Upload
others
View
1
Download
0
Embed Size (px)
Citation preview
1
Title: A novel variation in the FRIZZLE PANICLE (FZP) gene promoter improves 1
grain number and yield in rice. 2
3
Authors: Sheng-Shan Wang , Chia-Lin Chung ,, Kai-Yi Chen and Rong-Kuen Chen
4
5
Author affiliation: 6
Crop Improvement Division, Tainan District Agricultural Research and Extension 7
Station, Tainan 71246, Taiwan 8
†Department of Plant Pathology and Microbiology, National Taiwan University, 9
Taipei 10617, Taiwan 10
‡Department of Agronomy, National Taiwan University, Taipei 10617, Taiwan 11
§Chiayi Branch, Tainan District Agricultural Research and Extension Station, Tainan 12
71246, Taiwan 13
14
15
16
17
18
Running title: qSBN7 improves grain number in rice 19
Genetics: Early Online, published on March 9, 2020 as 10.1534/genetics.119.302862
Copyright 2020.
2
20
Keywords: secondary branch number per panicle, sink capacity, trade-offs among 21
yield components, CACTA transposon, rice, Oryza sativa 22
23
1Corresponding author: 24
Name: Rong-Kuen Chen, 25
Affiliation: Chiayi Branch, Tainan District Agricultural Research and Extension 26
Station 27
Address: No. 70, Muchang, Xinhua, Tainan 71246, Taiwan 28
Tel: +8865-3751574 29
E-mail: [email protected] 30
31
32
33
34
35
36
A novel variation in the FRIZZLE PANICLE (FZP) gene promoter improves 37
3
grain number and yield in rice 38
ABSTRACT 39
Secondary branch number per panicle plays a crucial role in regulating grain number 40
and yield in rice. Here we report the positional cloning and functional 41
characterization for SECONDARY BRANCH NUMBER7 (qSBN7), a quantitative 42
trait locus affecting secondary branch per panicle and grain number. Our research 43
revealed that the causative variants of qSBN7 are located in the distal promoter 44
region of FRIZZLE PANICLE (FZP), a gene previously associated with repression of 45
axillary meristem development in rice spikelets. qSBN7 is a novel allele of FZP 46
which causes an approximately 56% decrease in its transcriptional level, leading to 47
increased secondary branch and grain number, and reduced grain length. Field 48
evaluations showed that qSBN7 increased grain yield by 10.9% in a temperate 49
japonica variety, TN13, likely due to its positive effect on sink capacity. Our 50
findings suggest that incorporation of qSBN7 can increase yield potential and improve 51
the breeding of elite rice varieties. 52
53
54
Introduction 55
4
Grain number, one of the predominant components of rice yield, can be 56
efficiently increased by nitrogen fertilizer (Doberman and Fairhurst 2001). To achieve 57
high grain productivity, farmers usually apply excessive fertilizers, which lead to soil 58
acidification, groundwater contamination, and increased costs. Pyramiding 59
quantitative trait loci (QTLs) for grain number and other yield-related traits is an 60
alternative means of improving productivity without causing adverse environmental 61
effects. To date, several QTLs for grain number, such as Gn1a, DEP1, WFP/IPA1, 62
SCM2, SPIKE (qTSN4), GNP1, qNPT1, and SGDP7/COS1, have been identified from 63
natural variations and applied in rice breeding (Ashikari et al. 2005; Huang et al. 2009; 64
Jiao et al. 2010; Miura et al. 2010; Ookawa et al. 2010; Fujita et al. 2013; Wu et al. 65
2016; Bai et al. 2017; Wang et al. 2017a; Huang et al. 2018). 66
Grain number is associated with several morphological components of panicle 67
architecture, among which secondary branch number per panicle is one of the most 68
crucial (Mei et al. 2006; Luo et al. 2009). To identify new genes for grain number, a 69
backcross population with segregating secondary branch number per panicle and grain 70
number phenotypes was developed by using the donor parent IR65598-112-2 and 71
recurrent parent TN13 (Wang et al. 2017b). Genetic analysis and rough genetic 72
mapping suggested that qSBN7, a single locus located on the long arm of chromosome 73
5
7, underlay the secondary branch and grain number variant and that the allele of 74
IR65598-112-2 was recessive (Wang et al. 2017b). 75
IR65598-112-2 is a new plant type cultivar, one of several released in the 1990s 76
by the International Rice Research Institute with a higher grain number per panicle, 77
larger leaves, strong culms, and few unproductive tillers. The high yield potentials of 78
these cultivars render them suitable for rice breeding and genetic analysis of rice yield. 79
However, so far only a few QTLs for yield potentials have been identified from new 80
plant type cultivars (Fujita et al. 2013; Wang et al. 2017a). 81
To reveal the genetic determinant underlying secondary branch number per 82
panicle and grain yield in rice, we undertook map-based cloning and a functional 83
characterization of qSBN7. Natural variations in the promoter region of FRIZZLE 84
PANICLE (FZP), a gene encoding an APETALA2/ETHYLENE response factor (ERF), 85
was identified as the genetic basis of qSBN7. This finding provided insight into the 86
molecular mechanisms of the complex rice yield trait. Phenotypic evaluations also 87
showed that qSBN7 had pleiotropic effects on secondary branch number per panicle, 88
grain number, grain length, 1,000-grain weight, and percentage of filled grains. Our 89
results suggest that qSBN7 increases reproductive sink capacity in rice and can be 90
applied in breeding new elite cultivars. 91
6
92
Materials and Methods 93
Primers 94
Primers used for high-resolution mapping, DNA sequencing, genotyping of four grain 95
number genes, vector construction, expression analysis, NIL development, and 96
transgenic plant identification are listed in Table S1. 97
98
Development of NILs 99
Two BC3F2 populations with the genetic backgrounds of TN13 and TCS10 were 100
generated by recurrent backcross breeding using IR65598-112-2 as the donor parent. 101
Two backcross inbred lines (BILs) carrying homozygous qSBN7 allele of 102
IR65598-112-2, BIL_TN13sbn
and BIL_TCS10sbn
, were selected from respective 103
BC3F2 population based on the genotypes of the SNP2830.5 marker. A whole-genome 104
survey of the two BILs was conducted using restriction-site associated DNA 105
sequencing (RAD-seq). Seven and three introgression segments of IR65598-112-2 106
were detected in BIL_TN13sbn
and BIL_TCS10sbn
, respectively (Figure S1, A and B). 107
To develop NIL_TN13sbn
and NIL_TCS10sbn
, BIL_TN13sbn
and BIL_TCS10sbn
were 108
backcrossed to their recurrent parents two times. One BC5F1 plant was selected and 109
7
self-pollinated to develop NIL_TN13sbn
, using 8 Kompetitive Allele Specific PCR 110
(KASP) markers (TN13_C2_8, TN13_C3_6, TN13_C6_5, TN13_C7_22, 111
TN13_C8_20, TN13_C9_16, TN13_C11_21, SNP2831) located at the introgression 112
segments of IR65598-112-2 in BIL_TN13sbn
(Figure S1A). Similarly, One BC5F1 113
plant was selected and self-pollinated to develop NIL_CS10sbn
, using 5 KASP 114
markers (TCS10_C2_15, TCS10_C2_25, TCS10_C4_14, TCS10_C7_20, SNP2831) 115
located at the introgression segments of IR65598-112-2 in BIL_TCS10sbn
(Figure 116
S1B). Custom KASP SNP assays and KASP Genotyping Master Mix were supplied 117
by LGC Genomics (Middlesex, UK). KASP analysis was carried out according to the 118
manufacture’s protocol, with a 5 µL total reaction volume, on a CFX96 ConnectTM
119
Real-Time PCR Detection System (Bio-Rad). 120
121
Plant materials and growing conditions 122
For qRT-PCR analysis and transgenic analysis, BIL-sbn with the homozygous qSBN7 123
allele of IR65598-112-2 was developed as previously described12
(previously named 124
BIL-sbn/sbn). The 66 accessions used in sequence analysis of FZP are listed in Table 125
S2. All transgenic plants and the 66 accessions used for DNA sequencing were grown 126
in a closed greenhouse at Biotechnology Center in Southern Taiwan of Agricultural 127
8
Biotechnology Research Center, Academia Sinica, Tainan, Taiwan (23°10’N, 120°128
29’E). The others were grown in paddy fields at Chia-Yi, Taiwan (23°42’N, 120°129
28’E). The rice plants were cultivated according to conventional management 130
practices in a well-irrigated paddy field. The amount of nitrogen fertilizer used was 131
160 kg ha-1
in each field. 132
133
Fine mapping of qSBN7 134
Through backcross breeding, we generated a BC2F5 mapping population with 135
segregating panicle phenotypes using the donor parent IR65598-112-2 and recurrent 136
parent TN13. A total of 1,652 BC2F5 individuals were genotyped using the SNP2788 137
and SNP2855 markers. Twenty-four recombinants each with a single crossover event 138
in the interval between SNP2788 and SNP2855 were obtained and self-pollinated to 139
produce BC2F5:6 to BC2F5:9 lines for a progeny test. All recombinants were further 140
genotyped using additional five markers: Indel2823, Indel2829, SNP2830.7, 141
SNP2830.9 and SNP2835. For the progeny test, 52 individuals per BC2F5:6 line were 142
visually rated as low secondary branch number (SBN) type , segregating , or 143
high-SBN types. Furthermore, nine homozygous recombinants were selected based on 144
the location of their crossover sites and evaluated for secondary branch number per 145
9
main panicle in the BC2F5:9 generation. 146
147
Sequence polymorphisms of FZP in rice germplasms 148
Genomic DNA extracted from the 66 accessions were used as DNA templates for 149
PCR. Primers used in DNA sequencing of the 9.3-kb candidate region and genotyping 150
of four grain number genes (GN1A, IPA1, DEP1 and SPIKE) are listed in Table S1. To 151
avoid false nucleotide polymorphisms caused by PCR amplification, three 152
independent PCR amplicons resulting from each combination of primer pairs and 153
DNA templates were mixed and then submitted to Sanger sequencing. The DNA 154
sequences were analyzed using Chromas software version 2.23 155
(http://www.technelysium.com.au). 156
157
Vector construction and plant transformation 158
To generate the p66 plasmid, a DNA fragment spanning from 2466 bp upstream of the 159
FZP transcription start site to 1307 bp downstream of its stop codon was amplified 160
from TN13 plants using the Vector_p40F and Vector_p40R primers, then cloned into 161
the binary pCAMBIA1300 vector (Cambia) treated with BamHI. This mediated 162
vector was designated as p40. Then, a DNA fragment between 1375 bp and 7583 bp 163
10
upstream of the FZP transcription start site was amplified from TN13 plants using the 164
Vector_p66F and Vector_p66R primers, then cloned into the binary p40 vector treated 165
with EcoRI. To generate the pRNA1 plasmid, a 21-bp amiRNA sequence 166
(TAATGATATATGCATGATCGC for 3’-UTR of FZP) was designed using Web 167
MicroRNA Designer 3 software (http://wmd3.weigelworld.org/cgi-bin/webapp.cgi). 168
The amiRNA precursor was generated by gene synthesis. The sequence of the 169
amiRNA precursor is shown in Figure S2. The precursor was amplified using the 170
Vector_RNAi F and Vector_RNAi R primers and then cloned into the binary vector 171
pCAMBIA1301 (Cambia), which was digested using BglII and PmlI. All vectors were 172
constructed using the In-Fusion HD Cloning Kit (Clontech Takara Bio). Vector p66 173
was introduced into BIL-sbn and vector pRNA1 into TN13 by 174
Agrobacterium-mediated transformation (Toki et al. 2006) at the Transgenic Plant 175
Laboratory, Institute of Plant and Microbial Biology, Academia Sinica (Taiwan). The 176
copy number of each independent T0 plant was evaluated using TaqMan® Copy 177
Number Assays (Applied Biosystems). We chose the rice tubulin alpha-1 chain as an 178
endogenous control gene (Kim et al. 2015) and hptII in the p66 and pRNA1 plasmids 179
as the target gene. Real-time PCR data were analyzed using CopyCaller software 180
version 2.0 (Applied Biosystems) according to the manufacturer’s instructions. To 181
11
generate p66 and pRNA1 transgenic lines, hptII specific marker (Table S1) was used 182
to exclude the wild type plants at T1 and T2 generations. For p66, 4 out of 10 T1 lines 183
were selected then self-pollinated to generate T2; 10 out of 32-36 plants from each T2 184
line (total four independent T2 lines) were selected by hptII marker then used for 185
phenotyping. For pRNA1, 6 out of 12 T1 lines were selected then self-pollinated to 186
generate T2; 10 out of 32-36 plants from each T2 line (total six independent T2 lines) 187
were selected by hptII marker then used for phenotyping. 188
189
RNA isolation and qRT-PCR analysis 190
We extracted total RNA using the RNeasy Plant Mini Kit (Qiagen). One µg of total 191
RNA was treated with RNase-free DNase I (Ambion) and then submitted to cDNA 192
synthesis using a SuperScriptTM III First-Strand Synthesis System Kit (Invitrogen). 193
Transcriptional levels of LOC_Os07g47330 (FZP) and LOC_Os07g47340 were 194
detected in a real-time PCR analysis. All assays were conducted with three biological 195
and three technical replicates. Real-time PCR was performed on a CFX96 ConnectTM
196
Real-Time PCR Detection System (Bio-Rad). Each real-time PCR reaction was 197
performed with a final volume of 10 µL, consisting of 5 µL of 2× SsoAdvanced 198
Universal Probes Supermix (Bio-Rad), 0.25 µL of each primer (50 µmol/L), 0.25 µL 199
12
of probe (10 µmol/L), 1 µL cDNA of template, and 3.5 µL of ddH2O. The rice 200
ubiquitin gene UBQ5 (LOC_Os01g22490) was used as the internal control. 201
202
Next-generation sequencing and sequence analysis 203
To obtain the full length of the insertion located 6102 bp upstream of FZP, the 204
genomic DNA of BIL-sbn was extracted using the protocol described by CTAB 205
method (Murray and Thompson 1980). A HiSeq4000 platform (Illumina) was used for 206
next-generation sequencing. DNA libraries were sequenced as 150-bp pair-end reads 207
at Tri-I Biotech Inc. (Taipei, Taiwan). A total of 75.3 Gb of raw reads were obtained 208
and de novo assembled at Genomics company (Taipei, Taiwan). To investigate the 209
whole-genome background of BIL_TN13sbn
and BIL_TCS10sbn
, the RAD libraries of 210
TN13, TCS10, IR65598-112-2, BIL_TN13sbn
and BIL_TCS10sbn
were constructed as 211
previously described (Etter et al. 2011). A total of 7.6 Gb raw reads were obtained on 212
an Illumina HiSeq4000 at Tri-I Biotech Inc. (Taipei, Taiwan), and then analyze as 213
previously described (Wang et al. 2017b). 214
215
Analysis of grain quality 216
To evaluate eating quality traits, 150-200 g grains from each replication were milled 217
13
to yield brown rice grains. Chalky grain ratio was evaluated using 1,000 brown rice 218
grains and a rice quality selector (Satake Co.) following the operations manual. The 219
amylose content and protein content were measured using grain composition analyzer 220
(Kett Co.) in accordance with the operations manual. 221
222
Data availability Statement 223
Materials and plasmids are available upon request. FZP sequences of 66 rice 224
accessions (File S1), and the data in Supplemental Figures and Supplemental Tables 225
are available at FigShare 226
(https://figshare.com/articles/Supplemental_Material_for_Wang_et_al_2020/1191930227
3). Whole genome sequences of BIL_sbn are deposited in Sequence Read Archive 228
(SRA) database (SRA accession: PRJNA607167; 229
https://www.ncbi.nlm.nih.gov/sra/PRJNA607167). RAD sequencing data are 230
deposited in SRA database (SRA accession: PRJNA607003; 231
https://www.ncbi.nlm.nih.gov/sra/PRJNA607003). All other relevant data are within 232
the article and its Tables and Figures. 233
234
Results 235
14
High-resolution mapping and identification of qSBN7 236
TN13 is a temperate japonica cultivar with approximately 19.5 secondary branches 237
and 111.2 grains per panicle; IR65598-112-2 is a tropical japonica (javanica) cultivar 238
with approximately 82.1 secondary branches and 371.3 grains per panicle (Figure 1, 239
A-E). To identify the causal gene of qSBN7, we conducted high-resolution linkage 240
analysis on a segregating population consisting of 1,652 BC2F5 individuals derived 241
from IR65598-112-2 and TN13. The qSBN7 locus was narrowed to an approximately 242
9.3-kb segment between the Indel2829 and SNP2830.9 markers (Figure 1F and Figure 243
S3). According to Michigan State University Rice Genome Annotation Project release 244
7 (http://rice.plantbiology.msu.edu/), this region covers the full length of 245
LOC_Os07g47330 and the last two exons of LOC_Os07g47340 (Figure 1G). We 246
compared the sequences of TN13 and IR65598-112-2 across the 9.3-kb candidate 247
region and found no difference in the coding regions of the two candidate genes, 248
except for two SNPs (c.-4066C>T and c.-6383A>G) and an 8461-bp indel 249
(c.-6101>-6102insCACTACCA…) in the upstream of LOC_Os07g47330 (Figure 1G). 250
The 8461-bp insertion encodes a putative CACTA transposon (Figure S4) and thus 251
may affect the expression of LOC_Os07g47330 and LOC_Os07g47340, but the 252
transposon itself is unlikely to be the causative gene. 253
15
Quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis 254
was conducted to reveal the transcript levels of the two candidate genes at seedling 255
and three panicle development stages in TN13 and BIL-sbn (a BC2F4-derived line 256
carrying the homozygous qSBN7 locus of IR65598-112-2 in the TN13 genetic 257
background). No significant differences were detected between expressions of 258
LOC_Os07g47340 in TN13 and BIL-sbn at all stages (Figure 2A). However, 259
significantly higher expression of LOC_Os07g47330 was observed at the 1-mm 260
panicle stage in TN13 than in BIL-sbn (Figure 2B). At this stage the primary rachis 261
branch meristem produces lateral branches (Ikeda et al. 2004), suggesting that 262
differential expression of LOC_Os07g47330 may cause variations in secondary 263
branch number. LOC_Os07g47330 is the previously identified FRIZZLE PANICLE 264
(FZP) gene in rice. FZP encodes an ERF transcription factor (Komatsu et al. 2003) 265
and is the ortholog of the maize BRANCHED SILKLESS 1 gene (Chuck et al. 2002). 266
267
FZP was the gene responsible for qSBN7 268
To examine whether FZP underlay the secondary branch and grain number variant, a 269
9.8-kb genomic DNA fragment containing the FZP locus of TN13 (designated as p66) 270
(Figure S5) was introduced into BIL-sbn. The transgenic plants carrying a single copy 271
16
of p66 showed significantly lower secondary branch number per panicle, lower grain 272
number, and increased grain length (Figure 2 and Figure S6). Comparison of FZP 273
transcript levels in BIL-sbn and the four independent T2 lines showed that three lines 274
with rescued phenotypes (p66-01, p66-20, and p66-27) exhibited a significantly 275
higher FZP expression than BIL-sbn (Figure 2C). These results indicated that FZP 276
was the gene responsible for the observed qSBN7 effects. 277
278
Negative correlation between the level of FZP expression and qSBN7 phenotypes. 279
Next, we investigated whether the differential expression of FZP correlated with the 280
levels of secondary branch number per panicle, grain number, and grain length. We 281
generated a silencing transgenic line by introducing pRNA1, which contains a 21-bp 282
artificial microRNA sequence of FZP (amiRNA1), into TN13. Compared with TN13, 283
most of the independent T1 lines with single-copy amiRNA1 showed increased 284
secondary branch per panicle and grain number and reduced grain length, with some 285
variations (Figure 3 shows comparisons between TN13 and a representative silencing 286
line, pRNAi-19. Data from all 12 T1 lines are given in Figure S7, A-C). However, we 287
observed no significant difference in primary branch number per panicle among the 288
transgenic plants and TN13. (Figure 3B and Figure S7D) 289
17
We then performed qRT-PCR to clarify the transcript levels of FZP in TN13 and six 290
randomly chosen independent T2 lines. FZP was expressed in the six T2 lines at 291
lower levels than in TN13 (Figure 3F), and its expression was negatively correlated 292
with secondary branch number per panicle (r = −0.883) (Figure S8). We noted that 293
pRNAi-19, pRNAi-03, and BIL-sbn, which exhibited similar FZP expression levels 294
(approximately 36%–44% of FZP expression in TN13), all showed increased 295
secondary branch per panicle and grain number and similar panicle type (Figure 3 and 296
Figure S7). In pRNAi-01, the line exhibiting a stronger silencing effect (FZP 297
expression decreased to 24.6%), we found an increased secondary branch number per 298
panicle, almost no grains, and a frizzy panicle (floret formation replaced by 299
continuous branching), which was similar to previously reported fzp mutants14
(Figure 300
3A). Our findings confirmed that differential expression of FZP affected secondary 301
branch number per panicle, grain number, and grain length, but not primary branch 302
number per panicle. They also suggested that qSBN7 was a hypomorphic allele for 303
lower expression of FZP. 304
305
Sequence polymorphisms of FZP in rice germplasms 306
To investigate functional allelic variations in FZP, 66 accessions consisting of 22 307
18
temperate japonica, 15 tropical japonica, and 29 indica cultivars were selected for 308
sequencing analysis of a 1.8-kb genomic DNA region spanning a 402-bp promoter, 309
5’-UTR, the coding region, and 3’-UTR (Figure S9, A and B). Since IR65598-112-2 310
and TN13 have two single-nucleotide polymorphisms (SNPs) and one insertion 311
difference in the distal promoter region of FZP, the genotypes near these three 312
polymorphic sites in the 66 accessions were also examined. According to the panicle 313
structure of p66 and pRNA1 transgenic lines, FZP affected secondary branch number 314
per panicle by regulating secondary branch number per primary branch (Figure S6E 315
and Figure S7E). Therefore, secondary branch numbers per primary branch of the 66 316
accessions were evaluated. Eleven haplotypes were identified, with only four 317
synonymous polymorphisms and one missense polymorphism found in the coding 318
region (Figure S9C). Two indica cultivars carrying the same missense polymorphism, 319
IR61608-3B-20-2-2-1-2 (haplotype 10) and Mudgo (haplotype 11), showed different 320
levels of secondary branch numbers per primary branch, indicating that this was a 321
neutral mutation (Figure S9C and Table S2). Additionally, no amino acid changes in 322
ERF elements were detected (Figure S9C), indicating that the FZP protein was highly 323
conserved in rice. 324
Nucleotide variants found in the promoter and UTR regions may regulate the 325
19
transcriptional level of FZP, resulting in differential numbers of secondary branches 326
and grains. A comparison between the genotypes and phenotypes of the 66 accessions 327
(Figure S9C and Table S2) suggested that the polymorphisms at sites −6383, −220, 328
−136, 1211, and 1276 were unlikely to be the key regulatory elements for the trait. On 329
the other hand, haplotypes 6 (IR65598-112-2 and IR76904-7-19) and 7 (BSI325) 330
shared the same variants at sites −6102, −4066, and 1103 and exhibited relatively high 331
numbers of secondary branches per primary branch. Site 1103 (= Indel2829 marker) 332
at 3’-UTR was excluded based on the result from high-resolution mapping of qSBN7 333
(Figure S9A). 334
Among individual accessions in different rice populations (Table S2), 335
IR76904-7-19 (haplotypes 6) and IR65598-112-2 (haplotypes 6) showed higher 336
numbers of secondary branches per primary branch than other tropical japonica 337
cultivars investigated in this study. Similarly, BSI325 (haplotypes 7) showed higher 338
numbers of secondary branches per primary branch than other temperate japonica 339
cultivars tested. However, among the tested indica cultivars, Kasalath and Zhuan 340
(which shared the same variants at sites −6102, and −4066) did not show significantly 341
higher numbers of secondary branches per primary branch than the rest of the indica 342
cultivars (Table S2). To understand whether other trait-related polymorphisms 343
20
occurred in the distal promoter region, we sequenced an 8331-bp region in the 344
upstream of FZP for IR76904-7-19, BSI325, Kasalath, and Zhuan. Our results 345
revealed that whereas IR76904-7-19 and BSI325 were monomorphic to 346
IR65598-112-2, Kasalath and Zhuan9 differed from IR65598-112-2 by an 18-bp 347
duplication (GCACGCACGCACGGACGC) located 5308 bp upstream of FZP (Table 348
S2). This indicated that natural variants located in the distal promoter region of FZP 349
played a regulatory role in the production of secondary branches per panicle and 350
grains in rice, and qSBN7 was a rare allele in the collected accessions. 351
352
qSBN7 enhanced sink capacity and yield in a favorable genetic background 353
To evaluate the potential of qSBN7 for high-yield breeding, we generated two near 354
isogenic lines (NILs) NIL_TN13sbn
and NIL_TCS10sbn
, which carried the 355
homozygous qSBN7 allele of IR65598-112-2 in the TN13 (temperate japonica) and 356
TCS10 (indica) genetic background, respectively (Figure S1, C and D). Phenotypic 357
characterization of TN13 and NIL_TN13sbn
in rice paddies showed no significant 358
morphological differences at vegetative stages (Figure 4A). For panicle traits, 359
NIL_TN13sbn
showed higher numbers of secondary branches per panicle, grains per 360
panicle and grains per secondary branch than TN13, but also shorter grain length 361
21
(Figure 4). Similarly, there were no significant phenotypic differences among TCS10 362
and NIL_TCS10sbn
before flowering. However, NIL_TCS10sbn
showed severely 363
degenerated panicle and abortive grains (Figure S10), which were similar to the 364
phenotypes of the mutant lines (pRNAi-21) exhibiting stronger silencing effect of 365
FZP (Figure 3A). 366
Additional field experiments were conducted to determine whether qSBN7 affects 367
important agronomic traits, grain quality and yield components in the TN13 genetic 368
background. No significant difference in days to heading, plant height, amylose 369
content, protein content, chalky grain ratio and panicle number per plant were 370
observed between TN13 and NIL_TN13 sbn
(Table 1 and Table S3). However, 371
NIL_TN13sbn
showed significantly increased grain number, sink capacity, and grain 372
yield, and decreased 1,000-grain weight and filled-grain percentage than in TN13 373
(Table 1). NIL_TN13sbn
exhibited 10.9% higher grain yield than in TN13 (Table 1). 374
Taken altogether, our findings indicated that qSBN7 is a pleiotropic QTL for panicle 375
traits, and it could increase rice production without affecting grain quality in a 376
favorable genetic background TN13. 377
378
Discussion 379
22
Grain number is an essential agronomic trait for rice production, because it 380
determines reproductive sink capacity and thus affects grain yield. Several genes for 381
grain number have been identified from natural variations (Ashikari et al. 2005; 382
Huang et al. 2009; Jiao et al. 2010; Miura et al. 2010; Ookawa et al. 2010; Fujita et al. 383
2013; Wu et al. 2016; Wang et al. 2017a; Huang et al. 2018), each with distinct 384
pleiotropic effects on other agronomic traits. For example, the dep1 allele (DEP1 385
allele of Shennong 265) enhanced grain and secondary branch number per panicle but 386
reduced 1,000-grain weight, panicle length, and plant height (Huang et al. 2009). The 387
ipa1 allele (IPA1 allele of Shaoniejing) increased grain number, 1,000-grain weight, 388
and plant height, but reduced tiller number (Jiao et al. 2010). These genes with 389
differential effects are perhaps suitable for different ecological conditions and genetic 390
backgrounds, and can be applied to achieve different breeding goals. Further 391
identification of yield-related genes will allow greater flexibility in rice-breeding 392
programs. 393
Identifying advantageous alleles from natural variants can facilitate the breeding of 394
high-yield rice. We performed high-resolution mapping for a secondary branch per 395
panicle and grain number locus, qSBN7. Fine genetic mapping and a complementation 396
test for qSBN7 revealed that the causal gene was FZP, which encodes an ERF 397
23
transcription factor gene (Komatsu et al. 2003). Grass inflorescence development 398
involves meristem determinacy/indeterminacy decisions (Bommerta and Whippleb 399
2018). FZP appears to be a key regulator of the competitive balance between the 400
formation of axillary and floral meristems. Komatsu et al. (2003) showed that FZP 401
functions to repress axillary meristem formation in rice spikelets. Mutation of FZP 402
resulted in exceptionally high numbers of secondary and higher-order branches 403
without normal spikelets (Komatsu et al. 2003; Yi et al. 2005; Kato and Horibata 404
2012; Bai et al. 2016). FZP was recently identified as the causal gene of two grain 405
number loci in rice, Small Grain and Dense Panicle 7 (SGDP7) and CONTROL OF 406
SECONDARY BRANCH 1 (COS1) (Bai et al. 2017; Huang et al. 2018). An 18-bp 407
duplication ~5.3 kb upstream of FZP (SGDP7) caused reduced expression of FZP 408
and increased grain number and grain yield (Bai et al. 2017). A 4-bp deletion ~2.7 409
kb upstream of FZP (COS1) caused reduced expression of FZP and increased 410
secondary branches and grain yield (Huang et al. 2018). In this study, we found a 411
novel and advantageous allele of FZP. Compare to cultivated rice (TN13), qSBN7 of 412
IR65598-112-2 is also a hypomorphic allele of FZP which causes an approximately 413
56% decrease in its transcriptional level. Similar to SGDP7, qSBN7 probably 414
increased the transition from spikelet meristem to secondary branch meristem on 415
24
primary branches while sufficiently preventing the formation of tertiary branches on 416
secondary ones. Thus, qSBN7 can simultaneously increase secondary branch and 417
grain number, making it suitable for breeding elite rice varieties. 418
Sequence polymorphisms of FZP in 66 accessions showed that the FZP protein 419
was highly conserved in rice, and that variants located in the distal promoter region 420
were responsible for modulating production of secondary branches per panicle and 421
grains. It is notable that among the 66 accessions, only IR65598-112-2, IR76904-7-19, 422
and BSI325 carried the qSBN7 allele, suggesting that qSBN7 has not been widely used 423
in modern rice-breeding programs. In addition to the two polymorphic sites (−6102 424
and −4066) identified in the qSBN7 allele, the 18-bp duplication previously identified 425
in the SGDP7 allele (Bai et al. 2017) were found at site −5308 (in Kasalath and 426
Zhuan 9) (Table S2). This duplication contained two BES1 transcription factor 427
binding sites (CGTGCG), which were reported to be regulated by a brassinosteroid 428
signal transduction gene, OsBZR1(He et al. 2005; Bai et al. 2007). Curiously, 429
although both the variants of qSBN7 (−6102 and −4066) and the 18-bp duplication 430
(Bai et al. 2017) could repress the FZP expression and increase secondary branch 431
number in rice, two indica cultivars Kasalath and Zhuan (which contained both the 432
variants of qSBN7 and the 18-bp duplication) did not show significantly higher 433
25
numbers of secondary branches per primary branch than the rest of the indica 434
cultivars. How different variations in the promoter region of FZP affect its expression 435
and the regulation of secondary branch number per primary branch remain to be 436
resolved. 437
Transgenic analysis and allelic evaluation of qSBN7 revealed its pleiotropic effects 438
of increasing secondary branch per panicle and grain number, and reducing grain 439
length, 1,000-grain weight, and percentage of filled grains (Figure 2, Figure 4 and 440
Table 1). Other studies have noted trade-offs among yield components. It has been 441
reported that improving grain number per panicle could increase competition for 442
assimilate supply, resulting in a reduced filled grain percentage and 1,000-grain 443
weight. Thus, introgression lines carrying QTLs for grain number usually showed 444
increased panicle size but not enhanced grain yield (Ohsumi et al. 2011; Takai et al. 445
2014; Fukushima et al. 2017). In this study, qSBN7 could improve grain number and 446
grain yield in TN13 by approximately 71.4% and 10.9%, respectively (Table 1). TN13 447
is a variety exhibiting high lodging-resistance, long and erect flag leaf, and low 448
number of grains. The architectures imply that TN13 may have relatively higher 449
photosynthesis efficiencies but poor sink capacity (Li et al. 1998; Horton 2000). 450
When qSBN7 was introgressed into TN13, the improved sink capacity together with 451
26
the inherently high source capacity in TN13 successfully improved the grain yield. In 452
contrast, TCS10 is a high grain number variety which carries a grain number QTL, 453
Gn1a (Table S2). Although pyramiding qSBN7 with Gn1a may further promote the 454
development of spikelet meristems, most of the spikelets in NIL_TCS10sbn
were 455
aborted (Figure S10), perhaps due to a shortage of carbohydrates. Source, sink, and 456
translocation capacities all play important roles in grain yield (Ohsumi et al. 2011; 457
Adriani et al. 2016). qSBN7 allele of IR65598-112-2 had no effect on source size, but 458
the efficiencies of photosynthesis and translocation of carbohydrates appeared to be 459
critical during grain filling stage. In recent years, some QTLs for source-related traits 460
have been identified and used for rice breeding (Sun et al. 2014; Hu et al. 2015). 461
Pyramiding the beneficial qSBN7 allele and source-related QTLs may be the key to 462
successful development of high yield rice. 463
464
Acknowledgments 465
The work was supported by the Ministry of Science and Technology of Taiwan 466
(106-2313-B-002-021-MY3), Bureau of Animal and Plant Inspection and Quarantine 467
(BAPHIQ), Council of Agriculture, Taiwan (108AS-8.4.4-BQ-B1(1)), and Tainan District 468
Agricultural Research and Extension Station, Council of Agriculture, Taiwan 469
27
(108AS-7.6.3-NS-N2). 470
471
Literature Cited 472
Adriani, D. E., M. Dingkuhn, A. Dardou, H. Adam, D. Luquet et al., 2016 Rice 473
panicle plasticity in near isogenic lines carrying a QTL for larger panicle is 474
genotype and environment dependent. Rice 9: 28. 475
Ashikari, M., H. Sakakibara, S. Lin, T. Yamamoto, T. Takashi et al., 2005 Cytokinin 476
oxidase regulates rice grain production. Science 309: 741–745. 477
Bai, M. Y., L. Y. Zhang, S. S. Gampala, S. W. Zhu, W. Y. Song et al., 2007 Functions 478
of OsBZR1 and 14-3-3 proteins in brassinosteroid signaling in rice. Proc. Natl. 479
Acad. Sci. USA 104: 13839–13844. 480
Bai, X., Y. Huang, D. Mao, M. Wen, L. Zhang et al., 2016 Regulatory role of FZP in 481
the determination of panicle branching and spikelet formation in rice. Sci. Rep. 6: 482
19022. 483
Bai, X., Y. Huang, Y. Hu, H. Liu, B. Zhang et al., 2017 Duplication of an upstream 484
silencer of FZP increases grain yield in rice. Nat. Plants 3: 885–893. 485
Bommerta, P., and C. Whippleb, 2018 Grass inflorescence architecture and meristem 486
determinacy. Semin. Cell Dev. Biol. 79: 37–47. 487
28
Chuck, G., M. Muszynski, E. Kellogg, S. Hake, and R. J. Schmidt, 2002 The control 488
of spikelet meristem identity by the branched silkless1 gene in maize. Science 298: 489
1238–1241. 490
Doberman, A., and T. Fairhurst, 2001 Rice: Nutrient disorders and nutrient 491
management. PPI/PPIC, Singapore and IRRI, Philippines. 492
Etter, P. D., S. Bassham, P. A. Hohenlohe, E. A. Johnson, and W. A. Cresko, 2011 493
SNP discovery and genotyping for evolutionary genetics using RAD sequencing. 494
Methods Mol. Biol. 772: 157–178. 495
Fujita, D., K. R. Trijatmiko, A. G. Tagle, M. V. Sapasap, Y. Koide et al., 2013 NAL1 496
allele from a rice landrace greatly increases yield in modern indica cultivars. Proc. 497
Natl. Acad. Sci. USA 110: 20431–20436. 498
Fukushima, A., H. Ohta, N. Yokogami, N. Tsuda, A. Yoshida et al., 2017 Effects of 499
genes increasing the number of spikelets per panicle, TAW1 and APO1, on yield 500
and yield-related traits in rice. Plant Prod. Sci. 20: 485–489. 501
He, J. X., J. M. Gendron, Y. Sun, S. S. L. Gampala, N. Gendron et al., 2005 BZR1 is a 502
transcriptional repressor with dual roles in brassinosteroid homeostasis and 503
growth responses. Science 307: 1634–1638. 504
Horton, P., 2000 Prospects for crop improvement through the genetic manipulation of 505
29
photosynthesis: morphological and biochemical aspects of light capture. J. Exp. 506
Bot. 51: 475–485. 507
Hu, B., W. Wang, S. Ou, J. Tang, H. Li et al., 2015 Variation in NRT1.1B contributes 508
to nitrate-use divergence between rice subspecies. Nat. Genet. 47: 834–838. 509
Huang, X., Q. Qian, Z. Liu, H. Sun, S. He et al., 2009 Natural variation at the DEP1 510
locus enhances grain yield in rice. Nat. Genet. 41: 494–497. 511
Huang, Y., S. Zhao, Y. Fu, H. Sun, X. Ma et al., 2018 Variation in the regulatory 512
region of FZP causes increases in secondary inflorescence branching and grain 513
yield in rice domestication. Plant J. 96: 716–733. 514
Ikeda, K., H. Sunohara, and Y. Nagato, 2004 Developmental course of inflorescence 515
and spikelet in rice. Breed. Sci. 54: 147–156. 516
Jiao, Y., Y. Wang, D. Xue, J. Wang, M. Yan et al., 2010 Regulation of OsSPL14 by 517
OsmiR156 defines ideal plant architecture in rice. Nat. Genet. 42: 541–544. 518
Kato, T., and A. Horibata, 2012 A novel frameshift mutant allele, fzp-10, affecting the 519
panicle architecture of rice. Euphytica 184: 65–72. 520
Kim, A. R., H. Lim, J. I. Cho, C. K. Kim, S. U. Ji et al., 2015 Over- expression of 521
BrTSR53 gene improves tolerance of rice plant to salt stress. Plant Breed. Biotech. 522
3: 376–383. 523
30
Komatsu, M., A. Chujo, Y. Nagato, K. Shimamoto, and J. Kyozuka, 2003 FRIZZY 524
PANICLE is required to prevent the formation of axillary meristems and to 525
establish floral meristem identity in rice spikelets. Development 130: 3841–3850. 526
Li, Z., S. R. M. Pinson, J. W. Stansel, and A. H. Paterson, 1998 Genetic dissection of 527
the source-sink relationship affecting fecundity and yield in rice (Oryza sativa L.). 528
Mol. Breed. 4: 419–426. 529
Luo, X., F. Tian, Y. Fu, J. Yang, and C. Sun, 2009 Mapping quantitative trait loci 530
influencing panicle-related traits from Chinese common wild rice (Oryza 531
rufipogon) using introgression lines. Plant Breed. 128: 559–567. 532
Mei, H. W., J. L. Xu, Z. K. Li, X. Q. Yu, L. B. Guo et al., 2006 QTLs influencing 533
panicle size detected in two reciprocal introgressive line (IL) populations in rice 534
(Oryza sativa L.). Theor. Appl. Genet. 112: 648–656. 535
Miura, K., M. Ikeda, A. Matsubara, X. J. Song, M. Ito et al., 2010 OsSPL14 promotes 536
panicle branching and higher grain productivity in rice. Nat. Genet. 42: 545–549. 537
Murray, M. G., and W. F. Thompson, 1980 Rapid isolation of high molecular weight 538
plant DNA. Nucleic Acids Res. 8: 4321–4325. 539
Ohsumi, A., T. Takai, M. Ida, T. Yamamoto, Y. Arai-Sanoh et al., 2011 Evaluation of 540
yield performance in rice near-isogenic lines with increased spikelet number. 541
31
Field Crops Res. 120: 68–75. 542
Ookawa, T., T. Hobo, M. Yano, K. Murata, T. Ando et al., 2010 New approach for 543
rice improvement using a pleiotropic QTL gene for lodging resistance and yield. 544
Nat. Commun. 1: 132. 545
Sun, H., Q. Qian, K. Wu, J. Luo, S. Wang et al., 2014 Heterotrimeric G proteins 546
regulate nitrogen-use efficiency in rice. Nat. Genet. 46: 652–656. 547
Takai, T., T. Ikka, K. Kondo, Y. Nonoue, N. Ono et al., 2014 Genetic mechanisms 548
underlying yield potential in the rice high-yielding cultivar Takanari, based on 549
reciprocal chromosome segment substitution lines. BMC Plant Biol. 14: 295. 550
Toki, S., N. Hara, K. Ono, H. Onodera, A. Tagiri et al., 2006 Early infection of 551
scutellum tissue with Agrobacterium allows high-speed transformation of rice. 552
Plant J. 47: 969–976. 553
Wang, S., K. Wu, Q. Qian, Q. Liu, Q. Li et al., 2017a Non-canonical regulation of 554
SPL transcription factors by a human OTUB1-like deubiquitinase defines a new 555
plant type rice associated with higher grain yield.Cell Res. 27: 1142–1156. 556
Wang, S. S., R. K. Chen, K. Y. Chen, C. Y. Liu, S. M. Kao et al., 2017b Genetic 557
mapping of the qSBN7 locus, a QTL controlling secondary branch number per 558
panicle in rice. Breed. Sci. 67: 340–347. 559
32
Wu, Y., Y. Wang, X. F. Mi, J. X. Shan, X. M. Li et al., 2016 The QTL GNP1 encodes 560
GA20ox1, which increases grain number and yield by increasing cytokinin 561
activity in rice panicle meristems. PLOS Genet. 12: e1006386. 562
Yi, G., J. H. Choi, E. G. Jeong, N. S. Chon, K. K. Jena et al., 2005 Morphological and 563
molecular characterization of a new frizzy panicle mutant, “fzp-9(t)”, in rice 564
(Oryza sativa L.). Hereditas 142: 92–97. 565
566
567
568
569
570
571
572
573
574
575
576
577
578
579
580
581
582
583
584
585
586
587
588
Table 1. Comparison of agronomic traits between TN13 and NIL_TN13sbn 589
Traits1 TN13 NIL_TN13
sbn P-value
3
33
Days to heading 76.7 ± 1.5 76.0 ± 1.7 0.643
Plant height (cm) 93.2 ± 1.2 95.3 ± 3.2 0.338
Panicles per plant 15.6 ± 1.2 16.3 ± 1.2 0.493
Grains per panicle 99.2 ± 4.8 170.0 ± 16.1 0.002
Percentage of filled grains 85.6 ± 1.1 65.8 ± 9.2 0.025
1000-grain weight (g) 26.1 ± 0.8 21.1 ± 0.8 0.002
Sink capacity per plant2 (g) 39.9 ± 1.4 58.1 ± 7.3 0.013
Grain yield per plant (g) 34.2 ± 1.5 37.9 ± 1.3 0.045
1The experiments were carried out in paddy fields at Chia-Yi, Taiwan, in the first crop season of 2019. 590
A completely randomized design with three replications was used in all trials. Plant spacing was 15 cm 591
between plants and 30 cm between rows, with a single plant per hill. Data are shown as mean ± SD. (n 592
= 6 plants). 593
2 Sink capacity per plant (maximum grain weight per plant) = (number of grains per plant) ⅹ 594
(1000-grain weight)/1000. 595
3 The P-value indicates the significance of the difference between TN13 and NIL_TN13sbn based on 596
Student’s t-test. 597
598
599
600
601
602
603
604
605
606
607
608
Figure Legends 609
34
610
Figure 1 Map-based cloning of qSBN7. (A) Plant architecture of IR65598-112-2. 611
Scale bar, 20 cm. (B) Plant architecture of TN13. Scale bar, 20 cm. (C) Panicle 612
structure of IR65598-112-2 and TN13. Scale bar, 4 cm. (D) Number of secondary 613
branches per panicle. (E) Number of grains per panicle. (F) A high-resolution map 614
delimiting the qSBN7 locus to a 9.3-kb region between the Indel2829 and SNP2830.9 615
markers. (G) The structure of two putative genes predicted in Rice Genome 616
Annotation Project release 7. A C/T SNP, 8461-bp insertion, and A/G SNP were 617
located 4066, 6102 and 6383 bp upstream of LOC_Os07g47330, respectively. Values 618
in D and E are means ± SD (n = 10 plants). 619
620
621
Figure 2 Expression analysis of two candidate genes and complementation test of 622
qSBN7. (A) Transcript levels of LOC_Os07g47340 at seedling and three panicle 623
development stages. (B) Transcript levels of LOC_Os07g47330 at seedling and three 624
panicle development stages. (C) Transcript levels of FZP in BIL-sbn and four 625
independent transgenic lines at the 1-mm panicle stage. (D) Panicle structure of 626
BIL-sbn. Scale bar, 4 cm. (E) Panicle structure of p66-01. Scale bar, 4 cm. (F) Panicle 627
35
structure of TN13. Scale bar, 4 cm. (G) Grains of BIL-sbn, p66-01, and TN13. Scale 628
bar, 5 mm. (H) Number of secondary branches per main panicle. (I) Number of grains 629
per main panicle. (J) Grain length. Values in A–C and H–J are means ± SD (n = 3 630
independent trials and 3 plants per trial in A–C; n = 10 plants in H–J). Data in D–J 631
were collected from plants grown in paddies under greenhouse conditions in the 2016 632
second crop season. The plant spacing was 15 cm between plants and 20 cm between 633
rows. Student’s t-test was used to examine P values. ** Significant at 1% level; * 634
Significant at 5% level; n.s., not significant. 635
636
637
Figure 3 Transgenic analysis for FZP through gene silencing. (A) Panicle structures 638
of TN13, BIL-sbn, and four transgenic T1 lines. Scale bar, 4 cm. (B) Comparison of 639
primary branch number per main panicle between TN13 and pRNAi-19. (C) 640
Comparison of secondary branch number per main panicle between TN13 and 641
pRNAi-19. (D) Comparison of grain number per main panicle between TN13 and 642
pRNAi-19. (E) Comparison of grain length between TN13 and pRNAi-19. (F) FZP 643
transcript levels in TN13, BIL-sbn, and six independent T2 transgenic lines. Values in 644
B–F are means ± SD (n = 10 plants in B–E; n = 3 independent trials and 3 plants per 645
36
trial in F). Data in A–E were collected from plants grown in paddies under greenhouse 646
conditions in the 2016 second crop season. The plant spacing was 15 cm between 647
plants and 20 cm between rows. Data in F were collected from plants grown in 648
paddies under greenhouse conditions in the 2017 first crop season. The plant spacing 649
was 23 cm between plants and 23 cm between rows. Student’s t-test was used to 650
examine P values. ** Significant at 1% level; * Significant at 5% level; n.s., not 651
significant. 652
653
654
Figure 4 Phenotypic characterization of TN13 and NIL_TN13sbn
. (A) Plant structure 655
of TN13 and NIL_TN13sbn
. Scale bar, 20 cm. (B) Panicle structure of TN13 and 656
NIL_TN13sbn
. Scale bar, 4 cm. (C) Grain size of TN13 and NIL_TN13sbn
. Scale bar, 5 657
mm. (D) Number of primary branches per main panicle. (E) Number of secondary 658
branches per main panicle. (F) Number of grains per main panicle. (G) Grain length. 659
(H) Number of grains per secondary branch. A completely randomized design with 660
three replications was used in all trials. Data in D–H were collected from plants 661
grown in paddies under natural conditions. The plant spacing was 15 cm between 662
plants and 30 cm between rows. Values in D–H are means ± SD (n = 10 plants). 663
37
Student’s t-test was used to examine P values. ** Significant at 1% level; n.s., not 664
significant. 665
666