A MECHANISTIC CONNECTION BETWEEN FATTY ACID SYNTHASE AND

ENDOPLASMIC RETICULUM HOMEOSTASIS

BY

JOY L. LITTLE

A Dissertation Submitted to the Graduate Faculty of

WAKE FOREST UNIVERSITY GRADUATE SCHOOL OF ARTS AND SCIENCES

in Partial Fulfillment of the Requirements

for the Degree of

DOCTOR OF PHILOSOPHY

Cancer Biology

August 2008

Winston-Salem, North Carolina

Approved By:

Steven J. Kridel, Ph.D., Advisor

Examining Committee:

Michael E. Robbins, Ph.D., Chairman

Susan M. Hutson, Ph.D.

Scott D. Cramer, Ph.D.

Darren Seals, Ph.D.

ii

ACKNOWLEDGEMENTS

Almost a full five years have passed towards the culmination of this dissertation. I

have many people to thank and acknowledge in this endeavor, without whom, completion

of this milestone would have not been possible. First and foremost, I would like to thank

my advisor, Dr. Steve Kridel. Steve, you have provided me with everything possible to

make my graduate school career a success, including a strong project, critical input, high

expectations, opportunity, and encouragement. The lessons I’ve learned under your

advisement will continue to help me succeed and for that I sincerely thank you. Maybe

one day, after all, I’ll make you famous.

I would like to thank my committee, Dr. Mike Robbins, Dr. Susan Hutson, Dr.

Scott Cramer, and Dr. Isabelle Berquin for their valuable input, advice, and direction. I

would also like to thank Darren Seals for stepping in. In addition, the Cancer Biology

department at WFUSM deserves my acknowledgment for accepting me into their PhD

program and training me to think critically about cancer and its underlying causes and

issues. Without the laboratory experience provided for me by employment by and the

encouragement of Dr. Mark Miller, I do not know that I would have made the same

valuable decision to come to Wake Forest for graduate school. For that, Dr. Miller, I

sincerely thank you.

I thank Dr. Scott Cramer for his infamous class that teaches critical thinking, but

more so for the opportunity to later help facilitate his class. The skills I have acquired

through such experience have and will continue to benefit me at every future step.

iii

I would also like to acknowledge Frances Wheeler, the Kridel lab manager.

Without you, Frances, I cannot even begin to imagine how much horribly different my

lab experience would have been. Thank you for your work, assistance, advice, and, most

of all, patience.

I am so fortunate to have had classmates like Dr. Racquel Collins-Underwood and

Dr. Alix Norris. Thank you girls for being wonderful allies in our fight towards our

respective degrees. You both are incredible women and scientists.

Lori Hart and Diane Fels were the senior students I most admired. You girls are

amazing friends as well as role models for me in terms of not only intelligence and work

ethic, but personality and spirit, as well, so I thank you.

To the more recent Kridel Lab inductees, Sarah Ryan and Kristen Norman. I

could not have chosen a better pair of scientists to have joined the lab. You girls have

such amazing potential and I expect big things out of you! Thank you for being such

great friends, as well.

To my parents, without your support, I would have never made it past my first

semester. Thank you, Mom and Dad for always believing in me. Dad, you have always

encouraged me to “do my best”. I am never quite satisfied and because of that, I have

been so much more successful than I ever thought possible. Mom, you have always

iv

encouraged me to stand up for myself and hold my own. You make me laugh and

brighten my day when I need it most. You’ve also been pretty good at letting me

complain! Mom and Dad, you two are the most amazing and important people in my life.

I also would like to acknowledge my brother Keith who is an inspiration through

his own victory over cancer over a decade ago. Keith, I also thank you for your support

and encouragement not to be “old and busted”. To my brother Scott, his wife Johanna,

and daughter Madeleine, I thank you all for your unending encouragement, support and

entertainment.

To my best friend, Julie: You will always tell me exactly what I need to know and

regardless of what I want to hear. Your support and friendship cannot be put into words

that will adequately explain what you mean to me. Last but no where near least, Amanda

Havnen, Emily Sandone, Abigail Eaton, Patrick Dillon, and Sophia Maund, I thank you

all for being wonderful friends and giving me unwavering support, unending

encouragement, and overall perspective. I am a better person for having each of you in

my life.

v

TABLE OF CONTENTS

Acknowledgments ii

List of Figures viii

List of Abbreviations x

Abstract xiv

CHAPTER I

GENERAL INTRODUCTION

(Sections from Book Chapter in press in Subcellular Biochemistry: Lipids in Health and

Disease, Volume 49, 2008)

I.1. Abstract 2

I.2. FATTY ACID SYNTHESIS 3

The FASN Enzyme 3

Other Players in the Fatty Acid Synthesis Pathway 5

I.3. FASN EXPRESSION 6

FASN Expression in Normal Cells 6

FASN Expression in Tumor Cells 10

I.4. FASN REGULATION 12

FASN Regulation in Normal Cells 12

FASN Regulation in Tumor Cells 13

Palmitate utilization in normal and tumor cells 17

I.5. ENDOPLASMIC RETICULUM 18

The Endoplasmic Reticulum 18

Lipids and the Endoplasmic Reticulum 19

Endoplasmic Reticulum Stress 20

vi

Unfolded Protein Response 20

PKR-like Endoplasmic Reticulum-Resident Kinase Signaling 21

Inositol-Requiring Enzyme 1 Signaling 23

I.6. Overview 25

References 26

CHAPER II

INHIBITION OF FATTY ACID SYNTHASE INDUCES ENDOPLASMIC

RETICULUM STRESS IN TUMOR CELLS

(Published in Cancer Research, volume 67, number 3, pages 1262-1269, 2007)

II.1. Abstract 37

II.2. Introduction 38

II.3. Materials and Methods 40

II.4. Results 45

II.5. Discussion 57

References 61

CHAPER III

DISRUPTION OF CROSSTALK BETWEEN THE FATTY ACID SYNTHESIS AND

PROTEASOME PATHWAYS ENHANCES UPR SIGNALING AND TUMOR CELL

DEATH

(Submitted to Molecular Cancer Therapeutics, 2008)

III.1. Abstract 65

III.2. Introduction 66

III.3. Materials and Methods 69

III.4. Results 74

III.5. Discussion 84

vii

References 89

CHAPER IV

INHIBITION OF FATTY ACID SYNTHASE INDUCES CASPASE INDEPENDENT

CELL DEATH THROUGH INDUCTION OF REACTIVE OXYGEN SPECIES

IV.1. Abstract 94

IV.2. Introduction 95

IV.3. Materials and Methods 98

IV.4. Results 102

IV.5. Discussion 111

References 115

CHAPER V

GENERAL DISCUSSION

(Sections from Book Chapter in press in Subcellular Biochemistry: Lipids in Health and

Disease, volume 49, 2008)

V.1. Inhibiting FASN Activity 119

Small Molecule Inhibitors of FASN 119

Effects In vivo 119

Cell Cycle Effects In vitro 120

Cell Signaling Effects 121

In vitro Tumor Cell Death 123

V.2. Concluding Remarks 128

References 131

Scholastic Vita 135

viii

LIST OF FIGURES

CHAPTER I

Figure 1 The FASN Enzyme 5

Figure 2 Regulation of FASN Expression in Normal and Tumor Cells. 17

Figure 3 The Unfolded Protein Response 22

CHAPTER II

Figure 1 Fatty acid synthase inhibitors induce phosphorylation of eIF2! in 46

tumor cells

Figure 2 PERK phosphorylates eIF2! is response to, and protects cells 49

against, orlistat treatment.

Figure 3 FAS inhibitor treatment activates processing of XBP-1 51

Figure 4 Inhibition of FAS activity induces mRNA expression of 52

ER stress regulated genes

Figure 5 Phosphorylation of eIF2! is an early event in cells 53

treated with FAS inhibitors

Figure 6 Pharmacological FAS inhibitors cooperate with thapsigargin 56

CHAPTER III

Figure 1 FAS inhibitors combine with bortezomib to increase cell death 74

Figure 2 Fatty acid synthesis and proteasome pathways exhibit crosstalk 76

Figure 3 Bortezomib and FAS inhibitors combine to saturate the PERK 79

arm of UPR adaptation signaling

Figure 4 Combining bortezomib with FAS inhibitors enhances IRE-1- 80

mediated XBP-1 mRNA processing.

Figure 5 Combining bortezomib and FAS inhibitors induces JNK 81

activation and CHOP expression.

Figure 6 UPR-associated cell death is mediated by JNK activation 83

ix

and CHOP

CHAPTER IV

Figure 1 Cell death induced by FAS inhibitors is independent of caspase 103

activity

Figure 2 Bcl-2 does not protect PC-3 cells from FAS inhibitor-induced 104

cell death

Figure 3 Bcl-2 inhibits eIF2! phosphorylation, but not XBP-1 processing 106

in cells treated with orlistat

Figure 4 Reduction in clonogenic survival induced by FASN inhibition is 107

not dependent on eIF2! phosphorylation

Figure 5 GADD34 overexpression does not rescue clonogenic survival 109

reduced by FASN inhibition

Figure 6 FASN inhibitors induce reactive oxygen species 110

CHAPTER V

Figure 1 Inhibiting FASN in Tumor Cells 128

x

LIST OF ABBREVIATIONS

FASN fatty acid synthase

ACC acetyl-CoA-carboxylase

ACL ATP-citrate lyase

NADPH nicotinamide adenine dinucleotide phosphate

MAT malonyl acetyl transferases

KS ketoacyl synthase

KR "-ketoacyl reductase

DH "-hydroxyacyl dehydratase

ER enoyl reductase

TE thioesterase

ACP acyl carrier protein

VLCFA very long chain fatty acids

ELOVL1-6 elongase of very long chain fatty acids 1-6

SCD1 stearoyl-CoA desaturase-1

AMPK AMP-activated kinase

ME malic enzyme

FASKOL liver-specific deletion of FAS

PPAR! Peroxisome Proliferator-Activating Receptor alpha

HMG-CoA 3-hydroxy-3-methyl-glutaryl-CoA

SREBP sterol response element binding protein

S1P site-one protease

S2P site-two protease

xi

RIPCre Cre-recombinase under the control of rat insulin 2 promoter

CPT1 carnitine palmityl transferase 1

MCD malonyl-CoA desaturase

SCAP SREBP cleavage activating protein

NF-Y nuclear factor Y

SP1 stimulatory protein 1

RNAi RNA interference

PI3K phosphatidylinositol-3 kinase

KGF keratinocyte growth factor

EGF epidermal growth factor

JNK cJun N-terminal kinase

RTK receptor tyrosine kinase

AR androgen receptor

PR progesterone receptor

USP2a ubiquitin-specific protease 2a

EGCG epigallocatechin-3-gallate

TOFA 5-(tetradecyloxy)-2-furoic acid

FDA food and drug administration

CHOP C/EBP homologous protein

XBP-1 X-box binding protein 1

eIF2! ! subunit of eukaryotic initiation factor 2

UPR unfolded protein response

IRE1 inositol requiring enzyme 1

xii

GADD34 growth arrest and DNA damage transcript 34

PP1 protein phosphatase 1

ATF4 activating transcription factor 4

PERK PKR-like ER kinase

ER endoplasmic reticulum

DMEM Dulbecco’s modified eagle’s medium

FBS fetal bovine serum

siRNA small interfering ribonucleic acid

RPMI-1640 Roswell Park Memorial Institute 1640 medium

kDa kilo Daltons

PBS phosphate buffered saline

WB western blot

IF immunofluorescence

DTT dithiothretiol

SDS-PAGE sodium dodecyl sulfate polyacrylamide gel electrophoresis

SDS sodium dodecyl sulfate

PARP poly(adenosine diphosphate)-ribose polymerase

BSA bovine serum albumin

DCFH-DA dichlorofluorescin di-acetate

DCFH dichlorofluorescin

NAC N-acetyl cysteine

Nrf2 NF-E2 related factor 2

Bcl-2 B-cell lymphoma 2

xiii

ROS reactive oxygen species

zVAD-fmk benzyloxycarbonyl-Val-Ala-Asp (OMe) fluoromethyl ketone

BNIP3 Bcl-2/E1B 19kD interacting protein

TRAIL tumor necrosis factor-related apoptosis-inducing ligand

DAPK2 death-associated protein kinase 2

Bax Bcl-2 associated X protein

iPLA2 phospholipase A2

MTS 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-

sulfophenyl)-2H-tetrazolium

xiv

ABSTRACT

Fatty acid synthase (FASN) is the enzyme responsible for catalyzing the ultimate

steps of fatty acid synthesis in cells. FASN is expressed at high levels in tumor cells but

is mostly absent in corresponding normal cells. Because of the unique expression profile

of FASN, there is considerable interest not only in understanding its contribution to

tumor cell growth and proliferation, but also in developing inhibitors that target FASN

specifically as an anti-tumor modality. Work from our lab and the work contained in this

thesis provides evidence that: 1. pharmacological blockade of FASN activity induces

endoplasmic reticulum stress and subsequent activation of the unfolded protein response;

2. FASN inhibitors can be combined with the proteasome inhibitor bortezomib to

enhance UPR-mediated cell death; and 3. FASN inhibitor cell death cannot be protected

by inhibition of caspase cleavage, Bcl-2 overexpression, or phosphorylation of eIF2!, but

may be mediated through accumulation of reactive oxygen species. This work contributes

to the larger understanding of FASN in mediating aspects of proliferation, growth and

survival. As a result, a clearer understanding of the role of FASN in tumor cells has been

developed.

1

CHAPTER I

GENERAL INTRODUCTION

Joy L. Little and Steven J. Kridel

The following introduction contains sections to be published in a chapter of the book

Subcellular Biochemistry: Lipid in Health and Disease. Stylistic variations are due to the

requirements of the publisher. J. L. Little prepared the manuscript. Dr. S. J. Kridel acted

in an advisory and editorial capacity.

2

I.1 Abstract

While normal tissues are tightly regulated by nutrition and a carefully balanced

system of glycolysis and fatty acid synthesis, tumor cells are under significant

evolutionary pressure to bypass many of the checks and balances afforded normally.

Cancer cells have high energy expenditure from heightened proliferation and metabolism

and often show increased lipogenesis. Fatty acid synthase (FASN), the enzyme

responsible for catalyzing the ultimate steps of fatty acid synthesis in cells, is expressed

at high levels in tumor cells and is mostly absent in corresponding normal cells. Because

of the unique expression profile of FASN, there is considerable interest not only in

understanding its contribution to tumor cell growth and proliferation, but also in

developing inhibitors that target FASN specifically as an anti-tumor modality.

Pharmacological blockade of FASN activity has identified a pleiotropic role for FASN in

mediating aspects of proliferation, growth and survival. Work from the Kridel lab has

uncovered one function of FASN in maintaining endoplasmic reticulum (ER)

homeostasis. When certain conditions perturb the integrity of the ER by inducing the

accumulation of unfolded proteins, ‘ER stress’ occurs and causes activation of the

Unfolded Protein Response (UPR). The UPR is critical for the balance of adaptation and

alarm signals in a tumor cell. This introduction will provide an overview of FASN in

tumor development and the UPR as a basis for the work presented in this thesis.

3

I.2. FATTY ACID SYNTHESIS

I.2.1 The FASN Enzyme

One of the metabolic hallmarks of a tumor cell is increased lipogenesis (1, 2). In

fact, in many instances the vast majority of fatty acids in tumors are synthesized de novo

(3). In mammalian cells, fatty acid synthase (FASN) is the central enzyme of long chain

fatty acid synthesis. FASN is a multifunctional polypeptide that is comprised of seven

separate functional domains (Figure 1A). The individual domains of FASN work in

concert to catalyze thirty-two different reactions to synthesize the sixteen carbon fatty

acid palmitate, using acetyl-CoA and malonyl-CoA as substrates and nicotinamide

adenine dinucleotide phosphate (NADPH) as an electron donor. The fatty acid synthesis

reaction mechanism can be separated into three functional groupings: 1) to bind and

condense the substrates, 2) to reduce the intermediates and 3) to release the final

saturated long chain fatty acid palmitate (Figure 1B). The malonyl acetyl transferase

(MAT) domain binds malonyl-CoA and acetyl-CoA, while the ketoacyl synthase (KS)

domain acts to condense the acyl chain (Figure 1B). This "-ketoacyl moiety is then

reduced in steps by the "-ketoacyl reductase (KR), "-hydroxyacyl dehydratase (DH), and

enoyl reductase (ER) domains to a saturated acyl intermediate. This derivative can then

be elongated by repeating the reactions catalyzed by the five previous enzyme activities

for seven cycles until the thioesterase (TE) domain cleaves the final product, the sixteen

carbon fatty acid palmitate. Throughout the entire synthesis of palmitate, the acyl carrier

protein (ACP) acts as a coenzyme to bind intermediates by a 4’-phosphopantetheine

group (Figure 1B). In total, approximately 30 intermediates are involved in the process,

but it is the high specificity of the TE domain for a 16 carbon fatty acid, as well as the

4

MAT specificity for malonyl-CoA, that are responsible for preventing leakage of

intermediates (4). The overall FASN reaction is as follows:

Acetyl-CoA + 7 Malonyl-CoA + 14 NADPH + 14 H+ # Palmitic acid + 7 CO2 +

8 CoA + 14 NADP+ + 6 H2O

The structure of FASN has yet to be definitively characterized, as there are two

distinct models (5). Early complementation studies suggest that FASN functions as a

homodimer in head-to-tail conformation with two simultaneous reactions beginning in

one subunit and finishing in the other (4, 6-8). However a more recent crystal structure

analysis of porcine FASN challenges this historical model. The 4.5 $ structure reveals

FASN as an intertwined dimer in a conformation resembling an ‘X’ with one central core

region with two arms and two legs (9). However, at this lower resolution, the definitive

placement of the flexible TE domain and ACP is not possible. It is also unclear whether

the body of the FASN complex can be identified as two distinct monomers. In this model,

the KS domain is near the bottom of the central core of the complex and two MAT

domains are in the “legs” of the X shape. The DH domains are located in the top half of

the central region just under the ER domains. Adjacent to the ER domains are the KR

domains that comprise the “arms” of this X complex. The study equates the reaction

pockets of this structure as having “double hot dog” folds but observes asymmetry of the

two sides of the reaction chambers that may reveal hinge regions that allow different

conformations of the FASN complex (5, 9).

5

Figure 1: The FASN Enzyme A. The FASN polypeptide comprises seven functional domains: the ketoacyl synthase (KS), malonyl acetyl transferase (MAT), "-hydroxyacyl dehydratase (DH), enoyl reductase (ER), "-ketoacyl reductase (KR), the acyl carrier protein (ACP), and thioesterase (TE) domains. B. The FASN reaction mechanism. The MAT domain of the enzyme binds malonyl-CoA and acetyl-CoA, while the KS domain acts to condense the growing acyl chain. The resulting "-ketoacyl moiety is then reduced in steps by the KR, DH, and ER to a saturated acyl intermediate. This process is repeated in seven cycles, after which, the TE domain releases the sixteen carbon fatty acid palmitate.

I.2.2 Other Players in the Fatty Acid Synthesis Pathway

While FASN is the central enzyme of fatty acid synthesis, other enzymes and

pathways upstream of FASN are required to generate and supply substrates. Glucose

enters the cell and is converted through glycolysis to pyruvate which is then shuttled into

the mitochondria to enter the citric acid cycle. Citrate is shuttled out of the mitochondria,

where ATP-citrate lyase (ACL) catalyzes the conversion of citrate to oxaloacetate and

acetyl-CoA. Acetyl-CoA Carboxylase (ACC) catalyzes the conversion of acetyl-CoA to

N CKS MAT DH ER KR TEACP

7 · malonyl-CoA

acetyl-CoA

ACP

8 · CoA + 7 · CO2

MATKS

KRDH

7 · NADPH

7 · NADP+

6 · H2O

7 · NADPH7 · NADP+

palmitate

ERTE

STARTELONGATION

TERMINATION

A.

B.

6

malonyl-CoA in the rate limiting and first committed step of lipogenesis. Unlike FASN,

which is primarily regulated transcriptionally, ACC is negatively regulated by post-

translational phosphorylation at serine 79 by AMP-activated kinase (AMPK). Energy

deficiency stimulates AMPK to regulate energy consumption of cells, specifically by

regulating ACC among other enzymes. Fatty acid synthesis requires NADPH, which is

provided through the hexose monophosphate shunt and malic enzyme (ME) to donate

electrons (10). Recent findings also suggest that glutamine metabolism can generate

sufficient NADPH in glycolytic tumor cells as well as act as a carbon source for fatty

acid synthesis (11).

After fatty acid synthesis, downstream enzymes can further modify palmitate for

various cellular functions. In the endoplasmic reticulum, the 16 carbon fatty acid can be

modified to fatty acids with eighteen or more carbons known as very long chain fatty

acids (VLCFA), such as the eighteen carbon saturated fatty acid stearate (18:0) by a

family of elongase enzymes called elongation of very long chain fatty acids (ELOVL1-6)

(12). Palmitate and stearate can also be desaturated by stearoyl-CoA desaturase-1 (SCD1)

at the cis-9 carbon to palmitoleate (16:1) and oleate (18:1), respectively (13).

I.3. FASN EXPRESSION

I.3.1 FASN Expression in Normal Cells

In normal tissue, FASN is expressed and active in cells that have a high lipid

metabolism, such as liver and adipose tissues, to generate triglycerides in response to

excess caloric intake (10, 14, 15). FASN is also expressed in a niche-specific manner in

7

specialized tissues such as lactating mammary glands (16, 17) cycling endometrium (16,

18), and various other cell types including type II alveolar cells to produce lung

surfactant (16, 19), brain cells (14, 16), and seminal vesicles to produce seminal fluid

(16). FASN is only weakly detectable, if at all, in other rapidly dividing normal tissues

such as the intestinal epithelium, stomach epithelium, and hematopoietic cells in adults

and is not detectable in most other adult tissues (16).

Despite the low expression profile in most adult tissues, FASN is critical for

developing embryos and is highly expressed in proliferative fetal cells (16). The

importance of FASN in development is underscored by the fact that mice with

homozygous deletions of the FASN gene display an embryonic lethal phenotype (20).

FASN -/- mice die before implantation around embryonic day 3.5, most likely because

developing embryos are unable to acquire enough fatty acids from the mother for

adequate membrane biogenesis. The importance of FASN during development is further

highlighted by the fact that the majority of heterozygotes are also resorbed after

implantation. Those that survive do not live long beyond birth, indicating that one FASN

allele is usually insufficient for embryogenesis, implantation, and developing tissues (20).

The importance of the fatty acid synthesis pathway in development is further supported

by the demonstration that deletion of ACC1 in mice also results in an embryonic lethal

phenotype (21).

Mice harboring tissue-specific deletions of FASN have been generated to facilitate

understanding of the role of FASN in normal tissue. To date FASN has been deleted in

8

liver, "-cells, and hypothalamus (22, 23). To knock out FASN in the liver, mice with a

“floxed” FASN allele were crossed with mice harboring an allele of Cre driven by a rat

albumin promoter. Although this liver-specific deletion of FASN (FASKOL) leaves

animals viable without severe physiological effects, it is not without consequence. When

FASKOL mice are fed a diet containing zero fat or are fasted for prolonged periods, they

develop symptoms similar to those seen in mice engineered to lack Peroxisome

Proliferator-Activating Receptor alpha (PPAR!) (24). Both PPAR! knockout and

FASKOL mice become hypoglycemic, develop steatosis (fatty liver) that correlates with

reduced serum and liver cholesterol, reduced expression of 3-hydroxy-3-methyl-glutaryl-

CoA (HMG-CoA) reductase, decreased cholesterol biosynthesis activity, and elevated

sterol response element binding protein 2 (SREBP-2) expression. While the

hypoglycemia and fatty liver may be reversed with dietary fat, all effects including

cholesterol biosynthesis, HMG-CoA reductase and SREBP2 levels, as well as cholesterol

levels in the serum and liver are rescued by administration of a PPAR! agonist. This

reveals distinct levels of metabolic regulation between de novo and dietary fat and

indicates that products downstream of FASN activity regulate cholesterol, glucose, and

fatty-acid homeostasis in the liver through activation of PPAR! (22). Interestingly, mice

with a liver-specific knockout of ACC1 are still able to undergo fatty acid synthesis, but

this discrepancy can be attributed to compensatory production of malonyl-CoA by the

ACC2 isoform (25).

To determine whether FASN plays a role in pancreatic "-cell function, a knockout

of FASN was generated. Crossing floxed FASN mice with mice harboring Cre under the

9

control of rat insulin 2 promoter (RIPCre) causes specific deletion of FASN in pancreatic

"-islet cells, as well as the hypothalamus, a region of the brain known for controlling

motivational states, such as feeding. The resulting FASN knockout (FASKO) mice

exhibit reduced feeding behavior and are highly active, even while maintained on a high

fat diet (23). This correlates with studies showing the small molecule FASN inhibitor

C75 acts in the hypothalamus to stimulate fatty acid oxidation via carnitine palmityl

transferase 1 (CPT1) and induce a reversible anorexic phenotype (see section V.1.2).

Interestingly, the "-cells lacking FASN are unaffected as loss of FASN does not alter

insulin or glucose levels during glucose tolerance testing or stimulation either in vivo or

in vitro (23). Therefore, the fasting phenotype of FASKO mice appears to be solely

attributable to the effects on the hypothalamus. As a matter of fact, this observation is in

agreement with a recent study showing FASN is not required for normal insulin secretion

of "-cells in vitro (26). Intracerebroventricular injection of FASKO mice with a small

molecule drug Wy14,643 to activate PPAR! restores feeding and weight gain, indicating

that FASN controls PPAR! activation in the hypothalamus. Pharmacological activation

of PPAR! in these mice also restores expression of CPT-1 and malonyl-CoA desaturase

(MCD) that control cellular levels of malonyl-CoA by controlling the rate of transfer of

fatty acids into the mitochondria for "-oxidation and malonyl-CoA stability, respectively

(23). These studies elucidate the importance of FASN in energy homeostasis and provide

a mechanism through which FASN can regulate its effects.

10

I.3.2 FASN Expression in Tumor Cells

As discussed above, FASN has historically been studied in relation to normal

physiology and as a central mediator of energy balance. In the last few decades, however,

it has become clear that FASN is associated with tumor development. Accordingly, high

FASN expression has been identified in many tumor types (1, 27). Haptoglobin-related

protein (Hpr) was demonstrated to correlate with breast cancer stage, prognosis, as well

as recurrence and patient survival (28, 29). Shortly after this observation, Hpr, or

oncogenic antigen (OA-519) protein was identified as FASN (30). Since these

discoveries, FASN upregulation has been demonstrated in every type of solid tumor. An

initial retrospective study showed FASN expression correlated with staining of the

proliferation marker MIB-1 to predict survival of breast cancer patients (31). Subsequent

studies confirmed the association of FASN with breast cancer recurrence, as well as

shorter overall and disease-free survival in early breast cancer patients (32, 33). Breast

cancer is not the only tumor type with elevated FASN levels. FASN expression is

associated with prostate cancer prognosis, progression, and stage (34-36). As a matter of

fact, FASN is upregulated in androgen-independent prostate tumors and expression

correlates with disease stage, as the highest levels of FASN expression are in androgen

independent metastases (37, 38). FASN expression correlates with poor prognosis,

advanced progression, and/or decreased survival in a number of other cancers of different

origins including: ovarian (39, 40), melanoma (41, 42), nephroblastoma (Wilms tumor)

(43), retinoblastoma (44), bladder (45), pancreas (46), soft tissue sarcoma (47), non-small

cell lung cancer (48), endometrium (49), and Paget’s disease of the vulva (50). While

FASN expression correlates with decreased survival and/or poor prognosis in a large

11

number of tumor types, there are tumor types that despite elevated FASN expression, do

not correlate with patient survival or disease stage (51-53). In addition, there are several

tumor types that show increased FASN expression, but correlation with disease

progression or patient survival has not been investigated or published at this time. These

tumors include hyperplastic parathyroid (54), stomach carcinoma (55), mesothelioma

(56), glioma (57), and hepatocellular carcinoma (58).

Increased FASN expression in tumors is an early, common event (59, 60) and its

correlation with reduced survival and increased recurrence rationalizes the potential for

anti-FASN tumor therapeutics (1, 27, 61). As evidence that lipogenesis as a whole is

important in cancer, many of the enzymes upstream of FASN show altered expression

patterns in human tumor cells. For instance, ACL is overexpressed in cancer cells of

breast and bladder (62, 63). ACC is overexpressed in breast and prostate cancer cells (2,

64-66). Interestingly, the tumor suppressor breast cancer susceptibility gene 1 (BRCA1)

can bind the phosphorylated inactive ACC to prevent re-activation (67). In addition,

squamous cell carcinomas of the lung show lower immunohistochemical staining of

phosphorylated inactive ACC than adenocarcinoma with poor prognosis (68). The strong

functional correlation between upstream mediators of fatty acid synthesis and cancer

underscores the importance of this pathway in tumor biology.

12

I.4. FASN REGULATION

I.4.1 FASN Regulation in Normal Cells

In nonmalignant tissues, FASN expression is primarily regulated at the

transcriptional level (Figure 2A) (69). There is a single FASN gene and the signals in

normal cells that stimulate FASN transcription are numerous but strictly defined (70).

Transcription of FASN is stimulated by dietary carbohydrate, glucose, insulin, amino

acids, sterols and cyclic-AMP through specific response elements (4, 10, 71-76).

Hormones such as the thyroid hormone triiodothyronine (T3) (77), progesterone (78),

androgen (66) and adrenal glucocorticoids (15) can also upregulate FASN in liver and

adipose tissues. FASN transcription is mediated by multiple transcription factors.

Upstream stimulatory factors (USFs) are required for insulin mediation of FASN

expression, but other factors such as nuclear factor Y (NF-Y) and stimulatory protein 1

(SP1) can also play a role in FASN transcription (79, 80). However, the vast majority of

FASN-regulatory signals act through a family of transcription factors known as sterol

response element binding proteins (SREBPs) that control lipid homeostasis and bind to

various elements in the FASN promoter. There are three SREBP family members:

SREBP-1a, SREBP-1c, and SREBP-2. SREBP-1a and SREBP-1c have been most widely

linked to regulation of lipogenic gene transcription, while SREBP-2 is most linked to

cholesterol metabolism. The SREBPs exist as endoplasmic reticulum membrane bound

precursors that are activated after proteolytic processing by site-one and site-two

proteases (S1P, S2P). When sterol levels are low, S1P cleaves the SREBP molecule to

release the N terminal portion from the endoplasmic reticulum (81). SREBP then binds to

the SREBP cleavage activating protein (SCAP) and is translocated to the Golgi where

13

S2P further processes the molecule so that the transcription factor is activated. The

processed SREBP then translocates to the nucleus to bind specific E box motifs and sterol

response elements (SREs) (82). There is evidence that dietary factors stimulate the

expression of FASN in a manner mediated through signaling pathways such as the

phosphoinositide-3 kinase (PI3K) pathway. For instance, nonmalignant 3T3-L1

adipocytes regulate insulin-mediated FASN expression through Akt in a manner

independent of both mitogen activated protein kinase (MAPK) and P70 S6 kinase, but

dependent on SREBPs (75, 83).

Expression of FASN is tightly controlled so that transcription does not continue

unabated under typical circumstances. Polyunsaturated fatty acids (PUFAs) (84-86),

sterols (80, 87), and leptin (88) all act to repress FASN transcription and do so by

specifically down-regulating SREBP-1 in hepatocytes (79, 89). This highly complex

organization of checks and balances for FASN expression is necessary to supply the cell

with essential de novo fatty acids for cellular function and growth (Figure 2A). Just as

importantly, controls keep the cell from continuing unnecessary lipogenesis.

I.4.2 FASN Regulation in Tumor Cells

While FASN expression is tightly controlled through dietary and hormonal

stimuli in nonmalignant cells, tumor cells ignore these restrictions and increase FASN

beyond typical levels (Figure 2B). In fact, an early study of orthotopic hepatomas

revealed that while low-fat, high-fat, and high-cholesterol diets all affected rates of fatty

acid synthesis in the normal liver, the rates of hepatoma fatty acid synthesis were

14

unchanged (90). It has since been discovered that deregulation of upstream signals drive

FASN expression in a manner that is largely transcriptional in tumors (Figure 2B) (2).

Overexpression of FASN in tumor cells is induced at the transcriptional level by

receptor tyrosine kinase (RTK)-stimulation of Ras and Akt (Figure 2B). Keratinocyte

growth factor (KGF) can induce the Akt- and cJun N-terminal kinase (JNK)-dependent

expression of FASN in pulmonary cancer cells (91). Epidermal growth factor (EGF) has

also been shown to increase FASN in prostate cancer cells (92).

In addition to growth factor signaling, activation of the RTK HER2/Neu is linked

with FASN expression in tumor cells. HER2/Neu upregulates PI3K-dependent FASN

transcription in breast cancer cells (93, 94). Blocking HER2/Neu with Herceptin

decreases FASN expression (93). There appears to be a crosstalk between these

pathways, as inhibition of FASN activity leads to the downregulation of HER2/NEU

(95). While HER2/Neu is primarily associated with breast cancer progression,

HER2/Neu and FASN expression correlate in squamous cell carcinomas of the tongue, as

well (53). Surprisingly, HER2/Neu can also regulate FASN expression in prostate cancer

cells (96). These data suggest there is coordinate regulation of HER2/Neu activation and

FASN upregulation in tumor cells.

Downstream of RTK signaling, the PI3K/Akt pathway has been shown to

upregulate FASN. Loss of PTEN is a frequent transformation event in cancer, that leads

to a gain of function in Akt signaling (97, 98). In prostate cancer cells, this signaling

15

cascade drives androgen receptor (AR)-mediated oncogenic transcription and progression

to metastatic disease (97, 99). The PTEN-null LNCaP tumor cell line has high levels of

FASN. Reintroducing PTEN or using the PI3K inhibitor LY294002 can decrease FASN

expression, whereas introducing constitutively active Akt can restore FASN expression

(100). The connection between FASN expression and PI3K activity is further observed in

prostate carcinoma samples with high Gleason scores, where high FASN expression

correlates with phosphorylated Akt that is localized to the nucleus (101). Moreover, a

crosstalk between these pathways has been identified. In ovarian cancer cell lines,

phosphorylated Akt correlates with and drives FASN expression. Conversely, inhibiting

FASN results in decreased Akt phosphorylation (102). These data suggest that PI3K

signaling through Akt is an important mediator of FASN transcription in tumor cells.

In addition to RTK-driven stimulation of Akt, there is evidence that the small

GTP-ase protein Ras can influence FASN expression in tumors. Constitutively active H-

ras induces increased PI3K and MAPK-dependent FASN expression in MCF-10A cells

(103). Consistent with this notion, the expression of activated K-ras correlates with

FASN expression in human colorectal cancer samples (104, 105). Altogether, these data

suggest that RTK signaling, Ras, and PI3K-Akt pathways can drive transcriptional up-

regulation of FASN expression in tumor cells (Figure 2B).

Not surprisingly, hormones are another common factor driving FAS expression in

tumor cells (Figure 2B). Progestins stimulate FASN expression in breast cancer cells (78,

106, 107). Consistent with this finding, increased FASN expression in endometrial

16

carcinoma correlates with expression of both estrogen and progesterone receptors (PR)

(108). In prostate cancer, FASN expression can be regulated by androgens in prostate

cancer through upregulation of transcription factors such as S14 and SREBPs (109-112).

In addition, HER2/Neu can drive activation of AR in prostate cancer cells to increase

MAPK-dependent induction of FASN in the absence of androgen (96).

While the main mechanism of FASN overexpression in tumors is through

transcriptional upregulation, there is also evidence that FASN is regulated by post-

transcriptional mechanisms (Figure 2B). For instance, HER2/Neu driven expression of

both FASN and ACC can be regulated at the translational level through Akt, PI3K, and

mTOR-dependent mechanisms (94). FASN stabilization is tightly linked with the de-

ubiquitinating enzyme ubiquitin-specific protease 2a (USP2A) in prostate cancer cells.

USP2A is androgen regulated and is not only upregulated similarly to FASN, but actually

interacts with FASN to enhance FASN stability (113). Treating prostate tumor cells with

the proteasome inhibitor MG-132, also increases FASN expression, further supporting

evidence that FASN is regulated by the proteasome (113). Interestingly, yeast studies

provided early evidence of FASN regulation by proteasomal degradation (114). FASN

can also be upregulated in cancer cells by FASN gene amplification (115). The fact that

numerous mechanisms act to increase FASN expression in tumor cells highlights the

importance of FASN in tumor progression.

17

Figure 2: Regulation of FASN Expression in Normal and Tumor Cells. A. In normal cells (hepatocytes and adipocytes) FASN expression is primarily regulated through transcriptional mechanisms by multiple stimuli. B. In tumor cells, FASN expression is regulated by transcriptional and non-transcriptional mechanisms via multiple pathways.

I.4.3 Palmitate Utilization in Normal and Tumor Cells

Upregulation of FASN activity causes the increased production of fatty acids,

particularly palmitate. While the mechanisms that drive FASN expression are different in

tumors as compared to normal cells, the utilization of its products differs, as well. Fatty

acids are used for a variety of cellular functions. In nonmalignant adipose and hepatic

tissue, palmitate is incorporated into triglycerides for secretion and storage to be

ultimately used as an energy source through "-oxidation (116). Fatty acids such as

palmitate can also comprise a regulatory pool that activates energy mediators such as

PPAR! in the liver and hypothalamus (22, 23). In addition, key signaling molecules, such

Normal cell Tumor cell

FASN

palmitate

FASN

palmitate

glucose PUFAs insulin

+

triglycerides phospholipidPPAR!

+_PI3K

dietary stimuli

p-AktH-Ras

proteasome

Akt, mTOR++

_

phospholipid

lipid rafts

PTEN

growth factors

HER2/Neu

RTK

+LY294002

rapamycin

LY294002

transcriptionaltranscriptional post-transcriptional

MG-132

(EGFR, HER2/Neu,

KGFR)

SREBP

A. B.

AR/PR +

X

18

as Ras and Hedgehog, can be palmitoylated to target these proteins to cellular

membranes (117). So far, a link between protein palmitoylation and FASN activity has

not been established though. In development, fatty acids can segregate into phospholipids

to create cellular membranes (20). Similarly, tumor FASN-derived palmitate segregates

into phospholipid microdomains known as lipid rafts (Figure 2B) (118). Lipid rafts are

involved in a number of key biological functions including signal transduction,

polarization, trafficking, and migration (119, 120). Considering that palmitate can

ultimately be used for a number of cellular processes, including being elongated and

desaturated for subsequent events, it is apparent that FASN occupies an important niche

in tumor cells.

I.5. ENDOPLASMIC RETICULUM

I.5.1. Endoplasmic Reticulum

The endoplasmic reticulum (ER) plays a central role in many cellular functions,

including protein folding and glycosylation, as well as calcium ion storage and

homeostasis for the cell (121). The ER is also the primary site of phospholipid synthesis

to supply lipid for organelle and cellular membrane. Because the ER serves so many

important functions, it is not surprising that the ER also acts as a quality control

mechanism for both trans-membrane bound and certain soluble or secreted proteins. If

proteins are improperly folded, they are either retained in the ER until proper folding is

achieved or are targeted through specific mechanisms for degradation (121).

19

V.5.2. Lipids and the Endoplasmic Reticulum

There are significant links between ER homeostasis and lipids. Not only is the ER

the main site of phospholipid synthesis, but phospholipids are, in turn, critical for

maintaining ER integrity and homeostasis. For example, inhibiting synthesis of

phosphatidylcholine, the main phospholipid of the ER and other cellular membranes,

perturbs the ER function and induces a condition referred to as ‘ER stress’ (122).

Inhibiting phosphatidylcholine synthesis induces key signaling components associated

with the cellular response to ER stress, known as the unfolded protein response (UPR),

including induction of a pro-apoptotic factor known as C/EBP homologous protein

(CHOP) (122). In turn, the UPR has mechanisms in place to upregulate phospholipid

synthesis. Mice lacking a key UPR component, X-box binding protein 1 (XBP-1) are

embryonically lethal due to underdeveloped ER in the liver (123). Reintroducing XBP-1

to only the liver of XBP-1-/- mice partially rescues viability, but tissues with high

secretory capacities such as salivary and acinar tissues are non-functional because of

inadequate ER volume (124). Overexpression of the active form of XBP-1 results in

activation of a key enzyme in the phosphatidylcholine synthesis pathway leading to

increased ER size and volume (125, 126). These studies indicate a critical connection

between phospholipids and ER homeostasis. Considering that palmitate can segregate to

phospholipid, the connections between lipids and ER function led our lab to hypothesize

that synthesis of the fatty acid palmitate is also required for maintenance of ER

homeostasis (127). Furthermore, we hypothesize that FASN inhibitors induce cell death

through an ER stress-dependent mechanism.

20

I.5.2. Endoplasmic Reticulum Stress

Typically, proteins are translated off the ribosome into the ER where they are

folded into their proper conformations and exported for cellular function (121). If a

protein is misfolded, it is degraded through ER-associated degradation (ERAD). As the

protein enters the ER, key protein chaperones, such as BiP, help keep the protein in its

unfolded conformation until translation has completed and the full protein is in the ER

lumen (121). Certain physiological events such as glucose deprivation, acidosis, or low

oxygen can cause the accumulation of unfolded proteins. Pharmacological agents that

interfere with protein secondary modifications or calcium homeostasis can also induce

the accumulation of unfolded proteins (128). If these unfolded proteins continue to

burden the ER, the cell will undergo proteotoxicity and subsequent cell death. However,

the cell has an integrated stress response program specific to conditions resulting in

unfolded protein accumulation known as the unfolded protein response (UPR) (128).

I.5.3. Unfolded Protein Response

The UPR is activated under conditions of ER stress to reduce translation,

upregulate chaperones, increase ER volume, and increase ER-associated degradation to

allow the cell to adapt and recover from its stressor (126, 129, 130). If this adaptation

protocol is insufficient to mediate cell survival in response to the ER stressor, or becomes

saturated, then a corresponding alarm signal cascade will be activated to induce

programmed cell death. Therefore, activation of these stress signals is critical to the

cellular balance between survival and death. The UPR is comprised of three proximal

sensors that mediate various components important for adaptation and apoptosis. The

21

PKR-like ER kinase (PERK) is an ER trans-membrane kinase that phosphorylates serine

51 of the alpha subunit of eIF2 under conditions of ER stress to inhibit bulk translation

(131). The inositol-requiring enzyme 1 (IRE1) is also an ER trans-membrane kinase that

also acts as an endonuclease to splice the mRNA of XBP-1 to form a potent ER-stress

specific transcription factor that upregulates chaperones and genes involved in membrane

biogenesis (129, 130). In addition, IRE1 can also interact with TRAF2 to activate JNK

and corresponding alarm signals (132). The third arm acts through activated transcription

factor 6 (ATF6) that becomes activated through proteolysis to upregulate chaperones and

other key components of the UPR (133, 134). The three arms of the UPR are each

activated under conditions of ER stress to mediate functions to reduce protein burden,

adapt the capacity of the ER to handle protein burden, or undergo apoptosis (Figure 3).

I.5.3.1. PKR-like Endoplasmic Reticulum Resident Kinase Signaling

PERK is one of four known cellular stress kinases able to phosphorylate

eukaryotic initiation factor 2 alpha (eIF2!) to reduce bulk translation and upregulate the

translation of key survival genes such as activating transcription factor 4 (ATF4) (131,

135, 136). PERK becomes activated under conditions of ER stress when the binding

protein BiP titrates off the ER luminal domain of PERK to bind misfolded proteins

allowing PERK to dimerize and autophosphorylate (137). Activated PERK is then able to

phosphorylate serine 51 of the alpha subunit of eIF2 (131). Fully active translation

requires formation of the ribosomal 43S pre-initiation complex consisting of eIF2,

Methionyl t-RNA, GTP, and other eIFs. Phosphorylation of eIF2! acts as a dominant

negative by binding and sequestering the guanine nucleotide exchange factor, eIF2B,

22

thereby preventing eIF2 from joining the 43S complex and facilitating the exchange of

GTP. Reducing translation lowers the input of protein to the already burdened ER.

PERK-dependent phosphorylation of eIF2! also directly leads to the increased translation

of ATF4 due to an alternative upstream open reading frame (138, 139).

Figure 3. The Unfolded Protein Response Certain conditions induce the accumulation of unfolded proteins in the ER. The UPR responds by reducing protein burden, increasing adaptation genes, and inducing alarm genes through activation of PERK, IRE1, and ATF6. PERK phosphorylates eIF2! to reduce bulk translation and increase translation of ATF4. IRE1 mediates the splicing of XBP-1 to yield a transcription factor important for upregulation of adaptation genes. IRE1 also interacts with TRAF2 to activate JNK and downstream alarm signals. ATF6, once activated, also upregulates adaptation and alarm signals of the UPR.

Upregulation of ATF4 allows for the induction of various downstream targets

important for adaptation of the ER such as protein folding chaperones, as well as targets

important for the alarm response such as the pro-apoptotic factor known as C/EBP

homologous protein (CHOP) (140). The simultaneous induction of adaptation and alarm

BiP

PERK IRE1 ATF6

eIF2! p-eIF2!

global translation off

GADD34

XBP-1(s)

ATF4

Golgi

Adaptation Alarm, Death

BiP, GADD34, XBP1 CHOP

XBP-1(us)

degradation

TRAF2

p-JNK

c-Junproteasome

ER-associated

degradation

23

signals is a common theme in the UPR. The UPR, in general, but PERK-dependent

phosphorylation of eIF2! specifically, acts as a rheostat to fine tune signals that balance

survival and death in a cell experiencing ER stress (141). If a cell is unable to maintain or

induce adequate levels of phosphorylated eIF2!, the cell dies due to proteotoxicity. If the

cell has levels of phosphorylated eIF2! that are too high, the cell cannot translate enough

protein to survive. Therefore, the levels are carefully regulated by stress kinases such as

PERK and the ER-stress effector growth arrest and DNA damage protein 34 (GADD34)

that complexes with protein phosphatase 1 (PP1) to mediate the dephosphorylation of

eIF2! (128, 142-144).

I.5.3.2. Inositol-Requiring Enzyme 1 Signaling

The IRE1 arm of the UPR is another signaling pathway designed to mediate

adaptation and alarm signals (128). Activation of IRE1 is not well understood. One

model suggests that BiP titrates off the ER luminal domain of IRE1 to activate IRE1 in a

manner similar to that of PERK activation (137). However, mutating the domain of BiP

thought to bind to IRE1 does not affect IRE1 activation (145). Some evidence based on

the crystal structure of the ER luminal domain of IRE1 suggests that IRE1 may be able to

bind unfolded proteins and, therefore respond to their accumulation directly (146).

Despite this debate, evidence does indicate that IRE1 does indeed oligomerize and, then

trans-autophosphorylates (147).

In addition to its kinase ability, IRE1 also acts as an endonuclease to splice a 26

base pair fragment from XBP-1 mRNA to cause a reading frame shift (129, 130).

24

Spliced, or processed, XBP-1 (XBP-1(s)) is then translated to a stable ER-stress specific

transcription factor that upregulates ER chaperones and other adaptation genes, including

itself and genes involved in membrane biogenesis (125, 129, 130). Activated IRE1 can

also interact with TRAF2 to activate JNK and corresponding alarm signals including

activation of the ER stress-associated caspase 12 (132, 148). IRE1 activation is able to

induce expression of the ER stress pro-apoptotic protein CHOP downstream of JNK

(149, 150). Also in support of the connection with IRE1 and alarm signal transduction,

Bax and Bak at the ER are required for IRE1 activity (151). Altogether, IRE1 is an

important mediator of not only UPR adaptation signaling, but the alarm response as well.

Understanding the contribution of the UPR signaling arms allows for a unique

opportunity to exploit its careful balance of survival and death and shift the cell past

levels compatible with survival. Combining pharmacologic or physiological ER stressors

can potentially augment cell death and, therefore, increase chemotherapeutic efficacy.

We have shown that perturbing fatty acid synthesis induces ER stress and activation of

the UPR (127). Further, we show that FASN inhibitors can be combined with a

proteasome inhibitor to increase cell death through increased UPR signaling. We

hypothesize that this is likely due to a downstream perturbation in phospholipid levels

needed for ER membrane, function, and overall homeostasis. In fact, we propose that the

ER may act as a sensor for fatty acid and, moreover, FASN levels in a tumor cell (127).

25

I.6. Overview

Fatty acid synthase represents a highly attractive therapeutic target considering its

expression profile and the dependency of tumor cell survival on FASN expression. While

FASN inhibitors are known to induce cell death, the mechanism has not been well

established. Furthermore, it is not understood why tumor cells express FASN when

palmitate can be obtained from the circulation. This dissertation describes a connection of

FASN with the endoplasmic reticulum and how this connection may facilitate tumor cell

survival. Chapter II details the initial discovery of the connection between the FASN and

the ER and shows that FASN inhibitors induce the physiological phenomenon known as

“ER stress” (overviewed above). Chapter III describes how combining FASN inhibitors

with a clinically approved proteasome inhibitor, bortezomib, not only increases tumor

cell death mediated through the UPR, but also reveals crosstalk between the fatty acid

synthesis and proteasome pathways. Chapter IV reveals that FASN inhibitor cell death

may be mediated by accumulation of reactive oxygen species through a mechanism that

is independent of both caspase cleavage and PERK-dependent phosphorylation of eIF2!.

Chapter V will summarize how this dissertation fits in the global understanding of FASN

in cancer cells and the application of FASN inhibitors for clinical use.

26

References

1. Kuhajda FP. Fatty acid synthase and cancer: new application of an old pathway.

Cancer Research 2006;66:5977-80. 2. Swinnen JV, Brusselmans K, Verhoeven G. Increased lipogenesis in cancer cells:

new players, novel targets. Curr Opin Clin Nutr Metab Care 2006;9:358-65. 3. Ookhtens M, Kannan R, Lyon I, Baker N. Liver and adipose tissue contributions

to newly formed fatty acids in an ascites tumor. Am J Physiol Regul Integr Comp Physiol 1984;247:R146-53.

4. Wakil SJ. Fatty acid synthase, a proficient multifunctional enzyme. Biochemistry 1989;28:4523-30.

5. Smith S. Architectural Options for a Fatty Acid Synthase. Science 2006;311:1251-52.

6. Smith S, Witkowski A, Joshi AK. Structural and functional organization of the animal fatty acid synthase. Prog Lipid Res 2003;42:289-317.

7. Rangan VS, Joshi AK, Smith S. Fatty acid synthase dimers containing catalytically active beta-ketoacyl synthase or malonyl/acetyltransferase domains in only one subunit can support fatty acid synthesis at the acyl carrier protein domains of both subunits. Journal of Biological Chemistry 1998;273:34949-53.

8. Rangan VS, Joshi AK, Smith S. Mapping the functional topology of the animal fatty acid synthase by mutant complementation in vitro. Biochemistry 2001;40:10792-99.

9. Maier T, Jenni S, Ban N. Architecture of mammalian fatty acid synthase at 4.5 A resolution. Science 2006;311:1258-62.

10. Wakil SJ, Stoops JK, Joshi VC. Fatty acid synthesis and its regulation. Annu Rev Biochem 1983;52:537-79.

11. Deberardinis RJ, Mancuso A, Daikhin E, et al. Beyond aerobic glycolysis: Transformed cells can engage in glutamine metabolism that exceeds the requirement for protein and nucleotide synthesis. Proc Natl Acad Sci U S A 2007;104:19345-50.

12. Jakobsson A, Westerberg R, Jacobsson A. Fatty acid elongases in mammals: their regulation and roles in metabolism. Prog Lipid Res 2006;45:237-49.

13. Sampath H, Ntambi JM. The fate and intermediary metabolism of stearic acid. Lipids 2005;40:1187-91.

14. Jayakumar A, Tai MH, Huang WY, et al. Human fatty acid synthase: properties and molecular cloning. Proc Natl Acad Sci U S A 1995;92:8695-9.

15. Volpe JJ, Marasa JC. Hormonal regulation of fatty acid synthetase, acetyl-CoA carboxylase and fatty acid synthesis in mammalian adipose tissue and liver. Biochim Biophys Acta 1975;380:454-72.

16. Kusakabe T, Maeda M, Hoshi N, et al. Fatty Acid Synthase Is Expressed Mainly in Adult Hormone-sensitive Cells or Cells with High Lipid Metabolism and in Proliferating Fetal Cells. The Journal of Histochemistry & Cytochemistry 2000;48:613-22.

27

17. Thompson BJ, Smith S. Biosynthesis of fatty acids by lactating human breast epithelial cells: an evaluation of the contribution to the overall composition of human milk fat. Pediatr Res 1985;19:139-43.

18. Pizer ES, Kurman RJ, Pasternack GR, Kuhajda FP. Expression of fatty acid synthase is closely linked to proliferation and stromal decidualization in cycling endometrium. Int J Gynecol Pathol 1997;16:45-51.

19. Buechler KF, Rhoades RA. Fatty acid synthesis in the perfused rat lung. Biochim Biophys Acta 1980;619:186-95.

20. Chirala SS, Chang H, Matzuk M, et al. Fatty acid synthesis is essential in embryonic development: fatty acid synthase null mutants and most of the heterozygotes die in utero. Proc Natl Acad Sci U S A 2003;100:6358-63.

21. Abu-Elheiga L, Matzuk MM, Kordari P, et al. Mutant mice lacking acetyl-CoA carboxylase 1 are embryonically lethal. Proc Natl Acad Sci U S A 2005;102:12011-16.

22. Chakravarthy MV, Pan Z, Zhu Y, et al. "New" hepatic fat activates PPARalpha to maintain glucose, lipid, and cholesterol homeostasis. Cell Metab 2005;1:309-22.

23. Chakravarthy MV, Zhu Y, Lopez M, et al. Brain fatty acid synthase activates PPARalpha to maintain energy homeostasis. Journal of Clinical Investigation 2007;117:2539-52.

24. Kersten S, Seydoux J, Peters JM, et al. Peroxisome proliferator-activated receptor alpha mediates the adaptive response to fasting. J Clin Invest 1999;103:1489-98.

25. Harada N, Oda Z, Hara Y, et al. Hepatic de novo lipogenesis is present in liver-specific ACC1-deficient mice. Mol Cell Biol 2007;27:1881-8.

26. Joseph JW, Odegaard ML, Ronnebaum SM, et al. Normal flux through ATP-citrate lyase or fatty acid synthase is not required for glucose-stimulated insulin secretion. J Biol Chem 2007;282:31592-600.

27. Kuhajda FP. Fatty-acid synthase and human cancer: new perspectives on its role in tumor biology. Nutrition 2000;16:202-8.

28. Kuhajda FP, Katumuluwa AI, Pasternack GR. Expression of haptoglobin-related protein and its potential role as a tumor antigen. Proc Natl Acad Sci U S A 1989;86:1188-92.

29. Kuhajda FP, Piantadosi S, Pasternack GR. Haptoglobin-related protein (Hpr) epitopes in breast cancer as a predictor of recurrence of the disease. N Engl J Med 1989;321:636-41.

30. Kuhajda FP, Jenner K, Wood FD, et al. Fatty Acid Synthesis: A Potential Selective Target for Antineoplastic Therapy. Proc Natl Acad Sci U S A 1994;91:6379-83.

31. Jensen V, Ladekarl M, Holm-Nielsen P, Melsen F, Soerensen FB. The prognostic value of oncogenic antigen 519 (OA-519) expression and proliferative activity detected by antibody MIB-1 in node-negative breast cancer. J Pathol 1995;176:343-52.

32. Alo PL, Visca P, Marci A, et al. Expression of fatty acid synthase (FAS) as a predictor of recurrence in stage I breast carcinoma patients. Cancer 1996;77:474-82.

33. Alo PL, Visca P, Trombetta G, et al. Fatty acid synthase (FAS) predictive strength in poorly differentiated early breast carcinomas. Tumori 1999;85:35-40.

28

34. Shurbaji MS, Kuhajda FP, Pasternack GR, Thurmond TS. Expression of oncogenic antigen 519 (OA-519) in prostate cancer is a potential prognostic indicator. Am J Clin Pathol 1992;97:686-91.

35. Epstein JI, Carmichael M, Partin AW. OA-519 (fatty acid synthase) as an independent predictor of pathologic state in adenocarcinoma of the prostate. Urology 1995;45:81-6.

36. Shurbaji MS, Kalbfleisch JH, Thurmond TS. Immunohistochemical detection of a fatty acid synthase (OA-519) as a predictor of progression of prostate cancer. Hum Pathol 1996;27:917-21.

37. Pizer ES, Pflug BR, Bova GS, et al. Increased fatty acid synthase as a therapeutic target in androgen-independent prostate cancer progression. Prostate 2001;47:102-10.

38. Rossi S, Graner E, Febbo P, et al. Fatty acid synthase expression defines distinct molecular signatures in prostate cancer. Mol Cancer Res 2003;1:707-15.

39. Gansler TS, Hardman W, 3rd, Hunt DA, Schaffel S, Hennigar RA. Increased expression of fatty acid synthase (OA-519) in ovarian neoplasms predicts shorter survival. Hum Pathol 1997;28:686-92.

40. Alo PL, Visca P, Framarino ML, et al. Immunohistochemical study of fatty acid synthase in ovarian neoplasms. Oncol Rep 2000;7:1383-8.

41. Innocenzi D, Alo PL, Balzani A, et al. Fatty acid synthase expression in melanoma. J Cutan Pathol 2003;30:23-8.

42. Kapur P, Rakheja D, Roy LC, Hoang MP. Fatty acid synthase expression in cutaneous melanocytic neoplasms. Mod Pathol 2005;18:1107-12.

43. Camassei FD, Jenkner A, Rava L, et al. Expression of the lipogenic enzyme fatty acid synthase (FAS) as a predictor of poor outcome in nephroblastoma: an interinstitutional study. Med Pediatr Oncol 2003;40:302-8.

44. Camassei FD, Cozza R, Acquaviva A, et al. Expression of the lipogenic enzyme fatty acid synthase (FAS) in retinoblastoma and its correlation with tumor aggressiveness. Invest Ophthalmol Vis Sci 2003;44:2399-403.

45. Visca P, Sebastiani V, Pizer ES, et al. Immunohistochemical expression and prognostic significance of FAS and GLUT1 in bladder carcinoma. Anticancer Res 2003;23:335-9.

46. Alo PL, Amini M, Piro F, et al. Immunohistochemical expression and prognostic significance of fatty acid synthase in pancreatic carcinoma. Anticancer Res 2007;27:2523-7.

47. Takahiro T, Shinichi K, Toshimitsu S. Expression of fatty acid synthase as a prognostic indicator in soft tissue sarcomas. Clin Cancer Res 2003;9:2204-12.

48. Visca P, Sebastiani V, Botti C, et al. Fatty acid synthase (FAS) is a marker of increased risk of recurrence in lung carcinoma. Anticancer Res 2004;24:4169-73.

49. Sebastiani V, Visca P, Botti C, et al. Fatty acid synthase is a marker of increased risk of recurrence in endometrial carcinoma. Gynecol Oncol 2004;92:101-5.

50. Alo PL, Galati GM, Sebastiani V, et al. Fatty acid synthase expression in Paget's disease of the vulva. Int J Gynecol Pathol 2005;24:404-8.

51. Rashid A, Pizer ES, Moga M, et al. Elevated expression of fatty acid synthase and fatty acid synthetic activity in colorectal neoplasia. Am J Pathol 1997;150:201-8.

29

52. Nemoto T, Terashima S, Kogure M, et al. Overexpression of fatty acid synthase in oesophageal squamous cell dysplasia and carcinoma. Pathobiology 2001;69:297-303.

53. Silva SD, Perez DE, Alves FA, et al. ErbB2 and fatty acid synthase (FAS) expression in 102 squamous cell carcinomas of the tongue: Correlation with clinical outcomes. Oral Oncology 2008:doi:10.1016/j.oraloncology.2007.06.008.

54. Alo PL, Visca P, Mazzaferro S, et al. Immunohistochemical study of fatty acid synthase, Ki67, proliferating cell nuclear antigen, and p53 expression in hyperplastic parathyroids. Ann Diagn Pathol 1999;3:287-93.

55. Kusakabe T, Nashimoto A, Honma K, Suzuki T. Fatty acid synthase is highly expressed in carcinoma, adenoma and in regenerative epithelium and intestinal metaplasia of the stomach. Histopathology 2002;40:71-9.

56. Gabrielson EW, Pinn ML, Testa JR, Kuhajda FP. Increased fatty acid synthase is a therapeutic target in mesothelioma. Clin Cancer Res 2001;7:153-7.

57. Zhao W, Kridel S, Thorburn A, et al. Fatty acid synthase: a novel target for antiglioma therapy. Br J Cancer 2006;95:869-78.

58. Yahagi N, Shimano H, Hasegawa K, et al. Co-ordinate activation of lipogenic enzymes in hepatocellular carcinoma. European Journal of Cancer 2005;41:1316-22.

59. Swinnen JV, Roskams T, Joniau S, et al. Overexpression of fatty acid synthase is an early and common event in the development of prostate cancer. Int J Cancer 2002;98:19-22.

60. Myers RB, Oelschlager DK, Weiss HL, Frost AR, Grizzle WE. Fatty acid synthase: an early molecular marker of progression of prostatic adenocarcinoma to androgen independence. J Urol 2001;165:1027-32.

61. Kridel SJ, Lowther WT, Pemble CWt. Fatty acid synthase inhibitors: new directions for oncology. Expert Opin Investig Drugs 2007;16:1817-29.

62. Szutowicz A, Kwiatkowski J, Angielski S. Lipogenetic and glycolytic enzyme activities in carcinoma and nonmalignant diseases of the human breast. Br J Cancer 1979;39:681-7.

63. Turyn J, Schlichtholz B, Dettlaff-Pokora A, et al. Increased activity of glycerol 3-phosphate dehydrogenase and other lipogenic enzymes in human bladder cancer. Horm Metab Res 2003;35:565-9.

64. Milgraum LZ, Witters LA, Pasternack GR, Kuhajda FP. Enzymes of the fatty acid synthesis pathway are highly expressed in in situ breast carcinoma. Clinical Cancer Research 1997;3:2115-20.

65. Swinnen JV, Vanderhoydonc F, Elgamal AA, et al. Selective activation of the fatty acid synthesis pathway in human prostate cancer. Int J Cancer 2000;88:176-9.

66. Heemers H, Vanderhoydonc F, Roskams T, et al. Androgens stimulate coordinated lipogenic gene expression in normal target tissues in vivo. Mol Cell Endocrinol 2003;205:21-31.

67. Moreau K, Dizin E, Ray H, et al. BRCA1 Affects Lipid Synthesis through Its Interaction with Acetyl-CoA Carboxylase. J Biol Chem 2006;281:3172-81.

30

68. Conde E, Suarez-Gauthier A, Garcia-Garcia E, et al. Specific pattern of LKB1 and phospho-acetyl-CoA carboxylase protein immunostaining in human normal tissues and lung carcinomas. Hum Pathol 2007;38:1351-60.

69. Hillgartner FB, Salati LM, Goodridge AG. Physiological and molecular mechanisms involved in nutritional regulation of fatty acid synthesis. Physiol Rev 1995;75:47-76.

70. Amy CM, Williams-Ahlf B, Naggert J, Smith S. Molecular cloning of the mammalian fatty acid synthase gene and identification of the promoter region. Biochem J 1990;271:675-9.

71. Paulauskis JD, Sul HS. Cloning and expression of mouse fatty acid synthase and other specific mRNAs. Developmental and hormonal regulation in 3T3-L1 cells. J Biol Chem 1988;263:7049-54.

72. Rufo C, Teran-Garcia M, Nakamura MT, et al. Involvement of a unique carbohydrate-responsive factor in the glucose regulation of rat liver fatty-acid synthase gene transcription. J Biol Chem 2001;276:21969-75.

73. Foufelle F, Gouhot B, Pegorier JP, et al. Glucose stimulation of lipogenic enzyme gene expression in cultured white adipose tissue. A role for glucose 6-phosphate. J Biol Chem 1992;267:20543-6.

74. Moustaid N, Beyer RS, Sul HS. Identification of an insulin response element in the fatty acid synthase promoter. J Biol Chem 1994;269:5629-34.

75. Wang D, Sul HS. Insulin stimulation of the fatty acid synthase promoter is mediated by the phosphatidylinositol 3-kinase pathway. Involvement of protein kinase B/Akt. J Biol Chem 1998;273:25420-26.

76. Rangan VS, Oskouian B, Smith S. Identification of an inverted CCAAT box motif in the fatty-acid synthase gene as an essential element for modification of transcriptional regulation by cAMP. J Biol Chem 1996;271:2307-12.

77. Moustaid N, Sul HS. Regulation of expression of the fatty acid synthase gene in 3T3-L1 cells by differentiation and triiodothyronine. J Biol Chem 1991;266:18550-4.

78. Lacasa D, Le Liepvre X, Ferre P, Dugail I. Progesterone stimulates adipocyte determination and differentiation 1/sterol regulatory element-binding protein 1c gene expression. potential mechanism for the lipogenic effect of progesterone in adipose tissue. J Biol Chem 2001;276:11512-16.

79. Teran-Garcia M, Adamson AW, Yu G, et al. Polyunsaturated fatty acid suppression of fatty acid synthase (FASN): evidence for dietary modulation of NF-Y binding to the Fasn promoter by SREBP-1c. Biochem J 2007;402:591-600.

80. Bennett MK, Lopez JM, Sanchez HB, Osborne TF. Sterol regulation of fatty acid synthase promoter. Coordinate feedback regulation of two major lipid pathways. J Biol Chem 1995;270:25578-83.

81. Sakai J, Nohturfft A, Goldstein JL, Brown MS. Cleavage of Sterol Regulatory Element-binding Proteins (SREBPs) at Site-1 Requires Interaction with SREBP Cleavage-activating Protein. Evidence from in vivo competition studies. J Biol Chem 1998;273:5785-93.

82. Magana MM, Osborne TF. Two tandem binding sites for sterol regulatory element binding proteins are required for sterol regulation of fatty-acid synthase promoter. J Biol Chem 1996;271:32689-94.

31

83. Porstmann T, Griffiths B, Chung YL, et al. PKB/Akt induces transcription of enzymes involved in cholesterol and fatty acid biosynthesis via activation of SREBP. Oncogene 2005;24:6465-81.

84. Xu J, Nakamura MT, Cho HP, Clarke SD. Sterol regulatory element binding protein-1 expression is suppressed by dietary polyunsaturated fatty acids. A mechanism for the coordinate suppression of lipogenic genes by polyunsaturated fats. J Biol Chem 1999;274:23577-83.

85. Moon YS, Latasa MJ, Griffin MJ, Sul HS. Suppression of fatty acid synthase promoter by polyunsaturated fatty acids. J Lipid Res 2002;43:691-8.

86. Jump DB, Clarke SD, Thelen A, Liimatta M. Coordinate regulation of glycolytic and lipogenic gene expression by polyunsaturated fatty acids. J Lipid Res 1994;35:1076-84.

87. Adams CM, Reitz J, De Brabander JK, et al. Cholesterol and 25-Hydroxycholesterol Inhibit Activation of SREBPs by Different Mechanisms, Both Involving SCAP and Insigs. J Biol Chem 2004;279:52772-80.

88. Fukuda H, Iritani N, Sugimoto T, Ikeda H. Transcriptional regulation of fatty acid synthase gene by insulin/glucose, polyunsaturated fatty acid and leptin in hepatocytes and adipocytes in normal and genetically obese rats. European Journal of Biochemistry 1999;260:505-11.

89. Worgall TS, Sturley SL, Seo T, Osborne TF, Deckelbaum RJ. Polyunsaturated Fatty Acids Decrease Expression of Promoters with Sterol Regulatory Elements by Decreasing Levels of Mature Sterol Regulatory Element-binding Protein. J Biol Chem 1998;273:25537-40.

90. Sabine JR, Abraham S, Chaikoff IL. Control of lipid metabolism in hepatomas: insensitivity of rate of fatty acid and cholesterol synthesis by mouse hepatoma BW7756 to fasting and to feedback control. Cancer Research 1967;27:793-9.

91. Chang Y, Wang J, Lu X, Thewke DP, Mason RJ. KGF induces lipogenic genes through a PI3K and JNK/SREBP-1 pathway in H292 cells. J Lipid Res 2005;46:2624-35.

92. Swinnen JV, Heemers H, Deboel L, et al. Stimulation of tumor-associated fatty acid synthase expression by growth factor activation of the sterol regulatory element-binding protein pathway. Oncogene 2000;19:5173-81.

93. Kumar-Sinha C, Ignatoski KW, Lippman ME, Ethier SP, Chinnaiyan AM. Transcriptome analysis of HER2 reveals a molecular connection to fatty acid synthesis. Cancer Research 2003;63:132-9.

94. Yoon S, Lee MY, Park SW, et al. Up-regulation of acetyl-CoA carboxylase alpha and fatty acid synthase by human epidermal growth factor receptor 2 at the translational level in breast cancer cells. J Biol Chem 2007;282:26122-31.

95. Menendez JA, Vellon L, Mehmi I, et al. Inhibition of fatty acid synthase (FAS) suppresses HER2/neu (erbB-2) oncogene overexpression in cancer cells. Proc Natl Acad Sci U S A 2004;101:10715-20.

96. Yeh S, Lin H-K, Kang H-Y, et al. From HER2/Neu signal cascade to androgen receptor and its coactivators: A novel pathway by induction of androgen target genes through MAP kinase in prostate cancer cells. Proc Natl Acad Sci U S A 1999;96:5458-63.

32

97. Mulholland DJ, Dedhar S, Wu H, Nelson CC. PTEN and GSK3beta: key regulators of progression to androgen-independent prostate cancer. Oncogene 2006;25:329-37.

98. Blanco-Aparicio C, Renner O, Leal JFM, Carnero A. PTEN, more than the AKT pathway. Carcinogenesis 2007;28:1379-86.

99. Wang S, Gao J, Lei Q, et al. Prostate-specific deletion of the murine Pten tumor suppressor gene leads to metastatic prostate cancer. Cancer Cell 2003;4:209-21.

100. Van de Sande T, De Schrijver E, Heyns W, Verhoeven G, Swinnen JV. Role of the phosphatidylinositol 3'-kinase/PTEN/Akt kinase pathway in the overexpression of fatty acid synthase in LNCaP prostate cancer cells. Cancer Research 2002;62:642-6.

101. Van de Sande T, Roskams T, Lerut E, et al. High-level expression of fatty acid synthase in human prostate cancer tissues is linked to activation and nuclear localization of Akt/PKB. J Pathol 2005;206:214-9.

102. Wang HQ, Altomare DA, Skele KL, et al. Positive feedback regulation between AKT activation and fatty acid synthase expression in ovarian carcinoma cells. Oncogene 2005;24:3574-82.

103. Yang YA, Han WF, Morin PJ, Chrest FJ, Pizer ES. Activation of fatty acid synthesis during neoplastic transformation: role of mitogen-activated protein kinase and phosphatidylinositol 3-kinase. Exp Cell Res 2002;279:80-90.

104. Ogino S, Brahmandam M, Cantor M, et al. Distinct molecular features of colorectal carcinoma with signet ring cell component and colorectal carcinoma with mucinous component. Mod Pathol 2006;19:59-68.

105. Ogino S, Kawasaki T, Ogawa A, et al. Fatty acid synthase overexpression in colorectal cancer is associated with microsatellite instability, independent of CpG island methylator phenotype. Hum Pathol 2007;38:842-9.

106. Chalbos D, Chambon M, Ailhaud G, Rochefort H. Fatty acid synthetase and its mRNA are induced by progestins in breast cancer cells. J Biol Chem 1987;262:9923-6.

107. Menendez JA, Oza BP, Colomer R, Lupu R. The estrogenic activity of synthetic progestins used in oral contraceptives enhances fatty acid synthase-dependent breast cancer cell proliferation and survival. Int J Oncol 2005;26:1507-15.

108. Pizer ES, Lax SF, Kuhajda FP, Pasternack GR, Kurman RJ. Fatty acid synthase expression in endometrial carcinoma: correlation with cell proliferation and hormone receptors. Cancer 1998;83:528-37.

109. Swinnen JV, Esquenet M, Goossens K, Heyns W, Verhoeven G. Androgens stimulate fatty acid synthase in the human prostate cancer cell line LNCaP. Cancer Research 1997;57:1086-90.

110. Swinnen JV, Ulrix W, Heyns W, Verhoeven G. Coordinate regulation of lipogenic gene expression by androgens: evidence for a cascade mechanism involving sterol regulatory element binding proteins. Proc Natl Acad Sci U S A 1997;94:12975-80.

111. Heemers H, Vanderhoydonc F, Heyns W, Verhoeven G, Swinnen JV. Progestins and androgens increase expression of Spot 14 in T47-D breast tumor cells. Biochem Biophys Res Commun 2000;269:209-12.

33

112. Heemers H, Maes B, Foufelle F, et al. Androgens stimulate lipogenic gene expression in prostate cancer cells by activation of the sterol regulatory element-binding protein cleavage activating protein/sterol regulatory element-binding protein pathway. Mol Endocrinol 2001;15:1817-28.

113. Graner E, Tang D, Rossi S, et al. The isopeptidase USP2a regulates the stability of fatty acid synthase in prostate cancer. Cancer Cell 2004;5:253-61.

114. Egner R, Thumm M, Straub M, et al. Tracing intracellular proteolytic pathways. Proteolysis of fatty acid synthase and other cytoplasmic proteins in the yeast Saccharomyces cerevisiae. J Biol Chem 1993;268:27269-76.

115. Shah US, Dhir R, Gollin SM, et al. Fatty acid synthase gene overexpression and copy number gain in prostate adenocarcinoma. Human Pathology 2006;37:401-9.

116. Thupari JN, Landree LE, Ronnett GV, Kuhajda FP. C75 increases peripheral energy utilization and fatty acid oxidation in diet-induced obesity. Proc Natl Acad Sci U S A 2002;99:9498-502.

117. Resh MD. Trafficking and signaling by fatty-acylated and prenylated proteins. Nat Chem Biol 2006;2:584-90.

118. Swinnen JV, Van Veldhoven PP, Timmermans L, et al. Fatty acid synthase drives the synthesis of phospholipids partitioning into detergent-resistant membrane microdomains. Biochem Biophys Res Commun 2003;302:898-903.

119. Freeman MR, Cinar B, Lu ML. Membrane rafts as potential sites of nongenomic hormonal signaling in prostate cancer. Trends in Endocrinology and Metabolism 2005;16:273-9.

120. Freeman MR, Cinar B, Kim J, et al. Transit of hormonal and EGF receptor-dependent signals through cholesterol-rich membranes. Steroids 2007;72:210-7.

121. Molecular Biology of the Cell. New York: Garland Science, 2002. 122. van der Sanden MH, Houweling M, van Golde LM, Vaandrager AB. Inhibition of

phosphatidylcholine synthesis induces expression of the endoplasmic reticulum stress and apoptosis-related protein CCAAT/enhancer-binding protein-homologous protein (CHOP/GADD153). Biochem J 2003;369:643-50.

123. Reimold AM, Etkin A, Clauss I, et al. An essential role in liver development for transcription factor XBP-1. Genes Dev 2000;14:152-7.

124. Lee AH, Chu GC, Iwakoshi NN, Glimcher LH. XBP-1 is required for biogenesis of cellular secretory machinery of exocrine glands. Embo J 2005;24:4368-80.

125. Sriburi R, Jackowski S, Mori K, Brewer JW. XBP1: a link between the unfolded protein response, lipid biosynthesis, and biogenesis of the endoplasmic reticulum. J Cell Biol 2004;167:35-41.

126. Sriburi R, Bommiasamy H, Buldak GL, et al. Coordinate regulation of phospholipid biosynthesis and secretory pathway gene expression in XBP-1(S)-induced endoplasmic reticulum biogenesis. J Biol Chem 2007;282:7024-34.

127. Little JL, Wheeler FB, Fels DR, Koumenis C, Kridel SJ. Inhibition of fatty acid synthase induces endoplasmic reticulum stress in tumor cells. Cancer Research 2007;67:1262-9.

128. Ron D, Walter P. Signal integration in the endoplasmic reticulum unfolded protein response. Nat Rev Mol Cell Biol 2007;8:519-29.

129. Calfon M, Zeng H, Urano F, et al. IRE1 couples endoplasmic reticulum load to secretory capacity by processing the XBP-1 mRNA. Nature 2002;415:92-6.

34

130. Lee A-H, Iwakoshi NN, Glimcher LH. XBP-1 Regulates a Subset of Endoplasmic Reticulum Resident Chaperone Genes in the Unfolded Protein Response. Mol Cell Biol 2003;23:7448-59.

131. Harding HP, Zhang Y, Ron D. Protein translation and folding are coupled by an endoplasmic-reticulum-resident kinase. Nature 1999;397:271-74.

132. Urano F, Wang X, Bertolotti A, et al. Coupling of stress in the ER to activation of JNK protein kinases by transmembrane protein kinase IRE1. Science 2000;287:664-6.

133. Haze K, Yoshida H, Yanagi H, Yura T, Mori K. Mammalian Transcription Factor ATF6 Is Synthesized as a Transmembrane Protein and Activated by Proteolysis in Response to Endoplasmic Reticulum Stress. Mol Biol Cell 1999;10:3787-99.

134. Thuerauf DJ, Morrison L, Glembotski CC. Opposing Roles for ATF6{alpha} and ATF6{beta} in Endoplasmic Reticulum Stress Response Gene Induction. J Biol Chem 2004;279:21078-84.

135. Harding HP, Zhang Y, Bertolotti A, Zeng H, Ron D. Perk is essential for translational regulation and cell survival during the unfolded protein response. Mol Cell 2000;5:897-904.

136. Harding HP, Novoa I, Zhang Y, et al. Regulated Translation Initiation Controls Stress-Induced Gene Expression in Mammalian Cells. Molecular Cell 2000;6:1099-108.

137. Bertolotti A, Zhang Y, Hendershot LM, Harding HP, Ron D. Dynamic interaction of BiP and ER stress transducers in the unfolded-protein response. Nat Cell Biol 2000;2:326-32.

138. Lu PD, Harding HP, Ron D. Translation reinitiation at alternative open reading frames regulates gene expression in an integrated stress response. J Cell Biol 2004;167:27-33.

139. Vattem KM, Wek RC. Reinitiation involving upstream ORFs regulates ATF4 mRNA translation in mammalian cells. Proceedings of the National Academy of Sciences 2004;101:11269-74.

140. Harding HP, Zhang Y, Zeng H, et al. An Integrated Stress Response Regulates Amino Acid Metabolism and Resistance to Oxidative Stress. Molecular Cell 2003;11:619-33.

141. Rutkowski DT, Kaufman RJ. That which does not kill me makes me stronger: adapting to chronic ER stress. Trends Biochem Sci 2007;32:469-76.

142. Schroder M, Kaufman RJ. The mammalian unfolded protein response. Annu Rev Biochem 2005;74:739-89.

143. Ma Y, Hendershot LM. The unfolding tale of the unfolded protein response. Cell 2001;107:827-30.

144. Schroder M, Kaufman RJ. Divergent roles of IRE1alpha and PERK in the unfolded protein response. Curr Mol Med 2006;6:5-36.

145. Kimata Y, Oikawa D, Shimizu Y, Ishiwata-Kimata Y, Kohno K. A role for BiP as an adjustor for the endoplasmic reticulum stress-sensing protein Ire1. J Cell Biol 2004;167:445-56.

146. Credle JJ, Finer-Moore JS, Papa FR, Stroud RM, Walter P. Inaugural Article: On the mechanism of sensing unfolded protein in the endoplasmic reticulum. Proceedings of the National Academy of Sciences 2005;102:18773-84.

35

147. Shamu CE, Walter P. Oligomerization and phosphorylation of the Ire1p kinase during intracellular signaling from the endoplasmic reticulum to the nucleus. Embo J 1996;15:3028-39.

148. Yoneda T, Imaizumi K, Oono K, et al. Activation of caspase-12, an endoplastic reticulum (ER) resident caspase, through tumor necrosis factor receptor-associated factor 2-dependent mechanism in response to the ER stress. J Biol Chem 2001;276:13935-40.

149. Guyton KZ, Xu Q, Holbrook NJ. Induction of the mammalian stress response gene GADD153 by oxidative stress: role of AP-1 element. Biochem J 1996;314:547-54.

150. Wang XZ, Harding HP, Zhang Y, et al. Cloning of mammalian Ire1 reveals diversity in the ER stress responses. Embo J 1998;17:5708-17.

151. Hetz C, Bernasconi P, Fisher J, et al. Proapoptotic BAX and BAK Modulate the Unfolded Protein Response by a Direct Interaction with IRE1{alpha}. Science 2006;312:572-76.

36

CHAPTER II

INHIBITION OF FATTY ACID SYNTHASE INDUCES ER STRESS IN TUMOR CELLS

Joy L. Little, Frances B. Wheeler, Diane R. Fels, Constantinos Koumenis, and Steven J. Kridel

The following manuscript was published in Cancer Research, volume 67, number 3,

pages 1262-1269, 2007, and is reprinted with permission. Stylistic variations are due to

the requirements of the journal. J. L. Little performed all of the experiments described in

this chapter with the exception of 14C-acetate labeling of fatty acid synthesis and one

clonogenic survival assay of PC-3 cells treated with orlistat and thapsigargin which were

performed by F. B. Wheeler. D. R. Fels and C. Koumenis acted in an advisory and

technical capacity. J. L. Little assisted in preparation of and editing the manuscript. Dr. S.

J. Kridel prepared the initial manuscript and acted in an advisory and editorial capacity.

37

II.1 Abstract

Fatty acid synthase (FAS), the cellular enzyme that synthesizes palmitate, is

expressed at high levels in tumor cells and is vital for their survival. Through synthesis of

palmitate, FAS primarily drives the synthesis of phospholipids in tumor cells. In this

study, we tested the hypothesis that the FAS inhibitors induce endoplasmic reticulum

(ER) stress in tumor cells. Treatment of tumor cells with FAS inhibitors induces robust

PERK-dependent phosphorylation of the translation initiation factor eIF2! and

concomitant inhibition of protein synthesis. PERK deficient transformed mouse

embryonic fibroblasts (MEFs) and HT-29 colon carcinoma cells that express a dominant

negative PERK (%C-PERK) are hypersensitive to FAS inhibitor-induced cell death.

Pharmacological inhibition of FAS also induces processing of X-box binding protein-1,

indicating that the IRE1 arm of the ER stress response is activated when FAS is inhibited.

Induction of ER stress is further confirmed by increased expression of the ER stress-

regulated genes CHOP, ATF4 and GRP78. FAS inhibitor-induced ER stress is activated

prior to the detection of caspase 3 and PARP cleavage, primary indicators of cell death,

and orlistat-induced cell death is rescued by co-incubation with the global translation

inhibitor cycloheximide. Lastly, FAS inhibitors cooperate with the ER stress inducer

thapsigargin to enhance tumor cell killing. These results provide the first evidence that

FAS inhibitors induce ER stress and establish an important mechanistic link between

FAS activity and ER function.

38

II.2 Introduction

Fatty acid synthase (FAS) is a multifunctional enzyme that catalyzes the terminal

steps in the synthesis of the 16-carbon fatty acid palmitate in cells (1, 2). In normal tissue

the FAS expression levels are relatively low as fatty acid is generally supplied by dietary

fatty acids. On the other hand, FAS is expressed at significantly higher levels in many

tumors including those of the prostate, breast, colon, ovary and others (3-5). This

expression profile suggests that tumors require higher levels of fatty acids than can be

supplied from circulation. Several reports have demonstrated that FAS expression levels

correlate with tumor progression, aggressiveness and metastasis (5-7). In fact, FAS

expression levels are predictive of the progression from organ-confined prostate cancer to

metastatic prostate cancer (6), indicating that FAS provides a metabolic advantage to

tumor cells. Because of the strong link between FAS expression and cancer, FAS has

become an attractive target for therapeutic intervention.

The functional connection between FAS and tumor progression has been provided

by the discovery and design of small molecule drugs that inhibit the catalytic activity of

FAS (8, 9). Cerulenin and C75, which target the keto-acyl synthase domain of FAS, were

the first small molecules to be described as inhibitors of FAS activity in human tumor

cells. These pharmacological agents inhibit FAS activity and induce cell death in many

tumor cell lines in vitro (5, 7). The compounds are also effective at inhibiting the growth

of human tumor xenografts in vivo and have chemopreventive abilities (10-12). We were

the first to describe orlistat as an inhibitor of the thioesterase domain of FAS (13).

Orlistat inhibits FAS activity and induces cell death in a variety of tumor cell lines and is

39

able to effectively inhibit the growth of prostate tumor xenografts in mice (13-15). The

data linking FAS function and tumor cell survival emphasizes the relevance of FAS as an

attractive anti-tumor target. The importance of fatty acid synthesis in tumor cells is

further underscored by data demonstrating that pharmacological and genetic inhibition of

two upstream enzymes in the fatty acid synthesis pathway, ATP citrate lyase (ACL) and

acetyl CoA carboxylase (ACC), also induces cell death in tumor cell lines (16-18).

Because FAS is a target for therapeutic intervention, it is important to fully

understand the role of FAS in tumor cells as well as the anti-tumor effects of FAS

inhibitors. Given that the endoplasmic reticulum (ER) is the major site for phospholipid

synthesis in cells, it is not surprising that previous studies have identified a link between

pathways that regulate lipid synthesis and the ER stress response (19-21). Fatty acid

synthesis in general, and FAS activity in particular, drives phospholipid synthesis which

primarily occurs in the ER (22). Because of the direct connection between FAS activity

and phospholipid synthesis, we tested the hypothesis that pharmacological blockade of

FAS activity might induce ER stress in tumor cells (22). The data presented herein

demonstrates for the first time that inhibition of FAS induces ER stress specifically in a

variety of tumor cells and not in normal cells. Importantly, we also demonstrate that FAS

inhibitors cooperate with a known ER stress inducer, thapsigargin, to induce cell death.

The data also provide evidence that FAS inhibitors might be combined with PERK

inhibitors to more effectively treat cancer. The evidence suggests that increased FAS

expression in tumor cells is important for ER function to maintain membrane biogenesis

and suggests a role for ER stress in the anti-tumor effects of FAS inhibitors.

40

II.3 Materials and Methods

Materials. The PC-3, DU145, HT-29, HeLa, and FS-4 cell lines were obtained from

American Type Culture Collection (Manassas, VA). Cell culture medium and

supplements were from Invitrogen (Carlsbad, CA). Antibodies against eIF2!, phospho-

eIF2!, cleaved caspase 3, and cleaved PARP were from Cell Signaling Technologies

(Beverly, MA). Antibody against fatty acid synthase was from BD Transduction Labs

(San Diego, CA). Antibody against "-tubulin was from NeoMarkers (Fremont, CA).

TRIzol was from Invitrogen (Carlsbad, CA). Avian Myleoblastosis Virus (AMV)

Reverse Transcriptase and Taq Polymerase were from Promega (Madison, WI). 35S-

methionine and 14C-acetate were purchased from GE Healthcare (formerly Amersham

Biosciences, Piscataway, NJ). Oligonucleotides were synthesized by Integrated DNA

Technologies (Coralville, IA), except for those designed for siRNA which were

synthesized by Dharmacon (Lafayette, Co). All other reagents were purchased from

Sigma (St. Louis, MO), Calbiochem (San Diego, CA) or BioRad (Hercules, CA).

Cell culture and drug treatments. Prostate tumor cell lines were maintained in RPMI

1640 supplemented with 10% fetal bovine serum at 37#C and 5% CO2. Wild-type and

PERK-/- mouse embryonic fibroblasts (MEFs), obtained from David Ron, M.D. (Skirball

Institute for Biomolecular Medicine, New York University School of Medicine, New

York, NY), HeLa cervical cancer cells, and FS-4 human foreskin fibroblasts were

maintained in DMEM-high glucose supplemented with 10% fetal bovine serum. HT-29

colon carcinoma cells were maintained in McCoy’s 5A media supplemented with 10%

FBS. HT-29 cells expressing the pBabe-puro empty vector or the pBabe-puro-%C-PERK

41

construct were maintained with 1 µg/ml puromycin and supplemented with 20% FBS,

non-essential amino acids and 2-mercaptoethanol. Cells were treated for the indicated

times and drug concentrations as indicated. Orlistat was extracted from capsules in EtOH

as described previously and stored at -80#C (13). Further dilutions were made in dimethyl

sulfoxide (DMSO).

Generation of "C-PERK expressing cells. To generate human tumor cells with deficient

PERK signaling, HT-29 cells seeded in 6-well plates were transfected with 1 µg of

pBabe-puro or pBabe-puro-%C-PERK using Lipofectamine (Invitrogen). These plasmids

have been described previously (23). Stable populations of each construct were selected

by incubating transfected cells with 3 µg/ml puromycin for 48 hours. The transfected cell

populations were then maintained in 1 µg/ml puromycin for subsequent experiments in

the media described above.

Immunoblot analysis. Cells were harvested after the indicated treatments, washed with

ice-cold phosphate-buffered saline, and lysed in buffer containing 1% Triton X-100 and a

complete protease, kinase, and phosphatase inhibitor cocktail. Protein samples were

electrophoresed through 7.5%, 10% or 12% SDS-polyacrylamide gels and transferred to

nitrocellulose, except for blots to detect phospho-eIF2! and eIF2!, which were

transferred to Immobilon-P membrane (PVDF). Immunoreactive bands were detected by

enhanced chemiluminescence (PerkinElmer, Boston, MA).

42

Metabolic labeling of protein and fatty acid synthesis. To measure fatty acid synthesis, 1

×105 cells per well were seeded in 24-well plates. Cells were treated with C75 (10

µg/ml), orlistat (25, 50 µmol/L), or cerulenin (5, 10 µg/ml) for 2 hours. 14C-acetate (1

µCi) was added to each well for two hours. Cells were collected, washed and lipids were

extracted and quantified as previously described (13). To measure new protein synthesis,

PC-3 cells were seeded in 6-well plates. Orlistat (50 µmol/L) and thapsigargin (1 µmol/L)

were added for the indicated times. After incubation with orlistat or thapsigargin, the

cells were switched to methionine deficient medium while maintaining the drug

concentrations. Methionine deficient medium supplemented with 100 $Ci/ml 35S-

methionine was added to the cells for thirty minutes to label newly synthesized proteins.

After the labeling period, cells were washed, lysed and samples were resolved by

electrophoresis through a 10%-SDS-polyacrylamide gel. The gel was then stained with

Coomassie, dried and relative protein synthesis of each sample was quantified after

scanning with a Typhoon 9210 (Amersham) using ImageQuant software.

Clonogenic survival assays. Cells were plated in 6-well plates at low density depending

on the individual cell type. PC-3 cells were plated at a density of 800 cells per well,

except for the experiment combining C75 with thapsigargin, for which PC-3 cells were

plated at 3000 cells per well. HT-29 and MEF cells were plated at a density of 400 cells

per well. Human tumor cells were plated 48 hours prior to each experiment, while MEFs

were plated 24 hours prior to treatment. Fresh medium containing the indicated drugs was

added at the indicated concentrations for 12-20 hours as indicated. The media was then

removed, the wells were washed and fresh medium was added. Plates were incubated

43

until macroscopic colonies were formed. To visualize colonies the wells were washed

twice with ice-cold phosphate-buffered saline and fixed for 10 minutes with a 10%

methanol, 10% acetic acid solution. Colonies were stained with a 0.4% crystal violet,

20% methanol solution for 10 minutes. The crystal violet solution was removed, the wells

were washed with water to remove excess dye, and dried at room temperature overnight.

Colonies were quantified by counting and by solubilization in 33% acetic acid followed

by spectrophotometric analysis at 540 nm. Survival of treated cells was normalized

relative to vehicle treated cells and statistical significance was determined by two-tailed

Student's t tests.

Detection of XBP-1 splicing and ATF4, GRP78, CHOP, and GADD34 expression. Cells

were exposed to the various drug treatments or transfected with siRNA for the indicated

times. Total RNA was isolated from cells using TRIzol according to the manufacturer’s

directions. cDNA was generated from 2 $g of total RNA using AMV-reverse

transcriptase. XBP-1 was amplified by polymerase chain reaction (PCR) with Taq

polymerase using the oligonucleotides AAACAGAGTAGCAGCTCAGACTGC (sense)

and TCCTTCTGGGTAGACCTCTGGGAG (antisense). The XBP-1 products were

resolved on 2% Tris-acetate-EDTA agarose gels and imaged on the Typhoon 9210 at

610nm. The expression of CHOP, ATF4, GRP78, and GADD34 was determined by

semi-quantitative PCR using RNA collected as described above. Multiple cycles were

tested for each gene to determine the optimum cycles in the linear range. The

oligonucleotide sequences used were: CHOP, CAGAACCAGCAGAGGTCACA and

AGCTGTGCCACTTTCCTTTC; GRP78, CTGGGTACATTTGATCTGACTGG and

44

GCATCCTGGTGGCTTTCCAGCCATTC; ATF4, CTTACGTTGCCATGATCCCT and

CTTCTGGCGGTACCTAGTGG; and GADD34, GTGGAAGCAGTAAAAGGAGCAG

and CAGCAACTCCCTCTTCCTCG. The CHOP, GRP78 and ATF4 products were

resolved on 1% Tris-acetate-EDTA agarose gels and imaged on the Typhoon 9210 at

610nm.

Suppression of FAS expression with siRNA. A paired siRNA oligonucleotide against the

FAS gene (FAS1 sense, GUAGGCCUUCCACUCCUAUU) and one siRNA against

luciferase as a negative control (Luc sense, CUUACGUGAUACUUCGAUU) were

designed and synthesized by Dharmacon. The individual siRNAs (30 nmol/L) were

transfected into cells at plating with siPORT NeoFX transfection reagent (Ambion,

Austin, TX) according to manufacturers instructions. Cells were collected at indicated

times after transfection then harvested for RNA to perform RT-PCR or protein for

immunoblot analysis.

45

II.4 Results

Pharmacological inhibition of FAS induces phosphorylation of eIF2! in tumor cells.

Several studies have demonstrated that lipid composition is important for maintaining ER

function (19-21, 24, 25). Other studies have demonstrated that FAS drives phospholipid

synthesis in tumor cells (22). Because of this fact, we hypothesized that FAS inhibitors

might induce ER stress. One hallmark of ER stress is the PERK-dependent

phosphorylation of the translation initiation factor eIF2!. We first examined the

phosphorylation status of eIF2! in cells treated with three different pharmacological

inhibitors of FAS (Figure 1A). PC-3 cells were treated with orlistat (12.5-50 µmol/L, left)

or cerulenin (5 or 10 µg/ml, middle) for 16 hours, or C75 (10 µg/ml) for 8-24 hours

(right). Each FAS inhibitor induced robust phosphorylation of eIF2! at each

concentration after 16 hours of treatment, as did thapsigargin (data not shown). All three

inhibitors induce eIF2! phosphorylation, similarly, regardless of tumor cell type tested

(data not shown). Likewise, fatty acid synthesis was inhibited to similar degrees by each

treatment, as measured by 14C-acetate incorporation into total cellular lipids (Figure 1B,

left). Because phosphorylation of eIF2! leads to inhibition of protein synthesis, we

performed a 35S-methionine labeling experiment to measure levels of newly synthesized

proteins in cells treated with orlistat. PC-3 cells were treated with orlistat (50 µmol/L) for

12 and 24 hours or thapsigargin (1 µmol/L) as a positive control for 1 hour (Figure 1B,

right). Orlistat treatment reduced protein synthesis by 56% after 12 hours and by 73% at

24 hours, similar to treatment with thapsigargin. Therefore, orlistat treatment is sufficient

to induce phosphorylation of eIF2! and, subsequently, inhibit protein synthesis. To

further confirm our findings, a genetic approach was also used to inhibit FAS expression.

46

Figure 1. Fatty acid synthase inhibitors induce phosphorylation of eIF2! in tumor cells. A, PC-3 cells were treated with the indicated concentrations of orlistat (left) or cerulenin (middle) for 16 hours, or C75 (10 µg/ml) for 8-24 hours (right). Samples were resolved by SDS-PAGE, transferred to polyvinylidene difluoride and the membrane was probed with antibodies specific for phospho-eIF2!, total eIF2! and "-tubulin. B, PC-3 cells were treated for two hours with C75 (10 µg/ml), orlistat (25 µmol/L, 50µmol/L), or cerulenin (5 µg/ml, 10 µg/ml), then incubated with 14C-acetate (1 µCi) for two hours. Cells were collected, washed and lipids were extracted and quantified relative to vehicle-treated control (left). PC-3 cells were treated with orlistat (50 µmol/L) for the indicated times or thapsigargin (Tgn, 1 µmol/L) for one hour and then pulsed with 10 µCi 35S-methionine for thirty minutes. Protein aliquots were then resolved by SDS-PAGE and new protein synthesis was quantified by scanning on a Typhoon 9210. Quantification is relative to vehicle treated control (right). C, PC-3 cells were transfected with siRNA against FAS or luciferase (Luc) for the indicated times and analyzed by immunoblot. D, FS-4 normal foreskin fibroblasts were treated with orlistat (25 µmol/L) for 24 hours or Tgn (1 µmol/L) for one hour side by side with PC3 cells and prepared for immunoblot analysis.

Orlistat (µM)0 12.5 25 50

eIF2!

"-tubulin

p-eIF2!

A

D

Cerulenin (µg/ml)

eIF2!

"-tubulin

p-eIF2!

eIF2!

"-tubulin

p-eIF2!

C75 10µg/ml (hrs)0 8 16 24

Luc FAS Luc FAS 48 hrs 72 hrs

siRNA

p-eIF2!

"-actin

FAS

100 44 27 32Relative protein synthesis

0 12 24 TgnOrl (hrs)

100 44 27 32Relative protein synthesis

0 12 24 TgnOrl (hrs)B

0 16 24 Tgn 0 16 24 Tgn

PC-3 FS-4

p-eIF2!

"-actin

Orl (hrs)Orl (hrs)0 16 24 Tgn 0 16 24 Tgn

PC-3 FS-4

p-eIF2!

"-actin

Orl (hrs)Orl (hrs)

C

C75 Orlistat Cerulenin

14C

-ace

tate

inco

rpor

atio

n

0 5 10

eIF2!

"-tubulin

p-eIF2!

eIF2!

"-tubulin

p-eIF2!

DMSO 10 µg/ml 25µM 50µM 5µg/ml 10 µg/ml0

0.10.20.30.40.50.60.70.80.9

11.1

PC-3

47

PC-3 cells were transfected with FAS-specific siRNA or siRNA against luciferase as a

negative control. Immunoblot analysis demonstrated a nearly 70% reduction of FAS

protein in the samples 48 hours after transfection which continued through 72 hours

(Figure 1C). Consistent with our findings using pharmacological inhibitors, reduction of

FAS expression levels resulted in the detection of significant levels of phosphorylated

eIF2! at 72 hours (Figure 1C). Conversely, treatment of normal human foreskin FS-4

fibroblasts with the FAS inhibitor orlistat did not result in phosphorylation of eIF2a

(Figure 1D). Collectively these data indicate that eIF2! phosphorylation induced by FAS

inhibition is, indeed, specific to both FAS and tumor cells.

PERK mediates eIF2! phosphorylation in response to orlistat treatment. There are four

known eIF2! kinases: PERK, GCN2, PKR and HRI; but PERK is the kinase that

phosphorylates eIF2! during the ER stress response (26, 27). To determine whether

PERK is the kinase responsible for the phosphorylation eIF2! in response to FAS

inhibition, wild-type and PERK-/- mouse embryonic fibroblasts (MEFs) transformed with

Ki-RasV12 were obtained and tested for their sensitivity to orlistat (28). The wild-type and

PERK-/- MEFs were treated with orlistat (12.5 µmol/L) for 8, 16 and 24 hours (Figure

2A) or treated with thapsigargin (1 µmol/L) for 1 hour (data not shown). In the wild-type

MEFs, orlistat induced phosphorylation of eIF2! within 8 hours (Figure 2A), consistent

with our findings in prostate tumor cell lines (Figure 1A). On the other hand, no

significant phosphorylation of eIF2! was evident during the same time course of orlistat

treatment in the PERK-deficient cells (Figure 2A). As expected, thapsigargin only

48

induced phosphorylation of eIF2! in the wild-type and not the PERK-/- MEFs (data not

shown). These data indicate that FAS inhibition results in PERK-dependent

phosphorylation of eIF2!.

It has been demonstrated that PERK deficient cells are hypersensitive to ER

stress-induced apoptosis (27). Because of this, we tested whether PERK-/- MEFs were

hypersensitive to orlistat-induced cell death using clonogenic survival assays. Wild-type

and PERK-/- MEFs were treated with vehicle, orlistat (25 µmol/L) or thapsigargin (100

nmol/L) for 16 hours (Figure 2B). As expected, the PERK-/- MEFs were hypersensitive

to thapsigargin-induced cell death as demonstrated by a three-fold decrease in clonogenic

survival (p<0.005). Similarly, the PERK-/- MEFs demonstrated hypersensitivity to orlistat

treatment, showing reduced clonogenic survival of wild-type transformed MEFs to 70%

of vehicle treated cells. On the other hand, clonogenic survival was decreased nearly

four-fold to less than 20% (p<0.005) in the PERK-/- MEFs following orlistat treatment.

These data indicate that inhibition of FAS activity induces ER stress which is exacerbated

by loss of PERK.

To further support the results obtained in MEFs, we generated stable populations

of HT-29 colon carcinoma cells transfected with a dominant negative PERK construct

that lacks the kinase domain (%C-PERK) or the corresponding empty vector (23). These

cells were seeded at low density and treated with C75 (9 µg/ml), orlistat (25 µmol/L), or

thapsigargin (10nmol/L) to assess clonogenic survival. As expected, the HT-29 %C-

49

PERK cells were hypersensitive to thapsigargin as demonstrated by a nearly three-fold

reduction in clonogenic survival (Figure 2C, p<0.005). Similarly, the HT-29 %C-PERK

Figure 2. PERK phosphorylates eIF2! is response to, and protects cells against, orlistat treatment. A, Wild-type (WT) and PERK-/- MEFs transformed with Ki-RasV12 were treated with orlistat (12.5 µmol/L) for the indicated times. Samples were analyzed with antibodies specific for phospho-eIF2! and total eIF2!. B, Clonogenic survival assays were performed in WT and PERK-/- MEFs, treated with vehicle, orlistat (25 µmol/L) or Tgn (100 nmol/L) for 16 hours, in triplicate. The surviving fraction was normalized relative to vehicle treated controls. C, HT-29 cells and HT-29/%C-PERK cells were treated with vehicle, orlistat (25 µmol/L), C75 (9 µg/ml) or Tgn (10 nmol/L) for 16 hours, in triplicate. Clonogenic survival was normalized relative to vehicle treated controls and statistical significance was determined by two-tailed Student's t tests.

DMSO C75 Orl Tgn0

0.10.20.30.40.50.60.70.80.9

11.11.2

DMSO Orl Tgn0

0.10.20.30.40.50.60.70.80.9

11.11.2

0 8 16 24 0 8 16 24

eIF2!

p-eIF2!

eIF2!

p-eIF2!

Orl (12.5µM) Orl (12.5µM)WT PERK-/-A

B

C

* *

*

**

(hrs)

WT

PERK-/-

HT-29

#C-PERK

Clo

noge

nic

Surv

ival

Clo

noge

nic

Surv

ival

MEF

HT-29

50

cells were also hypersensitive to both orlistat and C75 compared to the empty-vector

transfected cells. Clonogenic survival was reduced more than two-fold in C75 treated

cells and nearly four-fold in orlistat treated cells (Figure 2C, p<0.005). These results

confirm that PERK function is important for an adaptive response in tumor cells when

FAS activity is inhibited.

Treatment with orlistat induces processing of XBP-1. In addition to the PERK-regulated

arm, the ER stress response can also be mediated by IRE1, a kinase with endonuclease

activity that facilitates splicing of X-box binding protein-1 (XBP-1) mRNA to yield the

splice variant XBP-1(s) during ER stress (29). To determine whether pharmacological

inhibition of FAS also activates the IRE1 pathway, the status of XBP-1 mRNA was

assessed by RT-PCR using oligonucleotides that flank the splice site in the XBP-1

mRNA. Total RNA was collected from PC-3 cells treated with orlistat (50 µmol/L) for 8-

24 hours (Figure 3A) or with cerulenin (5 or 10 µg/ml) for 16 hours (Figure 3B).

Thapsigargin treatment resulted in a loss of the 473 bp product associated with un-spliced

XBP-1 and the appearance of the processed 447 bp form associated with XBP-1(s) that is

produced only in response to ER stress (Figure 3A). Similarly, orlistat treatment resulted

in the appearance of the 447 bp XBP-1(s) product in as few as 8 hours with maximum

processing by 16 hours (Figure 3A). Cerulenin also induced processing of XBP-1 (Figure

3B). To further confirm the role of FAS inhibition in the processing of XBP-1 to XBP-

1(s), HeLa cells were transfected with FAS-specific siRNA or siRNA against luciferase

as a negative control and collected for RT-PCR (Figure 3C). The 447 bp fragment that

corresponds to the ER stress specific XBP-1(s) product was detected at 72 hours in the

51

FAS specific siRNA samples. While PC-3 cells exhibit XBP-1 splicing after both orlistat

and thapsigargin treatment, FS-4 cells exhibited only minor induction of XBP-1 and no

splicing in response to orlistat (Figure 3D). These results suggest that the IRE1 pathway

of the ER stress response is activated in parallel to the PERK pathway when FAS is

inhibited in tumor cells.

Figure 3. FAS inhibitor treatment activates processing of XBP-1. A, PC-3 cells were treated with orlistat (50 µmol/L) for the indicated times or Tgn (500 nmol/L) for 8 hours. B, PC-3 cells were treated with the indicated concentrations of cerulenin for 16 hours or Tgn (500 nmol/L) for 8 hours. C, HeLa cells were transfected with siRNA against FAS or luciferase (Luc) for the indicated times. D, PC-3 and FS- 4 cells were treated with orlistat (50 µmol/L) for 16 hours or Tgn (1 µmol/L) for one hour. Total RNA was collected and RT-PCR was performed as described in experimental procedures. XBP-1 is indicated by the 473 bp product and XBP-1(s) is indicated by the 447 bp fragment.

Inhibition of FAS activity induces expression of ER stress regulated genes. Activation of

the ER stress response induces the expression of a number of genes associated with

Cer ($g/mL)0 5 10 Tgn

Orl (hrs)0 8 16 24 Tgn

"-actin

473 bp, XBP-1447 bp, XBP-1(s)

A

B

"-actin

473 bp, XBP-1447 bp, XBP-1(s)

Mock Luc FAS Luc FAS48 hrs 72 hrs

siRNA

C

"-actin

473 bp, XBP-1447 bp, XBP-1(s)

Con Orl Tgn Con Orl Tgn

PC-3 FS-4

473 bp, XBP-1447 bp, XBP-1(s)

"-actin

D

52

adaptation and cell death, including CHOP, GRP78 and ATF4. CHOP has been

implicated in ER stress-dependent apoptosis and CHOP-/- cells are mildly resistant to

apoptosis following treatment with ER stressing agents (30). The mRNA expression of

CHOP is induced in DU145 cells treated with orlistat (50 µmol/L) or C75 (9 µg/ml)

(Figure 4A). Similar effects were seen in PC-3 cells (data not shown). CHOP mRNA

expression was also induced following siRNA-mediated knockdown of FAS expression

in PC-3 cells (Figure 4B). Increased mRNA expression of CHOP may indicate that ER

stress could play a role in cell death induced by FAS inhibition (30). The mRNA

expression of GRP78, an ER stress regulated chaperone, is also induced in orlistat treated

cells (Figure 4C) (31). Furthermore, mRNA expression of the transcription factor ATF4,

which is dependent on eIF2! phosphorylation, is also induced by orlistat treatment

(Figure 4C). Collectively, the data in Figures 1-4 demonstrate that FAS inhibitors induce

the ER stress response.

Figure 4. Inhibition of FAS activity induces mRNA expression of ER stress regulated genes. A, DU145 cells were treated with vehicle control, orlistat (50 µmol/L, top), C75 (9 µg/ml, bottom), or Tgn (500 nmol/L) for 16 hours. B, PC-3 cells were transfected with siRNA against FAS or luciferase (Luc) for 72 hours. C, PC-3 cells were treated with vehicle control or orlistat (25 µmol/L) for 24 hours or Tgn (1µmol/L) for one hour. Total RNA was collected with TRIzol and semi-quantitative RT-PCR was performed with oligonucleotides specific for CHOP (A and B), GRP78 and ATF4 (C) or "-actin (A-C).

Con Orl TgnA

CHOP

"-actin

Con C75 Tgn

CHOP

"-actin

BLuc FAS

72 hrs siRNA

CHOP

"-actin

Con Orl Tgn

GRP78

"-actin

ATF4

C

53

ER stress is an early event in cells treated with FAS inhibitors. To determine whether

phosphorylation of eIF2! and subsequent indications of the ER stress response events

coincide or precede cell death induced by FAS inhibition, we analyzed the temporal

phosphorylation of eIF2! and markers of caspase activity and cell death. In PC-3 cells

treated with orlistat, phosphorylation of eIF2! was evident at 16 hours of treatment,

while significant cleavage of caspase 3 and PARP are not detectable until 24 and 48

hours, respectively, consistent with previous reports (13). These data indicate that the ER

stress response is induced prior to caspase 3 activation and PARP cleavage. These data

are further supported by the timeline of XBP-1 processing following orlistat treatment

(Figure 3A). Previous studies have demonstrated that inhibition of protein translation

with cycloheximide can ameliorate the effects of ER stress, likely by decreasing protein

burden on the ER (27). Clonogenic survival assays and immunoblot analysis were

performed in PC-3 cells treated with vehicle control, cycloheximide (CHX, 1 µg/ml),

Figure 5. Phosphorylation of eIF2! is an early event in cells treated with FAS inhibitors. A, PC-3 cells were treated with 50 µmol/L orlistat for the indicated times and samples were collected for immunoblot analysis and probed with antibodies specific for phospho-eIF2!, cleaved PARP, cleaved caspase 3, and "-actin. B, PC-3 cells were treated with DMSO, cycloheximide (CHX, 1 µg/ml), orlistat (25 µmol/L) or orlistat with CHX for 16 hours. Clonogenic survival was normalized relative to vehicle treated controls. C, PC-3 cells were treated with DMSO, cycloheximide (1µg/ml), orlistat (25µmol/L), or the combination of orlistat and CHX for 16 hours. Samples were collected for immunoblot analysis and probed with antibodies specific for phospho-eIF2!, total eIF2!, and "-tubulin.

cleaved PARP

"-actin

p-eIF2!

cleaved caspase 3

Orl (50µM)0 16 24 48

A B(hrs)

Clo

noge

nic

Surv

ival

eIF2!

p-eIF2!

"-tubulin

Orl+DMSO Orl CHX

C

DMSO CHX Orl Orl + CHX0

0.10.20.30.40.50.60.70.80.9

11.11.2

54

orlistat (25 µmol/L), or orlistat with CHX (Figure 5B and C). Cycloheximide treatment

rescued clonogenic survival of PC-3 cells treated with orlistat (Figure 5B), and also

inhibited orlistat induced phosphorylation of eIF2! (Figure 5C). These data are consistent

with previous reports on the protective effect of cycloheximide on cells under ER stress

and suggest that reduced protein burden on the ER or reduced expression of a specific

pro-apoptotic factor could be responsible.

Cooperation between FAS inhibitors and thapsigargin. At least one study has

demonstrated that ER stress can have a negative effect on the activity of

chemotherapeutic drugs (32). To determine the effect of ER stress on FAS inhibitor-

induced cell death, clonogenic survival assays, immunoblot, and RT-PCR analysis were

performed on tumor cells treated with orlistat or C75 in combination with the ER

stressing agent thapsigargin (Figure 6A and B). Lower doses of FAS inhibitors and

thapsigargin were used to achieve reduced cell kill by either single agent in order to

maximize the effect of the combination of the two drugs. PC-3 cells were seeded at low

density and treated with C75 (9 µg/ml), thapsigargin (25 nmol/L), or the combination of

both for 12 hours and assayed for clonogenic survival. The clonogenic survival of cells

treated with the combination of drugs was significantly reduced compared with either

agent alone (Figure 6A, left). This coincides with immunoblot data demonstrating that

levels of cleaved PARP are highest in lysates from cells treated with both drugs (Figure

6A, top right). Interestingly, while both C75 and thapsigargin induced phosphorylation of

eIF2! separately, the level of phosphorylated eIF2! was significantly reduced in cells

treated with the two agents combined, with no change in total eIF2! levels (Figure 6A,

55

top right). This data suggests that the combined agents facilitated a more rapid

progression of the ER stress response and induction of the GADD34 feedback loop (33).

In support of this, mRNA expression of GADD34 is increased in PC-3 cells treated with

both agents, as compared with either agent alone (Figure 6A, bottom right). Confirming

that the effects of this combination of drugs is not cell-type-specific, clonogenic survival

was assessed in HT-29 cells treated with one of two combinations: either 1) orlistat (25

µmol/L), thapsigargin (25 nmol/L) or the combination of both for 12 hours (Figure 6B,

left); or, 2) C75 (9 µg/ml), thapsigargin (25 nmol/L) or the combination of both for 12

hours (Figure 6B, right). While the clonogenic survival only indicates an additive

interaction, these data, importantly, demonstrate that ER stress does not inhibit the

actions of FAS inhibitors and may actually enhance their efficacy.

56

Figure 6. Pharmacological FAS inhibitors cooperate with thapsigargin. A, PC-3 cells were treated with DMSO, C75 (9 µg/ml), Tgn (25 nmol/L) or the combination of each for 12 hours and clonogenic survival was normalized relative to vehicle treated controls (left). Times and doses of these various experiments were selected to achieve minimal cell kill from single agents, so that the effect of the combination would be most clear. PC-3 cells were treated with DMSO, C75 (9 µg/ml), Tgn (25 nmol/L) or the combination of both for 20 hours and samples were subjected to immunoblot analysis (top right), or RNA was collected and sq RT-PCR was performed using primers specific for GADD34 or "-actin (bottom right). B, HT-29 were treated with DMSO, orlistat (25 µmol/L), Tgn (25 nmol/L) or the combination of each for 12 hours (left). Cells were treated with DMSO, C75 (9 µg/ml), Tgn (25 nmol/L) or the combination of each for 12 hours (right). Clonogenic survival was normalized relative to vehicle treated controls. C, Model demonstrating that in a proliferating tumor cell FAS contributes to ER function by driving phospholipid synthesis (left). When FAS is inhibited (right), ER stress is induced which activates signals that mediate adaptation and promote ER membrane biogenesis.

" -tubulin

" -actin

A

B

C

HT-29 HT-29

FAS

palmitate

phospholipid

ER homeostasis, protein folding

Survival

FAS

palmitate

Orlistat, C75Cerulenin, siRNA

ER stress

PERK IRE1

XBP1sp-eIF2!

Adaptation

ER membrane biogenesis

ATF4, CHOP

Adaptation

Proliferating tumor cell Tumor cell with inhibited FAS activity

Attenuated protein synthesis

FAS

palmitate

phospholipid

ER homeostasis, protein folding

Survival

FAS

palmitate

Orlistat, C75Cerulenin, siRNA

ER stress

PERK IRE1

XBP1sp-eIF2!

Adaptation

ER membrane biogenesis

ATF4, CHOP

Adaptation

Proliferating tumor cell Tumor cell with inhibited FAS activity

Attenuated protein synthesis

PC-3

cPARP

p-eIF2!

eIF2!

FASCon C75 Tgn C75/T

GADD34

IB

RT-PCR

PC-3

DM SO Orl Tgn Orl + Tgn0

0.10.20.30.40.50.60.70.80.9

11.1

DM SO C75 Tgn C75 + Tgn0

0.10.20.30.40.50.60.70.80.9

11.1

DM SO C75 Tgn C75 + Tgn0

0.10.20.30.40.50.60.70.80.9

11.1

Clo

noge

nic

Surv

ival

Clo

noge

nic

Surv

ival

Clo

noge

nic

Surv

ival

" -actin

A

B

C

HT-29 HT-29

FAS

palmitate

phospholipid

ER homeostasis, protein folding

Survival

FAS

palmitate

Orlistat, C75Cerulenin, siRNA

ER stress

PERK IRE1

XBP1sp-eIF2!

Adaptation

ER membrane biogenesis

ATF4, CHOP

Adaptation

Proliferating tumor cell Tumor cell with inhibited FAS activity

Attenuated protein synthesis

FAS

palmitate

phospholipid

ER homeostasis, protein folding

Survival

FAS

palmitate

Orlistat, C75Cerulenin, siRNA

ER stress

PERK IRE1

XBP1sp-eIF2!

Adaptation

ER membrane biogenesis

ATF4, CHOP

Adaptation

Proliferating tumor cell Tumor cell with inhibited FAS activity

Attenuated protein synthesis

PC-3

cPARP

p-eIF2!

eIF2!

FASCon C75 Tgn C75/T

GADD34

IB

RT-PCR

PC-3

DM SO Orl Tgn Orl + Tgn0

0.10.20.30.40.50.60.70.80.9

11.1

DM SO C75 Tgn C75 + Tgn0

0.10.20.30.40.50.60.70.80.9

11.1

DM SO C75 Tgn C75 + Tgn0

0.10.20.30.40.50.60.70.80.9

11.1

Clo

noge

nic

Surv

ival

Clo

noge

nic

Surv

ival

Clo

noge

nic

Surv

ival

A

B

C

HT-29 HT-29

FAS

palmitate

phospholipid

ER homeostasis, protein folding

Survival

FAS

palmitate

Orlistat, C75Cerulenin, siRNA

ER stress

PERK IRE1

XBP1sp-eIF2!

Adaptation

ER membrane biogenesis

ATF4, CHOP

Adaptation

Proliferating tumor cell Tumor cell with inhibited FAS activity

Attenuated protein synthesis

FAS

palmitate

phospholipid

ER homeostasis, protein folding

Survival

FAS

palmitate

Orlistat, C75Cerulenin, siRNA

ER stress

PERK IRE1

XBP1sp-eIF2!

Adaptation

ER membrane biogenesis

ATF4, CHOP

Adaptation

Proliferating tumor cell Tumor cell with inhibited FAS activity

Attenuated protein synthesis

PC-3

cPARP

p-eIF2!

eIF2!

FASCon C75 Tgn C75/T

GADD34

IB

RT-PCR

PC-3

DM SO Orl Tgn Orl + Tgn0

0.10.20.30.40.50.60.70.80.9

11.1

DM SO C75 Tgn C75 + Tgn0

0.10.20.30.40.50.60.70.80.9

11.1

DM SO C75 Tgn C75 + Tgn0

0.10.20.30.40.50.60.70.80.9

11.1

Clo

noge

nic

Surv

ival

Clo

noge

nic

Surv

ival

Clo

noge

nic

Surv

ival

57

II.5 Discussion

The ER stress response is a choreographed series of cellular events activated by

specific insults that result in altered ER function (26, 34). The combined effect of this

response is activation of genes that are specifically expressed to engage an adaptation

protocol. Upon prolonged stress, the adaptation mechanism of the ER stress response

saturates, thus, activating cell death. Several studies have developed important

connections between lipid synthesis pathways and the ER stress response (19-21, 35).

Inhibition of phospholipid synthesis, especially that of phosphatidylcholine (PtdCho),

induces ER stress-related pathways (19). Similarly, altering phospholipid metabolism by

manipulation of phospholipase activity amplifies the ER stress response in "-cells (36). In

addition, the accumulation of the GM1-ganglioside activates the ER stress response in

neurons, indicating that sphingolipid levels are also important for regulating ER function

(35). Recent studies have demonstrated that cholesterol-induced apoptosis in

macrophages is triggered by ER stress induction, and small molecule inhibitors of

cholesterol synthesis activate the integrated stress response (24, 25). There are also direct

links between the individual ER stress components and lipid synthesis pathways. For

instance, overexpression of the ER stress specific XBP-1(s) expands ER volume by

increasing the activity of enzymes responsible for PtdCho synthesis (19). Moreover, mice

that are null for XBP-1 have underdeveloped ER (37, 38). Collectively, these data

demonstrate that lipid and sterol levels are important for maintaining ER function.

Because FAS inhibitors are being developed as anti-tumor agents, it is important

to understand the effects these drugs have on both normal and tumor cells. The evidence

58

here demonstrates that FAS inhibitors induce the ER stress response in a variety of tumor

cells, but not in normal cells. A model summarizing these data is presented in Figure 6C.

Our results suggest that in a proliferating tumor cell FAS activity drives phospholipid

synthesis which facilitates ER homeostasis and function. When FAS activity is inhibited

in tumor cells, the result is PERK-dependent phosphorylation of eIF2!, a concomitant

attenuation of protein synthesis and the IRE1-mediated processing of XBP-1.

Interestingly, phosphorylation of eIF2! persists for as long as 48 hours with no

attenuation (Figure 5A), suggesting that protein phosphatase 1 activity is not activated or

that GADD34 is not induced as is evidenced by lack of expression in Figure 6A.

Downstream of PERK and IRE1 activation, inhibiting FAS activity also induces mRNA

expression of canonical markers of the ER stress response pathway including CHOP,

GRP78 and ATF4. The precise role of these players has not been determined in cells that

have been treated with FAS inhibitors. However, it has previously been shown that ATF4

acts to protect cells from ER generated reactive oxygen species (39). Another report

demonstrated that siRNA-mediated knockdown of FAS or ACC in breast cancer cells

results in cell death that is mediated by reactive oxygen species and attenuated by

supplementation with the antioxidant vitamin E, which suggests that the ER stress

response in general, and ATF4 expression specifically, may be a response to changes in

the redox status of FAS inhibitor treated cells (40). These data are consistent with the

hypothesis that the ER stress response initially acts to protect cells from FAS inhibitors,

but do not rule out that ER stress could also facilitate cell death after prolonged stress.

59

It is interesting to note that several indicators of ER stress, including

phosphorylation of eIF2!, inhibition of protein synthesis, and XBP-1 processing are

detected well before canonical hallmarks of apoptosis, cleaved caspase 3 and cleaved

PARP. This indicates that the ER may be an early sensor of fatty acid and phospholipid

levels in tumor cells. When the ER stress response is unable to fully restore ER function

perturbed by FAS inhibition, it is possible that this leads to the initiation of a cell death

program. Consistent with this notion, cycloheximide is able to inhibit orlistat induced cell

death and phosphorylation of eIF2!. These data do not conflict with previous reports

demonstrating that FAS inhibitors activate the intrinsic cell death pathway and that

ceramide accumulation contributes to FAS inhibitor induced cell death (41, 42). In fact, a

previous study demonstrated that ceramide accumulation is also associated with

thapsigargin induced ER stress and apoptosis (36). It is possible that FAS inhibitor

induced ER stress may result in ceramide accumulation that is important in for cell death;

however, the relationship between FAS inhibition, ER stress, and subsequent downstream

events remains to be determined. Given the importance of phospholipid synthesis during

S-phase of the cell cycle, the demonstration that FAS inhibitors induce ER stress in tumor

cells also compliments a previous study that established that FAS inhibitors induce

apoptosis during S-phase (43, 44). Collectively, the data presented herein fill a critical

gap in our understanding of how endogenous fatty acid synthesis is required to maintain

proper ER integrity and function.

We have demonstrated that inhibiting FAS activity in tumor cells induces an ER

stress response. Based on these findings, we propose that one teleological explanation for

60

high FAS levels in tumors is to provide support for a dynamic ER in rapidly proliferating

cells. Furthermore, we hypothesize that the ER acts as a sensor of FAS activity and

resulting phospholipid levels. In addition, we demonstrate that orlistat and C75 cooperate

with the ER stressing agent thapsigargin to enhance cell death in vitro. While

thapsigargin is highly toxic and not a likely candidate for tumor therapy, these data

implies that tumor microenvironment-induced ER stress will not hinder the efficacy of

FAS inhibitors (45). The data also suggest that FAS inhibitors might be combined with

PERK inhibitors to enhance tumor cell cytotoxicity. In summary, these data provide the

first evidence that FAS inhibitors induce ER stress, which may explain some anti-tumor

effects of FAS inhibitors, and they also establish an important mechanistic link between

FAS and ER function in tumor cells.

61

References

1. Wakil SJ. Fatty acid synthase, a proficient multifunctional enzyme. Biochemistry 1989;28:4523-30.

2. Asturias FJ, Chadick JZ, Cheung IK, et al. Structure and molecular organization of mammalian fatty acid synthase. Nat Struct Mol Biol 2005;12:225-32.

3. Milgraum LZ, Witters LA, Pasternack GR, Kuhajda FP. Enzymes of the fatty acid synthesis pathway are highly expressed in in situ breast carcinoma. Clinical Cancer Research 1997;3:2115-20.

4. Pizer ES, Pflug BR, Bova GS, et al. Increased fatty acid synthase as a therapeutic target in androgen-independent prostate cancer progression. Prostate 2001;47:102-10.

5. Kuhajda FP. Fatty acid synthase and cancer: new application of an old pathway. Cancer Research 2006;66:5977-80.

6. Rossi S, Graner E, Febbo P, et al. Fatty acid synthase expression defines distinct molecular signatures in prostate cancer. Mol Cancer Res 2003;1:707-15.

7. Kuhajda FP. Fatty-acid synthase and human cancer: new perspectives on its role in tumor biology. Nutrition 2000;16:202-8.

8. Kuhajda FP, Jenner K, Wood FD, et al. Fatty acid synthesis: a potential selective target for antineoplastic therapy. Proceedings of the National Academy of Sciences of the United States of America 1994;91:6379-83.

9. Kuhajda FP, Pizer ES, Li JN, et al. Synthesis and antitumor activity of an inhibitor of fatty acid synthase. Proc Natl Acad Sci USA 2000;97:3450-54.

10. Alli PM, Pinn ML, Jaffee EM, McFadden JM, Kuhajda FP. Fatty acid synthase inhibitors are chemopreventive for mammary cancer in neu-N transgenic mice. Oncogene 2005;24:39-46.

11. Pizer ES, Jackisch C, Wood FD, et al. Inhibition of fatty acid synthesis induces programmed cell death in human breast cancer cells. Cancer Research 1996;56:2745-47.

12. Wang HQ, Altomare DA, Skele KL, et al. Positive feedback regulation between AKT activation and fatty acid synthase expression in ovarian carcinoma cells. Oncogene 2005;24:3574-82.

13. Kridel SJ, Axelrod F, Rozenkrantz N, Smith JW. Orlistat is a novel inhibitor of fatty acid synthase with antitumor activity. Cancer Research 2004;64:2070-5.

14. Menendez JA, Vellon L, Lupu R. Antitumoral actions of the anti-obesity drug orlistat (XenicalTM) in breast cancer cells: blockade of cell cycle progression, promotion of apoptotic cell death and PEA3-mediated transcriptional repression of Her2/neu (erbB-2) oncogene. Ann Oncol 2005;16:1253-67.

15. Knowles LM, Axelrod F, Browne CD, Smith JW. A fatty acid synthase blockade induces tumor cell-cycle arrest by down-regulating Skp2. J Biol Chem 2004;279:30540-5.

16. Hatzivassiliou G, Zhao F, Bauer DE, et al. ATP citrate lyase inhibition can suppress tumor cell growth. Cancer Cell 2005;8:311-21.

17. Brusselmans K, De Schrijver E, Verhoeven G, Swinnen JV. RNA interference-mediated silencing of the acetyl-CoA-carboxylase-alpha gene induces growth inhibition and apoptosis of prostate cancer cells. Cancer Res 2005;65:6719-25.

62

18. Chajes V, Cambot M, Moreau K, Lenoir GM, Joulin V. Acetyl-CoA Carboxylase {alpha} Is Essential to Breast Cancer Cell Survival. Cancer Research 2006;66:5287-94.

19. Sriburi R, Jackowski S, Mori K, Brewer JW. XBP1: a link between the unfolded protein response, lipid biosynthesis, and biogenesis of the endoplasmic reticulum. J Cell Biol 2004;167:35-41.

20. van der Sanden MHM, Meems H, Houweling M, Helms JB, Vaandrager AB. Induction of CCAAT/Enhancer-binding Protein (C/EBP)-homologous Protein/Growth Arrest and DNA Damage-inducible Protein 153 Expression during Inhibition of Phosphatidylcholine Synthesis Is Mediated via Activation of a C/EBP-activating Transcription Factor-responsive Element. J Biol Chem 2004;279:52007-15.

21. Cox JS, Chapman RE, Walter P. The unfolded protein response coordinates the production of endoplasmic reticulum protein and endoplasmic reticulum membrane. Mol Biol Cell 1997;8:1805-14.

22. Swinnen JV, Van Veldhoven PP, Timmermans L, et al. Fatty acid synthase drives the synthesis of phospholipids partitioning into detergent-resistant membrane microdomains. Biochem Biophys Res Commun 2003;302:898-903.

23. Brewer JW, Diehl JA. PERK mediates cell-cycle exit during the mammalian unfolded protein response. PNAS 2000;97:12625-30.

24. Feng B, Yao PM, Li Y, et al. The endoplasmic reticulum is the site of cholesterol-induced cytotoxicity in macrophages. Nat Cell Biol 2003;5:781-92.

25. Harding HP, Zhang Y, Khersonsky S, et al. Bioactive small molecules reveal antagonism between the integrated stress response and sterol-regulated gene expression. Cell Metab 2005;2:361-71.

26. Kaufman RJ. Regulation of mRNA translation by protein folding in the endoplasmic reticulum. Trends Biochem Sci 2004;29:152-8.

27. Harding HP, Zhang Y, Bertolotti A, Zeng H, Ron D. Perk is essential for translational regulation and cell survival during the unfolded protein response. Mol Cell 2000;5:897-904.

28. Bi M, Naczki C, Koritzinsky M, et al. ER stress-regulated translation increases tolerance to extreme hypoxia and promotes tumor growth. Embo J 2005;24:3470-81.

29. Calfon M, Zeng H, Urano F, et al. IRE1 couples endoplasmic reticulum load to secretory capacity by processing the XBP-1 mRNA. Nature 2002;415:92-6.

30. Zinszner H, Kuroda M, Wang X, et al. CHOP is implicated in programmed cell death in response to impaired function of the endoplasmic reticulum. Genes Dev 1998;12:982-95.

31. Luo S, Baumeister P, Yang S, Abcouwer SF, Lee AS. Induction of Grp78/BiP by translational block: activation of the Grp78 promoter by ATF4 through and upstream ATF/CRE site independent of the endoplasmic reticulum stress elements. J Biol Chem 2003;278:37375-85.

32. Gray MD, Mann M, Nitiss JL, Hendershot LM. Activation of the Unfolded Protein Response Is Necessary and Sufficient for Reducing Topoisomerase II{alpha} Protein Levels and Decreasing Sensitivity to Topoisomerase-Targeted Drugs. Mol Pharmacol 2005;68:1699-707.

63

33. Ma Y, Hendershot LM. Delineation of a negative feedback regulatory loop that controls protein translation during endoplasmic reticulum stress. J Biol Chem 2003;278:34864-73.

34. Xu C, Bailly-Maitre B, Reed JC. Endoplasmic reticulum stress: cell life and death decisions. J Clin Invest 2005;115:2656-64.

35. Tessitore A, del PMM, Sano R, et al. GM1-ganglioside-mediated activation of the unfolded protein response causes neuronal death in a neurodegenerative gangliosidosis. Mol Cell 2004;15:753-66.

36. Ramanadham S, Hsu FF, Zhang S, et al. Apoptosis of insulin-secreting cells induced by endoplasmic reticulum stress is amplified by overexpression of group VIA calcium-independent phospholipase A2 (iPLA2 beta) and suppressed by inhibition of iPLA2 beta. Biochemistry 2004;43:918-30.

37. Reimold AM, Etkin A, Clauss I, et al. An essential role in liver development for transcription factor XBP-1. Genes Dev 2000;14:152-7.

38. Lee AH, Iwakoshi NN, Glimcher LH. XBP-1 regulates a subset of endoplasmic reticulum resident chaperone genes in the unfolded protein response. Mol Cell Biol 2003;23:7448-59.

39. Harding HP, Zhang Y, Zeng H, et al. An Integrated Stress Response Regulates Amino Acid Metabolism and Resistance to Oxidative Stress. Molecular Cell 2003;11:619-33.

40. Chajes V, Cambot M, Moreau K, Lenoir GM, Joulin V. Acetyl-CoA Carboxylase {alpha} Is Essential to Breast Cancer Cell Survival. Cancer Res 2006;66:5287-94.

41. Heiligtag SJ, Bredehorst R, David KA. Key role of mitochondria in cerulenin-mediated apoptosis. Cell Death Differ 2002;9:1017-25.

42. Bandyopadhyay S, Zhan R, Wang Y, et al. Mechanism of Apoptosis Induced by the Inhibition of Fatty Acid Synthase in Breast Cancer Cells. Cancer Research 2006;66:5934-40.

43. Zhou W, Simpson PJ, McFadden JM, et al. Fatty Acid Synthase Inhibition Triggers Apoptosis during S Phase in Human Cancer Cells. Cancer Research 2003;63:7330-37.

44. Jackowski S, Wang J, Baburina I. Activity of the phosphatidylcholine biosynthetic pathway modulates the distribution of fatty acids into glycerolipids in proliferating cells. Biochimica et Biophysica Acta (BBA) - Molecular and Cell Biology of Lipids 2000;1483:301-15.

45. Fels DR, Koumenis C. The PERK/eIF2alpha/ATF4 Module of the UPR in Hypoxia Resistance and Tumor Growth. Cancer Biol Ther 2006;5:723-8.

64

CHAPTER III

DISRUPTION OF CROSSTALK BETWEEN THE FATTY ACID SYNTHESIS AND

PROTEASOME PATHWAYS ENHANCES UPR SIGNALLING AND CELL DEATH

Joy L. Little, Frances B. Wheeler, Constantinos Koumenis, and Steven J. Kridel

The following manuscript will be submitted to Molecular Cancer Therapeutics. Stylistic

variations are due to the requirements of the publisher. J. L. Little performed all of the

experiments and prepared the manuscript. Dr. S. J. Kridel acted in an advisory and

editorial capacity.

65

III.1 Abstract

Fatty Acid Synthase (FASN) is the terminal enzyme responsible for fatty acid synthesis

and is upregulated in tumors of various origins to facilitate growth and progression. We

have recently demonstrated that FASN inhibitors induce ER stress. The proteasome is a

critical component of maintaining ER integrity and has significant connections with

FASN. We asked whether FASN inhibitors would combine with bortezomib, the FDA-

approved proteasome inhibitor, to increase cell death. Indeed, low doses of bortezomib

synergize with low doses of FASN inhibitors to reduce clonogenic survival, consistent

with an increase in apoptotic markers. Interestingly, FASN inhibitors induce

accumulation of ubiquinated proteins and enhance the accumulation induced by

bortezomib treatment. In turn, bortezomib increases fatty acid synthesis, suggesting

crosstalk between the pathways. We hypothesize that cell death resulting from disruption

of this crosstalk is mediated by increased UPR signaling. Indeed, disruption of crosstalk

increases signals of the adaptation arm of UPR signaling, including eIF2!

phosphorylation, ATF4 accumulation, and XBP-1 splicing. Furthermore, while single

agents show little activation of the alarm arm of UPR signaling, crosstalk disruption

yields significant enhancement of JNK activation and CHOP expression. Death induced

by the disruption of the fatty acid synthesis-proteasome crosstalk is largely dependent on

JNK activation and CHOP expression. Combined, the data support the notion that the

UPR balance between adaptive to stress signaling can be exploited to mediate increased

cell death and suggests novel applications of FASN inhibitors for clinical use.

66

III.2 Introduction

Fatty acid synthase (FASN) is the central enzyme responsible for catalyzing the

ultimate steps of fatty acid synthesis in mammalian cells (1, 2). Interestingly, high levels

of FASN expression have been noted in many types of tumors. Accordingly, FASN

expression levels correlate with advanced tumor stage and grade, poor patient prognosis

and reduced overall- and disease-free survival (3-5). A functional correlation between

FASN expression levels and tumor cell survival has been firmly established with the

development of small molecule inhibitors of FASN that induce cell death specifically in

tumor cells and reduce tumor growth in spontaneous and xenograft tumor models (6-10).

FASN inhibitors induce a number of anti-tumor effects including cell cycle arrest

and cell death (3-5). Some of the effects of FASN inhibitors are mediated through key

tumor signaling pathways. For instance, it has been demonstrated that pharmacological

inhibition of FASN activity results in reduced Akt phosphorylation in multiple tumor cell

lines (11, 12). Conversely, phosphoinositide 3-kinase (PI3K) and Akt can drive FASN

expression in tumor cells (12, 13). The demonstration that reduced FASN activity

negatively affects Akt activation identifies feedback between the two pathways. As a

result, blocking both pathways results in synergistic cell death (11, 12, 14). Synergy

between FASN inhibitors and other chemotherapeutics has also been noted in multiple

cell lines (15-19). This evidence is particularly important considering FASN

overexpression has been shown to protect breast cancer cells from apoptosis induced by

the chemotherapeutics adriamycin and mitoxantrone (20). In summary, these studies

demonstrating connections between FASN and oncogenic pathways underscore the

67

potential of FASN inhibitors for clinical use and suggest novel strategies for targeting

tumor cells to improve cell killing efficiency.

In addition to oncogene-mediated mechanisms, FASN overexpression can also be

mediated through stabilization by the ubiquitin-specific protease 2a (USP2A)

deubiquitinating enzyme (21). Treating prostate tumor cells with the proteasome inhibitor

MG-132, also increases FASN expression, supporting evidence of FASN regulation by

the proteasome (21). Inhibition of the proteasome can also stabilize nuclear SREBP-1

which results in increased FASN expression (22). Conversely, inhibiting FASN affects

the proteasome pathway. For example, inhibiting FASN activity compromises stability of

the E3 ubiquitin ligase, Skp2, that is responsible for mediating the stability of key cellular

proteins such as p27 (23). FASN inhibition also affects the expression profiles of several

E2 ubiquitin conjugation enzymes and several E3 ubiquitin ligases (24). Combined, these

data suggest a level of crosstalk between the fatty acid synthase and proteasome

pathways.

Previous work from our lab demonstrates that FASN inhibitors induce activation

of the PKR-like ER kinase (PERK) and inositol-requiring enzyme 1 (IRE1) arms of the

unfolded protein response (UPR) pathway (25). Interestingly, the proteasome is a critical

component in maintaining homeostasis in the endoplasmic reticulum (ER) and

bortezomib, an FDA-approved inhibitor of the 26S proteasome, also activates the UPR in

tumor cells (26-30). Given connections between the proteasome and FASN, as well as the

ability for inhibitors of the proteasome and FASN to induce ER stress, we hypothesized

68

that FASN inhibitors and proteasome inhibitors will combine to increase UPR signaling

thus leading to enhanced tumor cell death. The data presented herein shows novel

evidence of a functional crosstalk between the fatty acid synthesis and proteasomal

pathways that is the basis for UPR-mediated synergism between two clinically-relevant

ER stressors.

69

III.3. Materials and Methods

Materials. The PC-3 cells were obtained from American Type Culture Collection

(Manassas, VA). Cell culture medium and supplements were from Invitrogen (Carlsbad,

CA). Antibodies against eIF2!, phospho-eIF2!, phosphorylated JNK, total JNK

(Thr183/Tyr185), phosphorylated c-Jun (Ser63), Lamin A/C, !-tubulin, cleaved caspase

three (Asp175), and cleaved PARP (Asp214) were from Cell Signaling Technologies

(Beverly, MA). Antibody against fatty acid synthase was from BD Transduction Labs

(San Diego, CA). Antibody against "-tubulin was from NeoMarkers (Fremont, CA).

Antibodies against CHOP (R-20), ATF4 (CREB2 C-20), ubiquitin (FL-76), and XBP-1

(M-186) were from Santa Cruz Biotechnology, Incorporated (Santa Cruz, CA). TRIzol

was from Invitrogen (Carlsbad, CA). Avian Myleoblastosis Virus (AMV) Reverse

Transcriptase and Taq Polymerase were from Promega (Madison, WI). 14C-acetate was

purchased from GE Healthcare (Piscataway, NJ). Oligonucleotides were synthesized by

Integrated DNA Technologies (Coralville, IA), except for those designed for siRNA

which were synthesized by Dharmacon (Lafayette, Co). Orlistat was purchased from

Roche (Nutley, NJ), bortezomib was purchased from Millenium Pharmaceuticals

(Cambridge, MA) and JNK inhibitor II, SP600125 and JNK inhibitor V, AS601245, from

Calbiochem (San Diego, CA). All other reagents were purchased from Sigma (St. Louis,

MO), Calbiochem (San Diego, CA) or BioRad (Hercules, CA).

Cell culture and drug treatments. Prostate tumor cell lines were maintained in RPMI

1640 supplemented with 10% fetal bovine serum at 37#C and 5% CO2. Cells were treated

for the times and with drug concentrations as indicated. Orlistat was extracted from

70

capsules in EtOH as described previously and stored at -80#C (8). Further dilutions were

made in dimethyl sulfoxide (DMSO). Bortezomib was dissolved in DMSO and stored as

individual 20 µmol/L aliquots at -20#C.

Immunoblot analysis. Cells were harvested after the indicated treatments, washed with

ice-cold phosphate-buffered saline, and lysed in buffer containing 1% Triton X-100 to

prepare for immunoblots. Lysis buffer was supplemented with protease, kinase, and

phosphatase inhibitors 200 µmol/L phenylmethanesulphonylfluoride (PMSF), 5 µg/ml

aprotinin, 5 µg/ml pepstatin A, 5 µg/ml leupeptin, 1 µmol/L sodium fluoride (NaF), 1

µmol/L sodium orthovanadate (Na3VO4), 50 µmol/L okadeic acid just before use. For

nuclear proteins, such as ATF4, CHOP, and XBP-1, nuclear extracts were obtained by

harvesting cells, washing with ice-cold PBS, then lysing cells using a harvest buffer

containing 10 mmol/L HEPES (pH 7.9), 50 mmol/L NaCl, 500 mmol/L sucrose, 100

µmol/L EDTA, 0.5% Triton-X 100 with 1 mmol/L DTT, 10 mmol/L tetrasodium

pyrophosphate, 100 mmol/L NaF, 17.5 mmol/L "-glycerophosphate, 1 µmol/L Na3VO4, 1

mmol/L PMSF, 4 µg/ml aprotinin, 2 µg/ml pepstatin A added just before use to separate

the cytoplasmic and nuclei. The nuclei were pelleted in a swinging bucket rotor and then

washed with buffer containing 10 mmol/L HEPES, 10 mmol/L KCl, 100 µmol/L EDTA,

and 100 µmol/L EGTA with 1 mmol/L DTT, 1 mmol/L PMSF, 1 µmol/L Na3VO4, 4

µg/ml aprotinin, and 2 µg/ml pepstatin added just before use. The nuclei were then lysed

in a buffer containing 10 mmol/L HEPES (pH 7.9), 500 mmol/L NaCl, 100 µmol/L

EDTA, 100 µmol/L EGTA, and 0.1% NP-40 with 1 mmol/L DTT, 1 mmol/L PMSF, 1

µmol/L Na3VO4, 4 µg/ml aprotinin, and 2 µg/ml pepstatin added just before use. Protein

71

samples were electrophoresed through 10%, 12%, or 13.5% SDS-polyacrylamide gels

and transferred to nitrocellulose, except for blots to detect phospho-eIF2! and eIF2!,

which were transferred to Immobilon-P membrane (PVDF). Immunoreactive bands were

detected by enhanced chemiluminescence (Perkin Elmer). Lamin A/C, !-tubulin, "-actin

were used as loading controls for western blots.

Quantification of Ubiquitin-Modified Proteins

Autoradiographs were scanned using a HP ScanJet4890. The digital files were then

quantified using UN-SCAN-IT (Orem, UT). The average intensity of ubiquitin detection

was calculated relative to vehicle treated samples for each blot. Then the values for three

independent experiments were averaged and graphed on a logarithmic scale. Statistical

significance between individual treatments and vehicle treated cells was determined for

each pair using two-tailed students t-test.

Metabolic labeling of protein and fatty acid synthesis. To measure fatty acid synthesis, 1

×105 cells per well were seeded in 24-well plates. Cells were treated as indicated. 14C-

acetate (1 µCi) was added to each well for an additional two hours. Cells were collected,

washed and lipids were extracted and quantified as previously described (8).

Clonogenic survival assays. PC-3 cells were plated in 6-well plates at a density of 2000

cells per well 48 hours prior to each experiment. Fresh medium containing the indicated

drugs was added at the indicated concentrations for sixteen to twenty hours as indicated.

The media was then removed, the wells were washed and fresh medium was added.

72

Plates were incubated until macroscopic colonies were formed. Visualization of colonies

was performed as described previously (25). Colonies were quantified by counting.

Survival of treated cells was normalized relative to vehicle treated cells and statistical

significance was determined by two-tailed Student's t tests.

Combination Index Calculation. PC-3 cells were treated with a dose response of orlistat,

bortezomib, or the combination and analyzed for clonogenic survival. Calculations were

performed based on the Chou-Talalay method that calculates a combination index based

on the equation: CI = (D1)/(Dx1) + (D2)/(Dx2) + (D1)(D2)/(Dx1)(Dx2) where (D1) and

(D2) are the doses of the individual drugs that have ‘x’ effect when used in combination

and (Dx1) and (Dx2) are the doses of the drugs having ‘x’ effect when used separately

(31). A CI < 1 indicates synergism.

Detection of XBP-1 splicing and GADD34 expression. Cells were exposed to the various

drug treatments or transfected with siRNA for the indicated times. RTPCR was

performed for XBP-1 splicing and GADD34 expression as described previously (25).

Suppression of CHOP expression with siRNA. A siGENOME SMARTpool siRNA

oligonucleotide cocktail against CHOP (1, AAAUGAAGAGGAAGAAUCA; 2,

GAAUCUGCACCAAGCAUGA; 3, CCAGCAGAGGUCACAAGCA; 4,

GAGCUCUGAUUGACCGAAU) and one nontargeting siRNA against luciferase as a

negative control (Luc sense, CUUACGUGAUACUUCGAUU) were designed and

synthesized by Dharmacon. The individual siRNAs (83 nmol/L) were transfected into

73

cells at plating with siPORT NeoFX transfection reagent (Ambion) according to

manufacturers instructions. After 48 hours, transfection media was removed and fresh

media containing indicated drug was added to cells. After indicated treatment times, cells

were collected and nuclear protein was harvested for western blot analysis of CHOP and

"-actin.

74

III.4. Results

We hypothesized that the identified connections between the fatty acid synthesis

and proteasome pathways would provide a novel strategy to target UPR activation and

increase cell death in tumor cells. To test this hypothesis PC-3 cells were examined for

clonogenic survival after treatment with orlistat or C75 and the proteasome inhibitor

bortezomib (Velcade, PS-341). Doses and times were titrated so that minimal cell killing

would occur from any of the single agents (data not shown). Clonogenic survival of PC-3

cells treated with orlistat was reduced by approximately 60%. Clonogenic survival of

cells treated with C75 was reduced by 30%. Lastly, survival of cells treated with

bortezomib was reduced by only 20%. When the FASN inhibitors are combined with

bortezomib, however, clonogenic survival was strikingly diminished (P < 0.01, Figure

1A). An analysis of the combination–index demonstrated that combining FASN

inhibitors with bortezomib resulted in synergism (31). Western blot analysis of cell

lysates from the treatments also demonstrated that the combinations of orlistat or C75

Figure 1. FASN inhibitors combine with bortezomib to increase cell death. A, Clonogenic survival assays were performed on PC-3 cells treated with orlistat (25 µmol/L), bortezomib (5 nmol/L), the combination of orlistat and bortezomib, C75 (10 µg/ml) or C75 and bortezomib for 16 hours. Clonogenic survival was determined relative to vehicle-treated controls. B, PC-3 cells treated with bortezomib (5 nmol/L), orlistat (25 µmol/L), C75 (10 µg/ml), or the combination of FASN inhibitors and bortezomib for 18 hours and collected for western blot analysis using antibodies specific for cleaved PARP, cleaved caspase 3, and total eIF2!.

Con Orl Orl +Btz

C75 C75 + Btz

Btz

Rel

ativ

e

Clo

noge

nic S

urvi

val

cleaved PARP

cleaved caspase 3

Con Btz Orl Btz C75 BtzOrl+ C75+

eIF2!

0

0.2

0.4

0.6

0.8

1

1.2A B

Con Orl Orl +Btz

C75 C75 + Btz

Btz

Rel

ativ

e

Clo

noge

nic S

urvi

val

cleaved PARP

cleaved caspase 3

Con Btz Orl Btz C75 BtzOrl+ C75+

eIF2!

0

0.2

0.4

0.6

0.8

1

1.2A B

75

with bortezomib resulted in significantly increased levels of both cleaved PARP and

cleaved caspase three that were undetectable with the single agents (Figure 1B).

Combined, the data showed that combining inhibitors of the proteasome and FASN

resulted in enhanced tumor cell death.

Given the established links between the fatty acid synthesis and proteasome

pathways, we asked whether inhibition of FASN would affect the function of the

proteasome. PC-3 cells were treated with the FASN inhibitors orlistat and C75,

bortezomib, or the FASN inhibitors and bortezomib together at the same doses used for

clonogenic survival assays in Figure 1. Western blot analysis of ubiquitin-modified

proteins was then performed. As expected, bortezomib induced accumulation of

ubiquitin-modified proteins (Figures 2A, 2B). Interestingly, PC-3 cells treated with either

orlistat or C75 induced a modest but significant accumulation of ubiquitin-modified

proteins (P & 0.05). The co-treatment of FASN inhibitors with bortezomib also appeared

to cause an additive accumulation of ubiquitin-modified proteins (Figures 2A, 2B),

further suggesting that FASN activity contributes to the functionality of the proteasomal

pathway. Next, we asked whether inhibition of proteasome activity affected fatty acid

synthesis. Metabolic labeling of newly synthesized fatty acids revealed that PC-3 cells

treated with bortezomib for four hours exhibited a dose-dependent increase in fatty acid

synthesis (P<0.05, Figure 2C) with no change in FASN protein levels (Figure 2D).

Collectively, these data indicated crosstalk between the fatty acid synthesis and

proteasome pathways.

76

Figure 2. Fatty acid synthesis and proteasome pathways exhibit crosstalk. A, PC-3 cells were treated with vehicle, orlistat (25 µmol/L), bortezomib, (5 nmol/L), C75 (9 µg/ml), or the combination of bortezomib and orlistat or C75 for 16 hours and subjected to immunoblot analysis with antibodies specific for ubiquitin and "-actin. B, Three separate experiments of PC-3 cells treated as in A were quantified by measuring intensity of the exposure from ubiquitin antibody in each treatment as compared to vehicle treated lanes using UN-SCAN-IT (Orem, UT). C, PC-3 cells were treated for two hours with 5, 10, or 20 nmol/L bortezomib and incubated with 14C-acetate (1 µCi) for two hours. Cells were collected, washed and lipids were extracted and quantified relative to vehicle-treated control as described in Experimental Methods. Asterisks indicate statistical significance by students t-test (P<0.05). B, PC-3 cells were treated with vehicle or bortezomib (20 nmol/L) for 4 or 6 hours in duplicate. Cells were collected for western blot analysis using antibodies specific to fatty acid synthase, ubiquitin, or "-actin.

We have shown that FASN inhibitors induce ER stress in tumor cells and others

have shown the requirement for the proteasome in ER homeostasis (25, 28-30, 32). To

characterize the role of the UPR in cells treated with the combination of FASN inhibitors

Con Orl C75 C75 + Btz

Btz

Ubiquitin

"-actin

Con Btz Orl C75 Btz BtzOrl+ C75+

0

0.2

0.4

0.6

0.8

1

1.2

1.4

1.6

1.8

0 5 10 20 Bortezomib (nM)

Rel

ativ

e Fa

tty

Aci

d Sy

nthe

sis

***

Btz (20nM)

"-actin

Ubiquitin

"-actin

FAS

0 4 6 hours

C D

A B

Rel

ativ

e In

tens

ity

Orl +Btz

0.1

1

10

100

500

Con Orl C75 C75 + Btz

Btz

Ubiquitin

"-actin

Con Btz Orl C75 Btz BtzOrl+ C75+

0

0.2

0.4

0.6

0.8

1

1.2

1.4

1.6

1.8

0 5 10 20 Bortezomib (nM)

Rel

ativ

e Fa

tty

Aci

d Sy

nthe

sis

***

0

0.2

0.4

0.6

0.8

1

1.2

1.4

1.6

1.8

0 5 10 20 Bortezomib (nM)

Rel

ativ

e Fa

tty

Aci

d Sy

nthe

sis

***

Btz (20nM)

"-actin

Ubiquitin

"-actin

FAS

0 4 6 hours

C D

A B

Rel

ativ

e In

tens

ity

Orl +Btz

0.1

1

10

100

500

77

and bortezomib, we first examined the phosphorylation status of eukaryotic translation

initiation factor 2! (eIF2!) by western blot in response to bortezomib. Bortezomib

induced a rapid and transient phosphorylation of eIF2! (Figure 3A). Bortezomib-induced

phosphorylation of eIF2! at this early timepoint corresponded to the short time required

for increased lipogenesis (Figure 2C). Consistent with previous work, FASN inhibitors

showed phosphorylation of eIF2! as early as eight hours that continues to 24 and 48

hours (25). Disrupting crosstalk between the proteasome and fatty acid synthesis

pathways resulted in non-phosphorylated eIF2! at sixteen hours, which was consistent

with the lack of phosphorylated eIF2! with bortezomib alone (Figure 3B).

In the UPR signaling cascade, growth arrest and DNA damage-inducible protein

34 (GADD34) is induced mediate the dephosphorylation of eIF2! to restore bulk

translation (33, 34). To test whether single and combined agents induce GADD34

expression over the course of sixteen hours, semi-quantitative RT-PCR was performed

with oligonucleotides specific for GADD34. PC-3 cells treated with orlistat showed slight

GADD34 mRNA at eight and sixteen hours compared to vehicle treated controls (Figure

3C). On the other hand, consistent with the timecourse of phosphorylated eIF2! in

bortezomib treated cells, GADD34 mRNA was induced minimally at eight hours with

robust levels of GADD34 accumulated by sixteen hours (Figure 3C). Inhibiting crosstalk

between pathways induced GADD34 mRNA at eight hours to a level higher than seen

with bortezomib or orlistat alone. The robust GADD34 expression at eight hours after

treatment with orlistat and bortezomib remained high through sixteen hours thereby

correlating with the lack of phosphorylated eIF2! at the same timepoint (Figure 3C).

78

Together, these data showed that interrupting crosstalk between the proteasome and fatty

acid synthesis pathways resulted in acceleration of the eIF2! – GADD34 feedback loop

indicative of increased UPR signaling and suggested that proteotoxicity may be a cause

of the synergistic cell death.

Phosphorylation of eIF2! is a primary event in UPR signaling that activates

downstream signals including the pro-survival activating transcription factor 4 (ATF4)

(35, 36). Therefore, we tested whether interrupting crosstalk between proteasome and

fatty acid synthesis pathways would increase ATF4 expression. Orlistat induced early

expression of ATF4 at eight hours that was sustained through the sixteen hour time point

(Figure 3D). Significant ATF4 expression at sixteen hours was consistent with robust

phosphorylation of eIF2! (Figure 3B) and low levels of GADD34 (Figure 3C) in orlistat

treated cells. Bortezomib induced high levels of nuclear ATF4 at eight hours that

decreased at twelve and sixteen hours, consistent with phosphorylated eIF2! status and

GADD34 expression (Figure 3). Interfering with the fatty acid synthesis – proteasome

crosstalk induced accumulation of ATF4 that was more robust than orlistat or bortezomib

treated cells at eight hours but decreased by the sixteen hour time point (Figure 3D).

Correspondingly, GADD34 levels were high and phosphorylated eIF2! levels were low

at sixteen hours in combination treated cells (Figure 3C). Together, the time courses of

eIF2! phosphorylation, GADD34, and ATF4 expression indicated that adaptation signals

of the PERK arm of the UPR pathway were not only active in cells treated with FASN

inhibitors and bortezomib, but were saturated when crosstalk between pathways were

disrupted.

79

Figure 3. Bortezomib and FASN inhibitors combine to saturate the PERK arm of UPR adaptation signaling. A, PC-3 cells were treated with vehicle (DMSO) or 20 nmol/L bortezomib for the indicated times. Samples were resolved by SDS-PAGE, transferred to PVDF and the membrane was probed with antibodies specific for phospho-eIF2! and total eIF2!. B, PC-3 cells were treated with vehicle, bortezomib (5 nmol/L), orlistat (25 µmol/L), C75 (10 µg/ml), or the combination of bortezomib and orlistat or bortezomib and C75 for 16 hours and samples were subjected to immunoblot analysis and probed with antibodies specific for phospho-eIF2! and total eIF2!. Asterisk denotes higher molecular weight nonspecific band. C, PC-3 cells were treated with vehicle, orlistat (25 µmol/L), bortezomib (20 nmol/L), or the combination of bortezomib and orlistat for the indicated times. Total RNA was collected and semi-quantitative RT-PCR was performed using primers specific for GADD34 and "-actin. D, PC-3 cells were treated with vehicle, orlistat (25 µmol/L), bortezomib (5 nmol/L), or the combination of bortezomib and orlistat. Nuclear fractions were isolated and prepared for immunoblot analysis and probed with antibodies specific for ATF4 and Lamin A/C.

We next the examined the IRE1-mediated processing of X-box binding protein 1

(XBP-1) in cells treated with orlistat, C75, bortezomib, or the combination. Orlistat and

bortezomib induced moderate splicing of XBP-1 mRNA by eight hours (Figure 4A).

Disrupting crosstalk with both agents caused and earlier and more robust processing of

XBP-1 that was complete by sixteen hours (Figure 4A). Correspondingly, at these times

and concentrations, accumulation of the XBP-1 transcription factor only occurred in cells

treated with both agents (Figure 4B and C). Therefore, disrupting crosstalk between the

eIF2!*

0 2 4 6 8 16

p-eIF2!

Bortezomib (20 nmol/L)

p-eIF2!

eIF2!

Con Btz Orl C75 Btz BtzOrl+ C75+

GADD34

Orl Btz Orl+Btz Tgn0 8 16 8 16 8 16 1

"-actin

hours

A B

DC

ATF4

Lamin A/C

hoursOrl Btz Orl+Btz

0 8 12 16 8 12 16 8 12 16

hours

80

proteasome and fatty acid synthesis pathways enhanced the adaptation response through

IRE1-mediated processing of XBP-1 in prostate tumor cells.

Figure 4. Combining bortezomib with FASN inhibitors enhances IRE1-mediated XBP-1 mRNA processing. A, PC-3 cells were treated with vehicle, orlistat (25 µmol/L), bortezomib (5 nmol/L) or the combination of bortezomib and orlistat. Total RNA was collected with TRIzol and RT-PCR was performed with oligonucleotides specific for XBP-1 and "-actin. XBP-1 (us) is indicated by the 473 bp product and XBP-1 (s) is indicated by the 447 bp fragment. PC-3 cells were treated for one hour with thapsigargin (1 µmol/L) as a positive control. B, PC-3 cells were treated with vehicle, orlistat (25 µmol/L), bortezomib (5 nmol/L), or the combination of bortezomib and orlistat. Nuclear lysates were collected as described in Experimental Methods for immunoblot analysis with antibodies specific for XBP-1 and Lamin A/C. Immunoblot indicates the 55 kD XBP-1 (s) protein. Asterisk denotes higher molecular weight nonspecific band. C, PC-3 cells were treated with vehicle, bortezomib (5 nmol/L), C75 (9 µg/ml), or the combination of bortezomib and C75. Asterisk denotes higher molecular weight nonspecific band.

We next asked whether IRE1-activated signals characteristic of the alarm arm of

the UPR pathway were upregulated in cells in which we disrupted fatty acid synthesis-

proteasome crosstalk. We examined Jun N-terminal kinase (JNK) phosphorylation by

western blot (Figure 5A). While orlistat induces no detectable level of JNK activation

between four and sixteen hours, bortezomib induced minimal JNK activation only at

Orl Btz Orl+Btz Tgn0 8 16 8 16 8 16 1

Orl Btz Orl+Btz Tgn0 8 16 8 16 8 16 1

"-actin

hours

Lamin A/C

XBP-1 (s)

OrlCon Btz Orl + Btz

C75Con Btz C75 + Btz

Lamin A/C

XBP-1 (s)

A

B

C

*

*

473 bp, XBP-1447 bp, XBP-1(s)

81

sixteen hours (Figure 5A). Disrupting crosstalk, however, induced JNK phosphorylation

as early as four hours that increased through sixteen hours. The C/EBP homologous

protein (CHOP) transcription factor can be induced by JNK activation (37, 38). Orlistat

only induced moderate CHOP expression at sixteen hours (Figure 5B). Similarly, at

twelve hours, bortezomib induced minimal CHOP expression that slightly increased by

sixteen hours (Figure 5B). On the other hand, disrupting the crosstalk between the fatty

acid synthesis and proteasome pathways induced an earlier and more robust CHOP

expression (Figure 5B). A JNK inhibitor was used to verify the role of JNK in mediating

CHOP expression. Pharmacological inhibition of JNK blocked the phosphorylation of

JNK and c-Jun (Figure 6A). More importantly, inhibition of JNK also caused a

significant decrease in CHOP expression and cleavage of caspase three and PARP

(Figure 6A). Consistent with these findings, trypan-blue exclusion assays also

Figure 5. Combining bortezomib and FASN inhibitors induces JNK activation and CHOP expression. A, PC-3 cells were treated with vehicle, orlistat (25 µmol/L), bortezomib (20 nmol/L), or the combination of bortezomib and orlistat. Nuclear lysates were collected as described in Experimental Methods for immunoblot analysis with antibodies specific for CHOP and Lamin A/C. B, PC-3 cells were treated with vehicle, orlistat (25 µmol/L), bortezomib (20 nmol/L), or the combination of bortezomib and orlistat. Whole cell lysates were collected for immunoblot analysis of phospho-JNK, total JNK, and "-actin.

CHOP

Lamin A/C

Orl Btz Orl+Btz

0 8 12 16 8 12 16 8 12 16 hours

Orl Btz Orl+Btz

0 4 10 16 4 10 16 4 10 16

phospho-JNK

"-actin

hours

total JNK

A

B

82

demonstrated that JNK inhibition protected cells from cell death induced by the

combination of orlistat and bortezomib (P<0.001, Figure 6B).

We next tested whether CHOP is the effector of JNK signaling leading to cell

death. To do so, we obtained a SMARTpool of siRNA oligonucleotides against CHOP.

PC-3 cells were transfected with CHOP or control siRNA. After 48 hours, the

transfection media was removed and cells were treated with vehicle, orlistat, or the

combination of orlistat and bortezomib. The siRNA-mediated knockdown of CHOP had

no effect on orlistat or bortezomib induced cell death (not shown). On the other hand,

siRNA-mediated knockdown of CHOP expression protected cells from the effects of

combining orlistat and bortezomib (P < 0.001, Figure 6C). The level of protection was

proportional with the reduction in CHOP levels (Figure 6D). Therefore, it appeared that

the JNK-CHOP axis was more important in cells where the onset of ER stress and UPR

signaling is rapid and robust. Altogether, the data showed that FASN inhibitors and

bortezomib combined to enhance UPR signaling resulting in synergistic reduction in

tumor cell viability mediated through the UPR alarm arm and JNK-mediated CHOP

expression.

83

Figure 6. UPR-associated cell death is mediated by JNK activation and CHOP. A, PC-3 cells were treated with vehicle, orlistat (50 µmol/L), bortezomib (20 nmol/L), or the combination of bortezomib and orlistat with and without JNK inhibitor (JNKi, 20 nmol/L). Nuclear lysates were collected as described in Experimental Methods for immunoblot analysis with antibodies specific for CHOP, phosphorylated c-Jun and !-tubulin. Whole cell lysates were analyzed with antibodies specific for cleaved PARP, cleaved caspase 3, and "-actin. B, PC-3 cells were treated with vehicle, orlistat (50 µmol/L), bortezomib (20 nmol/L), or the combination of bortezomib and orlistat with and without JNK inhibitor (20 nmol/L). Cells were collected and counted using a trypan-blue exclusion assay and the ratio of viable cells was calculated relative to vehicle treated cells. Statistical significance was determined using students t-test (P<0.01). C, PC-3 cells were transfected with a SMARTpool siRNA against CHOP or a control siRNA. After 48 hours, cells were treated with vehicle or the combination of bortezomib (20 nmol/L) and orlistat (50 µmol/L) for 18 hours. Cells were then collected and counted using trypan blue exclusion and the ratios of viable cells relative to vehicle treated controls were calculated from three independent experiments. Statistical significance between CHOP siRNA and control siRNA cells treated with orlistat and bortezomib was determined by two-tailed student’s t-test (P = 1 x 10-7). D, Cells from C were analyzed by immunoblot with antibodies specific for CHOP and "-actin.

0

0.2

0.4

0.6

0.8

1

1.2

cleaved caspase 3

cleaved PARP

"-actin

cleaved caspase 3

cleaved PARP

"-actin

phospho-cJun

!-tubulin

CHOP

DMSO Orl Btz Orl + Btz- + - + - + - + JNK inhibitor

A B

Rel

ativ

e V

iabi

lity

D

Con CHOP Con CHOP

"-actin

CHOP

DMSO Orl + Btz

siRNACon CHOP Con CHOP

"-actin

CHOP

DMSO Orl + Btz

siRNA

"-actin

CHOP

DMSO Orl + Btz

siRNA

DMSO Orl + Btz

ControlsiRNACHOPsiRNA

00.20.40.60.8

11.2

**C

Rel

ativ

e V

iabi

lity*

DMSOJNKi

Who

le C

ellN

ucle

ar

84

III.5. Discussion

We have previously shown that inhibiting FASN induces ER stress and UPR

signaling before cell death occurs and hypothesize that cell death induced by FASN

inhibition is dependent on the UPR (25). The data herein reveal a functional crosstalk

between the fatty acid synthesis and proteasome pathways. The connection of each of

these pathways with ER homeostasis provides a unique therapeutic opportunity. In fact,

when inhibitors of both the proteasome and FASN pathways are combined, increased cell

death occurs through the IRE1-JNK-CHOP arm of the UPR pathway.

Accumulating evidence links the proteasome and FASN pathways (21, 23, 24).

The data herein suggests that the integrity of the proteasome pathway relies, at least in

part, on functional fatty acid synthesis as FASN inhibitors cause the accumulation of

ubiquinated proteins through an undetermined mechanism (Figure 2A). It is possible that

either the proteasome overall, or a component of the proteasome pathway, relies on the

fatty acid synthesis pathway for proper function. Another ER stressing agent,

tunicamycin, an agent that inhibits protein glycosylation, can also induce the

accumulation of ubiquitin-modified proteins and enhances the stability of E3-ubiquitin

ligases GRP78/(BiP) and Hrd1 (39). Therefore, it is possible that the proper functioning

of the ER-associated degradation pathway is dependent upon ER integrity.

Perhaps more interesting is that inhibiting the proteasome alone can increase total

lipogenesis (Figure 2C). As the increased lipogenesis does not correlate with increased

FASN protein levels, the data suggest a mechanism independent of those that have been

85

suggested previously, namely stabilization of SREBP-1 or FASN protein (21, 22).

Induction of fatty acid synthesis by bortezomib could be due to a couple of possibilities.

Inhibition of the proteasome could be affecting turnover of a protein that affects

modification of FASN or ACC. Because of the short time of treatment with bortezomib

required to detect the increase of lipogenesis, a previously unidentified post-translational

modification may occur to increase activity of either FASN, or the upstream fatty acid

synthesis mediator, acetyl-CoA carboxylase (ACC). Alternatively, there could be

increased incorporation of fatty acid into phospholipid. Previous studies have

demonstrated that XBP-1(s) can increase phosphatidylcholine synthesis (40). However,

we do not see significant splicing of XBP-1 until eight hours and no detectable XBP-1

transcription factor at sixteen hours (Figure 4). Therefore, it is unlikely that XBP-1(s) is

inducing phospholipid synthesis in response to bortezomib treatment. Regardless, the

crosstalk between the fatty acid synthesis and proteasome pathways is the basis for

synergism when inhibitors of these pathways are combined. Concomitant with the

synergism, data showing increased levels of UPR signaling, particularly that of the alarm

arm, support a growing body of literature describing the ability for the UPR to induce cell

death after adaptation signals have been saturated or are ineffective (41-43).

The activation of adaptation and stress signals is critical to the cellular balance

between survival and cell death. PERK-dependent phosphorylation of eIF2! can act as a

rheostat to fine tune signals that balance survival and death in a cell experiencing ER

stress (44). If a cell is unable to sustain balanced levels of phosphorylated eIF2!, the cell

dies due to proteotoxicity. If the cell has levels of phosphorylated eIF2! that are too high,

86

the cell cannot translate enough protein to adapt and survive. As compared to the

combination of FASN inhibitors with bortezomib and bortezomib alone, FASN inhibitors

take the longest amount of time to induce cell death. Correspondingly, FASN inhibitors

result in sustained levels of phosphorylated eIF2! (Figure 3). The disruption of crosstalk

between the proteasome and fatty acid synthesis pathways induces early and robust

GADD34 expression to mediate the de-phosphorylation of eIF2! (Figure 3).

Coincidently, disrupting crosstalk quickly induces cell death, perhaps by proteotoxicity

associated with down-regulated eIF2! phosphorylation.

The IRE1 arm of the UPR is another signaling pathway designed to mediate

adaptation and alarm signals (41, 43, 45). IRE1 splices XBP-1 mRNA that is then

translated to a stable ER-stress specific transcription factor that upregulates ER

chaperones and other adaptation genes (46, 47). We show that FASN inhibitors and

bortezomib both induce splicing of XBP-1, but that the combined treatment results in the

accumulation of the XBP-1 transcription factor (Figure 4A-C). Therefore, disrupting the

fatty acid synthesis-crosstalk enhances adaptation signaling through the IRE1 arm of the

UPR. Disruption of crosstalk between the two pathways also shifts the balance of

adaptation and stress signals downstream of IRE1. Activated IRE1 can also interact with

tumor necrosis factor receptor adaptor factor 2 (TRAF2) to activate JNK and

corresponding alarm signals including expression of the ER stress pro-apoptotic protein

CHOP (48, 49). Indeed, disruption of crosstalk leads to robust activation of JNK, as well

as enhanced accumulation of CHOP, thereby confirming the hypothesis that increased ER

stress shifts the UPR program to cell death.

87

Consistent with other studies, the data presented here indicate that CHOP

mediates cell death when fatty acid synthesis-proteasome crosstalk is disrupted (Figure 6)

(50). However, it does not appear that CHOP plays a significant role in cell death induced

by FASN inhibitors or bortezomib, possibly due to the length of time it takes to induce

cell death by single agents. With the doses of FASN inhibitors of bortezomib used,

initiation of cell death takes a significantly long time. However, the combination of

agents induces cell death within 18 hours (Figure 6). The immediate and rapid onset of

cell death induced by crosstalk disruption could induce a more severe UPR alarm

response, in which CHOP plays a more critical and central role, whereas, with single

agents, the cell is able to remain within its UPR protocol of adaptation (Figure 6). That

JNK and CHOP mediate death in this system is consistent with the notion that IRE1

guides cell fate in response to ER stress (43).

Altogether, the data indicate that rapid and robust UPR activation occurs when

fatty acid synthesis and proteasome crosstalk is disrupted. While the connection between

the proteasome and the ER-associated degradation pathway of the UPR is well

established, the extent of involvement of the fatty acid synthesis pathway in mediating

proteasome function remains to be determined. It will be important for future studies to

determine the precise connections between these two important tumor-support systems.

Significant interest and opportunity lies in exploiting the careful balance of survival and

death mediated by the UPR to shift a tumor cell past levels compatible with survival to

augment cell death. Collectively, these data provide insight into how two important tumor

88

support systems can be inhibited to shift UPR balance from adaptation to stress and result

in increased tumor cell death.

89

References

1. Jayakumar A, Tai MH, Huang WY, et al. Human fatty acid synthase: properties and molecular cloning. Proc Natl Acad Sci U S A 1995;92:8695-8699.

2. Wakil SJ, Stoops JK, Joshi VC. Fatty acid synthesis and its regulation. Annu Rev Biochem 1983;52:537-579.

3. Kridel SJ, Lowther WT, Pemble CWt. Fatty acid synthase inhibitors: new directions for oncology. Expert Opin Investig Drugs 2007;16:1817-1829.

4. Kuhajda FP. Fatty-acid synthase and human cancer: new perspectives on its role in tumor biology. Nutrition 2000;16:202-208.

5. Kuhajda FP. Fatty acid synthase and cancer: new application of an old pathway. Cancer Research 2006;66:5977-5980.

6. Funabashi H, Kawaguchi A, Tomoda H, et al. Binding Site of Cerulenin in Fatty Acid Synthetase. J Biochem (Tokyo) 1989;105:751-755.

7. Kuhajda FP, Pizer ES, Li JN, et al. Synthesis and antitumor activity of an inhibitor of fatty acid synthase. Proc Natl Acad Sci U S A 2000;97:3450-3454.

8. Kridel SJ, Axelrod F, Rozenkrantz N, Smith JW. Orlistat is a novel inhibitor of fatty acid synthase with antitumor activity. Cancer Research 2004;64:2070-2075.

9. Alli PM, Pinn ML, Jaffee EM, McFadden JM, Kuhajda FP. Fatty acid synthase inhibitors are chemopreventive for mammary cancer in neu-N transgenic mice. Oncogene 2005;24:39-46.

10. Zhou W, Han WF, Landree LE, et al. Fatty acid synthase inhibition activates AMP-activated protein kinase in SKOV3 human ovarian cancer cells. Cancer Research 2007;67:2964-2971.

11. Wang HQ, Altomare DA, Skele KL, et al. Positive feedback regulation between AKT activation and fatty acid synthase expression in ovarian carcinoma cells. Oncogene 2005;24:3574-3582.

12. Liu X, Shi Y, Giranda VL, Luo Y. Inhibition of the phosphatidylinositol 3-kinase/Akt pathway sensitizes MDA-MB468 human breast cancer cells to cerulenin-induced apoptosis. Mol Cancer Ther 2006;5:494-501.

13. Van de Sande T, De Schrijver E, Heyns W, Verhoeven G, Swinnen JV. Role of the phosphatidylinositol 3'-kinase/PTEN/Akt kinase pathway in the overexpression of fatty acid synthase in LNCaP prostate cancer cells. Cancer Research 2002;62:642-646.

14. Bandyopadhyay S, Pai SK, Watabe M, et al. FAS expression inversely correlates with PTEN level in prostate cancer and a PI 3-kinase inhibitor synergizes with FAS siRNA to induce apoptosis. Oncogene 2005;24:5389-5395.

15. Menendez JA, Vellon L, Mehmi I, et al. Inhibition of fatty acid synthase (FAS) suppresses HER2/neu (erbB-2) oncogene overexpression in cancer cells. Proc Natl Acad Sci U S A 2004;101:10715-10720.

16. Menendez JA, Vellon L, Lupu R. Antitumoral actions of the anti-obesity drug orlistat (XenicalTM) in breast cancer cells: blockade of cell cycle progression, promotion of apoptotic cell death and PEA3-mediated transcriptional repression of Her2/neu (erbB-2) oncogene. Ann Oncol 2005;16:1253-1267.

90

17. Menendez JA, Colomer R, Lupu R. Inhibition of tumor-associated fatty acid synthase activity enhances vinorelbine (Navelbine)-induced cytotoxicity and apoptotic cell death in human breast cancer cells. Oncol Rep 2004;12:411-422.

18. Menendez JA, Lupu R, Colomer R. Inhibition of tumor-associated fatty acid synthase hyperactivity induces synergistic chemosensitization of HER -2/ neu -overexpressing human breast cancer cells to docetaxel (taxotere). Breast Cancer Res Treat 2004;84:183-195.

19. Menendez JA, Vellon L, Colomer R, Lupu R. Pharmacological and small interference RNA-mediated inhibition of breast cancer-associated fatty acid synthase (oncogenic antigen-519) synergistically enhances Taxol (paclitaxel)-induced cytotoxicity. Int J Cancer 2005;115:19-35.

20. Liu H, Liu Y, Zhang J-T. A new mechanism of drug resistance in breast cancer cells: fatty acid synthase overexpression-mediated palmitate overproduction. Mol Cancer Ther 2008;7:263-270.

21. Graner E, Tang D, Rossi S, et al. The isopeptidase USP2a regulates the stability of fatty acid synthase in prostate cancer. Cancer Cell 2004;5:253-261.

22. Hirano Y, Yoshida M, Shimizu M, Sato R. Direct Demonstration of Rapid Degradation of Nuclear Sterol Regulatory Element-binding Proteins by the Ubiquitin-Proteasome Pathway. J Biol Chem 2001;276:36431-36437.

23. Knowles LM, Axelrod F, Browne CD, Smith JW. A fatty acid synthase blockade induces tumor cell-cycle arrest by down-regulating Skp2. J Biol Chem 2004;279:30540-30545.

24. Knowles LM, Smith JW. Genome-wide changes accompanying knockdown of fatty acid synthase in breast cancer. BMC Genomics 2007;8:168-181.

25. Little JL, Wheeler FB, Fels DR, Koumenis C, Kridel SJ. Inhibition of fatty acid synthase induces endoplasmic reticulum stress in tumor cells. Cancer Research 2007;67:1262-1269.

26. Alberts B, Johnson A, Lewis J, et al., editors. Molecular Biology of the Cell, 4th ed. New York: Garland Science; 2002.

27. Gardner RC, Assinder SJ, Christie G, et al. Characterization of peptidyl boronic acid inhibitors of mammalian 20 S and 26 S proteasomes and their inhibition of proteasomes in cultured cells. Biochem J 2000;346:447-454.

28. Obeng EA, Carlson LM, Gutman DM, et al. Proteasome inhibitors induce a terminal unfolded protein response in multiple myeloma cells. Blood 2006;107:4907-4916.

29. Nawrocki ST, Carew JS, Pino MS, et al. Bortezomib sensitizes pancreatic cancer cells to endoplasmic reticulum stress-mediated apoptosis. Cancer Res 2005;65:11658-11666.

30. Fribley A, Zeng Q, Wang C-Y. Proteasome Inhibitor PS-341 Induces Apoptosis through Induction of Endoplasmic Reticulum Stress-Reactive Oxygen Species in Head and Neck Squamous Cell Carcinoma Cells. Mol Cell Biol 2004;24:9695-9704.

31. Chou T-C, Talalay P. Quantitative analysis of dose-effect relationships: the combined effects of multiple drugs or enzyme inhibitors. Advances in Enzyme Regulation 1984;22:27-55.

91

32. Kincaid MM, Cooper AA. ERADicate ER stress or die trying. Antioxid Redox Signal 2007;9:2373-2387.

33. Novoa I, Zeng H, Harding HP, Ron D. Feedback inhibition of the unfolded protein response by GADD34-mediated dephosphorylation of eIF2alpha. J Cell Biol 2001;153:1011-1022.

34. Ma Y, Hendershot LM. Delineation of a negative feedback regulatory loop that controls protein translation during endoplasmic reticulum stress. J Biol Chem 2003;278:34864-34873.

35. Harding HP, Novoa I, Zhang Y, et al. Regulated Translation Initiation Controls Stress-Induced Gene Expression in Mammalian Cells. Molecular Cell 2000;6:1099-1108.

36. Lu PD, Harding HP, Ron D. Translation reinitiation at alternative open reading frames regulates gene expression in an integrated stress response. J Cell Biol 2004;167:27-33.

37. Guyton KZ, Xu Q, Holbrook NJ. Induction of the mammalian stress response gene GADD153 by oxidative stress: role of AP-1 element. Biochem J 1996;314:547-554.

38. Urano F, Wang X, Bertolotti A, et al. Coupling of Stress in the ER to Activation of JNK Protein Kinases by Transmembrane Protein Kinase IRE1. Science 2000;287:664-666.

39. Shen Y, Ballar P, Apostolou A, Doong H, Fang S. ER stress differentially regulates the stabilities of ERAD ubiquitin ligases and their substrates. Biochemical and Biophysical Research Communications 2007;352:919-924.

40. Sriburi R, Bommiasamy H, Buldak GL, et al. Coordinate regulation of phospholipid biosynthesis and secretory pathway gene expression in XBP-1(S)-induced endoplasmic reticulum biogenesis. J Biol Chem 2007;282:7024-7034.

41. Xu C, Bailly-Maitre B, Reed JC. Endoplasmic reticulum stress: cell life and death decisions. J Clin Invest 2005;115:2656-2664.

42. Ma Y, Hendershot LM. The role of the unfolded protein response in tumour development: friend or foe? Nat Rev Cancer 2004;4:966-977.

43. Lin JH, Li H, Yasumura D, et al. IRE1 Signaling Affects Cell Fate During the Unfolded Protein Response. Science 2007;318:944-949.

44. Novoa I, Zhang Y, Zeng H, et al. Stress-induced gene expression requires programmed recovery from translational repression. Embo J 2003;22:1180-1187.

45. Ron D, Walter P. Signal integration in the endoplasmic reticulum unfolded protein response. Nat Rev Mol Cell Biol 2007;8:519-529.

46. Calfon M, Zeng H, Urano F, et al. IRE1 couples endoplasmic reticulum load to secretory capacity by processing the XBP-1 mRNA. Nature 2002;415:92-96.

47. Lee A-H, Iwakoshi NN, Glimcher LH. XBP-1 Regulates a Subset of Endoplasmic Reticulum Resident Chaperone Genes in the Unfolded Protein Response. Mol Cell Biol 2003;23:7448-7459.

48. Wang XZ, Harding HP, Zhang Y, et al. Cloning of mammalian Ire1 reveals diversity in the ER stress responses. Embo J 1998;17:5708-5717.

49. Urano F, Wang X, Bertolotti A, et al. Coupling of stress in the ER to activation of JNK protein kinases by transmembrane protein kinase IRE1. Science 2000;287:664-666.

92

50. Zinszner H, Kuroda M, Wang X, et al. CHOP is implicated in programmed cell death in response to impaired function of the endoplasmic reticulum. Genes Dev 1998;12:982-995.

93

CHAPTER IV

INHIBITION OF FATTY ACID SYNTHASE INDUCES CASPASE INDEPENDENT CELL DEATH THROUGH INDUCTION OF REACTIVE OXYGEN SPECIES

Joy L. Little and Steven J. Kridel

J. L. Little performed all of the experiments described in this chapter, except for the

western blot analysis of Bcl-2-overexpressing cells treated with orlistat for

phosphorylation of eIF2!, which were performed by Karen Burger. J. L. Little prepared

the manuscript. Dr. S. J. Kridel acted in an advisory and editorial capacity.

94

IV.1. Abstract FASN inhibitors induce tumor cell death in vitro and in vivo and have attractive

chemotherapeutic potential. FASN inhibitors induce many characteristics associated with

the mitochondrial pathway of apoptosis, but the exact mechanism has yet to be

elucidated. The data herein show that FASN inhibitor-induced cell death in PC-3 cells

occurs independently of caspase activation. Additionally, the anti-apoptotic Bcl-2 protein

does not protect tumor cells from FASN inhibitors. Recently we have shown that FASN

inhibitors induce ER stress activation of the PERK and IRE1 arms of the UPR and

hypothesize that cell death is mediated through this pathway. While Bcl-2 has been

linked to protection of ER stress, cytosolic Bcl-2 appears to partially inhibit

phosphorylation of eIF2! in response to FASN inhibition, but has no effect on IRE1-

mediated splicing of XBP-1. Interestingly, despite the fact that deficiencies in PERK

signaling yield hypersensitivity to FASN inhibitor treatment, cells unable to

phosphorylate eIF2! are not sensitive to FASN inhibition. Therefore, cell death induced

by FASN inhibition is independent of phosphorylated eIF2!. PERK has also been

associated with a pro-survival antioxidant response, therefore, the status of reactive

oxygen species was investigated in cells treated with FASN inhibitors. Indeed, FASN

inhibitors induce ROS accumulation and are protected from cell death in the presence of

an ROS scavenger. It is possible PERK may be activating a downstream pro-survival

antioxidant response in cells treated with FASN inhibitors. Alternatively, FASN

inhibitors may be inducing ER stress-mediated cell death through an alternate

mechanism. These data provide insight into the pathways activated when FASN activity

is disrupted in tumor cells.

95

IV.2. Introduction

Fatty acid synthase (FASN) is a multifunctional enzyme that catalyzes the

terminal steps in the synthesis of the 16-carbon fatty acid palmitate in cells (1, 2). In

normal tissue the FASN expression levels are relatively low as fatty acid is generally

supplied by dietary fatty acids. On the other hand, FASN is expressed at significantly

higher levels in many tumors including those of the prostate, breast, colon, ovary and

others (3-5). Several reports have demonstrated that FASN expression levels correlate

with tumor progression, aggressiveness and metastasis (4-6). Because of the strong link

between FASN expression and cancer, FASN has become an attractive target for

therapeutic intervention.

The functional connection between FASN and tumor progression has been

provided by the discovery and design of small molecule drugs that inhibit the catalytic

activity of FASN (7, 8). To date, all small molecule inhibitors of FASN have

demonstrated ability to block tumor growth in vivo (9-16). Inhibition of FASN activity

results in multiple aspects of apoptosis. For instance, FASN inhibitors induce DNA

fragmentation and changes in cell morphology characteristic of apoptosis (10, 17, 18).

FASN inhibitors induce the loss of mitochondrial potential and cytochrome c release

(19). In addition, the pro-apoptotic factor Bax is induced in cells treated with FASN

inhibitors and appears to correlate with the extent of cell death induced by FASN

inhibitors (19). FASN inhibition induces accumulation of ceramide and apoptotic factors

such as BNIP3, tumor necrosis factor-related apoptosis-inducing ligand (TRAIL), and

death-associated protein kinase 2 (DAPK2) (20). In addition to links with the

96

mitochondria, cell death induced by FASN inhibition has also been linked to the

accumulation of reactive oxygen species (ROS) (21, 22). ROS have even been shown to

induce FASN expression (23). The prevailing hypothesis, however, regarding the

mechanism of FASN inhibitor cell death is attributed to accumulation of malonyl-CoA

and, potentially, its interaction with CPT-1, the enzyme responsible for transferring fatty

acids into the mitochondria for oxidation (10, 24, 25).

Work from our lab indicates that cell death induced by FASN inhibitors could be

mediated through the ER as FASN inhibitors induce ER stress before cell death occurs.

We hypothesize that FASN supplies fatty acid as substrate for phospholipids critical for

maintaining ER homeostasis (26). In support of this hypothesis, inhibiting FASN and

ACC reduces incorporation of fatty acid into membrane phospholipids, an event which

occurs in the endoplasmic reticulum (25). Furthermore, inhibiting fatty acid incorporation

into phospholipids corresponds to a decrease in cell volume and other morphological

changes ultimately leading to apoptosis (27). In connection with the data from our lab

showing that FASN inhibitors perturb ER integrity, cell death could be mediated by the

ER stress response, which then could occur independently of, or signal to, the

mitochondrial pathway of apoptosis (26). In fact, the UPR has been linked to

accumulation of ROS, as well as cell death. One mediator of the UPR adaptation arm,

activating transcription factor 4 (ATF4), protects cells from oxidative stress (28). ROS

accumulation caused by activity of tumor necrosis factor alpha (TNF!) can induce ER

stress and activation of the UPR. In turn, the UPR prevents downregulation of

antioxidants such as glutathione to help recover from ROS accumulation (29). Finally,

97

PERK can phosphorylate the anti-oxidant pro-survival protein NF-E2 related factor

(Nrf2) to protect against ER stress induced ROS (30, 31).

Given the links between fatty acid synthesis, oxidative stress and the UPR, we

wanted to resolve the connections between the three pathways in cell death induced by

FASN inhibition. The data presented herein shows that caspase cleavage is not required

for FASN inhibitor-induced cell death and that Bcl-2 does not protect cell death induced

by FASN inhibition. Bcl-2 does protect against phosphorylation of eIF2!, however,

eIF2! phosphorylation is also not required for FASN inhibitor-induced cell death. Lastly,

ROS are induced in cells treated with FASN inhibitors and blocking ROS rescues cell

death. These data provides important insight into the mechanism of cell death induced by

FASN inhibitors and the potential links between the UPR and oxidative stress in this

process.

98

IV.3. Materials and Methods

Materials. The PC-3 cells were obtained from American Type Culture Collection

(Manassas, VA). Wild-type and PERK-/- mouse embryonic fibroblasts (MEFs) were

obtained from David Ron, M.D. (Skirball Institute for Biomolecular Medicine, New York

University School of Medicine, New York, NY). S51A MEFs were obtained from R.

Kauffman, PhD (University of Michigan Medical School, Ann Arbor, MI). HT29

colorectal cancer cells containing pBabe-puromycin empty vector or pBabe-puromycin

GADD34 were obtained from Constantinos Koumenis, PhD (University of Pennsylvania

School of Medicine, Philadelphia, PA). Cell culture medium and supplements were from

Invitrogen (Carlsbad, CA). Antibodies against eIF2!, phosphorylated eIF2!, cleaved

caspase 3 (Asp175), cleaved caspase 9, and cleaved PARP (Asp214) were from Cell

Signaling Technologies (Beverly, MA). Antibody against FASN was from BD

Transduction Labs (San Diego, CA). Antibody against Bcl-2 was from Santa Cruz

Biotechnology, Incorporated (Santa Cruz, CA). Antibody against "-tubulin was from

NeoMarkers (Fremont, CA). Trizol was from Invitrogen (Carlsbad, CA). Avian

Myleoblastosis Virus (AMV) Reverse Transcriptase and Taq Polymerase were from

Promega (Madison, WI). Dichlorofluoroscein diacetate and N-acetyl cysteine was

purchased from Sigma (St. Louis, MO). Oligonucleotides were synthesized by Integrated

DNA Technologies (Coralville, IA). Orlistat was purchased from Roche (Nutley, NJ). All

other reagents were purchased from Sigma (St. Louis, MO), Calbiochem (San Diego,

CA) or BioRad (Hercules, CA).

99

Cell culture and drug treatments. Prostate tumor PC-3 cells were maintained in RPMI

1640 supplemented with 10% fetal bovine serum at 37#C and 5% CO2. MEFs were

maintained in DMEM-high glucose supplemented with 10% fetal bovine serum and 1

µg/ml puromycin. S51A MEFs were supplemented with 10 µM non-essential amino

acids and 0.55 µM 2-mercaptoethanol. HT-29 colon carcinoma cells expressing the

pBabe-puro empty vector or the pBabe-puro-GADD34 construct were maintained in

McCoy’s 5A media supplemented with 1 µg/ml puromycin and 20% FBS, 10 µM non-

essential amino acids and 0.55 µM 2-mercaptoethanol. Cells were treated for the times

and with drug concentrations as indicated. Orlistat was extracted from capsules in EtOH

as described previously and stored at -80#C. Further dilutions were made in dimethyl

sulfoxide (DMSO).

Immunoblot analysis. Cells were harvested after the indicated treatments, washed with

ice-cold phosphate-buffered saline, and lysed in buffer containing 1% Triton X-100

supplemented with protease, kinase, and phosphatase inhibitors including: 200 µM

phenylmethanesulphonylfluoride (PMSF), 5 µg/ml aprotinin, 5 µg/ml pepstatin A, 5

µg/ml leupeptin, 50 µM okadeic acid just before use. Protein samples were

electrophoresed through 10%, 12%, or 13.5% SDS-polyacrylamide gels and transferred

to nitrocellulose, except for blots to detect phosphorylated eIF2! and eIF2!, which were

transferred to Immobilon-P membrane (PVDF). Immunoreactive bands were detected by

enhanced chemiluminescence (Perkin Elmer). "-actin or "-tubulin were used as loading

controls for all western blots.

100

Generation of GADD34 expressing cells. To generate human tumor cells with a

constitutively active C-terminus fragment of GADD34, HT-29 cells seeded in 6-well

plates were transfected with 1 µg of pBabe-puro or pBabe-puro-GADD34 using

Lipofectamine (Invitrogen). These plasmids have been described previously (32). Stable

populations of each construct were selected by incubating transfected cells with 3 µg/ml

puromycin for 48 hours. The transfected cell populations were then maintained in 1

µg/ml puromycin for subsequent experiments in the media described above.

Clonogenic survival assays. Cells were plated in 6-well plates at low density 48 hours

prior to each experiment, except for MEFs, which were plated 24 hours prior. Densities

varied between cell type with PC-3 cells seeded at 800 cells/well, while MEFs and HT29

cells were seeded at 400 cells per well. Fresh medium containing the indicated drugs was

added at the indicated concentrations for 16-20 hours as indicated. The media was then

removed, the wells were washed and fresh medium was added. Plates were incubated

until macroscopic colonies were formed. Visualization of colonies was performed as

described previously (26). Colonies were quantified by counting. Survival of treated cells

was normalized relative to vehicle treated cells and statistical significance was

determined by two-tailed Student's t tests.

MTS survival assays. Cells were plated in 96-well plates at a density of 4000 cells per

well for 48 hours prior to each experiment. Fresh medium containing the indicated drugs

at the indicated concentrations for 24-72 hours as indicated. CellTiter96 viability (MTS)

reagent was then added to each well and allowed to incubate for 1-3 hours. Absorbance

101

was then measured at 492 nm – 690 nm and survival of treated cells was normalized

relative to vehicle treated cells and statistical significance was determined by two-tailed

Student's t tests.

ROS Detection. PC-3 cells were seeded in 24-well plates at a density of 1 x 105 cells per

well. Before treating, cells are incubated with 20 µM Dichlorofluorosciene-diacetate

(DCFH) or a non-hydrolyzable C-369 probe as a control to verify background

fluorescence was unchanged between treatments. The probe was removed, the cells were

washed repeatedly (3-5 times) with PBS, and phenol-free RPMI media was replaced with

or without the indicated drugs. At the indicated timepoints, fluorescence was measured at

an excitation wavelength of 498 nm and an emission wavelength of 522 nm on a BMG

LabTech Fluorostar Optima Fluorometer. Fluorescence was determined relative to

vehicle treated controls.

Detection of GADD34 expression. Cells were exposed to the various drug treatments or

transfected with siRNA for the indicated times. RTPCR was performed for GADD34

expression as described previously (26).

102

IV.4. Results

Inhibiting FASN in tumor cells induces cell death both in vitro and in vivo, but the

exact mechanism has not been elucidated (3-5). Given the associations between FASN-

inhibitor induced effects and the mitochondria, we first hypothesized that the

mitochondrial pathway of apoptosis may be involved in cell death induced by FASN

inhibitors. Because caspase activation is a key component of the mitochondrial pathway

of apoptosis, cells treated with FASN inhibitors were treated with and without the

caspase inhibitor ZVAD-fmk (ZVAD) and MTS survival assays were performed. The

general kinase inhibitor staurosporine, known to induce the mitochondrial pathway of

apoptosis, was used as a positive control. As expected, ZVAD increased the survival of

staurosporine treated PC-3 cells. Interestingly, cells treated with either C75 (Figure 1A)

or cerulenin (Figure 1B) were not rescued by the addition of ZVAD. This data indicates

that death induced by FASN inhibitors occurs independently of caspase activity. This is

despite the fact that FASN inhibitors induce cleavage of both caspases 3 and 9, as well as

the downstream caspase target PARP (13, 19, 26).

The data indicating that caspase activity does not appear to mediate cell death

induced by FASN inhibitors led us to investigate the role of Bcl-2 in cell death induced

by FASN inhibitors. Bcl-2 acts at the mitochondria to inhibit pro-apoptotic proteins such

as Bax and Bak from facilitating cytochrome c release (33). Bcl-2 also can act at the

endoplasmic reticulum to prevent calcium ion release and the resulting induction of cell

death (34). PC-3 cells were engineered to over-express the anti-apoptotic protein Bcl-2.

Empty vector and cells over-expressing Bcl-2 were collected for western blot analysis to

103

Figure 1. Cell death induced by FASN inhibitors is independent of caspase activity. A, PC-3 cells were seeded for MTS viability assays in 96-well plates. After 2 days, media was removed, cells were washed once with PBS and serum free media was added. After 24 hours, the cells were incubated 30 minutes with 2 µM of the pan caspase inhibitor ZVAD-fmk in serum-free media. Then, serum-free media was added to the ZVAD or control media with vehicle, C75 (9 µg/ml), or staurosporine (1µM) for 18 hours. CellTiter96 reagent was then added to each well and allowed to incubate for 2 hours. Absorbance was then read at 492 nm and viability was assessed relative to vehicle-treated PC-3 cells. B, PC-3 cells were seeded for MTS viability assays and switched to serum-free media as in A. After 24 hours, the cells were incubated 30 minutes with 2 µM ZVAD-fmk in serum-free media. Then, serum-free media was added to the ZVAD or control media with vehicle, cerulenin (15 µg/ml), or staurosporine (1µM) for 18 hours, resulting in a final concentration of 1µM ZVAD. CellTiter96 reagent was then added to each well and allowed to incubate for 2 hours. Absorbance was then read at 492 nm and viability was assessed relative to vehicle-treated PC-3 cells.

verify that the Bcl-2 over-expressing cells show a marked increase in Bcl-2 protein levels

(Figure 2A). Incidentally, these cells also show comparative levels of FASN protein.

Next, the control and Bcl-2 expressing cells were treated with orlistat for 48 hours and

collected for western blot analysis of key apoptotic markers. Bcl-2 overexpressing cells

show reduced cleavage of caspase 3, no reduction in full length caspase 9, and negligible

cleavage of PARP in response to orlistat as compared to vector containing cells also

treated with orlistat (Figure 2B). MTS survival assays were then performed to test

whether Bcl-2 overexpression would maintain viability in cells treated with orlistat.

Staurosporine treatment of vector containing PC-3 cells caused a dramatic reduction of

DMSO C75 Staurosporine- + - + - + zvad-fmk

DMSO cerulenin Staurosporine- + - + - + zvad-fmk

A B

0

0.2

0.4

0.6

0.8

1

1.2

00.20.40.60.8

11.21.4

Rel

ativ

e V

iabi

lity

Rel

ativ

e V

iabi

lity

104

viability that was mostly prevented in the Bcl-2 overexpressing cells (Figure 2C).

However, treatment with either cerulenin or orlistat results in no difference in cell death

between vector and Bcl-2 overexpressing cells (Figure 2C). Therefore, FASN inhibition

induces cell death independent of Bcl-2 protection, indicating that death induced by

FASN inhibitors may be occurring through an alternate mechanism.

Figure 2. Bcl-2 does not protect PC-3 cells from FASN inhibitor-induced cell death. A, PC-3 cells transfected with either empty vector, or Bcl-2 were collected for western blotting analysis with antibodies specific for FASN, Bcl-2, or "-tubulin. B, Vector or Bcl-2 overexpressing PC-3 cells were treated with 50 µM orlistat in serum-free media or vehicle. After 48 hours, cells were collected for western blotting analysis with antibodies specific for cleaved caspase 3, full length caspase 9, cleaved PARP, and "-tubulin. C, Vector and Bcl-2 overexpressing PC-3 cells were seeded for a MTS survival assay as described in Materials and Methods. Staurosporine (1 µM) or cerulenin (10 µg/ml) was added for 24 hours, while orlistat (50 µM) was added for 72 hours. At the end of each timepoint, MTS reagent was added, absorbance was measured at 492 nm, and survival analyzed relative to untreated cells.

Though Bcl-2 does not protect prostate tumor cells from FASN inhibitor-induced

cell death, Bcl-2 has been shown to play a role in cell death induced by endoplasmic

reticulum (ER) stress (35, 36). Because our lab has recently shown that FASN inhibitors

induce ER stress, we wanted to determine whether Bcl-2 affects activation of key ER

stress pathway signals (26). Control and Bcl-2 overexpressing cells were treated with a

timecourse of orlistat and cell lysates were collected for western blot analysis of eIF2!

phosphorylation. Control cells treated with orlistat show induced phosphorylation of

0

0.2

0.4

0.6

0.8

1

1.2

control Bcl-2

Bcl-2Bcl-2

FASNFASN

"-tubulin

control Bcl-2Con Orl Con Orl

"-tubulin

cleaved caspase-3

caspase-9

cleaved PARP

control Bcl-2Con Orl Con Orl

"-tubulin

cleaved caspase-3

caspase-9

cleaved PARP

Rel

ativ

e V

iabi

lity

ControlBcl-2ControlBcl-2

Con St Cer Orl

A CB

105

eIF2! at 8 hours and further induction at 20 hours (Figure 3A). The level of

phosphorylated eIF2! at 20 hours is similar to levels induced by the positive control

thapsigargin. Orlistat induction of phosphorylated eIF2! at 8 and 20 hours is consistent

with published work (26). Bcl-2 overexpressing cells show a higher basal level of

phosphorylated eIF2! that is largely unchanged at 8 hours, but somewhat increased at 20

hours to levels comparable to levels induced by thapsigargin treatment (Figure 3A).

However, the level of induction of phosphorylated eIF2! by orlistat or thapsigargin is

severely compromised compared to vector-containing PC-3 cells. Therefore, Bcl-2

appears to partially inhibit eIF2! phosphorylation in response to orlistat treatment.

Another hallmark of ER stress and activation of the unfolded protein response

(UPR) is IRE1-mediated processing of XBP-1. Processing of XBP-1 occurs under

conditions of ER stress resulting in the translation of the ER stress specific transcription

factor that can upregulate key genes involved in the adaptation arm of the UPR. PC-3

cells treated with a timecourse of orlistat show moderate XBP-1 splicing at 8, 12, and 16

hours consistent with earlier work (Figure 3B) (26). Bcl-2 overexpressing PC-3 cells

treated with orlistat also show moderate XBP-1 processing at all timepoints. XBP-1

processing in response to thapsigargin treatment is also similar between the vector and

Bcl-2 overexpressing cells. Therefore, Bcl-2 does not affect IRE1-mediated processing of

XBP-1 in PC-3 cells treated with the FASN inhibitor orlistat, indicating IRE1 is not

affected by Bcl-2 activity under such conditions.

106

Figure 3. Bcl-2 inhibits eIF2! phosphorylation, but not XBP-1 processing in cells treated with orlistat. A, PC-3 empty vector and Bcl-2 overexpressing cells were treated for 8 or 20 hours with 50 µM orlistat, 1 hour 1 µM thapsigargin, or vehicle control. Cells were collected for western blot analysis with antibodies specific for phosphorylated eIF2! and "-actin. B, PC-3 cells transfected with empty vector or Bcl-2 were treated with vehicle (DMSO) or 50 µM orlistat for 8, 12, and 16 hours, or 1µM thapsigargin for one hour. Total RNA was collected with TRIzol and RT-PCR was performed with oligonucleotides specific for XBP-1 and "-actin. XBP-1 (us) is indicated by the 473 bp product and XBP-1 (s) is indicated by the 447 bp fragment.

The UPR is a coordinated set of signals that act to initially help the cell adapt to

ER stress. Phosphorylation of eIF2! by PERK is one of these key signals. Therefore,

cells that are deficient for PERK cannot respond to ER stress completely and are sensitive

to these agents (37). Previously, we have shown that cells deficient for PERK are

hypersensitive to FASN inhibitors as well (26). The primary event of PERK signaling is

the phosphorylation of eIF2!. Therefore, it is not surprising that cells with a Ser51Ala

mutant allele of eIF2! (S51A) that is unable to be phosphorylated are equally sensitive to

ER stressors (38). To test the role of eIF2! phosphorylation downstream of PERK

activation after FASN inhibition, wild-type (WT), PERK-/- and S51A MEFs were seeded

for clonogenic survival assays and treated with vehicle, orlistat, or thapsigargin as a

positive control. Thapsigargin treatment was titrated to a dose low enough to cause little

reduction in clonogenic survival of WT MEF cells. However, both PERK-/- and S51A

0 8 20 Tgn 0 8 20 TgnOrl (hrs) Orl (hrs)

PC-3 Bcl-2

p-eIF2!

"-actin

A

B

0 8 12 16 Tgn 0 8 12 16 Tgn

Orl (hrs) Orl (hrs)PC-3 Bcl-2

XBP-1 us/s

107

MEFs showed a dramatic reduction in clonogenic survival after thapsigargin treatment, as

expected (Figure 4A). Clonogenic survival of WT MEFs was minimally affected by

orlistat treatment, whereas PERK-/- MEFs were dramatically more sensitive, also as

expected (P < 0.01). Surprisingly, S51A MEFs showed no significant decrease in

clonogenicity after orlistat treatment (Figure 4A). Western blotting confirms that S51A

MEFs showed no detectable eIF2! phosphorylation in response to either orlistat or

thapsigargin indicating the S51A cells were functionally sound (Figure 4B). Due to the

surprising nature of this result, we decided to utilize another method to confirm that

Figure 4. Reduction in clonogenic survival induced by FASN inhibition is not dependent on eIF2! phosphorylation. A, Immortalized and transformed MEFs with a transgene of eIF2! that is unable to be phosphorylated (S51A MEFs), PERK-/- MEFs, and their wild-type counterparts were seeded at low density for clonogenic survival analysis. Cells were then treated with 50 µM orlistat or 200 nM thapsigargin for 16 hours. Drug-containing media was then removed, cells were washed with PBS, and fresh media was replaced. Colonies were assessed relative to untreated controls for each cell type. Statistical significance was determined between the WT and S51A MEFs treated with orlistat (P=0.64) and between the WT and PERK-/- MEFs treated with orlistat (P<0.01) using students t-test. B, WT and S51A MEFs were treated with vehicle, 50 µM orlistat for 14 and 18 hours, or 1 µM thapsigargin for one hour and collected for western blot analysis using antibodies specific for phosphorylated and total eIF2!.

A

0 14 18 Tgn 0 14 18 Tgn

eIF2!

p-eIF2!

Orl (hrs) Orl (hrs)WT S51A

BDMSO Orl Tgn

0

0.2

0.4

0.6

0.8

1

1.2 WT

PERK

S51A

Clo

noge

nic

Surv

ival

108

FASN inhibitor-induced cell death is insensitive to eIF2! phosphorylation.

Others have shown that cells overexpressing GADD34, a protein that interacts

with protein phosphatase 1 (PP1) to mediate the de-phosphorylation of eIF2!, are

phenotypically similar to the S51A MEFs (39). Therefore, we transfected HT29 cells

with GADD34 or a control pBabe-puro empty vector to verify the results of the S51A

MEFs. HT29 empty vector and GADD34 cells were treated with C75 and showed

negligible difference in clonogenic survival (P = 0.4), despite a marked difference in

thapsigargin treated cells (P < 0.001) (Figure 5A). Similarly, HT29 GADD34 cells

treated with orlistat are no more sensitive to cell death than the vector containing

counterparts (P=0.5, Figure 5B). HT29 GADD34 cells, similar to the S51A MEFs, also

showed no detectable eIF2! phosphorylation in response to orlistat or thapsigargin

(Figure 5C). Therefore, viability in response to FASN inhibition is independent of eIF2!

phosphorylation.

Cells deficient for PERK signaling are hypersensitive to FASN inhibition, but this

effect is independent of eIF2! phosphorylation, a primary event downstream of PERK in

the UPR. The only other known downstream target of PERK kinase activity is the pro-

survival antioxidant protein NF-E2 related factor (Nrf2) (30). Nrf2 responds to alterations

in redox status at the ER to activate downstream adaptation genes (31). Therefore, we

tested whether FASN inhibitors can induce accumulation of reactive oxygen species

(ROS) using a fluorescent probe activated by oxidation. PC-3 cells were treated with

vehicle, orlistat, C75, or hydrogen peroxide as a positive control for 24 hours. These cells

109

were then incubated with dichlorofluoroscein di-acetate and the fluorescence was

measured relative to vehicle treated controls. As expected, hydrogen peroxide treatment

resulted in an 8-9 fold increase in fluorescence (Figure 6A). Interestingly, orlistat and

C75 treatments induced a 3 and 4 fold increase in fluorescence, respectively, indicating

Figure 5. GADD34 overexpression does not rescue clonogenic survival reduced by FASN inhibition. A, HT29 cells were transfected with empty vector or GADD34. These cells were seeded for clonogenic analysis at low density. HT29 vector and GADD34 cells were then treated with 6 µg/ml C75 or 50 nM thapsigargin for 16 hours. Drug-containing media was then removed, cells were washed with PBS, and fresh media was then replaced. Clonogenic survival was determined relative to vehicle treated controls. B, HT29 vector and GADD34 cells were seeded for clonogenic analysis as in A. Cells were then treated with 25 µM orlistat or 100 nM thapsigargin for 16 hours. Fresh media was replaced and colonies allowed to grow. Clonogenic survival was measured relative to vehicle treated controls. C, HT29 vector and GADD34 cells were treated with vehicle, 50 µM orlistat for 14 and 18 hours, or 1 µM thapsigargin for 1 hour. Cells were then collected for western blot analysis using antibodies specific for phosphorylated and total eIF2!.

A

B

C

0

0.2

0.4

0.6

0.8

1

1.2HT29

GADD34

0

0.2

0.4

0.6

0.8

1

1.2HT29

GADD34

HT29

GADD34

0

0.2

0.4

0.6

0.8

1

1.2HT29GADD34

0

0.2

0.4

0.6

0.8

1

1.2HT29GADD34HT29GADD34

DMSO Orl Tgn

DMSO C75 Tgn

0 14 18 Tgn 0 14 18 Tgn

eIF2!

p-eIF2!

Orl (hrs) Orl (hrs)HT29 GADD34

Clo

noge

nic

Surv

ival

Clo

noge

nic

Surv

ival

110

that inhibition of FASN induces accumulation of ROS (Figure 6A). To determine

whether this increase in reactive oxygen species has a functional consequence,

clonogenic survival assays of PC-3 cells were performed with the FASN inhibitor C75

and the simultaneous treatment with the ROS scavenger N-acetyl cysteine (NAC).

Concurrent treatment of PC3 cells with C75 and NAC resulted in a dramatic rescue of

clonogenic survival as compared to cells treated with C75 alone (P<0.001, Figure 6B).

Therefore, ROS are induced in response to FASN inhibition and contribute to the

resulting cell death.

Figure 6. FASN inhibitors induce reactive oxygen species. A, PC-3 cells were incubated with dicholorofluorescein diacetate (DCFH-DA) for 45 minutes, then washed with PBS several times and treated with vehicle, 50 µM orlistat or 9 µg/ml C75 for 24 hours in phenol-free media. Fluorescence was measured using a fluorometer at 492 nm, excitation, 522 nm, emission. Relative fluorescence was determined compared to vehicle treated control. B, PC-3 cells were seeded for clonogenic survival analysis at low density. Cells were incubated with 5 mM N-acetyl cysteine (NAC) or regular media for 4 hours. Fresh media containing vehicle or 9 µg/ml C75 in the presence or absence of NAC was then added to cells for 16 hours. Drug-containing media was then removed, cells washed, and fresh media replaced. Clonogenic survival was assessed compared to vehicle treated control and statistical significance was determined using student’s t-test between C75 and C75 + NAC treated cells (P < 0.001).

0

0.2

0.4

0.6

0.8

1

1.2

A

ControlNAC

**

B

0

2

4

6

8

10

DMSO H2O2 Orl C75 DMSO C75

Clo

noge

nic

Surv

ival

Rel

ativ

e Fl

uore

scen

ce

111

IV.5. Discussion

Because of the unique expression of FASN in tumors, much emphasis has been

put toward the development of pharmacological agents that inhibit FASN activity and,

therefore, inhibit tumor growth and progression. So far, anti-FASN drugs have

successfully inhibited tumor growth in several tumor models with minimal side effects.

Therefore, FASN represents a highly tractable anti-tumor target with significant clinical

potential. Understanding cell death mechanisms is important for clinical application and

for understanding tumor biology; however, the mechanism of FASN inhibitor-induced

cell death has not been fully elucidated. The prevailing hypothesis regarding cell death

induced by FASN inhibition is attributed to malonyl-CoA accumulation and subsequent

apoptosis (10, 24, 25). Other data implicate the accumulation of reactive oxygen species

in FASN inhibitor-induced cell death (21-23). All of these studies indicate that a tumor

cell overexpressing FASN requires fatty acid synthesis for proper cellular membrane

integrity and function. Data from our lab showing that FASN inhibitors induce ER stress

suggests that the ER may be a primary sensor of cellular fatty acid and, subsequent

phospholipid levels (26). In fact, there are significant links between the ER and

mitochondria during apoptosis (36, 40, 41). The data presented herein contributes to the

understanding of how the mitochondria, ER, and ROS affect tumor cell death initiated by

FASN inhibition.

Caspase cleavage is a critical hallmark of the mitochondrial pathway of apoptosis.

Interestingly, cell death induced by FASN inhibition proceeds independent of caspase

cleavage. Furthermore, the anti-apoptotic factor Bcl-2 thought to control mitochondrial

112

activity and cytochrome c release, does not protect cells from FASN inhibition. However,

we and others have shown that caspase cleavage does indeed occur (19, 26). In addition,

mitochondrial membrane potential is disrupted and cytochrome c is released in cells

treated with FASN inhibitors (19). Therefore, these results were surprising, but indicate

that the trigger of cell death is upstream and independent of key aspects of the

mitochondria.

We have shown that FASN inhibitors induce ER stress and proposed that cell

death induced by FASN inhibitors could be mediated through the UPR response (26).

Bcl-2 is known to also reside at the ER and can control apoptosis through changes in Ca2+

flux (34). In fact, Bcl-2 overexpression protects against death induced by the ER stressor

and SERCA pump inhibitor thapsigargin (34). While Bcl-2 does not protect against cell

death induced by FASN inhibitors Bcl-2 does inhibit, to a degree, FASN inhibitor-

induced phosphorylation of eIF2! (Figure 3). Phosphorylation of eIF2! is a primary

event in UPR signaling for adaptation (42). Others have shown that cells lacking the

ability to phosphorylate eIF2! after ER stress are hypersensitive similar to the effect of

cells lacking PERK (38, 39). Our data shows that cells lacking ability to phosphorylate or

sustain phosphorylation of eIF2! are not hypersensitive to cell death induced by FASN

inhibition like the cells without PERK activity (Figures 4, 5).

There are multiple links between the mitochondria and the ER in mediating

apoptosis that describe how the anti-apoptotic Bcl-2 and the pro-apoptotic Bax and Bak

are important at both organelles. For instance, one study shows that ER-targeted Bcl-2

113

can protect cells from staurosporine by preventing mitochondrial Bax activation and

subsequent cytochrome c release (35). Interestingly, Bax and Bak directly interact with

and are required for IRE1 activity at the ER membrane (43). Data herein shows Bcl-2

does not affect IRE1-mediated splicing of XBP-1 in cells treated with FASN inhibitors.

Therefore it is possible that induction of the UPR by FASN inhibitors may be triggering

cell death through the IRE1 pathway that activates JNK and pro-death signals (44).

What is not addressed in the data presented here is the specific role of signals

downstream of PERK in cells treated with FASN inhibitors. Protection from cell death is

clearly dependent upon PERK, but not eIF2! phosphorylation (Figures 4 and 5; (26)).

The other known downstream target of PERK signaling is Nrf2. PERK phosphorylates

Nrf2 so that it releases from its cytosolic binding partner Keap1 to trans-locate to the

nucleus and upregulate anti-oxidant pro-survival genes (30, 31). Nrf2 is traditionally

considered an anti-oxidant response factor (45). In support of PERK-Nrf2 involvement in

cells treated with FASN inhibitors, ROS accumulate and are required for cell death

induced by FASN inhibition (Figure 6). Furthermore, the data shown herein support other

work showing FASN inhibitors induce ROS (22, 23). However, we have yet to determine

whether Nrf2 is induced or is translocated to the nucleus in cells treated with FASN

inhibitors (data not shown). Therefore, we cannot yet conclude whether Nrf2 plays a role

in PERK-mediated protection in cells treated with FASN inhibitors. It will be important

to determine whether ROS originate from the ER or mitochondria and whether the ER

membrane integrity is perturbed as a result of FASN inhibition. It is possible that cell

death induced by FASN inhibitors induces ROS that occurs parallel or subsequent to

114

UPR induction. It is also possible that the intersect between the UPR, apoptosis, and ROS

induced by FASN inhibitors is dependent on IRE1, given its association with Bax and

Bak at the ER membrane (43). Further investigation should be done regarding this

possibility.

Regardless of the unanswered questions remaining, the data presented here

provide unique insight into pathways of the UPR and apoptosis and how they do not

always act similarly in cells treated with different agents. Furthermore, these data provide

novel information regarding the cellular effects of FASN inhibitors that will facilitate

their application for clinical use.

115

References

1. Wakil SJ. Fatty acid synthase, a proficient multifunctional enzyme. Biochemistry 1989;28:4523-30.

2. Asturias FJ, Chadick JZ, Cheung IK, et al. Structure and molecular organization of mammalian fatty acid synthase. Nat Struct Mol Biol 2005;12:225-32.

3. Kridel SJ, Lowther WT, Pemble CWt. Fatty acid synthase inhibitors: new directions for oncology. Expert Opin Investig Drugs 2007;16:1817-29.

4. Kuhajda FP. Fatty acid synthase and cancer: new application of an old pathway. Cancer Research 2006;66:5977-80.

5. Kuhajda FP. Fatty-acid synthase and human cancer: new perspectives on its role in tumor biology. Nutrition 2000;16:202-8.

6. Rossi S, Graner E, Febbo P, et al. Fatty acid synthase expression defines distinct molecular signatures in prostate cancer. Mol Cancer Res 2003;1:707-15.

7. Kuhajda FP, Jenner K, Wood FD, et al. Fatty acid synthesis: a potential selective target for antineoplastic therapy. Proceedings of the National Academy of Sciences of the United States of America 1994;91:6379-83.

8. Kuhajda FP, Pizer ES, Li JN, et al. Synthesis and antitumor activity of an inhibitor of fatty acid synthase. Proc Natl Acad Sci USA 2000;97:3450-54.

9. Pizer ES, Wood FD, Heine HS, et al. Inhibition of fatty acid synthesis delays disease progression in a xenograft model of ovarian cancer. Cancer Research 1996;56:1189-93.

10. Pizer ES, Thupari J, Han WF, et al. Malonyl-coenzyme-A is a potential mediator of cytotoxicity induced by fatty-acid synthase inhibition in human breast cancer cells and xenografts. Cancer Research 2000;60:213-8.

11. Pizer ES, Pflug BR, Bova GS, et al. Increased fatty acid synthase as a therapeutic target in androgen-independent prostate cancer progression. Prostate 2001;47:102-10.

12. Gabrielson EW, Pinn ML, Testa JR, Kuhajda FP. Increased fatty acid synthase is a therapeutic target in mesothelioma. Clin Cancer Res 2001;7:153-7.

13. Kridel SJ, Axelrod F, Rozenkrantz N, Smith JW. Orlistat is a novel inhibitor of fatty acid synthase with antitumor activity. Cancer Research 2004;64:2070-5.

14. Wang HQ, Altomare DA, Skele KL, et al. Positive feedback regulation between AKT activation and fatty acid synthase expression in ovarian carcinoma cells. Oncogene 2005;24:3574-82.

15. Zhou W, Han WF, Landree LE, et al. Fatty acid synthase inhibition activates AMP-activated protein kinase in SKOV3 human ovarian cancer cells. Cancer Research 2007;67:2964-71.

16. Orita H, Coulter J, Lemmon C, et al. Selective Inhibition of Fatty Acid Synthase for Lung Cancer Treatment. Clin Cancer Res 2007;13:7139-45.

17. Pizer ES, Jackisch C, Wood FD, et al. Inhibition of fatty acid synthesis induces programmed cell death in human breast cancer cells. Cancer Research 1996;56:2745-47.

18. Furuya Y, Akimoto S, Yasuda K, Ito H. Apoptosis of androgen-independent prostate cell line induced by inhibition of fatty acid synthesis. Anticancer Res 1997;17:4589-93.

116

19. Heiligtag SJ, Bredehorst R, David KA. Key role of mitochondria in cerulenin-mediated apoptosis. Cell Death Differ 2002;9:1017-25.

20. Bandyopadhyay S, Zhan R, Wang Y, et al. Mechanism of Apoptosis Induced by the Inhibition of Fatty Acid Synthase in Breast Cancer Cells. Cancer Research 2006;66:5934-40.

21. An Z, Wang H, Song P, et al. Nicotine-induced activation of AMP-activated protein kinase inhibits fatty acid synthase in 3T3L1 adipocytes: a role for oxidant stress. J Biol Chem 2007;282:26793-801.

22. Chajes V, Cambot M, Moreau K, Lenoir GM, Joulin V. Acetyl-CoA Carboxylase {alpha} Is Essential to Breast Cancer Cell Survival. Cancer Research 2006;66:5287-94.

23. Furuta E, Pai SK, Zhan R, et al. Fatty acid synthase gene is up-regulated by hypoxia via activation of Akt and sterol regulatory element binding protein-1. Cancer Res 2008;68:1003-11.

24. Thupari JN, Pinn ML, Kuhajda FP. Fatty Acid Synthase Inhibition in Human Breast Cancer Cells Leads to Malonyl-CoA-Induced Inhibition of Fatty Acid Oxidation and Cytotoxicity. Biochemical and Biophysical Research Communications 2001;285:217-23.

25. Zhou W, Simpson PJ, McFadden JM, et al. Fatty Acid Synthase Inhibition Triggers Apoptosis during S Phase in Human Cancer Cells. Cancer Research 2003;63:7330-37.

26. Little JL, Wheeler FB, Fels DR, Koumenis C, Kridel SJ. Inhibition of fatty acid synthase induces endoplasmic reticulum stress in tumor cells. Cancer Research 2007;67:1262-9.

27. De Schrijver E, Brusselmans K, Heyns W, Verhoeven G, Swinnen JV. RNA interference-mediated silencing of the fatty acid synthase gene attenuates growth and induces morphological changes and apoptosis of LNCaP prostate cancer cells. Cancer Research 2003;63:3799-804.

28. Harding HP, Zhang Y, Zeng H, et al. An Integrated Stress Response Regulates Amino Acid Metabolism and Resistance to Oxidative Stress. Molecular Cell 2003;11:619-33.

29. Xue X, Piao J-H, Nakajima A, et al. Tumor Necrosis Factor {alpha} (TNF{alpha}) Induces the Unfolded Protein Response (UPR) in a Reactive Oxygen Species (ROS)-dependent Fashion, and the UPR Counteracts ROS Accumulation by TNF{alpha}. J Biol Chem 2005;280:33917-25.

30. Cullinan SB, Zhang D, Hannink M, et al. Nrf2 is a direct PERK substrate and effector of PERK-dependent cell survival. Mol Cell Biol 2003;23:7198-209.

31. Cullinan SB, Diehl JA. PERK-dependent activation of Nrf2 contributes to redox homeostasis and cell survival following endoplasmic reticulum stress. J Biol Chem 2004;279:20108-17.

32. Novoa I, Zeng H, Harding HP, Ron D. Feedback inhibition of the unfolded protein response by GADD34-mediated dephosphorylation of eIF2alpha. J Cell Biol 2001;153:1011-22.

33. Danial NN, Korsmeyer SJ. Cell Death: Critical Control Points. Cell 2004;116:205.

117

34. Lam M, Dubyak G, Chen L, et al. Evidence that BCL-2 Represses Apoptosis by Regulating Endoplasmic Reticulum-Associated Ca2+ Fluxes. Proceedings of the National Academy of Sciences 1994;91:6569-73.

35. Thomenius MJ, Wang NS, Reineks EZ, Wang Z, Distelhorst CW. Bcl-2 on the Endoplasmic Reticulum Regulates Bax Activity by Binding to BH3-only Proteins. J Biol Chem 2003;278:6243-50.

36. Hacki J, Egger L, Monney L, et al. Apoptotic crosstalk between the endoplasmic reticulum and mitochondria controlled by Bcl-2. Oncogene 2000;19:2286-95.

37. Harding HP, Zhang Y, Bertolotti A, Zeng H, Ron D. Perk is essential for translational regulation and cell survival during the unfolded protein response. Mol Cell 2000;5:897-904.

38. Scheuner D, Song B, McEwen E, et al. Translational Control Is Required for the Unfolded Protein Response and In Vivo Glucose Homeostasis. Molecular Cell 2001;7:1165.

39. Koritzinsky M, Rouschop KMA, van den Beucken T, et al. Phosphorylation of eIF2[alpha] is required for mRNA translation inhibition and survival during moderate hypoxia. Radiotherapy and Oncology 2007;83:353.

40. Ferri KF, Kroemer G. Organelle-specific initiation of cell death pathways. Nat Cell Biol 2001;3:E255-63.

41. Szegezdi E, Logue SE, Gorman AM, Samali A. Mediators of endoplasmic reticulum stress-induced apoptosis. EMBO Rep 2006;7:880-5.

42. Ron D, Walter P. Signal integration in the endoplasmic reticulum unfolded protein response. Nat Rev Mol Cell Biol 2007;8:519-29.

43. Hetz C, Bernasconi P, Fisher J, et al. Proapoptotic BAX and BAK Modulate the Unfolded Protein Response by a Direct Interaction with IRE1{alpha}. Science 2006;312:572-76.

44. Urano F, Wang X, Bertolotti A, et al. Coupling of stress in the ER to activation of JNK protein kinases by transmembrane protein kinase IRE1. Science 2000;287:664-6.

45. Zhang DD. Mechanistic studies of the Nrf2-Keap1 signaling pathway. Drug Metab Rev 2006;38:769-89.

118

CHAPTER V

GENERAL DISCUSSION

Joy L. Little and Steven J. Kridel

(The following discussions contains sections to be published in a chapter of the book

Subcellular Biochemistry: Lipid in Health and Disease. Stylistic variations are due to the

requirements of the publisher. J. L. Little prepared the manuscript. Dr. S. J. Kridel acted

in an advisory and editorial capacity.)

119

V.1. Inhibiting FASN Activity

V.1.1. Small Molecule Inhibitors of FASN

Because of the unique expression of FASN in tumors, much emphasis has been

put toward the development of pharmacological agents that inhibit FASN activity and,

therefore, inhibit tumor growth and progression. Historically, a Cephalosporium

caerulens mycotoxin metabolite known as cerulenin [(2S, 3R)-2,3-epoxy-4-oxo-7,10-

dodecadienoylamide] has been the primary FASN inhibitor used in biological studies.

Cerulenin covalently binds the "-ketoacyl synthase domain in FASN that is responsible

for binding and condensing the substrates (1). More recently, C75 was formulated as a

synthetic analog of cerulenin due to instability and poor systemic availability of cerulenin

(2). C93 is the newest generation of C75 analogues (3). Both C75 and C93 target the "-

ketoacyl synthase activity of FASN (2, 3). Recently, orlistat (Xenical©), a FDA-

approved drug for obesity that targets gastrointestinal lipases, was described as a novel

inhibitor of FASN thioesterase activity (4). There also exists a growing body of literature

showing that various natural products such as the green tea polyphenolic component

epigallocatechin-3-gallate (EGCG) can inhibit FASN activity (5).

V.1.2. Effects In vivo

To date, all small molecule inhibitors of FASN have demonstrated ability to block

tumor growth in vivo. Cerulenin greatly increases survival and delays progression of

ovarian cancer xenografts without significantly affecting fatty acid synthesis in the liver

(6). C75 reduces growth of several tumor xenograft models, including prostate, breast,

ovarian and mesothelioma (7-10). C93 and C75 both reduce ovarian and lung cancer

120

xenograft growth (3, 11). The novel FASN inhibitor orlistat has also been shown to

inhibit prostate tumor xenograft growth (4). FASN inhibitors also work in genetic models

of tumorigenesis, including the Neu-N murine mammary transgenic model (12-14). While

FASN inhibitors are not typically given orally due to poor bioavailability, recent work

shows that C93 can work in vivo after oral administration (11). Surprisingly, cerulenin,

C75 and related compounds induce a reversible anorexic phenotype that is associated

with "-oxidation in the hypothalamus. This phenotype is mimicked in mice with FASN

deleted in the hypothalamus (see section I.3.1) (11, 15-18). Interestingly, the anorexic

effect of FASN inhibitors has been overcome with newer generation drugs like C93 that

can reduce tumor growth with no anorexic effect (11). The discrepancy between the

knockout studies and pharmacological findings has yet to be explained.

V.1.3. Cell Cycle Effects In vitro

To determine the cellular consequences of FASN inhibition, numerous studies

have focused on the in vitro anti-tumor effects of these inhibitors. Many studies have

linked FASN inhibitors with cell cycle and growth arrest (Figure 1). Cerulenin acts in

vitro to inhibit fatty acid synthesis-mediated growth of breast carcinoma cells that can be

rescued with palmitate (19). Cerulenin induces a block at the G2/M cell cycle checkpoint

in an androgen-independent prostate cancer cell line that correlates with an induction of

cyclin-dependent kinase inhibitors p21 and p27 (20). However, glioma cells accumulate

in S phase after cerulenin treatment (21). Different hepatocellular carcinoma cell lines

treated with C75 undergo either G1 or G2 cell cycle arrest independent of p53 status (22).

In melanoma A-375 cells, cerulenin induces accumulation of cells in S phase, while C75

121

induces accumulation of G2/M phase cells (23). RKO colorectal cancer cells treated with

either cerulenin or C75 show a transient accumulation of cells in S and G2/M phases, but

accumulation in G1 and G2/M phases later (24). Both cerulenin and C75 induce S phase

arrest and inhibit DNA replication in breast, colorectal, and promyelocytic leukemia

cancer cells (25). Orlistat induces cell cycle arrest by downregulating Skp2, a

deubiquinating enzyme, leading to decreased turnover of p27/kip1, therefore blocking

prostate tumor cells from entering S phase (26). Orlistat has also been shown to induce an

accumulation of breast cancer cells in S phase (27). Use of RNA interference (RNAi) to

mediate knockdown of both the FASN and ACC! genes induces a decrease in S phase

cells, further supporting the role of fatty acid synthesis in progression to or in S phase

(28).

The data show there is little consensus on the phase that tumor cells arrest growth

after inhibition of FASN in various tumor cells, which may be attributed to different

tumor cell types. It is likely that a lack of de novo fatty acid synthesis in tumor cells

impacts phospholipid synthesis required for proper DNA synthesis and cell cycle

progression (29).

V.1.4. Cell Signaling Effects

The effects of FASN inhibitors are also mediated through key tumor signaling

pathways. For example, it has been demonstrated that pharmacological inhibition of

FASN activity results in reduced Akt activation in multiple tumor cell lines (Figure 1) (9,

30). As mentioned previously, it has been demonstrated that PI3K and Akt can drive

122

FASN expression in tumor cells (Chapter I, Figure 2B) (9, 31). The demonstration that

reduced FASN activity negatively affects Akt activation identifies a feedback between

the two pathways. Not surprisingly, inhibiting the PI3K pathway synergizes with cell

death induced by genetic and pharmacological inhibition of FASN (9, 30, 32).

In addition to the PI3K pathway, HER2/Neu has also been linked with FASN

expression in breast and prostate cancer cells (33-35). Inhibiting FASN with cerulenin

and C75 reduces expression of Her2/neu expression in breast cancer cell lines (Figure 1)

(33, 36). Additionally, inhibiting Her2/Neu with Herceptin synergizes with FASN

inhibitors to induce cell death (36). Altogether, these data indicate that the very pathways

that drive FASN expression in malignant cells are also affected when FASN activity is

blocked. Moreover, tumor cell killing can be potentiated when FASN inhibitors are

combined with inhibitors of these signaling pathways. The reason for this crosstalk has

not been clearly defined, but it is tempting to speculate that inhibition of FASN activity

directly impacts on lipid raft function, which results in reduced kinase signaling.

The data presented herein further support the idea that inhibitors of various

signaling pathways that crosstalk with fatty acid synthesis will synergize with FASN

inhibitors. For instance, the proteasome pathway has been implicated in maintaining

stability of FASN in prostate cancer (37). Our data show that inhibiting FASN in

combination with the proteasome inhibitor, bortezomib, induces synergistic cell death

(Chapter III, Figure 1). The number of pathways that crosstalk with FASN and show

123

interdependence with FASN activity speaks to the critical and central role FASN has in

tumor biology.

V.1.5. In vitro Tumor Cell Death

In addition to cell cycle arrest, all FASN inhibitors induce cell death in tumor

cells (3, 4, 25, 38). Cerulenin induces breast and prostate cancer cell death that correlates

with DNA fragmentation and morphology characteristic of apoptosis (8, 20, 38). The

mitochondria have also been linked to facilitation of cell death induced by cerulenin. For

instance, the pro-apoptotic mitochondrial factor Bax worsens cerulenin-induced cell

death when overexpressed (39). This correlation between cerulenin and the mitochondrial

pathway of apoptosis is further supported by the induction of cytochrome c release

(Figure 1) (39). FASN inhibition has been linked to p53 status of tumor cells, but whether

p53 plays any role in FASN-expressing cells is unclear, as FASN is expressed in tumors

independent of p53 status. FASN is strongly and significantly associated with p53

expression in hyperplastic parathyroids (40). In various cancer cells, blocking p53

activity with a dominant negative construct potentiates FASN inhibitor-induced cell death

(24). Conversely, others have reported that FASN inhibitors work equally well in tumors

independent of p53 status (39).

The data presented herein identify independence of cell death induced by FASN

inhibitors from the mitochondrial pathway of apoptosis. In support of previous work,

cleavage of both caspases 3 and 9 occurs after FASN inhibition in tumor cells (Chapter

II, Figure 5; Chapter IV, Figure 2). However, inhibition of caspase cleavage by the pan-

124

caspase inhibitor zVAD-fmk does not protect tumor cells from FASN inhibitor-induced

cell death (Chapter IV, Figure 1). Therefore, these data indicate a different understanding

of the role caspases and the mitochondrial pathway may be playing. Furthermore,

overexpression of the anti-apoptotic mitochondrial protein Bcl-2 does not protect from

cell death induced by FASN inhibitors (Chapter IV, Figure 2). Therefore, FASN

inhibitors may be inducing cell death through a mechanism that is not directly attributed

to canonical mitochondrial apoptotic pathway mediators.

Cell death induced by FASN inhibitors could be a result of the cell lacking fatty

acid for membrane biogenesis. Inhibiting FASN and ACC reduces incorporation of fatty

acid into membrane phospholipids, which occurs in the endoplasmic reticulum (41).

Inhibiting FASN incorporation into phospholipids corresponds to a decrease in cell

volume and other morphological changes ultimately leading to apoptosis (42). Inhibiting

FASN with small molecules (cerulenin, C75, orlistat) or with siRNAs induces

endoplasmic reticulum stress and activation of the unfolded protein response (UPR)

(Chapter II). The UPR is able to induce cell death if homeostasis is not restored and,

therefore, FASN inhibitors may be inducing cell death that is mediated by the UPR

(Chapter II, III).

Inhibition of FASN induces key components of the UPR adaptation signaling

pathway such as eIF2! phosphorylation and ATF4 expression (Chapter II, Figures 1, 2, 4,

5; Chapter III, Figure 3). Furthermore, PERK, the kinase responsible for eIF2!

phosphorylation in cells undergoing ER stress confers protection to cells treated with

125

FASN inhibitors (Chapter II, Figure 2; Chapter IV, Figure 4). The data herein, however,

add a surprising perspective to this, as eIF2! phosphorylation does not provide a

protective advantage to tumor cells treated with FASN inhibitors, despite sustained eIF2!

phosphorylation for over 24 hours in these cells (Chapter IV, Figures 4, 5). We show that

MEFs with a homozygous allele of eIF2! that is unable to be phosphorylated due to an

alanine mutation at serine 51 are no more sensitive to FASN inhibitors than wild-type

controls (Chapter IV, Figure 4). We confirm these data using a human cell line

expressing a constitutively active form of GADD34, the UPR factor responsible for

mediating the de-phosphorylation of eIF2! (Chapter IV, Figure 5). GADD34

overexpressing cells are no more sensitive to FASN inhibitors than their vector-

containing counterparts. Western blots confirm the lack of eIF2! phosphorylation in

these cells treated with FASN inhibitors and these cells are hypersensitive to the ER

stressor thapsigargin (Chapter IV, Figure 5). Therefore, we can conclude that eIF2!

phosphorylation fails to protect cells from FASN inhibitor-induced cell death. Previously,

cells unable to phosphorylate eIF2! have been shown to be equally hypersensitive to ER

stressors, such as glucose deprivation or hypoxia, as cells without PERK activity (43, 44).

These data indicate that there is much more to understand regarding the regulation of the

UPR and its divergent roles under specific stressors.

Our data also show that when ER stressors are combined with FASN inhibition,

tumor cell death is increased (Chapter II, Figure 6; Chapter III). Furthermore, these data

provide evidence that pro-death signals may be occurring through the UPR signaling

pathway mediated by IRE1-JNK-CHOP (Chapter III, Figures 5-7). While it has yet to be

126

determined whether FASN inhibition specifically operates through this pathway, both

JNK and CHOP activation play an important role in death induced by the combination of

FASN inhibitors and the proteasome inhibitor bortezomib (Chapter III, Figures 5-7). In

fact, the IRE1 arm may be the as yet undetermined link between FASN inhibitors and the

mitochondrial pathway of apoptosis. For instance, Bax is induced in cells treated with

FASN inhibitors. Moreover, induction of Bax correlates with the extent of cell death in

these cells (39). Interestingly, IRE1 can directly interact with, and its activity is directly

affected by Bax and Bak at the ER membrane (45). Therefore, the role of IRE1 in cell

death induced by FASN inhibitors should be investigated.

When FASN is inhibited malonyl-CoA accumulates (8). One hypothesis for the

mechanism of FASN inhibitor-induced cell death is attributed to this accumulation of

malonyl-CoA and, potentially, its interaction with CPT-1, the enzyme responsible for

transferring fatty acids into the mitochondria for oxidation. Malonyl-CoA acts as a

natural inhibitor of CPT-1 activity. Thus, FASN inhibitors may prevent both fatty acid

synthesis and oxidation (46). Driving this hypothesis is a study showing that co-treating

breast or ovarian cancer cells with the ACC inhibitor 5-(tetradecyloxy)-2-furoic acid

(TOFA) partially rescues cell death induced by FASN inhibitors C75 and cerulenin (8,

41). However, C75 alone can increase CPT-1 activity and directly compete with malonyl-

CoA (47, 48). Therefore, it is important to note that MCF-7 cells co-treated with C75 and

the CPT-1 inhibitor etomoxir show no effect on C75-induced cell death (41). Hence,

malonyl-CoA accumulation, not CPT-1 activation, is mediating death induced by FASN

inhibitors. In addition, siRNA-mediated knockdown of FASN induces accumulation of

127

ceramide and malonyl-CoA that leads to inhibition of CPT-1 and induction of apoptotic

genes BNIP3, TRAIL, and DAPK2 (49). Incidentally, ceramide has been shown to induce

JNK-dependent apoptosis (50). In addition, ceramide accumulates during cell death

induced by thapsigargin in "-cells. Furthermore, this effect is exacerbated when

phospholipid levels are altered by overexpression of phospholipase A(2) (51).

Upstream lipogenesis mediators ACL and ACC are also important in maintaining

tumor cell survival. RNAi-mediated knockdown or chemical inhibition of ACL in human

tumor cells decreases proliferation and induces cell death in vitro and limits tumor

growth by stimulating differentiation of tumor cells in vivo (52). ACL inhibition can also

impair Akt-mediated tumorigenesis and induce tumor cell death (53). In addition,

silencing ACC using RNAi induces apoptosis in breast and prostate cancer cells (28, 54).

Chemical inhibition of ACC can also induce tumor cell death (55). Data from our lab

indicate that ACC inhibition also induces the UPR (data not shown). It will be interesting

to continue investigation of the role of ACC in ER homeostasis and tumor cell biology.

While the effects of FASN inhibitors on tumor cells are clearly pleiotropic, and in

some cases maybe even specific to the tumor type, it is evident that many of the effects

can ultimately be tied to decreases in de novo synthesized fatty acids which can be

extended to phospholipid synthesis. Whatever the mechanisms may be, the data clearly

suggest that FASN occupies an important regulatory position in tumor cells to facilitate

the processes that lead to tumor cell proliferation and survival.

128

Figure 1: Inhibiting FASN in Tumor Cells. Several small molecule drugs can inhibit FASN activity. Blockade of FASN activity leads to a reduction in lipogenesis and phospholipid content in tumor cells. Inhibiting FASN also induces cycle arrest, cytochrome c release, and endoplasmic reticulum stress. In addition, FASN inhibitors can reduce the activation and expression of Akt and HER2/Neu. V.2. Concluding Remarks

In summary, FASN is upregulated in multiple tumor types and correlates with

poor patient prognosis and reduced survival. Correspondingly, a body of literature has

demonstrated a requirement of FASN activity for tumor cell viability. The data presented

in this dissertation provides powerful and novel understanding regarding the pleiotropic

effects of FASN inhibitors. Phospholipids synthesized from FASN-derived palmitate are

important for cell cycle progression, lipid raft signaling, and endoplasmic reticulum

homeostasis, all of which contribute to tumor cell survival, thereby, underscoring the

FASN

cell cycle arrest

cytochrome crelease

palmitate

ceruleninC75C93

orlistatsiRNA

HER2/NeuHER2/Neup-Aktp-Akt

cell death

endoplasmic reticulum stress

phospholipid

129

importance of FASN. These findings signify a central role for fatty acid synthesis in

critical cellular processes.

Chapter II is the first evidence to show the link between FASN and ER

homeostasis. This link suggests a potential teleological explanation for upregulation of

FASN in tumor cells. Given the importance of phospholipids for tumor cell membrane

and ER function and homeostasis, it is only logical that a tumor cell would selectively

upregulate factors that will provide substrate for phospholipid, such as FASN. In

addition, tumor cells have developed feedback mechanisms to mediate crosstalk between

FAS and signaling pathways like PI3-kinase and Her2/Neu. The discovery and

development of pharmacological agents that block FASN activity suggest that FASN can

be targeted for anti-tumor therapy. In addition, Chapter III provides novel evidence of a

functional crosstalk between the fatty acid synthesis and proteasome pathways, further

suggesting the central role of FASN in tumor cell biology. Furthermore, this crosstalk

provides a unique therapeutic opportunity for FASN inhibitors to be combined with the

proteasome inhibitor bortezomib, already FDA-approved for multiple myeloma and in

clinical trials for various other malignancies. Understanding the mechanism behind this

combination-induced cell death, furthers the potential for FASN inhibitors to be

combined with other ER stressing agents, as well as furthers understanding of

mechanisms behind cell death induced by FASN inhibitors. Finally, Chapter IV

delineates a distinction between the UPR signaling of cell death induced by FASN

inhibitors, the independence of mitochondrial components in this cell death response, as

130

well as supporting evidence that ROS play a central role in death induced by FASN

inhibitors.

So far, anti-FASN drugs have successfully inhibited tumor growth in several

tumor models with minimal side effects. FASN represents a highly tractable anti-tumor

target with significant clinical potential. The work contained in this thesis provides

evidence that will only further the potential of these agents and guide future work

regarding cell death induced by the UPR that may further the exploitation of UPR-

targeting agents for clinical use as well. Overall, this work contributes to the larger

understanding of FASN in mediating aspects of proliferation, growth and survival. As a

result, a clearer understanding of the role of FASN in tumor cells has been developed.

131

References 1. Funabashi H, Kawaguchi A, Tomoda H, et al. Binding Site of Cerulenin in Fatty

Acid Synthetase. J Biochem (Tokyo) 1989;105:751-55. 2. Kuhajda FP, Pizer ES, Li JN, et al. Synthesis and antitumor activity of an

inhibitor of fatty acid synthase. Proc Natl Acad Sci U S A 2000;97:3450-4. 3. Zhou W, Han WF, Landree LE, et al. Fatty acid synthase inhibition activates

AMP-activated protein kinase in SKOV3 human ovarian cancer cells. Cancer Research 2007;67:2964-71.

4. Kridel SJ, Axelrod F, Rozenkrantz N, Smith JW. Orlistat is a novel inhibitor of fatty acid synthase with antitumor activity. Cancer Research 2004;64:2070-5.

5. Tian WX. Inhibition of fatty acid synthase by polyphenols. Curr Med Chem 2006;13:967-77.

6. Pizer ES, Wood FD, Heine HS, et al. Inhibition of fatty acid synthesis delays disease progression in a xenograft model of ovarian cancer. Cancer Research 1996;56:1189-93.

7. Pizer ES, Pflug BR, Bova GS, et al. Increased fatty acid synthase as a therapeutic target in androgen-independent prostate cancer progression. Prostate 2001;47:102-10.

8. Pizer ES, Thupari J, Han WF, et al. Malonyl-coenzyme-A is a potential mediator of cytotoxicity induced by fatty-acid synthase inhibition in human breast cancer cells and xenografts. Cancer Research 2000;60:213-8.

9. Wang HQ, Altomare DA, Skele KL, et al. Positive feedback regulation between AKT activation and fatty acid synthase expression in ovarian carcinoma cells. Oncogene 2005;24:3574-82.

10. Gabrielson EW, Pinn ML, Testa JR, Kuhajda FP. Increased fatty acid synthase is a therapeutic target in mesothelioma. Clin Cancer Res 2001;7:153-7.

11. Orita H, Coulter J, Lemmon C, et al. Selective Inhibition of Fatty Acid Synthase for Lung Cancer Treatment. Clin Cancer Res 2007;13:7139-45.

12. Hennigar RA, Pochet M, Hunt DA, et al. Characterization of fatty acid synthase in cell lines derived from experimental mammary tumors. Biochim Biophys Acta 1998;1392:85-100.

13. Pflug BR, Pecher SM, Brink AW, Nelson JB, Foster BA. Increased fatty acid synthase expression and activity during progression of prostate cancer in the TRAMP model. Prostate 2003;57:245-54.

14. Alli PM, Pinn ML, Jaffee EM, McFadden JM, Kuhajda FP. Fatty acid synthase inhibitors are chemopreventive for mammary cancer in neu-N transgenic mice. Oncogene 2005;24:39-46.

15. Loftus TM, Jaworsky DE, Frehywot GL, et al. Reduced Food Intake and Body Weight in Mice Treated with Fatty Acid Synthase Inhibitors. Science 2000;288:2379-81.

16. Thupari JN, Kim EK, Moran TH, Ronnett GV, Kuhajda FP. Chronic C75 treatment of diet-induced obese mice increases fat oxidation and reduces food

132

intake to reduce adipose mass. Am J Physiol Endocrinol Metab 2004;287:E97-E104.

17. Tu Y, Thupari JN, Kim EK, et al. C75 alters central and peripheral gene expression to reduce food intake and increase energy expenditure. Endocrinology 2005;146:486-93.

18. Chakravarthy MV, Zhu Y, Lopez M, et al. Brain fatty acid synthase activates PPARalpha to maintain energy homeostasis. Journal of Clinical Investigation 2007;117:2539-52.

19. Kuhajda FP, Jenner K, Wood FD, et al. Fatty Acid Synthesis: A Potential Selective Target for Antineoplastic Therapy. Proc Natl Acad Sci U S A 1994;91:6379-83.

20. Furuya Y, Akimoto S, Yasuda K, Ito H. Apoptosis of androgen-independent prostate cell line induced by inhibition of fatty acid synthesis. Anticancer Res 1997;17:4589-93.

21. Zhao W, Kridel S, Thorburn A, et al. Fatty acid synthase: a novel target for antiglioma therapy. Br J Cancer 2006;95:869-78.

22. Gao Y, Lin LP, Zhu CH, et al. Growth arrest induced by C75, A fatty acid synthase inhibitor, was partially modulated by p38 MAPK but not by p53 in human hepatocellular carcinoma. Cancer Biol Ther 2006;5:978-85.

23. Ho TS, Ho YP, Wong WY, et al. Fatty acid synthase inhibitors cerulenin and C75 retard growth and induce caspase-dependent apoptosis in human melanoma A-375 cells. Biomed Pharmacother 2007;61:578-87.

24. Li JN, Gorospe M, Chrest FJ, et al. Pharmacological inhibition of fatty acid synthase activity produces both cytostatic and cytotoxic effects modulated by p53. Cancer Research 2001;61:1493-99.

25. Pizer ES, Chrest FJ, DiGiuseppe JA, Han WF. Pharmacological inhibitors of mammalian fatty acid synthase suppress DNA replication and induce apoptosis in tumor cell lines. Cancer Research 1998;58:4611-5.

26. Knowles LM, Axelrod F, Browne CD, Smith JW. A fatty acid synthase blockade induces tumor cell-cycle arrest by down-regulating Skp2. J Biol Chem 2004;279:30540-5.

27. Menendez JA, Vellon L, Lupu R. Antitumoral actions of the anti-obesity drug orlistat (XenicalTM) in breast cancer cells: blockade of cell cycle progression, promotion of apoptotic cell death and PEA3-mediated transcriptional repression of Her2/neu (erbB-2) oncogene. Ann Oncol 2005;16:1253-67.

28. Brusselmans K, De Schrijver E, Verhoeven G, Swinnen JV. RNA Interference-Mediated Silencing of the Acetyl-CoA-Carboxylase-{alpha} Gene Induces Growth Inhibition and Apoptosis of Prostate Cancer Cells. Cancer Research 2005;65:6719-25.

29. Jackowski S. Coordination of membrane phospholipid synthesis with the cell cycle. J Biol Chem 1994;269:3858-67.

30. Liu X, Shi Y, Giranda VL, Luo Y. Inhibition of the phosphatidylinositol 3-kinase/Akt pathway sensitizes MDA-MB468 human breast cancer cells to cerulenin-induced apoptosis. Mol Cancer Ther 2006;5:494-501.

31. Van de Sande T, De Schrijver E, Heyns W, Verhoeven G, Swinnen JV. Role of the phosphatidylinositol 3'-kinase/PTEN/Akt kinase pathway in the

133

overexpression of fatty acid synthase in LNCaP prostate cancer cells. Cancer Research 2002;62:642-6.

32. Bandyopadhyay S, Pai SK, Watabe M, et al. FAS expression inversely correlates with PTEN level in prostate cancer and a PI 3-kinase inhibitor synergizes with FAS siRNA to induce apoptosis. Oncogene 2005;24:5389-95.

33. Kumar-Sinha C, Ignatoski KW, Lippman ME, Ethier SP, Chinnaiyan AM. Transcriptome analysis of HER2 reveals a molecular connection to fatty acid synthesis. Cancer Research 2003;63:132-9.

34. Yoon S, Lee MY, Park SW, et al. Up-regulation of acetyl-CoA carboxylase alpha and fatty acid synthase by human epidermal growth factor receptor 2 at the translational level in breast cancer cells. J Biol Chem 2007;282:26122-31.

35. Yeh S, Lin H-K, Kang H-Y, et al. From HER2/Neu signal cascade to androgen receptor and its coactivators: A novel pathway by induction of androgen target genes through MAP kinase in prostate cancer cells. Proc Natl Acad Sci U S A 1999;96:5458-63.

36. Menendez JA, Vellon L, Mehmi I, et al. Inhibition of fatty acid synthase (FAS) suppresses HER2/neu (erbB-2) oncogene overexpression in cancer cells. Proc Natl Acad Sci U S A 2004;101:10715-20.

37. Graner E, Tang D, Rossi S, et al. The isopeptidase USP2a regulates the stability of fatty acid synthase in prostate cancer. Cancer Cell 2004;5:253-61.

38. Pizer ES, Jackisch C, Wood FD, et al. Inhibition of fatty acid synthesis induces programmed cell death in human breast cancer cells. Cancer Research 1996;56:2745-47.

39. Heiligtag SJ, Bredehorst R, David KA. Key role of mitochondria in cerulenin-mediated apoptosis. Cell Death Differ 2002;9:1017-25.

40. Alo PL, Visca P, Mazzaferro S, et al. Immunohistochemical study of fatty acid synthase, Ki67, proliferating cell nuclear antigen, and p53 expression in hyperplastic parathyroids. Ann Diagn Pathol 1999;3:287-93.

41. Zhou W, Simpson PJ, McFadden JM, et al. Fatty Acid Synthase Inhibition Triggers Apoptosis during S Phase in Human Cancer Cells. Cancer Research 2003;63:7330-37.

42. De Schrijver E, Brusselmans K, Heyns W, Verhoeven G, Swinnen JV. RNA interference-mediated silencing of the fatty acid synthase gene attenuates growth and induces morphological changes and apoptosis of LNCaP prostate cancer cells. Cancer Research 2003;63:3799-804.

43. Scheuner D, Song B, McEwen E, et al. Translational Control Is Required for the Unfolded Protein Response and In Vivo Glucose Homeostasis. Molecular Cell 2001;7:1165.

44. Koritzinsky M, Rouschop KMA, van den Beucken T, et al. Phosphorylation of eIF2[alpha] is required for mRNA translation inhibition and survival during moderate hypoxia. Radiotherapy and Oncology 2007;83:353.

45. Hetz C, Bernasconi P, Fisher J, et al. Proapoptotic BAX and BAK Modulate the Unfolded Protein Response by a Direct Interaction with IRE1{alpha}. Science 2006;312:572-76.

46. McGarry JD, Mills SE, Long CS, Foster DW. Observations on the affinity for carnitine, and malonyl-CoA sensitivity, of carnitine palmitoyltransferase I in

134

animal and human tissues. Demonstration of the presence of malonyl-CoA in non-hepatic tissues of the rat. Biochem J 1983;214:21-8.

47. Thupari JN, Landree LE, Ronnett GV, Kuhajda FP. C75 increases peripheral energy utilization and fatty acid oxidation in diet-induced obesity. Proc Natl Acad Sci U S A 2002;99:9498-502.

48. Yang N, Kays JS, Skillman TR, et al. C75 [4-Methylene-2-octyl-5-oxo-tetrahydro-furan-3-carboxylic Acid] Activates Carnitine Palmitoyltransferase-1 in Isolated Mitochondria and Intact Cells without Displacement of Bound Malonyl CoA. J Pharmacol Exp Ther 2005;312:127-33.

49. Bandyopadhyay S, Zhan R, Wang Y, et al. Mechanism of Apoptosis Induced by the Inhibition of Fatty Acid Synthase in Breast Cancer Cells. Cancer Research 2006;66:5934-40.

50. Chen C-L, Lin C-F, Chang W-T, et al. Ceramide induces p38 MAPK and JNK activation through a mechanism involving a thioredoxin-interacting protein-mediated pathway. Blood 2008;111:4365-74.

51. Ramanadham S, Hsu FF, Zhang S, et al. Apoptosis of insulin-secreting cells induced by endoplasmic reticulum stress is amplified by overexpression of group VIA calcium-independent phospholipase A2 (iPLA2 beta) and suppressed by inhibition of iPLA2 beta. Biochemistry 2004;43:918-30.

52. Hatzivassiliou G, Zhao F, Bauer DE, et al. ATP citrate lyase inhibition can suppress tumor cell growth. Cancer Cell 2005;8:311-21.

53. Bauer DE, Hatzivassiliou G, Zhao F, Andreadis C, Thompson CB. ATP citrate lyase is an important component of cell growth and transformation. Oncogene 2005;24:6314-22.

54. Chajes V, Cambot M, Moreau K, Lenoir GM, Joulin V. Acetyl-CoA Carboxylase {alpha} Is Essential to Breast Cancer Cell Survival. Cancer Research 2006;66:5287-94.

55. Beckers A, Organe S, Timmermans L, et al. Chemical inhibition of acetyl-CoA carboxylase induces growth arrest and cytotoxicity selectively in cancer cells. Cancer Research 2007;67:8180-7.

135

Joy L. Little Scholastic Vita

I. Personal Info Work: Home: Graduate Student 2529 Miller Park Circle Department of Cancer Biology Unit D Wake Forest University Health Sciences Winston-Salem, NC 27103 Medical Center Boulevard Phone: (336)-971-4385 Winston-Salem, NC 27157 Email: joy.l.little@gmail.com Phone: (336) 716-6752 email: jlittle@wfubmc.edu II. Education Degree Years Institution Field of Study/Department B.A. 1999-2003 Salem College Biology Major cum laude Winston-Salem, NC Math Minor Ph.D. 2003-2008 Wake Forest University Cancer Biology Dr. Steven J. Kridel Winston-Salem, NC II. Employment Position Years Institution Employer/Department Lab Technician 2002-2003 Wake Forest University Dr. Mark Miller Winston-Salem, NC Cancer Biology Introductory 2001-2002 Salem College Biology Department Biology Tutor Winston-Salem, NC III. Teaching 2005, 2007 Cell Biology of Cancer (CABI 704), Student Co-Facilitator 2007 Special Topics: Teaching in a small group setting (CABI 716) 2006 Introduction to Biochemical Techniques, mini-course Co-Facilitator IV. Awards 2004-2006 NIH Training Grant Appointment 2006 Cancer Biology Department Annual Retreat Presentation – Third place V. Bibliography A. Original publications 1. Xu J, Turner A, Little J, Bleecker ER, and Meyers DA (2002) Positive results in

association studies are associated with departure from Hardy-Weinberg equilibrium: hint for genotyping error? Journal of Human Genetics. 111, 573-574.

2. Floyd HS, Farnsworth CL, Kock ND, Mizesko MC, Little JL, Dance ST, Everitt J,

Tichelaar J, Whitsett JA, and Miller MS (2005) Conditional expression of the mutant

136

Ki-rasG12C allele results in formation of benign lung adenomas: development of a novel mouse lung tumor model. Carcinogenesis 26(12), 2196-220

3. Zhao W, Kridel S, Thorburn A, Kooshki M, Little J, Hebbar S and Robbins M

(2006) Fatty acid synthase: a novel target for antiglioma therapy. British Journal of Cancer 95, 869-878.

4. Little JL, Wheeler FB, Fels DR, Koumenis C, Kridel SJ (2007) Inhibition of Fatty

Acid Synthase Induces Endoplasmic Reticulum Stress in Tumor Cells. Cancer Research 67(3):1262-1269.

5. Little JL, Kridel SJ, Fatty Acid Synthase Activity in Tumor Cells. In Subcellular

Biochemistry: Lipids in Health and Disease, (PJ Quinn, X Wang, eds.), Springer, 49. In Press.

6. Little JL, Wheeler FB, Koumenis C, Kridel SJ (2008) Disruption of Crosstalk

Between the Fatty Acid Synthesis and Proteasome Pathways Enhances UPR Signaling and Cell Death. In Submission.

B. Abstracts 1. Joy L. Little, Diane R. Fels, Constantinos Koumenis and Steven J. Kridel, Orlistat

induces ER stress in prostate tumor cells. American Association for Cancer Research (AACR), Anaheim, California, April 16-20, 2005.

2. Joy L. Little, Frances B. Wheeler, Diane R. Fels, Constantinos Koumenis and Steven

J. Kridel, Inhibition of fatty acid synthase induces ER stress-dependent cell death. American Association for Cancer Research (AACR), Washington, D.C, April 1-5, 2006.

3. Joy L. Little, Frances B. Wheeler, Diane R. Fels, Constantinos Koumenis and Steven

J. Kridel, Fatty acid synthase inhibitors induce ER stress-dependent cell death, 11th Prouts Neck Meeting in Prostate Cancer, Prouts Neck, Maine, November 2-5, 2006.

4. Joy L. Little, Frances B. Wheeler, Diane R. Fels, Constantinos Koumenis and Steven

J. Kridel, Fatty Acid Synthase Inhibitors Induce ER Stress in Tumor Cells: Biological and Therapeutic Implications, AACR – Innovations in Prostate Cancer, San Francisco, California, December 6-9, 2006.

5. Joy L. Little, Frances B. Wheeler, Diane R. Fels, Constantinos Koumenis and Steven

J. Kridel, Fatty Acid Synthase Inhibitors Synergize with Velcade to Induce Endoplasmic Reticulum Stress-Mediated Cell Death in Tumor Cells. American Association for Cancer Research (AACR), Los Angeles, California, April 14-18, 2007.

6. Joy L. Little, Frances B. Wheeler, Constantinos Koumenis and Steven J. Kridel.

Crosstalk Between the Fatty Acid Synthesis and Proteasome Pathways Enhances

137

UPR Signaling and Cell Death. Moffitt Cancer Center Annual Retreat, Tampa, Florida, February 22, 2008.

C. Oral Presentations Salem College, Women in Science Exchange Conference, “Inhibition of Fatty Acid Synthase Induces Endoplasmic Reticulum Stress in Tumor Cells”, 9 March 2007. 2nd Annual Symposium on the Role of Dietary Fatty Acids in the Prevention and Treatment of Disease, Center for Botanical Lipids, Winston-Salem, NC, “Fatty acid synthase inhibitors induce ER stress-dependent cell death” October 24-26, 2007.