A Protein Interaction between b-Catenin and Dnmt1 ... · roles in cell–cell adhesion and in regulation of Wnt-driven transcription. Here, a novel mass spectrometry–based proteo-mics

Chromatin, Gene, and RNA Regulation

A Protein Interaction between b-Catenin andDnmt1 Regulates Wnt Signaling and DNAMethylation in Colorectal Cancer CellsJing Song1, Zhanwen Du2, Mate Ravasz3, Bohan Dong2,4, Zhenghe Wang2, andRob M. Ewing3

Abstract

Aberrant activation of the Wnt signaling pathway is animportant step in the initiation and progression of tumordevelopment in diverse cancers. The central effector of canon-ical Wnt signaling, b-catenin (CTNNB1), is a multifunctionalprotein, and has been extensively studied with respect to itsroles in cell–cell adhesion and in regulation of Wnt-driventranscription. Here, a novel mass spectrometry–based proteo-mics technique in colorectal cancer cells expressing stabilizedb-catenin, was used to identify a protein–protein interactionbetween b-catenin and DNA methyltransferase I (Dnmt1) pro-tein, the primary regulator of DNA methylation patterns inmammalian cells. Dnmt1 and b-catenin strongly colocalized inthe nuclei of colorectal cancer cells, and the interaction ismediated by the central domain of the Dnmt1 protein. Dnmt1protein abundance is dependent upon the levels of b-catenin,

and is increased in cells expressing stabilized mutant b-catenin.Conversely, the Dnmt1 regulates the levels of nuclear b-cateninand b-catenin/TCF–driven transcription. In addition, lysine-specific demethylase 1 (LSD1/KDM1A), a regulator of DNMT1stability, was identified as a component of the Dnmt1–b-cate-nin protein complex and perturbation of the Dnmt1–b-catenininteraction altered DNA methylation. In summary, a functionalprotein–protein interaction was identified between two criti-cally important oncoproteins, in turn revealing a link betweenWnt signaling and downstream nuclear functions mediated byDnmt1.

Implications: Two critical oncoproteins, Dnmt1 and b-catenin,mutually regulate one each other's levels and activities in colo-rectal cancer cells. Mol Cancer Res; 13(6); 969–81. �2015 AACR.

IntroductionCancer cells typically exhibit complex, multilayered perturba-

tions of signaling pathways and regulatory mechanisms (1).Dysregulation of the Wnt signaling pathway is a major factor inthe initiation and progression of colorectal cancer. Canonical orb-catenin-dependent Wnt signaling is the best-defined branch ofWnt signaling, and is activated by binding of a Wnt ligand withspecific cell surface receptor complexes. The subsequent signalingcascade leads to accumulation and nuclear translocation ofb-catenin, the central effecter of canonical Wnt signaling. Activat-ing mutations of b-catenin, which stabilize the protein, or loss offunction of tumor suppressors such as adenomatous polyposiscoli (APC), are causal events in the initiation of colorectal cancer

(2, 3). b-Catenin is one of the best studied oncoproteins anddiverse b-catenin protein–protein interactions have been identi-fied. Recent studies, for example, have revealed the association ofb-catenin with chromatin and epigenetic modifying complexes(4, 5), and it is clear that our knowledge of b-catenin proteinfunction is quite incomplete.

In this study, we identify a protein–protein interaction betweenb-catenin and Dnmt1, the primary maintenance DNA methyl-transferase in mammalian cells. Dnmt1 (Dnmt1 refers to theprotein product of the DNMT1 gene) expression is altered inmany different tumors (6–10), although somatic mutations ofDNMT1 are relatively rare events in human cancers. Although bestknown for its role inDNAmethylation, other functions have beendefined for Dnmt1 protein, including the formation of transcrip-tional repressor complexes withHDACandDMAP1proteins (11)and with the LSD1 histone demethylase (12). In addition, manyprotein–protein interactions between Dnmt1 and transcriptionfactors have been identified, principally mediated via the N-terminal regulatory region of the protein (13). DNMT1 itself issubject to multiple layers of regulation, including transcriptional(14) and posttranslational regulation through control of Dnmt1protein stability (13, 15, 16). How these different mechanismscontribute to regulation of Dnmt1 (and DNA methyltransferaseactivities in general) in cancer cells is only partially understood. Inaddition, in many cancer cells aberrant expression of DNAmethyltransferases occurs alongside dysregulated signal transduc-tion pathways, but the extent to which signaling pathways reg-ulate Dnmt1 and associated functions remains to be determined.

1Center for Proteomics and Bioinformatics, Case Western ReserveUniversity, Cleveland, Ohio. 2Department of Genetics and GenomeScience,CaseWesternReserveUniversity,Cleveland,Ohio. 3Centre forBiologicalSciences,UniversityofSouthampton, Southampton,UnitedKingdom. 4Department of Biochemistry, Wan Nan Medical College,Wu Hu, An Hui, China.

Note: Supplementary data for this article are available at Molecular CancerResearch Online (http://mcr.aacrjournals.org/).

Corresponding Authors: Rob M. Ewing, University of Southampton, B85 High-field campus, Southampton SO17 1BJ, UK. Phone: 44-0-23-8059-4401; Fax: 44-0-23-8059-5159; E-mail: [email protected]; and Zhenghe Wang, CaseWestern Reserve University, Cleveland, OH, [email protected]

doi: 10.1158/1541-7786.MCR-13-0644

�2015 American Association for Cancer Research.

MolecularCancerResearch

www.aacrjournals.org 969

on April 26, 2020. © 2015 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from

Published OnlineFirst March 9, 2015; DOI: 10.1158/1541-7786.MCR-13-0644

http://mcr.aacrjournals.org/

Here, we use mass spectrometry, coimmunoprecipitation(co-IP), and confocal microscopy to identify and characterizethe Dnmt1–b-catenin interaction. We show that the interactionis mediated by the central portion of the Dnmt1 protein andthat Dnmt1 and b-catenin protein levels are mutually depen-dent. We show that Dnmt1 protein levels are responsive toexogenous Wnt activation that the response is not mediated viatranscriptional mechanisms. Finally, to investigate the func-tional consequences of the Dnmt1–b-catenin interaction, weshow that the interaction with Dnmt1 protein regulates boththe level of b-catenin and b-catenin/TCF–driven transcriptionalactivity, and that CpG methylation of an imprinted locus issignificantly reduced in cells lacking b-catenin. In summary, ourstudy identifies a novel mechanism by which the levels of thesetwo important oncoproteins are regulated in cancer cells andpoints to a regulatory link between Wnt signaling and epige-netic functions of Dnmt1.

Materials and MethodsCell culture

Colorectal cancer cell lines RKO and HCT116 were main-tained in McCoy-5A media (Life Technologies, 16600-108)containing 10% FBS (Life Technologies, 10438-026) and 1%streptomycin–penicillin (Life Technologies, 15140-148) at37�C in CO2 incubator (5% CO2, 100% H2O). The humanembryonic kidney cell line HEK293T was maintained in DMEMmedia (Life Technologies, 11965-092) containing 10% FBS and1% streptomycin–penicillin under the same conditions. ForWnt activation, media were removed and the cells were washedtwice with serum-free McCoy5A media, and 1 mL serum-freeMcCoy5A media, added in each well of 6-well cell culture platewith purified Wnt3a protein (R&D Systems, Inc. 5036-WNP-010/CF) at the required final concentration of 30 ng/mL (17),and the cells were cultured for an additional 0.5, 1, 2, 3, 6, 12,or 24 hours before harvesting. Cells were harvested by scrapingthe cells off plates and then washed with cold PBS twice forimmediate use or storage (–80�C). Knockout cell lines wereprovided by the respective laboratories in which they weregenerated and cultured under the same conditions as the parentcell lines (18, 19).

Protein extraction and quantificationHarvested cells were lysed in buffer (25 mmol/L Tris-HCl,

pH7.4, 1 mmol/L EDTA, 150mmol/L NaCl, 1% NP-40, 50%glycerol, Protease inhibitor cocktail) by homogenization andincubated on ice for 30 minutes followed by centrifugation at13,000 rpm for 30 minutes. Benzonase nuclease (Sigma E1014)was added to the lysis buffer as required and the supernatant(soluble fraction) kept for further analysis. Proteins were quan-tified by Bio-Rad protein assay dye (Bio-Rad 500-0006) at 595nm.

RNA extraction and RT-PCRTotal RNAwas extracted fromWnt3a stimulatedHEK293T time

course cells using the RNeasy Mini Kit (Qiagen, 74104) and 1 mgRNA was used in one step RT-PCRs using SuperScript One-StepRT-PCR with Platinum Taq (Life Technologies 10928-034)on DNMT1 with forward primer 50-GTGGGGGACTGTGTCTC-TGT-30and reverse primer 50-TGCTGCCTTTGATGTAGTCG-30,

CTNNB1 with forward primer 50-AAGCCTCTCGGTCTGTGG-30

and reverse primer 50-TGATGGTTCAGCCAAACGCT-30, andGAPDH with forward primer 50-CCGTCTAGAAAAACCTGCC-30 and reverse primer 50-GCCAAATTCGTTGTCATACC-30 as load-ing control.One-step RT-PCR conditionswere set according to themanufactory's protocol (Life Technologies 10928-034) withannealing temperature at 55�C. The amplified DNA productswere then electrophoreed on 1.5% agarose gel containing SYBRSafe DNA gel stain (Life Technologies, S33102).

Flow-cytometry analysisHEK293T cells at different time points (0, 0.5, 1, 2, 3, 6, 12, and

24 hours) after stimulation were collected, washed twice with ice-cold PBS buffer (137 mmol/L NaCl, 2.7 mmol/L KCl, 8 mmol/LNa2HPO4, 1.46 mmol/L KH2PO4), resuspended in 50 mL PBSbuffer and fixed with 450 mL 100%Methanol in –20�C for at least20 minutes. The cells were then treated with RNase (Life Tech-nologies, 12091, Carlsbad, CA) in for 30 minutes before stainedwith 100 mg/mL propidium iodide and subsequently subjected toflow-cytometry analyzer (Beckman Coulter Epics XL flow cyt-ometer). A minimum of 10,000 cells within the gated regionwere analyzed and data were captured and presented by Expo32ADC Cytometry List Mode Data Acquisition & Analysis Software.

SDSPAGE and immunoblottingEqual amounts (20 mg) of proteins from different samples

were loaded on precast 4% and 12% Bis-Tris gel (Life Technol-ogies NP-0335). Following electrophoresis, gels were eitherstained with Coomassie Brilliant Blue (Pierce 20278) or trans-ferred to nitrocellulose membrane (Whatman 10402594). West-ern blotting was used to detect the protein with super signalELISA Pico chemiluminescent substrate. Primary antibodiesanti–b-catenin (Cell Signaling Technology 9581), anti–b-cate-nin (active; Cell Signaling Technology 8814), anti-Dnmt1 (CellSignaling Technology 5119), and anti–a-tubulin (Cell SignalingTechnology, Inc.) as loading control were applied at 1:1,000 andsecondary antibodies horseradish peroxidase (HRP)–conjugatedanti-mouse (Promega W4011) and HRP-conjugated anti-rabbit(Cell Signaling Technology 7074) were added at 1:20,000.Chemiluminescence detection using SuperSignal� ELISA PicoChemiluminescent Substrate (Thermo Scientific PI-37070) wasapplied to all westerns. Bands were quantified by ImageJ (http://rsbweb.nih.gov/ij/; refs. 18, 19) and the mean values and SDscomputed for three replicates.

Proteomic analysisStandard in-gel tryptic digestion was performed according to

the publishedmethod (20). The combined elution fractions werelyophilized in a SpeedVac Concentrator (Thermo Electron Cor-poration), resuspended in 100 mL of 0.1% formic acid and furthercleaned up by reverse phase chromatography using C18 column(Harvard). The final volume was reduced to 10 mL by vacuumcentrifugation and addition of 0.1% formic acid. Tryptic peptideswere separated by online reverse phase nanoscale capillary liquidchromatography (nano-LC, Dionex Ultimate 3000 series HPLCsystem) coupled to electoral spray injection (ESI) tandem massspectrometer (MS/MS) with octopole collision cell (Thermo-Finnegan LTQ Orbitrap). Loaded peptides were eluted onnano-LC with 90 minutes gradients ranging from 6% to 73%acetonitrile in 0.5% formic acid with a flow rate of 300 nL/min.

Song et al.

Mol Cancer Res; 13(6) June 2015 Molecular Cancer Research970




Data-dependent acquisition was performed on the LTQ-Orbitrapusing Xcalibur software (version2.0.6; Thermo Fisher Scientific)in the positive ion mode with a resolution of 60,000 at m/zrange of 325.0 to 1,800.0, and using 35% normalized collisionenergy, up to five most intensive multiple charged ions weresequentially isolated, fragmented and further analyzed.

Mass spectrometry data processingRaw LC-MS/MS data were processed using Mascot version

2.2.0 (Matrix Science). The sequence database was searchedwith a fragment ion mass tolerance of 0.8 Da and a parent iontolerance of 15 PPM. The raw data were searched against thehuman International Protein Index database (released in 2009and containing 74,017 protein sequences) with fixed modi-fication carbamidomethyl (C) and variable modification oxi-dation (M). The five fractions for each sample were combinedas a single search in Mascot. Peptides were filtered at a signif-icance threshold of P < 0.05 (Mascot). Scaffold (ProteomeSoftware Inc.; version 3.00.04) was used to analyze LC-MS/MS–based peptide and protein identifications (21). Peptideidentifications were accepted if they could be established atgreater than 95.0% probability as specified by the PeptideProphet algorithm (22). Protein identifications were acceptedif they could be established at greater than 99.0% probabilityand contained at least two identified peptides (22).

ImmunofluorescenceCells were grown to 50% confluence on cover slip slides (12-

545-80, Fisherbrand Cover Glasses) overnight and fixed first with4% formaldehyde in PBS (phosphate Buffered Saline) for 15minutes at room temperature. Fixed cells were blocked withblocking buffer composed of 1� PBS with 5% goat serum (CellSignaling Technology 5425) and 0.3% Triton X-100 for 60 min-utes at room temperature. Cells were then probed with an anti-FLAG (Sigma F1804) sera at dilution of 1:200 and b-catenin(D10A8) XP Rabbit antibody (Cell Signaling Technology8480) at dilution of 1:100 for 2 hours at room temperature,washed with PBS buffer three times of 5 minutes each, thenincubated with secondary Alexa Fluor 594 Goat Anti-Mouse IgG,highly cross-adsorbed antibody (Life Technologies A31624) andAlexa Fluor 488 Goat Anti-Rabbit IgG (HþL), highly cross-adsorbed antibody (Life Technologies A11034) at a dilution of1:1,000 for 30 minutes at room temperature in dark. Nuclei werestained with DAPI (Cell Signaling Technology 8961). Next, theSlides were rinsed with PBS and Prolong Gold Anti-Fade Reagent(Cell Signaling Technology 9071) was applied. Slides were thenanalyzed and imageswere taken on Leica TCS SP2AOBS filter-freeUV/spectral confocal laser scanner on an inverted DM IRE2microscope.

RNAiHCT116 and RKO cells were transfected with targeted siRNAs

against DNMT1 and CTNNB1 using Lipofectamine 2000 trans-fection reagent (Life Technologies, cat no. 11668) and thecells were then incubated at 37oC in CO2 incubator and har-vested 48 hours after transfection. Three gene unique 27mersiRNAs for each target were synthesized by Origene. The threetarget sequences of DNMT1are ACCAAAUUACGUAAAGAA-GAAUUAT (SR301244A), AGCACAGAAGUCAACCCAAAGAU-CT (SR301244B) and UGAGUGGAAAUUAAGACUUUAUGTA

(SR301244C). The three target sequences of CTNNB1 areGGAUCACAAGAUGGAAUUUAUCAAA (SR301063A), CGCA-UGGAAGAAAUAGUUGAAGGTT (SR301063B), and AGAAUU-GAGUAAUGGUGUAGAACAC (SR301063C). Control siRNA(SR30004) is designed and provided by Origene.

LEF/TCF reporter assaysTargeted cells (HCT116, RKO, DNMT1KO-HCT116, and

CTNNB1KO-HCT116) were seeded onto multiwall plates oneday before transfection and grown to 70% and 90% confluence.Vectors of LEF/TCF reporter, negative control, and positivecontrol were then individually premixed with transfectionreagent Lipofectamine2000 (Life Technologies 11668) andOpti-MEM serum-free culture medium and incubated at roomtemperature for 20 minutes. For cotransfection with siRNA,three target sequences of either DNMT1 or CTNNB1 (seeprevious description in RNAi) were added into the premix andincubated at room temperature for 20 minutes before use.Luciferase assay was performed using Dual-Luciferase reporterassay system (Promega 1910) 48 hours after transfection. Thecells were lysed in plate using passive lysis buffer (Promega1941) for 15 minutes at room temperature with gentle shaking.Cell lysates were then transferred into a 96-well plate anddevelopment substrates were added according to the instruc-tions (Promega 1910, Madison, WI). Firefly luciferase andRenilla luciferase activity were measure by microplate readerpremium Quad4 Monochromators (Tecan Group Inc. InfiniteM1000 pro). The promoter activity values were expressed asarbitrary units using a Renilla reporter for internal normaliza-tion according to the manufactory's protocol (Promega 1910).For experiments using TOPFlash/FOPFlash plasmids used wereM50 and M51 Super 8x TopFLASH (Addgene; ref. 23). Experi-ments were done in triplicates for all biologic cell cultures/transfections and luminescent measurements. Mean (barheight) of relative luciferase units for each sample plus SD(error bar) were then calculated and plotted.

Quantification of protein half-lifeHCT116, DNMT1KO-HCT116, and CTNNB1KO-HCT116 were

grown in separate 6-well plates to log phase. Cycloheximide (CellSignaling Technology 2112) was added to a final concentrationof 50 mg/mL to terminate protein synthesis. After cycloheximidetreatment, equal numbers of cells were collected at 0, 3, and 6hours, and cell lysates were prepared as described. The lysateswere analyzed by SDSPAGE and Western blotting. Bands corre-sponding to each protein were detected by using chemilumines-cence and the intensity of bands was quantified using ImageJ.Half-life (T1/2) was calculated as previously described (24).

Methylation analysis of H19 CpG islandsGenomic DNA was extracted with the QIAamp DNA Mini Kit

(Qiagen 51804). Bisulfite treatment of the genomic DNA sampleswas carried out with the Qiagen EpiTect Kit (Qiagen 59104)according to the manufacturer's instructions, followed by PCRamplification with specific primers for H19 promoter region(forward: 50-GGTCCCA/ideoxyU/ATGTAAGATTTTGGTGGAA-TAT-30; reverse: 50-GGCATAG/ideoxyU/ACAAACTCACACATCA-CAACC-30). The PCR products were gel-purified, inserted intoUSER cloning vector zw102 (courtesy of Wang laboratory), andsequenced with T3 universal primer.

Functional Protein Interaction between Dnmt1 and b-Catenin

www.aacrjournals.org Mol Cancer Res; 13(6) June 2015 971




Figure 1.Dnmt1 protein interacts with b-catenin in colorectal cancer cells. A, DNMT1 (FLAG) immunoprecipitates b-catenin in HCT116 cells. Total protein lysate from HCT116with Benzonase untreated (–) or treated (þ) was used in the immunoprecipitation and elution fractions were loaded on gel and blotted. B, b-cateninimmunoprecipitates DNMT1 in HCT116 cells. C, b-catenin is induced by Wnt3a stimulation in both RKO and DNMT1KI-RKO cells. D, Dnmt1 (anti-FLAG)immunoprecipitates b-catenin in DNMT1KI-RKO cells. E, subcellular fractionation and protein expression levels inDNMT1KI-HCT116 cells. F, Dnmt1 (anti-FLAG)immunoprecipitates b-catenin in nuclear fraction of DNMT1KI-HCT116 cells. Twenty micrograms of proteins from each fraction was loaded on SDSPAGE followedby Western blot analyses with anti-Dnmt1, anti-FLAG, anti–b-catenin, anti-HAUSP, anti–a-tubulin, and anti-GAPDH. (Continued on the following page.)

Song et al.





ResultsA Dnmt1–b-catenin protein–protein interaction

We previously performed a large-scale proteomics study tomap the Wnt-responsive proteome (17). Proteins were identi-fied whose expression levels responded to exogenous Wnt3Astimulation and we observed that Dnmt1 protein levels exhib-ited a robust response to Wnt activation in HEK293T cells and inthe colorectal cancer cell-lines, RKO, and HCT116. In this study,we used a novel affinity purification mass spectrometry (AP-MS)technique previously applied by us to identify Dnmt1 protein–protein interactions (15, 25). We introduced a 3xFLAG tag intothe DNMT1 locus in HCT116 cells (DNMT1KI-HCT116), expres-sing a stabilized mutant b-catenin (i.e., with constitutive acti-vation of Wnt signaling). The DNMT1KI-HCT116 cells were thenused in AP-MS experiments as previously described (25). Wefiltered the dataset to remove contaminants and nonspecificbinding proteins (26, 27, and then analyzed the identifiedpeptides and proteins (Supplementary Table S1). Peptides cor-responding to b-catenin (2 distinct peptides) were identifiedsuggesting that Dnmt1 protein and b-catenin interact inHCT116 cells.

To validate the association between b-catenin and Dnmt1proteins, co-IP experiments were performed. First, anti-FLAGimmunoprecipitates fromDNMT1KI-HCT116 cells were analyzedas shown in Fig. 1A. To assess whether the b-catenin–Dnmt1interaction is chromatin-dependent, we performed the co-IPexperiments with and without the Benzonase nuclease (Supple-mentary Fig. S2). No differences were observed in the Dnmt1signal indicating a soluble b-catenin–Dnmt1 protein complex.Western blots were also analyzed with anti-HAUSP/USP7 anti-bodies as a positive control, because USP7 has been shownpreviously to be associated with Dnmt1 protein complexes(15, 28). A co-IP experiment using native anti-Dnmt1 antibodies(instead of anti-FLAG) in parent HCT116 cells was also per-formed, showing the same result (Supplementary Fig. S3) as theanti-FLAG experiments. We next performed the reciprocal co-IPexperiment from DNMT1KI-HCT116 cells using native anti–b-catenin antibodies and observed Dnmt1 proteins in thesesamples (Fig. 1B), confirming the association of b-catenin andDnmt1.

We previously performed AP-MS experiments on RKO cellswith FLAG-tagged DNMT1 (DNMT1KI-RKO; refs. 15, 25), but didnot identify b-catenin peptides in these experiments. We rea-soned, however, that because endogenous b-catenin levels aresignificantly lower in RKO cells than in HCT116 cells, exogenousactivation of Wnt signaling in RKO cells might allow detection ofthe b-catenin–Dnmt1 interaction in RKO cells. We thereforetreated DNMT1KI-RKO cells with Wnt3a before Western andco-IP analysis as shown in Fig. 1C and D. Wnt3a treatment ofDNMT1KI-RKO cells increases b-catenin levels and b-catenin isdetected in anti-FLAG immunoprecipitates from DNMT1KI-RKOcells. We also analyzed nuclear and cytosolic subcellular fractions

from DNMT1KI-HCT116 cells. Dnmt1 protein is strongly local-ized to the nucleus of DNMT1KI-HCT116 cells (Fig. 1E) and anti-FLAG IP from nuclear fractions identifies b-catenin (Fig. 1F).

To map which regions of Dnmt1 protein are necessary for theinteraction with b-catenin, Myc-tagged deletion constructs ofDnmt1 protein were constructed as shown in Fig. 1G. These wereexpressed in HEK293 cells and immunoprecipitated for Westernanalysis with anti–b-catenin antibodies. As shown in Fig. 1G,b-catenin is only detected in association with full-length Dnmt1protein or with the central region of the protein encompassing thezinc finger and two BAH (Bromo-adjacent homology) domains.Thus, neither the N-terminal region nor the C-terminal DNAmethylase catalytic domains are necessary for the interaction ofDnmt1 protein with b-catenin.

(Continued.) (M, standard protein marker; r, biologic replicate; Nuc, nuclear fractions; Cyto, cytoplasmic fractions; IP, immunoprecipitation; IB,immunoblotting; Input indicates equal loading for IP experiments). G, the central portion of Dnmt1 interacts with b-catenin. HEK293 cells were transfected withplasmids expressing full-length Myc-tagged Dnmt1 (F), three Myc-tagged Dnmt1 deletion constructs (A–C) as shown in the diagram of Dnmt1 proteinas well as empty plasmid vector (Vec.). Cell lysates were immunoprecipitated with anti-Myc antibodies and cell lysate from nontransfected HEK293cells (Con.) were used as immunoprecipitation control. Elution fractions were then loaded on SDSPAGE followed by Western blot analyses withanti–b-catenin antibodies. M refers to standard protein marker.

Figure 2.Nuclear colocalization of Dnmt1 and b-catenin proteins. A, Dnmt1 proteincolocalizeswith b-catenin protein in HCT116 cells. B, Dnmt1 protein colocalizeswith b-catenin protein in Wnt3a stimulated HCT116 cells. Images shownwerecaptured by confocal microscopy. Dnmt1 is shown in red (anti–mouse-AlexaFluor594 secondary antibody); b-catenin is shown in green (anti–rabbit-AlexaFluor488 secondary antibody) and colocalization of Dnmt1 andb-catenin yellow (overlay images iv show all three colors). DAPI was used forcell nuclear staining (Blue); scale bar, 10 mm.






Figure 3.The Dnmt1–b-catenin association is mutually stabilizing. A, knockout of CTNNB1 leads to reduced abundance of endogenous Dnmt1. Twenty micrograms of totalprotein lysate from CTNNB1KO-HCT116 or HCT116 cells was loaded on SDSPAGE followed by Western blot analyses with anti-Dnmt1, anti–b-catenin, anti–g-catenin,anti-HAUSP, and anti-GAPDH. One step RT-PCR was performed on the total RNA extracted from both HCT116 and CTNNB1KO-HCT116 cells with specific primerpairs for Dnmt1 and GAPDH (as loading control). B, knockout of DNMT1 leads to reduced abundance of endogenous b-catenin. Twenty micrograms of total proteinlysate from DNMT1KO-HCT116or HCT116 cells was loaded on SDSPAGE followed by Western blot analyses with anti-Dnmt1, anti–b-catenin, and anti-GAPDH. One stepRT-PCRwas performed on the total RNA extracted from both HCT116 and DNMT1KO-HCT116 cells with specific primer pairs for CTNNB1 and GAPDH (as loading control).M refers to standard protein marker. C, Dnmt1 protein expression is rescued in CTNNB1KO-HCT116 cells by addition of b-catenin. b-Catenin protein expressionlevel was restored by making transient transfection in CTNNB1KO-HCT116 cells with plasmid vector containing full-length b-catenin. (Continued on the following page.)

Song et al.





We next studied the subcellular localization of b-catenin–Dnmt1 association using confocal microscopy and immuno-fluorescence to visualize the proteins in vivo (Fig. 2).DNMT1KI-HCT116 cells were either untreated (Fig. 2A) ortreated withWnt3a (Fig. 2B), and analyzed using anti–b-cateninand anti-FLAG antibodies. As is clearly shown,b-catenin signal isdetected in both the cytosolic and nuclear compartments,whereas Dnmt1 signal is confined to the nucleus. The mergedb-catenin and Dnmt1 signal shows strong colocalization of thetwo proteins in the nucleus, and this is most evident in cellstreated with Wnt3a (Fig. 2B, panel iv).

In summary, mass spectrometry, co-IP, and immunofluores-cence results indicate that b-catenin and Dnmt1 proteins are co-complexed in the nucleus, that this interaction increases inresponse to Wnt3a, and that the interaction occurs in multipledifferent cell lines.

Levels of Dnmt1 and b-catenin proteins are mutuallydependent

We next determined how the association between Dnmt1protein and b-catenin affects the levels of these two proteins.Two previously generated knockout cell lines, DNMT1�/�

(DNMT1KO-HCT116; ref. 29), CTNNB1�/� (CTNNB1KO-HCT116; ref. 30), and were compared with parent HCT116cells. Fig. 3A shows Western and RT-PCR analysis of parentHCT116 and CTNNB1KO-HCT116 cells. The levels of Dnmt1protein are substantially reduced in the CTNNB1KO-HCT116cells as compared with HCT116 parent cells. Notably, however,RT-PCR analysis reveals no difference between DNMT1 tran-script levels in CTNNB1KO-HCT116 and HCT116 cell lines,indicating that the lack of b-catenin does not affect DNMT1transcript levels. We also immunoblotted these samplesusing anti–g-catenin (plakoglobin) antibodies, and showedthat the levels of plakoglobin are elevated in CTNNB1�/� cells,consistent with the previously described observations thatplakoglobin can independently promote Wnt/TCF signalingin b-catenin–deficient cells (31). Figure 3B shows similar anal-ysis in DNMT1�/� (DNMT1KO-HCT116) cells. b-catenin levelsare substantially reduced in DNMT1KO-HCT116 as comparedwith HCT116 cells, although no difference in CTNNB1 tran-script levels is apparent. We re-introduced b-catenin intoCTNNB1KO-HCT116 by transient transfection of a full-lengthb-catenin expression construct (Fig. 3C). As shown clearly inthe Western analysis of these cells, re-expression of b-cateninrescues Dnmt1 protein expression in the CTNNB1�/�cells,indicating the dependence of Dnmt1 protein levels on b-cate-nin, although in the reciprocal experiment (Fig. 3D) in whichDnmt1 was expressed in DNMT1KO-HCT116 cells, significantrestoration of b-catenin protein levels was not observed.

To investigate how Dnmt1 and b-catenin affect one another'sstability, we measured protein half lives in the presence or

absence of each protein. CTNNB1KO-HCT116 and DNMT1KO-HCT116 cells were treated with cycloheximide to block transla-tion and then the protein degradation profiles observed. Asshown in Fig. 3E, we found that Dnmt1 has a significantly shorterhalf-life than b-catenin, and that in CTNNB1KO-HCT116 cells thehalf-life is reduced by approximately 30%. b-Catenin has a longerhalf-life that is reduced in the absence of Dnmt1. InDNMT1KO-HCT116 cells, b-catenin half-life is reduced by approx-imately 40% as compared with parent HCT116 cells.DNMT1KO-HCT116 and CTNNB1KO-HCT116 cells were alsotreated withMG-132 proteasome inhibitor and levels of b-cateninand Dnmt1 analyzed by Western blot analysis (SupplementaryFig. S6). In DNMT1KO-HCT116 cells, levels of b-catenin aremarkedly increased by the addition of MG-132 whereas inCTNNB1KO-HCT116 cells, levels of Dnmt1 increase in responseto MG-132, suggesting that the destabilization of Dnmt1 andb-catenin is mediated via the proteasome and can be inhibitedthrough inhibition of proteasomal activity.

To further study the interdependence of b-catenin and Dnmt1protein levels, we performed siRNA-mediated knockdown ofDNMT1 or CTNNB1 in HCT116 and RKO cells. Knockdown ofCTNNB1 in HCT116 (Fig. 4A) and in RKO cells (Fig. 4B) showsdecreased levels of Dnmt1 protein in both cell lines. The effect ismore marked in RKO cells than in HCT116 cells, and we notedthat in HCT116 cells, siRNA-mediated CTNNB1 knockdownonly partially reduced the levels of CTNNB1 (Fig. 4A), possiblydue to the substantially higher levels of endogenous b-catenin inHCT116 cells. Similarly, knockdown of DNMT1 in HCT116(Fig. 4C) and RKO (Fig. 4D) reduced levels of b-catenin pro-teins. The effect is also more marked in RKO cells, where thesiRNA-mediated knockdown of DNMT1 dramatically reducedlevels of Dnmt1 and b-catenin.

Regulatory mechanisms of the Dnmt1–b-catenin protein–protein interaction

We next tested two HCT116 derivative cell lines in whicheither the wild-type CTNNB1 allele (CTNNB1�/D45-HCT116)or mutant CTNNB1 allele (CTNNB1WT/�-HCT116) was dis-rupted (30). Using two different clones for each cell-line,we analyzed expression of b-catenin and Dnmt1. As shownin Fig. 5A, the levels of Dnmt1 protein are decreased inCTNNB1WT/�-HCT116 cells, in line with the decreased levelsof b-catenin in CTNNB1WT/�-HCT116 as compared withCTNNB1�/D45-HCT116 cells. Nuclear and cytosolic subcellularfractionations show a substantial reduction of Dnmt1 proteinin the nucleus of the cells expressing only wild-type b-catenin(Fig. 5B). We next stimulated each of these cell lines withexogenous Wnt3A (Fig. 5C and D). The levels of b-cateninshow a more robust response in the wild-type b-catenin cells ascompared with the mutant b-catenin cells, and this response is

(Continued.) Total protein lysate (20 mg) from HCT116, CTNNB1KO-HCT116, or CTNNB1KO-HCT116 with ectopic expressed b-catenin cells was loaded on SDSPAGEfollowed by Western blot analyses with anti-Dnmt1, anti–b-catenin, anti–b-catenin (active), and anti-GAPDH (loading control). M refers to standard protein marker.D, b-catenin expression is not rescued in DNMT1KO-HCT116 cells by addition of Dnmt1 protein.Transient transfection of DNMT1KO-HCT116 cells with plasmid vectorcontaining full-length Dnmt1 does not restore b-catenin expression. Total protein lysate (20 mg) from HCT116, DNMT1KO-HCT116, or DNMT1KO-HCT116 withectopically expressed Dnmt1 was loaded on SDSPAGE followed byWestern blot analyses with anti-Dnmt1, anti–b-catenin, and anti-GAPDH (loading control). M refersto standard protein marker. E, degradation profiles for b-catenin and Dnmt1 in HCT116, DNMT1KO-HCT116, or CTNNB1KO-HCT116 cells following cycloheximide treatment.Degradation rate constants were quantified bymeasuring the relative intensity of each protein by quantitativeWestern blotting at 0, 3, and 6 hours after cycloheximidetreatment. The intensity data were fit to a first-order decay function to estimate the degradation rate constant, which then was used to calculate the half-life.






reflected in the levels of Dnmt1 protein, which show a moremarked increase in response to Wnt3A in the wild-type b-cate-nin cells than in the mutant b-catenin cells. We also testedwhether the Dnmt1 response was responsive to exogenousWnt stimulation in CTNNB1KO-HCT116 cells. HCT116 andCTNNB1KO-HCT116 cells were treated with Wnt3a and West-ern analysis performed (Supplementary Fig. S4). As expected,Wnt3a only stabilizes Dnmt1 in the HCT116 cells, showingthat the stabilization of Dnmt1 in response to Wnt3A requiresb-catenin. Indeed, in these experiments, we observed a slightdecrease of Dnmt1 abundance in CTNNB1KO-HCT116 cellstreated with Wnt3A when compared with CTNNB1KO-HCT116cells not treated with Wnt3A, suggesting that a b-catenin–independent Wnt-mediated mechanism may also regulateDnmt1 expression.

Because Dnmt1 protein plays a central role in DNA methyla-tion during cell division and DNA replication (32, 33), we alsotested whether Wnt-driven modulation of Dnmt1 protein levelsmight be attributed to cell-cycle regulation following Wnt3astimulation. Flow cytometry was performed on cells harvestedacross the 24 hours time course following Wnt3a treatment. Nogross alterations of relative numbers of cells at each time pointwere apparent (Supplementary Fig. S1), and we therefore con-cluded that the response of Dnmt1 protein levels to Wnt3atreatment is not cell-cycle related.

To investigate mechanisms by which b-catenin regulates Dnmt1protein levels, we analyzed the expression of several Dnmt1 inter-acting proteins, including proteins that regulate Dnmt1 stability

through methylation (SET7, LSD1; refs. 16, 34). Immunoblots ofthese proteins were performed on lysates from HCT116 andCTNNB1KO-HCT116 cells as shown in Fig. 6A and B. We wereparticularly interested by the reduction in levels of LSD1 protein inCTNNB1KO-HCT116 cells. LSD1 (KDM1A) encodes a lysine-spe-cific demethylase, which has been shown to stabilize Dnmt1through demethylation (35). As a negative control, we also immu-noblotted a related lysine-specific demethylase, KDM3B, andfound no difference in the levels of KDM3B protein betweenHCT116 and CTNNB1KO-HCT116 cells (Fig. 6A). It may be thatthe reduction in LSD1 protein levels is attributable to destabiliza-tionofDnmt1–LSD1proteincomplexesby the reductionofDnmt1in and CTNNB1KO-HCT116 cells. We next tested whether LSD1protein was present in anti–b-catenin immunoprecipitates. Co-IPusing anti–b-catenin showed that both Dnmt1 and LSD1 proteinswere present (Fig. 6B), indicating that LSD1 is present in Dnmt1–b-catenin protein complexes, and indicating that LSD1 may func-tion in the b-catenin–dependent regulation of Dnmt1.

Functional consequences of the Dnmt1–b-catenin protein–protein interaction

Our results predict that Wnt/b-catenin signaling should bealtered according to Dnmt1-dependent regulation of b-cateninprotein levels. We first compared TCF-reporter (TOPFlash) activ-ity in cells transfected with DNMT1 expression vector in HCT116and CTNNB1�/D45-HCT116 (Fig. 7A). Next, we compared b-cate-nin/TCF signaling in DNMT1KO-HCT116 and HCT116 cells trea-ted with siRNA to reduce Dnmt1 levels as shown in Fig. 7B.

Figure 4.siRNA analysis of the Dnmt1–b-cateninassociation. Knockdown of CTNNB1leads to reduced abundance ofendogenous Dnmt1 in HCT116 (A) andRKO (B) cells. HCT116 or RKO cellswere transfected with control siRNAor three independent siRNAs againstCTNNB1. Immunoblots were used toquantify Dnmt1, b-catenin, g-catenin,and HAUSP with anti-Dnmt1, anti–b-catenin, anti–g-catenin, anti-HAUSPsera. GAPDH was used as loadingcontrol. Knockdown of Dnmt1 leads toreduced abundance of endogenousCTNNB1 in HCT116 (C) and RKO (D)cells. HCT116 or RKO cells weretransfected with control siRNA orthree independent siRNAs againstDnmt1. Immunoblots were used toquantify Dnmt1and b-catenin withantibodies against Dnmt1 andb-catenin, respectively. GAPDH wasused as loading control. M refers tostandard protein marker.

Song et al.





Overexpression of DNMT1 increases TCF reporter activityapproximately 2-fold and targeting of DNMT1 via siRNA orknockout reduces b-catenin signaling (�2- and �4-fold, respec-tively; all P < 0.05 Student t test). In RKO cells andCTNNB1�/WT-HCT116 cells, overall levels of TCF reporter activityare much lower (�10-fold), as expected (lower b-catenin levels)and statistically significant changes in TCF reporter were notdetected in either overexpression or RNAi experiments (supple-mentary Information). Although we cannot rule out that knock-down or knock-out of DNMT1 affects TCF signaling through ab-catenin–independent mechanism, these results suggest that

Dnmt1 protein regulates Wnt/TCF signaling by stabilizing b-cate-nin in the nucleus.

Finally, because DNMT1 is the primary mammalian mainte-nance DNA methyltransferase, we sought to determine whetherdestabilization of Dnmt1 in the absence of b-catenin also altersCpG methylation patterns. The H19 imprinted locus encodes anon–protein-coding RNA and functions as a tumor suppressor(35). We also previously found that the H19 imprinted locuswas a sensitive marker for DNMT1 methylation activity inHCT116 cells (15). We therefore compared the CpGmethylationstatus of approximately 20 clones each of HCT116 and

Figure 5.Immunoblot analysis of Dnmt1 expression in cells expressing mutant or wild-type b-catenin. A, immunoblot analysis of cells expressing wild-type b-catenin(CTNNB1WT/�-HCT116) and mutant b-catenin (CTNNB1�/D45-HCT116). Total soluble proteins were extracted and compared in two separate clones foreach cell-line, 20 mg of total protein was loaded on SDSPAGE and Western blots were performed using a–b-catenin, a-Dnmt1, and a–a-tubulin (loadingcontrol). B, immunoblot analysis of subcellular fractions of cells expressing wild-type b-catenin (CTNNB1WT/�-HCT116) and mutant b-catenin (CTNNB1�/D45-HCT116; two clones for each cell type). For each fraction, a total protein of 20 mg was loaded on SDSPAGE and Western blots were performed usinga–b-catenin and a-Dnmt1. C, Wnt3A time course stimulation of CTNNB1WT/�-HCT116 (clone D075) and CTNNB1�/D45-HCT116 cells (clone K058). Cells werecollected at 0, 1, 3, 6, and 24 hours post Wnt3A (30 ng/mL) stimulation on each cell line followed by total protein extraction. Total protein of 20 mgwas loaded on SDSPAGE and Western blots were performed using a–b-catenin and a-Dnmt1.






CTNNB1KO-HCT116 cells. As shown in Fig. 7C, there is signifi-cantly reduced methylation in the CTNNB1KO-HCT116 cells atseveral CpG loci, indicating that the lower levels of Dnmt1 pro-tein in CTNNB1KO-HCT116 cells has a knockon effect on DNAmethylation activity. In concordance with this finding, we alsoobserved increased levels ofH19mRNA transcripts in CTNNB1KO

-HCT116 as compared with HCT116 cells (SupplementaryFig. S7).

DiscussionHere, we analyze an interaction between Dnmt1 and b-catenin

proteins that mutually regulates the levels of each protein incolorectal cancer cells. The regulation is not mediated via tran-

scriptional activation of DNMT1, but instead through the inter-action of Dnmt1 protein with b-catenin in the nucleus. Given thecritical roles of both b-catenin and Dnmt1 cells in normal as wellas cancer cells, our results point to an important mechanism bywhich the two proteins cross-regulate. We found that the lysinedemethylase, LSD1, which regulates Dnmt1 stability, is present inDnmt1–b-catenin protein complexes, suggesting that the stabili-zation ofDnmt1 in these protein complexes ismediated via lysinemethylation. We investigated the downstream functional conse-quences of the b-catenin–Dnmt1 association, and showed thatDnmt1 protein levels regulate b-catenin/TCF signaling and thatthe absence of b-catenin impacts CpG methylation status, point-ing to a regulatory link between Wnt/b-catenin signaling and thedownstream functions of Dnmt1.

Although protein stability of Dnmt1 and b-catenin is animportant outcome of the interaction between the proteins, theprecise molecular mechanisms that result in increased b-catenin/TCF signaling activity remain to be determined. Although b-cate-nin expression rescues Dnmt1 expression in CTNNB1KO-HCT116cells, we did not observe rescue of b-catenin protein levels inDNMT1KO-HCT116 cells following expression of Dnmt1 (Fig. 3).Thismay imply that the increased b-catenin/TCF signaling activityinduced by Dnmt1 is not due to stabilization and increased levelsof b-catenin, but froman alternativemechanismbywhichDnmt1increases b-catenin transcriptional activity. Other studies haveshown that Dnmt1 can regulate transcription through proteininteractions, in a methylation-independent manner. The Dnmt1N-terminus was shown tomediate the interaction of Dnmt1 withHDAC and DMAP1 proteins, to form transcriptional repressorcomplexes (11), and many interactions between Dnmt1 andtranscription factors have been identified (13). E-cadherin expres-sion (in HCT116 cells) is regulated by an interaction betweenDnmt1 and the transcriptional repressor Snail1, and in the samestudy that loss of the Dnmt1 N-terminal domains promotedb-catenin translocation to the nucleus (36). Stabilization ofDnmt1 protein, but not alterations of DNMT1 transcript levelsare the cause of DNMT1 dysregulation in human mammaryepithelial cells, and this stabilization is mediated via the Dnmt1protein N-terminus (37). How LSD1 functions in the Dnmt1–b-catenin interaction remains to be determined, because LSD1 isknown to regulate Dnmt1 stability via demethylation (34). Othermodifying proteinsmay also be important; interactions ofDnmt1protein with HAUSP/USP7, UHRF1 and Tip60 proteins regulateDnmt1 by ubiquitination and acetylation (15, 38). Tip60 inter-acts with both Dnmt1 and b-catenin (39), and further massspectrometry analysis will determine whether Tip60 is present inb-catenin–Dnmt1 protein complexes. Although we previouslyshowed that Tip60 acetylates Dnmt1 protein, which promotesDnmt1 degradation (15), the significance of the b-catenin–Tip60interaction is as yet undetermined.

Our study points to a mechanism of cross-talk between Wntsignaling and DNA methylation mediated via a protein–proteininteraction between b-catenin and Dnmt1. How this cross-talkmanifests itself in tumors is as yet unknown, although in mouse,hypomorphic Dnmt1 alleles in the ApcMin background substan-tially reduce the number of polyps observed (40). Although thesuppression of polyp formation was attributed to decreased CpGisland methylation in the Dnmt1 hypomorphic mice, reducedDnmt1 protein levels may also suppress polyp formation bydestabilizing b-catenin and reducing Wnt/b-catenin–driven tran-scriptional activity via the mechanism that we have described.

Figure 6Analysis of known Dnmt1 interacting and regulatory proteins. A, anti–b-catenin immunoprecipitates both Dnmt1 and LSD1 proteins in HCT116cells. Total protein lysate from HCT116 or immunoprecipitates was blottedwith b-catenin, Dnmt1, and LSD1 antibodies. B, immunoblot analysis ofHCT116 and CTNNB1 knockout (CTNNB1KO-HCT116) cells (two replicateseach) of Dnmt1 interacting and regulatory proteins. Total soluble proteinswere extracted and compared in two separate clones for each cell-line(Clones are indicated as 1 and 2), 20 mg of total protein was loaded onSDSPAGE and Western blots were performed using anti-SET7, anti-LSD1(lysine demethylase regulating Dnmt1 stability) antibody, and relatedlysine demethylase anti-KDM3B.

Song et al.





Transcriptional regulation of DNMT1 by Wnt has also beenshown (41). Using colorectal HT-29 cells (expressing truncatedAPC) the authors showed that transfection of full-length APCreduces DNMT1 mRNA and DNMT1 promoter–reporter activity.In addition, the authors also inhibited TCF-driven transcriptionusing a dominant-negative TCF and found that this also reducesDNMT1 mRNA levels, indicating transcriptional control ofDNMT1 expression. In our study, we do not observe transcrip-tional effects of Wnt/b-catenin on DNMT1 (as measured bysteady-state RNA levels), but instead observed dramatic effectsof Wnt and b-catenin on Dnmt1 protein levels. These differencesmay imply that activation of Wnt/b-catenin by APC mutations isnot entirely functionally equivalent to activation by stabilizingCTNNB1/b-catenin mutations. We also note, as did the authorsof the previous study, that there are no apparent TCF-bindingsites in the DNMT1 promoter, and so the transcriptional activa-tion of DNMT1 is unlikely to be mediated via direct binding ofb-catenin/TCF in theDNMT1promoter. Taken together, our studyand these previous studies show that multilayered communica-tion exists between DNMT1 and Wnt/b-catenin signaling.Although these and previous studies have been performed in

cancer cell models, future work should establish the possibleimportance of cross-talk between DNMT1 and Wnt/b-cateninsignaling in clinical samples. In addition, although our study hasidentified that an interaction between Wnt/b-catenin and Dnmt1may alter DNA methylation patterns on a specific locus, it wouldbe interesting to measure global patterns of DNA methylationto see how widespread this effect is.

Interestingly, several studies have demonstrated methylation-independent functions for Dnmt1. In HCT116 cells, Dnmt1proteins lacking the C-terminal catalytic domain function astranscriptional repressors at specific loci (12). The authors spec-ulated that Dnmt1 serves as a scaffold for recruitment of tran-scriptional repressive complexes, including interaction with theLSD1 histone demethylase. Intriguingly, knockdown of Dnmt1protein was shown to regulate gene expression via a methylation-independent and histone deacetylation–independent mecha-nism (42). Our analysis showed that knockdown of Dnmt1protein can regulate TCF/b-catenin transcriptional activity. Futurestudies will establish whether Dnmt1 protein levels also regulateendogenous Wnt/b-catenin targets. The role played by chromatinshould also be considered. The interplay between soluble nuclear

0

20

40

60

80

100

120

No

rmal

ized

luci

fera

se u

nit

s HCT116

*

*

*

*

FOPFlash +FOPFlashDNMT1

TOPFLash +TOPFlashDNMT1

0

20

40

60

80

100

120

140

No

rmal

ized

luci

fera

se u

nit

s

No

rmal

ized

luci

fera

se u

nit

sDNMT1KO-HCT116

FOPFlash +FOPFlashDNMT1


0

20

40

60

80

100

120 CTNNB1–/Δ45-HCT116

*

*

Negativecontrol


020406080

100120140

No

rmal

ized

luci

fera

se u

nit

s

RNAi and knockout**

***

*

Clone No.1

5

10

15

2112 18 10 10 9 10 10 11 111298 8 9 87

% mC

48.2%WT(HCT116)

KO(CTNNB1KO)

35.3%

1

5

10

15

191 16 2 1 1 1 0 10 101010 101179 9

Methylated C sites

C

A

B

*P = 0.012

*P = 0.029

*P = 0.0023

*P = 0.0077**P = 0.021

Figure 7.Functional consequences of the Dnmt1–b-catenin interaction. A, TCF (luciferase) reporter activity in HCT116 and CTNNB1�/D45-HCT116 (mutant b-catenin)cells (B) TCF (luciferase) reporter activity in HCT116 and RKO cells (treated with DNMT1 siRNAs) as well as DNMT1KO-HCT116 and CTNNB1KO-HCT116 cells.All cells were transfected with LEF/TCF reporter. Negative and positive controls were also used for signal normalization and transfection efficiencymonitoring. Dual Luciferase assay was performed 48 hours after transfection and promoter activity values were expressed as arbitrary units using a Renillareporter for internal normalization. Experiments were done in triplicates for biologic cell cultures/transfections and luminescent measurements.Average numbers (bar height) of relative luciferase units for each sample plus standard deviation (error bar) were plotted relative to maximum. C,methylated CpG sites are decreased in CTNNB1 KO cells at the H19 locus, especially on the first six (1, 3, 4, 5, 6, and 7) of seven CpG sites. Genomic DNAsfrom wild-type HCT116 (WT) and CTNNB1 knockout HCT116 (KO) clones were bisulfite treated. The CpG island of H19 locus was PCR amplified, cloned,and sequenced with the Sanger sequencing method. Twenty one and 19 clones were sequenced for WT and KO, respectively (methylated CpG sites are blackspots, nonmethylated CpG sites are white spots and DNA sequences are represented as black lines).






Dnmt1 proteins and chromatin-associated Dnmt1 is complex.For example, Dnmt1 protein forms soluble complexes withUSP7 that then form trimeric complexes with chromatin-boundUHRF1 (28). In addition, in contrast with DNMT3A/B, a sub-stantial portion of Dnmt1 protein appears to exist as a solublepool in the nucleus rather than being associated with chromatin(43, 44). Finally, although the primary nuclear function ofb-catenin is to regulate transcription via association with TCFtranscription factors, our study shows that regulation of otherproteins via stabilizing protein–protein interactions may also bean important function of nuclear b-catenin.

In summary, our work identifies a novel mechanism by whichthe levels of two key oncoproteins, b-catenin and Dnmt1 areregulated in cancer cells. The b-catenin–Dnmt1 interaction sta-bilizes each protein, and in turn regulates downstream b-cateninand Dnmt1 functions. Our study indicates a possible cancer-relevant mechanism of cross-regulation between Wnt signalingandDNAmethylation. Given that theWnt pathway plays a criticalrole in development and tissue differentiation, the mechanismrevealed in this study could also explain howWnt signaling drivestissue differentiation.

Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.

Authors' ContributionsConception and design: J. Song, Z. Wang, R.M. EwingDevelopment of methodology: J. Song, Z. Du, R.M. EwingAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): J. Song, Z. Du, M. Ravasz, B. Dong, Z. WangAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): J. Song, M. Ravasz, Z. Wang, R.M. EwingWriting, review, and/or revision of themanuscript: J. Song, Z. Wang, R.M. EwingAdministrative, technical, or material support (i.e., reporting or organizingdata, constructing databases): J. Song, M. Ravasz, R.M. EwingStudy supervision: J. Song, R.M. Ewing

Grant SupportR.M. Ewing and Z. Wang acknowledge NCI award 1R21CA16006 that

supported in part the work described here. R.M. Ewing was supported by anEUMarie Curie FP7-PEOPLE-2012-CIG award. Z. Wang was supported by NCIaward P50CA150964. J. Song was supported by the Cancer PharmacologyTraining Program (R25CA148052) at Case Western Reserve University. J. Songacknowledges support via NIH S10RR017980 for use of the Imaging Facility,Department of Genetics and Genome Sciences.

The costs of publication of this article were defrayed in part by thepayment of page charges. This article must therefore be hereby markedadvertisement in accordance with 18 U.S.C. Section 1734 solely to indicatethis fact.

Received December 12, 2013; revised January 14, 2015; accepted January 26,2015; published OnlineFirst March 9, 2015.

References1. Hanahan D, Weinberg RA. Hallmarks of cancer: the next generation. Cell

2011;144:646–74.2. Morin PJ, Sparks AB, Korinek V, Barker N, Clevers H, Vogelstein B, et al.

Activation of beta-catenin-Tcf signaling in colon cancer by mutations inbeta-catenin or APC. Science 1997;275:1787–90.

3. Kinzler KW, Vogelstein B. Lessons from hereditary colorectal cancer. Cell1996;87:159–70.

4. Yakulov T, Raggioli A, Franz H, Kemler R. Wnt3a-dependent and-independent protein interaction networks of chromatin-bound b-cate-nin in mouse embryonic stem cells. Mol Cell Proteomics MCP 2013;12:1980–94.

5. Mosimann C, Hausmann G, Basler K. Beta-catenin hits chromatin:regulation of Wnt target gene activation. Nat Rev Mol Cell Biol 2009;10:276–86.

6. Jin B, Robertson KD. DNA methyltransferases, DNA damage repair, andcancer. Adv Exp Med Biol 2013;754:3–29.

7. Saito Y, Kanai Y, Nakagawa T, SakamotoM, SaitoH, Ishii H, et al. Increasedprotein expression of DNA methyltransferase (DNMT) 1 is significantlycorrelated with the malignant potential and poor prognosis of humanhepatocellular carcinomas. Int J Cancer J Int Cancer 2003;105:527–32.

8. Girault I, Tozlu S, Lidereau R, Bi�eche I. Expression analysis of DNAmethyltransferases 1, 3A, and 3B in sporadic breast carcinomas. ClinCancer Res 2003;9:4415–22.

9. Mizuno S, Chijiwa T, Okamura T, Akashi K, Fukumaki Y, Niho Y, et al.Expression of DNA methyltransferases DNMT1, 3A, and 3B in normalhematopoiesis and in acute and chronic myelogenous leukemia. Blood2001;97:1172–9.

10. De Marzo AM, Marchi VL, Yang ES, Veeraswamy R, Lin X, Nelson WG.Abnormal regulation of DNA methyltransferase expression during colo-rectal carcinogenesis. Cancer Res 1999;59:3855–60.

11. Rountree MR, Bachman KE, Baylin SB. DNMT1 binds HDAC2 and a newco-repressor, DMAP1, to form a complex at replication foci. Nat Genet2000;25:269–77.

12. Clements EG, Mohammad HP, Leadem BR, Easwaran H, Cai Y, Van NesteL, et al. DNMT1 modulates gene expression without its catalytic activitypartially through its interactions with histone-modifying enzymes.NucleicAcids Res 2012;40:4334–46.

13. QinW, Leonhardt H, Pichler G. Regulation of DNAmethyltransferase 1 byinteractions and modifications. Nucl Austin Tex 2011;2:392–402.

14. Kinney SRM, Pradhan S. Regulation of expression and activity of DNA(cytosine-5) methyltransferases in mammalian cells. Prog Mol Biol TranslSci 2011;101:311–33.

15. Du Z, Song J, Wang Y, Zhao Y, Guda K, Yang S, et al.DNMT1 stability is regulated by proteins coordinating deubi-quitination and acetylation-driven ubiquitination. Sci Signal 2010;3:ra80.

16. Est�eve P-O, Chin HG, Benner J, Feehery GR, Samaranayake M, HorwitzGA, et al. Regulation of DNMT1 stability through SET7-mediated lysinemethylation in mammalian cells. Proc Natl Acad Sci U S A 2009;106:5076–81.

17. Song J, Wang Z, Ewing RM. Integrated analysis of the Wnt responsiveproteome in human cells reveals diverse and cell-type specific networks.Mol Biosyst 2014;10:45–53.

18. Gassmann M, Grenacher B, Rohde B, Vogel J. Quantifying Western blots:pitfalls of densitometry. Electrophoresis 2009;30:1845–55.

19. Tan HY, Ng TW. Accurate step wedge calibration for densitometry ofelectrophoresis gels. Opt Commun 2008;281:3013–7.

20. Jim�enez CR, Huang L, Qiu Y, Burlingame AL. In-gel digestion of proteinsfor MALDI-MS fingerprint mapping. Curr Protoc Protein Sci 2001;Chapter16:Unit 16.4.

21. Searle BC. Scaffold: a bioinformatic tool for validating MS/MS-basedproteomic studies. Proteomics 2010;10:1265–9.

22. Nesvizhskii AI, Keller A, Kolker E, Aebersold R. A statistical model foridentifying proteins by tandem mass spectrometry. Anal Chem 2003;75:4646–58.

23. VeemanMT, SlusarskiDC, Kaykas A, Louie SH,MoonRT. Zebrafish prickle,a modulator of noncanonical Wnt/Fz signaling, regulates gastrulationmovements. Curr Biol 2003;13:680–5.

24. Belle A, Tanay A, Bitincka L, Shamir R,O'Shea EK.Quantification of proteinhalf-lives in the budding yeast proteome. Proc Natl Acad Sci U S A 2006;103:13004–9.

25. Song J, Hao Y, Du Z, Wang Z, Ewing RM. Identifying novel proteincomplexes in cancer cells using epitope-tagging of endogenous humangenes and affinity-purification mass spectrometry. J Proteome Res 2012;11:5630–41.

26. Ewing RM, Chu P, Li H, Taylor P, Climie S, McBroom L, et al. Large-scalemapping of human protein–protein interactions by mass spectrometry.Mol Syst Biol 2007;3:89.

Song et al.





27. Dazard J-EJ, Saha S, Ewing RM. ROCS: a reproducibility index and confi-dence score for interaction proteomics. BMC Bioinformatics 2012;13:128.

28. Felle M, Joppien S, N�emeth A, Diermeier S, Thalhammer V, Dobner T, et al.The USP7/Dnmt1 complex stimulates the DNA methylation activity ofDnmt1 and regulates the stability of UHRF1. Nucleic Acids Res 2011;39:8355–65.

29. Rhee I, Jair KW, Yen RW, Lengauer C, Herman JG, Kinzler KW, et al. CpGmethylation is maintained in human cancer cells lacking DNMT1. Nature2000;404:1003–7.

30. Chan TA, Wang Z, Dang LH, Vogelstein B, Kinzler KW. Targeted inactiva-tion of CTNNB1 reveals unexpected effects of beta-catenin mutation.Proc Natl Acad Sci U S A 2002;99:8265–70.

31. Maeda O, Usami N, Kondo M, Takahashi M, Goto H, Shimokata K, et al.Plakoglobin (gamma-catenin) has TCF/LEF family-dependent tran-scriptional activity in beta-catenin-deficient cell line. Oncogene 2004;23:964–72.

32. Unterberger A, Andrews SD,Weaver ICG, SzyfM.DNAmethyltransferase 1knockdown activates a replication stress checkpoint. Mol Cell Biol 2006;26:7575–86.

33. Easwaran HP, Schermelleh L, Leonhardt H, Cardoso MC. Replication-independent chromatin loadingofDnmt1duringG2andMphases. EMBORep 2004;5:1181–6.

34. Wang J, Hevi S, Kurash JK, Lei H, Gay F, Bajko J, et al. The lysinedemethylase LSD1 (KDM1) is required for maintenance of global DNAmethylation. Nat Genet 2009;41:125–9.

35. Yoshimizu T, Miroglio A, Ripoche M-A, Gabory A, Vernucci M, Riccio A,et al. The H19 locus acts in vivo as a tumor suppressor. Proc Natl Acad SciU S A 2008;105:12417–22.

36. Espada J, Peinado H, Lopez-Serra L, Seti�en F, Lopez-Serra P, Portela A,et al. Regulation of SNAIL1 and E-cadherin function by DNMT1 in a

DNA methylation-independent context. Nucleic Acids Res 2011;39:9194–205.

37. Agoston AT, Argani P, Yegnasubramanian S, Marzo AM De, Ansari-LariMA, Hicks JL, et al. Increased protein stability causes DNA methyl-transferase 1 dysregulation in breast cancer. J Biol Chem 2005;280:18302–10.

38. QinW, Leonhardt H, Spada F. Usp7 andUhrf1 control ubiquitination andstability of the maintenance DNA methyltransferase Dnmt1. J Cell Bio-chem 2011;112:439–44.

39. Sierra J, Yoshida T, Joazeiro CA, Jones KA. The APC tumor suppressorcounteracts beta-catenin activation and H3K4 methylation at Wnt targetgenes. Genes Dev 2006;20:586–600.

40. Eads CA, Nickel AE, Laird PW. Complete genetic suppressionof polyp formation and reduction of CpG-island hypermethyla-tion in ApcMin/þDnmt1-hypomorphic mice. Cancer Res 2002;62:1296–9.

41. Campbell PM, Szyf M. Human DNA methyltransferase gene DNMT1 isregulated by the APC pathway. Carcinogenesis 2003;24:17–24.

42. Milutinovic S, Brown SE, Zhuang Q, Szyf M. DNA methyltransferase 1knock down induces gene expression by a mechanism independent ofDNA methylation and histone deacetylation. J Biol Chem 2004;279:27915–27.

43. Jeong S, Liang G, Sharma S, Lin JC, Choi SH, Han H, et al. Selec-tive anchoring of DNA methyltransferases 3A and 3B to nucleo-somes containing methylated DNA. Mol Cell Biol 2009;29:5366–76.

44. Rothbart SB, Krajewski K, Nady N, Tempel W, Xue S, Badeaux AI,et al. Association of UHRF1 with methylated H3K9 directs themaintenance of DNA methylation. Nat Struct Mol Biol 2012;19:1155–60.






2015;13:969-981. Published OnlineFirst March 9, 2015.Mol Cancer Res Jing Song, Zhanwen Du, Mate Ravasz, et al. Signaling and DNA Methylation in Colorectal Cancer Cells

-Catenin and Dnmt1 Regulates WntβA Protein Interaction between

Updated version

10.1158/1541-7786.MCR-13-0644doi:

Access the most recent version of this article at:

Material

Supplementary

http://mcr.aacrjournals.org/content/suppl/2015/03/10/1541-7786.MCR-13-0644.DC1

Access the most recent supplemental material at:

Cited articles

http://mcr.aacrjournals.org/content/13/6/969.full#ref-list-1

This article cites 43 articles, 16 of which you can access for free at:

Citing articles

http://mcr.aacrjournals.org/content/13/6/969.full#related-urls

This article has been cited by 3 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://mcr.aacrjournals.org/content/13/6/969To request permission to re-use all or part of this article, use this link



http://mcr.aacrjournals.org/lookup/doi/10.1158/1541-7786.MCR-13-0644

http://mcr.aacrjournals.org/content/suppl/2015/03/10/1541-7786.MCR-13-0644.DC1

http://mcr.aacrjournals.org/content/13/6/969.full#ref-list-1

http://mcr.aacrjournals.org/content/13/6/969.full#related-urls

http://mcr.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://mcr.aacrjournals.org/content/13/6/969


Documents

A Protein Interaction between b-Catenin and Dnmt1 ... · roles in cell–cell adhesion and in regulation of Wnt-driven transcription. Here, a novel mass spectrometry–based proteo-mics