 ll SYBR Green PCR Master Mix, 0.4 ll of forwardand reverse primers and 3.7 ll nuclease-freewaterwas used to pro-duce a nal volume of 10 ll. The sequences of the primers wereused as follows: dnaA (chromosomal replication initiator protein)2.9. Gene expression of the response of E. coli to peptides

2.9.1. RNA isolationE. coli cells were incubatedwith 8 lMpeptide at 37 C for 30 min

and then collected by centrifugation for 5 min at 5000 rpm. Cellswere lysed in the presence of 10 mg/ml lysozyme at 37 C for30 min. After incubation, 1 ml of Trizol reagent was added, thetubes shaken for 15 s and then incubated on ice for 5 min. Chloro-

L. Li et al. / Food ChemExcept for S. aureus, the antibacterial activity of P7 was better thanNisin, which was active against the Gram-positive bacteria but notagainst Gram-positive bacteria.3.2. Peptide induced membrane damage

The increase in the uorescent signal for the cells stainedwith PIreects the membrane damage. As showed in Table 2 and Supple-mentary Fig. S2A, in the absence of the peptide, 99.9% of theuntreated control E. coli cells showed no uorescence signal.Treatment with ppTG20 caused only a minimal increase in theuorescence signal (1.67% cells stained with PI, Table 2 andSupplementary Fig. S2B). Compared to the control group, therewas a signicant increase (9.60%, Table 2 and SupplementaryFig. S2C) (p < 0.05) in the uorescence when the cells were treatedwith P7. The results indicated that P7 damaged rather than removedthe E. coli cell membrane.

3.3. Effect of P7 on morphology of E. coli cells

The morphologic effect of P7 was investigated by SEM. TheE. coli cells were treated with 8 lM P7 for 0.5 h, 1 h and 2 h, respec-tively. The P7 cells exposed to the peptide for 0.5 h (Fig. 1B) had amore wrinkled surface than the smooth surface of the untreatedcells (Fig. 1A), and formed pores on the cell surface. Moreover,the cells treated with P7 for 1 h appeared in an irregular manner,became lamentous, elongated and formed more pores, depres-sions or scars on the cell surface (Fig. 1C). However, as the incuba-tion time increased it was accompanied by a correspondingdecrease in the viable bacterial population (SupplementaryFig. S1) and both the number and degree of damaged cellsincreased (Fig. 1D), but the structure of the E. coli cells remainedintact after treatment with P7 for 2 h. This demonstrated that P7induced pore-formation on the cell surface and led to a morpholog-ical change but did not lyse the cell.

3.4. Localization of peptide in E. coli cells

The cellular localization of the peptide in the E. coli cells was

Table 1The minimal inhibitory concentrations of peptides against different pathogenicmicroorganisms.

Microorganism MIC (lM)

ppTG20 P7 Nisin Buforin II (521)

Gram-negative bacteriaE. coli >64 8 >64 1S. dysenteriae >64 8 >64 2S. typhimurium 64 4 >64 0.5

Gram-positive bacteriaL. monocytogenes >64 16 32 1S. aureus >64 32 16 1

166 (2015) 231239 233cell-penetrating efciency analysis of E. coli cells incubated withFITC-labelled peptides. When E. coli cells were treated with theFITC-labelled P7 for 0.5 h, the uorescence intensity of the treated

of E

amage (%) Cell-penetrating efciency (%)

ppTG20 1.67 0.82*

pen

istryP7 9.60 2.97Buforin II (521) NT

Each value of cell-penetrating efciency is expressed as the mean SD of three indeNT, Not test.* Signicant difference with control group (P < 0.05).Table 2Peptide induced membranes damage of E. coli cells and the cell-penetrating efciency

Experimental conditions Membrane d

Control 0.06 0.03

234 L. Li et al. / Food Chemcells increased to 87.9%, approaching the increase of uorescenceintensity of buforin II (521) (94.2%) but was much higher thanparent peptide (9.17%). There was no signicant differencebetween the P7-treated groups and the control groups (P > 0.05).

3.6. DNA binding by electrophoretic mobility shift assay

To evaluate the DNA binding activity of the peptide, a electro-phoretic mobility shift assay was performed. The results showedthat P7 could interact with E. coli genomic DNA, the same as the par-ent peptide. The distance migrated by the peptide-incubated DNAwas different from that migrated by the DNA itself. For ppTG20,

Fig. 1. E. coli cells treated with phosphate buffered saline (A), 8 mM P7 for 0.

# Signicant difference with buforin II (521) group (P < 0.05).0.34 0.10#

9.17 0.36*,#

87.9 2.57*

94.2 3.02*

dent experiments.. coli cells treated with FITC-labelled peptides.

166 (2015) 231239the electrophoretic mobility of the DNA was completely inhibitedby the peptide: DNAweight ratio of 30:1 (Fig. 3A). whereas, P7 com-pletely inhibited the migration of DNA at a weight ratio of 6(Fig. 3B). BuforinII (521) completely suppressed the migration ofE. coli genomic DNA above a weight ratio of 15 (Fig. 3C). The resultssuggested that P7 possessed a stronger DNA binding afnity.

3.7. Effect on cell cycle

The cell cycle of bacteria consists of three stages. Phase I, the timefromcell division to the initiationof chromosome replication, equiv-alent to phase G1 in the eukaryocyte. While phase R was similar to

5 h (B), 1 h (C) and 2 h (D) visualized by scanning electron microscopy.

age

istryppTG20 Fluorescence image P7 Fluorescence im

L. Li et al. / Food Chemphase S,which is thephase to replicate the chromosome.OncephaseR was completed, the prokaryote entered phase D directly withoutentering phase G2, the time from termination of replication to celldivision (Pan, Na, Xing, Fang, & Wang, 2007; Steen & Boye, 1980).The cell cycle of normalE. coli cell is shown in Fig. 4A. After treatmentwith ppTG20, the percentage of E. coli cells in phase S increased,while those in phase G1 decreased (Fig. 4B). P7 exhibited a strongereffect on the cell cycle compared to ppTG20 (Fig. 4C) but the effectwas similar to what was observed in the positive control buforin II

ppTG20 DIC image

ppTG20 Merge image

P7 DIC image

P7 Merge image

A BFig. 2. Confocal uorescence microscopic images of E. coli cells. E. coli cells were treated30 min. FITC-labelled peptides penetrated the cell membrane and accumulated in the cycontrast (DIC) and merge images of each cell type are shown.

166 (2015) 231239 235(521) (Fig. 4D). These results indicated that P7 caused most cellsto remain in phase S, affecting the DNA replication of bacteria intra-cellularly rather than targeting the membrane.

3.8. Change in gene expression in E. coli cells

The quantitative reverse transcriptionpolymerase chain reac-tion was carried out to analyse whether the expression of theDNA replication and DNA damage repairing related genes were

Cwith 8 lM of FITC-labelled ppTG20 (A), P7 (B) and Buforin II (521) (C) at 37 C fortoplasm. For each of the peptide treatments, uorescence, differential interference

istry236 L. Li et al. / Food Chemaffected after treatment with the peptide. In Fig. 4E, there was asignicant decrease in the expression of dnaG mRNA (P < 0.05).No signicant difference in the expression of the other ve inter-ested genes was observed between the ppTG20 treated and thecontrol groups (P > 0.05). In contrast, a total of six interest geneswere found to be responsive to P7. P7 included signicantlydecreased expression of genes encoding DNA replication comparedwith the control group (P < 0.05). These genes included dnaA, dnaB,dnaG and ssb. Exposure to P7 resulted in the up-regulation of recAand recN genes, which are involved in the SOS response to DNAdamage repair. Similar, but more pronounced, expression prolesof recA and recN genes were seen in buforin II (521) treatedgroups. The results demonstrated that P7 binded to DNA and it

Fig. 3. Gel retardation analysis of the binding of peptide to E. coli genomic DNA. Varioutemperature for 10 min and the reaction mixtures were applied to a 0.8% agarose gel el166 (2015) 231239induced damage in the DNA state, which may signicantlydown-regulate the expression of genes related to DNA replication.

4. Discussion

Natural preservatives are always being developed to satisfyconsumer demand with regard to nutritional, preservative-freeand minimally processed aspects of foods (Tiwari et al., 2009).Unfortunately, they show a narrow range of antibacterial spectrumand low antimicrobial activities. Meanwhile, multi-resistant path-ogenic bacteria are emerging and pathophoresis caused by food-borne pathogens have created an urgent need for the development

s amounts of peptides were incubated with 250 ng of E. coli genomic DNA at roomectrophoresis. The weight ratio (peptide: DNA) was indicated above each lane.

istryL. Li et al. / Food Chemof new kinds of preservatives (Rydlo, Miltz, & Mor, 2006). Safe andefcient preservatives can be used alone or in combination withother natural preservatives to replace traditional chemical preser-vatives. Antimicrobial peptides are small peptides with a widerange of antimicrobial activity (including bacteria, yeasts, andfungi), effective and safe therapeutics without antibiotic resistance(Brandenburg, Merres, Albrecht, Varoga, & Pufe, 2012). Their enzy-matic hydrolysis products are also safe for changing into smallpeptides. There they show prospective applications in the foodindustry. The antimicrobial peptides Nisin, which was initiallyevaluated as a clinical antibiotic, has been used as a food preserva-tive in dairy products and canned goods (Delves-Broughton et al.,

Fig. 4. Effect of peptide on cell cycle and verication of the expression changes of dnaA,cycle of normal E. coli cells, (B) cells treated with ppTG20 for 0.5 h, (C) cells treated wexpression level of samples were calibrated by the comparative threshold cycle methonormalized to 16s rRNA mRNA expression, where the values for the control group weregroup. Statistical different versus control as determined by ANOVA post hoc Tukeys tes166 (2015) 231239 2371996). In a previous study, we derived a cell-penetrating peptideanalogue, P7, and found it possessed higher antimicrobial activitiesthan the parent peptide and displayed low haemolysis. In thisstudy, we demonstrated that P7 possessed antimicrobial activitiesagainst ve spoilage and pathogenic microorganisms pertinent tofood. P7, the new peptide with efcient and safe features, couldbe a good possible candidate for food preservation.ppTG20contains 65% hydrophobic amino acids and shows classic amphi-pathic characteristics. Hydrophobicity is an essential feature forantibacterial peptidemembrane interactions. If it is too hydropho-bic, the peptide may become stuck in the membrane rather thaninternalize, thus preventing its transport to the intercellular target

dnaB, dnaG, ssb ,recA and recN of E. coli. cells analysis by ow cytometry. (A) The cellith P7 for 0.5 h, cells treated with buforin II (521) for 0.5 h (D), (E) The relatived, using 16s rRNA as an endogenous control. Data are expressed as fold changes,set at 1.0. Results are showed as means SD. P < 0.05 compared with the control

t.

showed). Thus, we conrmed that DNA was the major intracellulartarget of P7 after entering the cells. The improved antimicrobial

istry(Dathe & Wieprecht, 1999). A high percentage of net chargecontent plays an essential role in the antibacterial activity of AMPs(Fjell et al., 2011). In CPPs, a high percentage of hydrophobic resi-dues does not cause more membrane perturbation (Hugonina,Vukojevc, Bakalkinb, & Grslund, 2006), but the positive chargeand a-helicity are thought to be pivotal factors that mediate CPPsbinding to negatively charged glycosaminoglycans on the plasmamembrane (Rittner et al., 2005). The weak antibacterial activityof ppTG20 is due to its high ratio of hydrophobic residues and itslow positive charge. Therefore, P7 was derived by replacingPhe(3) and Trp(14) with Arg to reduce the hydrophobicity(containing 55% hydrophobic amino acids) but an increase in theoverall positive charge in order to enhance the peptide-membraneinteraction. Decreased hydrophobicity and increase net charge ofppTG20 did improve its antimicrobial afnity.

Most of the antimicrobial peptides target the cell membranes ofpathogenic microorganisms, lyse the cell membranes and lead todeath. It was not clear whether the antimicrobial mechanism ofP7 that derived from cell-penetrating peptide was same or differ-ent. Did P7 act like membrane-active antimicrobial peptide or asa intracellular-active cell penetrating peptide or other mechanism?Membrane damage measured in intact bacterial cells was monitor-ing the increase of PI uorescence after the addition of the peptide.At a concentration of 8 lM, P7 induced a minor damage effect(9.60% damage) on the E. coli cell membranes. But bactericidalkinetics analysis showed that exposure of E. coli to P7 for 0.5 hdid result in an immediate decrease in the number of bacterial cells(Supplementary Fig. S1). These results further conrmed that P7kills E. coli in some other way rather than by a membrane damagemechanism. The observation of morphological changes providedmore of an insight into the membrane effects by P7. Scanning elec-tron microscopy revealed that the untreated E. coli cells exhibitedsmooth surface morphology (Fig. 1A). Treatment with P7 for30 min resulted in wrinkled, elongated and pore formation onthe cell surface (Fig. 1B). Although P7 induced damage to the cellmembranes and surface morphology change of E. coli cells withthe time increased, it didnt lyse the bacterial cell membrane(Fig. 1C and Fig. 1D). CD spectroscopy has been used to assessthe structural properties of ppTG20 and P7 (SupplementaryFig. S3A). Their structure is random in PBS, but they both displayedmuch higher a-helicities in TFE/PBS. The a-helical content ofppTG20 and P7 was 79.8% and 81.2%, respectively (SupplementaryFig. S3B). The conformational transition of each peptide was neces-sary for the peptide attached to and insertion into the bacterialmembrane, that maybe support their varying abilities to translo-cate through bacterial membranes. Thus it was conceivable thatthe previously described ndings were the results for P7 enteringthe cytoplasm to exert its antibacterial activity by targeting othertargets. We further conrmed that the killing mechanism of P7 isin another way other than membrane-lysing mode. For determina-tion of the site of action of P7, FITC-labelled P7 was incubated withE. coli cells. The confocal laser-scanning microscopy images (Fig. 2Band Fig. 2C) revealed that P7 penetrated the cell membrane andaccumulated inside the cytoplasm of E. coli cells, which is similarto buforin II (521) that kills bacterium by penetrating the cellmembranes and inhibiting cellular function. Table 2 showed theresults of the cell-penetrating efciency of P7 and buforin II(521). The uorescence intensity of the E. coli cells treated withP7 increased to 87.9%. The positive control buforin II (521)penetrated more efciently (94.2%). That is, P7 possessed a highcell-penetrating efciency. Results of confocal laser-scanningmicroscopy images and FACS analysis indicated that P7 couldpenetrate E. coli cells membranes without lysing them and the

238 L. Li et al. / Food Chemeventual molecular target of P7 was intracellular.The initial interaction between P7 and the E. coli cells mem-

brane would allow it to penetrate into the cell to bind to the intra-activity of P7 was concerned with its cell-penetrating efciencyand DNA-binding afnity. Penetrating the cells more efcientlyand possessing good DNA-binding afnity contributed to thestrong antimicrobial activity of buforin II (521) (Table 1,MIC = 0.52 lM). The DNA stores and transmits the genetic infor-mation of life. Peptide interaction with DNA can hamper or inhibitmacromolecular synthesis, related gene expression, or disruptsmaterials needed for the life cycle of bacteria. It has been reportedthat certain antimicrobial peptides bind DNA or inhibit intracellu-lar processes after penetration into bacterial cells, such as buforin II(Park et al., 1998), tachyplesin (Yonezawa, Kuwahara, Fujii, &Sugiura, 1992), PR-39 (Boman, Agerberth, & Boman, 1993) and ind-olicidin (Subbalakshmi & Sitaram, 1998). After 30 min of P7 treat-ment, the E. coli cells remained in phase R where DNA replicationoccurs, without completing the cell cycle (Fig. 4C). P7 bound withDNA results in the inhibition of DNA replication, which disturbsthe normal cell cycle. This also demonstrated that P7 induced la-mentation in E. coli cells (Fig. 1B) as a result of inhibition of DNAsynthesis (Lutkenhaus, 1990; Subbalakshmi & Sitaram, 1998) or abacterial SOS-response (Ulvatne, Samuelsen, Haukland, Krmer, &Vorland, 2004). Furthermore, a quantitative reverse transcrip-tionpolymerase chain reaction was carried out to analyse thechanges in expression of DNA replication and DNA damagerepair-related genes (Fig. 4E). The expression of four down-regu-lated genes reected a response to perturbation of the E. coliDNA replication by P7. The gene expression results could be consis-tent with the cell cycle analysis that P7 affected DNA replicationduring cell cycle. Such genes may represent potential active targetsfor the antimicrobial activity of P7 against E. coli. Treatment withP7 induced the increased expression of recA and recN genes whichplay an important role in the SOS response to survival when DNAdamage occurs. Altered expression of these genes reected aprotective response to DNA damage by P7. We propose that P7interacted with E. coli genomic DNA and intercalated into theDNA base pairs to cause DNA damage, disturbing DNA replicationand resulting in bacterial death. BuforinII (521) kills E. coli bybinding to DNA and interfering intercellular functions, but thechange in expression proles of DNA replication and DNA damagerepair genes in E. coli cells was some different from P7. This mayinvolve in their different DNA-binding sites and DNA-bindingcapabilities.

5. Conclusion

More studies of the molecular mechanisms are needed. How-ever, our results clearly demonstrated that P7, derived from thecell-penetrating peptide ppTG20, has strong antibacterial activitiesagainst food-borne pathogenic microorganisms. This peptidemight be an attractive and valuable candidate as an effective foodbiological preservative. Moreover, antimicrobial mechanism analy-sis revealed that unlike most membrane-active peptides, P7 had acellular targets. The electrophoretic mobility shift assay showedthat P7 could interact with E. coli genomic DNA and completelyinhibited the migration of E. coli genomic DNA above a weight ratioof 6 (Fig. 3B). The DNA-binding afnity was 5 and 2.5 times stron-ger than that of parents peptide and buforin II (521), respectively(Fig. 3A and Fig. 3C). During the DNA-binding process P7 interca-lated into the E. coli genomic DNA base pairs, which was furthersupported by the competition with EB (ethidium bromide) in bind-ing to the E. coli genomic DNA uorescence experiments (data not

166 (2015) 231239minor damaging effect on the cytoplasmic membrane of E. coli.However P7 could penetrate the E. coli cell membranes and accu-mulate in the cytoplasm but did not lyse the cells. After uptake into

the cytoplasm, P7 interacted with intracellular DNA and affectedDNA replication, and eventually leading to cell death. All theseresults indicated that P7 exerted its antimicrobial activity againstE. coli by penetrating the cell membrane and targeting intracellularDNA.

Acknowledgments

This research was funded by National Natural Science Founda-tion of China (Grant No. 31172214 and 31201805) and Fundamen-tal Research Funds for the Central Universities (JUSRP1052).

Appendix A. Supplementary data

Supplementary data associated with this article can be found, inthe online version, at http://dx.doi.org/10.1016/j.foodchem.2014.05.113.

References

Boman, H. G., Agerberth, B., & Boman, A. (1993). Mechanisms of action onEscherichia coli of cecropin P1 and PR-39, two antibacterial peptides from pigintestine. Infection and Immunity, 61, 29782984.

Brandenburg, L. O., Merres, J., Albrecht, L. J., Varoga, D., & Pufe, T. (2012).Antimicrobial peptides: Multifunctional drugs for different applications.Polymers, 4, 539560.

Cleveland, J., Montville, T. J., Nes, I. F., & Chikindas, M. L. (2001). Bacteriocins: Safe,natural antimicrobials for food preservation. International Journal of Food

Joshi, S., Bisht, G. S., Rawat, D. S., Kumar, A., Kumar, R., Maiti, S., et al. (2010).Interaction studies of novel cell selective antimicrobial peptides with modelmembranes and E. coli ATCC 11775. Biochimica et Biophysica Acta (BBA) Biomembranes, 1798, 18641875.

Li, L. R., Shi, Y. H., Su, G. F., & Le, G. W. (2012). Selectivity for and destruction ofSalmonella typhimurium via a membrane damage mechanism of a cell-penetrating peptide ppTG20 analogue. International Journal of AntimicrobialAgents, 40, 337343.

Lutkenhaus, J. (1990). Regulation of cell division in E. coli. Trends in Genetics, 6,2225.

Pan, L. Z., Na, J., Xing, Z., Fang, H. J., & Wang, G. L. (2007). Inhibiting effect of melittinon pathogens of crops. Chinese Science Bulletin, 52, 639644.

Park, C. B., Kim, H. S., & Kim, S. C. (1998). Mechanism of action of the antimicrobialpeptide buforin II: Buforin II kills microorganisms by penetrating the cellmembrane and inhibiting cellular functions. Biochemical and BiophysicalResearch Communications, 244, 253257.

Park, C. B., Yi, K. S., Matsuzaki, K., Kim, M. S., & Kim, S. C. (2000). Structureactivityanalysis of buforin II, a histone H2A-derived antimicrobial peptide: The prolinehinge is responsible for the cell-penetrating ability of buforin II. Proceedings ofthe National Academy of Sciences, 97, 82458250.

Richard, J. P., Melikov, K., Vives, E., Ramos, C., Verbeure, B., Gait, M. J., et al. (2003).Cell-penetrating peptides a reevaluation of the mechanism of cellular uptake.Journal of Biological Chemistry, 278, 585590.

Rittner, K., Benavente, A., Bompard-Sorlet, A., Heitz, F., Divita, G., Brasseur, R., et al.(2005). New basic membrane-destabilizing peptides for plasmid-based genedelivery in vitro and in vivo. Molecular Therapy, 5(2), 104114.

Rydlo, T., Miltz, J., & Mor, A. (2006). Eukaryotic antimicrobial peptides: Promisesand premises in food safety. Journal of Food Science, 71, R125R135.

Splith, K., & Neundorf, I. (2011). Antimicrobial peptides with cell-penetratingpeptide properties and vice versa. European Biophysics Journal, 40, 387397.

Steen, H. B., & Boye, E. (1980). Bacterial growth studied by ow cytometry.Cytometry, 1, 3236.

Subbalakshmi, C., & Sitaram, N. (1998). Mechanism of antimicrobial action ofindolicidin. FEMS Microbiology Letters, 160, 9196.

L. Li et al. / Food Chemistry 166 (2015) 231239 239Microbiology, 71, 120.Dathe, M., & Wieprecht, T. (1999). Structural features of helical antimicrobial

peptides: Their potential to modulate activity on model membranes andbiological cells. Biochim Biophys Acta, 1462, 7187.

Delves-Broughton, J., Blackburn, P., Evans, R., & Hugenholtz, J. (1996). Applicationsof the bacteriocin, nisin. Antonie van Leeuwenhoek, 69, 193202.

Fjell, C. D., Hiss, J. A., Hancock, R. E. W., & Schneider, G. (2011). Designingantimicrobial peptides: Form follows function. Nature Reviews Drug Discovery,11, 3751.

Hugonina, L., Vukojevc, V., Bakalkinb, G., & Grslund, A. (2006). Membrane leakageinduced by dynorphins. FEBS Letters, 580, 32013205.

Imura, Y., Nishida, M., & Matsuzaki, K. (2007). Action mechanism of PEGylatedmagainin 2 analogue peptide. Biochimica et Biophysica Acta (BBA) Biomembranes, 1768, 25782585.Tiwari, B. K., Valdramidis, V. P., ODonnell, C. P., Muthukumarappan, K., Bourke, P., &Cullen, P. (2009). Application of natural antimicrobials for food preservation.Journal of Agricultural and Food Chemistry, 57, 59876000.

Ulvatne, H., Samuelsen, ., Haukland, H. H., Krmer, M., & Vorland, L. H. (2004).Lactoferricin B inhibits bacterial macromolecular synthesis in Escherichia coliand Bacillus subtilis. FEMS Microbiology Letters, 237, 377384.

Yang, S. T., Shin, S. Y., Hahm, K. S., & Kim, J. I. (2006). Design of perfectly symmetricTrp-rich peptides with potent and broad-spectrum antimicrobial activities.International Journal of Antimicrobial Agents, 27, 325330.

Yonezawa, A., Kuwahara, J., Fujii, N., & Sugiura, Y. (1992). Binding of tachyplesin I toDNA revealed by footprinting analysis: Signicant contribution of secondarystructure to DNA binding and implication for biological action. Biochemistry, 31,29983004.

A cell-penetrating peptide analogue, P7, exerts antimicrobial activity against Escherichia coli ATCC25922 via penetrating cell membrane and targeting intracellular DNA1 Introduction2 Materials and methods2.1 Materials2.2 Antimicrobial activity2.3 Cell membrane integrity analysis2.4 Scanning electron microscopy2.5 Confocal laser-scanning microscopy2.6 Cell-penetrating efficiency analysis2.7 Electrophoretic mobility shift assay2.8 Cell cycle analysis2.9 Gene expression of the response of E. coli to peptides2.9.1 RNA isolation2.9.2 Synthesis of cDNA2.9.3 RT-PCR

3 Results3.1 Antibacterial activities of peptides3.2 Peptide induced membrane damage3.3 Effect of P7 on morphology of E. coli cells3.4 Localization of peptide in E. coli cells3.5 Cell-penetrating efficiency3.6 DNA binding by electrophoretic mobility shift assay3.7 Effect on cell cycle3.8 Change in gene expression in E. coli cells

4 Discussion5 ConclusionAcknowledgmentsAppendix A Supplementary dataReferences