A yeast two-hybrid screen reveals that osteopontin associates with MAP1A and MAP1B in addition to other proteins linked to microtubule stability, apoptosis and protein degradation

A yeast two-hybrid screen reveals that osteopontinassociates with MAP1A and MAP1B in addition to otherproteins linked to microtubule stability, apoptosis andprotein degradation in the human brain

Philip Long, Parwez Samnakay, Peter Jenner and Sarah RoseNeurodegenerative Disease Research Group, Institute of Pharmaceutical Sciences, School of Biomedical Sciences, King’s College,London, UK

Keywords: chaperone protein, growth factor, osteopontin, Parkinson’s disease, rat brain

Abstract

Osteopontin (OPN) expression is reduced in surviving dopaminergic neurones in the substantia nigra (SN) in Parkinson’s disease(PD), and protects against MPP+-induced cell death in primary mesencephalic cultures and 6-OHDA-induced cell loss in the rat, whileinactivation of OPN aggravates cell death. OPN is thought to act through interactions with integrin receptors or CD44. However, thespecific protein interactions involved in OPN-mediated neuroprotection are unknown and are the focus of this study. The yeast two-hybrid (YTH) technique was utilised to investigate OPN–protein interactions, using full-length human OPN to screen a human foetalbrain cDNA library. Proteins involved in apoptosis, protein degradation and microtubule stability were identified as OPN bindingpartners. These included: MAP1A and MAP1B, which regulate microtubule stability; RNF138, an E3 ubiquitin-ligase; proteasomeb1 subunit, a subunit of the 20S proteasome involved in the ubiquitin-dependent cleavage of peptides; BAG6, SGTA and EF1A,proteins implicated in control of apoptosis; DnaJB1, a co-chaperone of Hsp70s; and pleiotrophin, a growth factor. The use ofsite-directed mutagenesis to modify known OPN protein binding sites outside the RGD integrin binding domain, specifically Y165Aand D139E, inhibited some of these interactions. Further investigation using affinity pull-down assays, co-immunoprecipitation andimmunohistochemistry confirmed that OPN associates with MAP1A and MAP1B in rat SN and striatum. These findings indicate a rolefor OPN in the regulation of microtubule dynamics, apoptosis and proteolysis in the brain, suggesting that OPN may act as anendogenous multifunctional protective protein in PD.

Introduction

Osteopontin (OPN) is a secreted phosphoprotein which is a member ofthe small integrin-binding ligand N-linked glycoprotein (SIBLING)family of proteins that are involved in numerous physiological andpathological events including wound healing angiogenesis, tumori-genesis and cell migration (Smith & Denhardt, 1987; Liaw et al.,1998; Asou et al., 2001). OPN contains a number of functionaldomains including integrin-, calcium-, heparin- and CD44-bindingsites and is subject to many cell-dependent post-translational modi-fications such as cleavage of thrombin and matrix metalloproteinase,phosphorylation at 28 different sites, glycosylation, trans-glutamina-tion and sialylation, explaining its diverse range of functions (Nemiret al., 1989; Beninati et al., 1994; Senger et al., 1994; Sorensen et al.,1995; Shanmugam et al., 1997; Agnihotri et al., 2001; Keykhosravaniet al., 2005; Christensen et al., 2007). Importantly, OPN is able to

influence oxidative stress, mitochondrial impairment, cytokine release,transcription of inducible nitric oxide synthase, inflammation andapoptotic processes (Lampe et al., 1991; Rollo et al., 1996; Nau et al.,1997; Weber et al., 1999; Noti, 2000; Gao et al., 2003).More recently, OPN has been shown to have relevance to

pathogenic events occurring in Parkinson’s disease (PD) through itslocalisation in brain and its ability to protect dopaminergic cellsagainst toxic insult. OPN mRNA and protein are found in a number ofregions of human, marmoset and rat brain but notably the substantianigra (SN) and striatum (Shin et al., 1999; Iczkiewicz et al., 2004,2006). In the human SN, OPN is co-localised with tyrosinehydroxylase in dopaminergic neurones (Iczkiewicz et al., 2006) and,in PD, OPN expression is reduced in remaining dopaminergicneurones in SN compared with age-matched controls (Iczkiewiczet al., 2006). OPN expression in SN in rats responds to mechanicaland toxic insult with an upregulation following administration ofthe inflammogen lipopolysaccharide and the dopaminergic toxin6-hydroxydopamine (6-OHDA) (Iczkiewicz et al., 2005, 2006).Importantly, both full-length OPN and a smaller peptide fragment

Correspondence: Sarah Rose, as above.E-mail: [email protected]

Received 3 November 2011, accepted 15 May 2012

European Journal of Neuroscience, pp. 1–10, 2012 doi:10.1111/j.1460-9568.2012.08189.x

ª 2012 The Authors. European Journal of Neuroscience ª 2012 Federation of European Neuroscience Societies and Blackwell Publishing Ltd

European Journal of Neuroscience

containing its RGD domain are able to protect against toxin-inducedcell death in both primary ventral mesencephalic neurones and in ratbrain (Iczkiewicz et al., 2010). The action of the RGD binding domainsuggests that these effects could be mediated through interactions withintegrin receptors or CD44 which are known targets for the protein. Bycontrast, inactivation of OPN in primary cell culture or in the intact SNled to an enhancement of dopaminergic cell death. These findingscontrast with observations by Maetzler et al. (2007) that the geneticablation of OPN leads to decreased cell death in MPTP-treated mice,so there is a complexity of effect that remains to be understood.In order to further understand the role of OPN in maintaining the

integrity of dopaminergic neurones in SN, we have sought to identifyOPN-interacting proteins of relevance to pathogenic processes occur-ring in PD. We have utilised a yeast two-hybrid (YTH) cDNA libraryscreen and demonstrated that OPN associates with proteins involvedin apoptosis, protein clearance and microtubule stability.

Materials and methods

Construction of the bait pGBKT7-OPN plasmid

The bait pGBKT7-OPN plasmid was generated by PCR amplificationof pcDNA3.1-OPN using Accuprime Pfx polymerase (Invitrogen) andthe following primers, which also contained NcoI and BamHIrestriction site sequences at the 5¢ end of each primer:5¢CACACCATGGGGATGAGAATTGCAGTGATTTGCTTT,5¢CACAGGATCCTTAATTGACCTCAGAAGATGCACT. Sam-

ples were incubated for 5 min at 95 �C and amplified in 35 sequentialcycles of 95 �C for 1 min, 60 �C for 1 min and 68 �C for 1 min. Thiswas followed by agarose gel electrophoresis of the PCR product, DNAgel purification, restriction enzyme digestion of PCR product andpGBKT7 vector; phenol–chloroform extraction and ligation of thepurified PCR product and cloning vector, catalysed by T4 ligase(Roche). The ligation product was transformed into E. coli, theplasmid DNA recovered by miniprep preparation (Qiagen). Toconfirm that the correct insert size was obtained, samples weredigested with appropriate restriction enzymes for 1 h and agarose gelelectrophoresis was performed to analyse the DNA band size.Missense mutations in OPN cDNA were introduced by PCR-mediatedsite-directed mutagenesis using PfuUltra DNA polymerase (Strata-gene) using the following primers:D139E, 5¢TTTCCCACGGAACTGCCAGCAAC, 5¢ GTTGCTGG

CAGTTCCGTGGGAAA;D161E, 5¢TGGCCGAGGTGAGAGTGTGGTTT, 5¢ AAACCACA

CTCTCACCTCGGCCA;Y165A, 5¢ TAGTGTGGTTGCTGGACTGAGGT, 5¢ ACCTCAGT

CCAGCAACCACACTA.All constructs were verified by DNA sequencing.

Transformation of yeast with plasmid DNA

The yeast strain Y190 (a generous gift from Professor Rob Harvey,School of Pharmacy) was co-transformed with pGBKT7-OPN andpACT2-cDNA library constructs. Plasmid DNA was introduced intocompetent Y190 cells using an adapted lithium acetate (LiAc) ⁄ single-stranded DNA ⁄ polyethylene glycol (PEG) method (Gietz et al.,1995). Denatured herring sperm DNA, pACT2 human foetal braincDNA library and pGBKT7-OPN bait were added to competent Y190cells. Cells were then incubated with PEG, LiAc and Tris-EDTA at30 �C for 45 min with gentle shaking, followed by heat-shock at42 �C for 20 min. Cells were then centrifuged at 3000 g for 1 min,resuspended in YPD Plus medium (Clontech) and incubated at 30 �C

for 90 min with gentle shaking. The cells were centrifuged at 3000 gfor 1 min and resuspended in 0.9% (w ⁄ v) NaCl solution (Clontech).The cell suspension was plated onto fifteen 132-mm diameterSD ⁄ -Leu ⁄ -Trp ⁄ -His agar plates, with 25 mm 3-amino-1,2,4-triazoledto eliminate background growth. Plates were incubated at 30 �C for5–21 days, and colonies that were 1–3 mm in size were picked andre-streaked onto fresh agar selection plates. After 3 days of growth at30 �C, these colonies were subjected to a LacZ freeze-fracture assay.

LacZ freeze-fracture assay

An adapted protocol of the LacZ freeze-fracture assay (Breeden &Nasmyth, 1985) was used to detect b-galactosidase activity in theyeast reporter strain Y190. X-Gal solution was prepared by dissolvingX-Gal (BDH Laboratory Supplies, Poole, UK) in N,N-dimethylfor-mamide and adding to Z-buffer (in mm: Na2HPO4Æ2H2O, 60;NaH2PO4Æ2H2O, 40; KCl, 10; MgSO4Æ7H2O, 1; pH 7.0) and 40 mm

b-mercaptoethanol, resulting in a 1 mg ⁄ mL X-Gal solution. Coloniesgrown on selective YPDA agar plates were transferred onto What-man’s No. 54 paper, immersed in liquid nitrogen for 2 · 5 s andthawed at room temperature in between immersions. Filters wereplaced in 2 mL of 1 mg ⁄ mL X-Gal solution and incubated at 37 �Cuntil a colour change was observed.

Yeast plasmid DNA preparation

A modified protocol of the QIAprep miniprep kit (Qiagen) was used toobtain minipreps of plasmid DNA. Yeast colonies were resuspendedin buffer P1 with 5 U ⁄ lL lyticase and �50 lL of glass beads (425–600 lm), incubated at 37 �C with shaking for 10 min followed byvigorous shaking for 20 min at 2500 rpm. The usual Qiagen protocolwas followed from this point. Yeast-purified plasmid DNA wastransformed into One Shot Top10 competent cells (Invitrogen) andminipreps of plasmid DNA prepared. Minipreps were sequenced usingpACT2 forward and reverse primers and DNA sequences compared tothe human genome using the BLAST database (http://blast.ncbi.nlm.nih.gov/Blast.cgi).

Preparation of yeast protein extracts

Competent yeast cells were transformed with pGBKT7-OPN and platedonto minimal agar lacking tryptophan (SD ⁄ -Trp) and protein extractionwas performed according to the Urea–SDS method outlined in theClontech Yeast Protocols Handbook. Samples were analysed by SDS-PAGE and Western blotting using an anti-OPN antibody, 1 : 1000(Assay Designs) and goat anti-rabbit antibody, 1 : 2000 (Dako).

Animals

Adult male Wistar rats (Charles River, Kent, UK) were housed ingroups of three or four at a temperature of 25 ± 1 �C with 50% relativehumidity on a 12-h light–dark cycle. Water and food were available adlibitum. All experiments were performed in accordance with the Animals(Scientific Procedures Act) 1986 under project licence No 70 ⁄ 6019,approved by the King’s College London Ethical Review Panel.

Double-labelling fluorescence immunohistochemistry

Rats were terminally anaesthetised with sodium pentobarbitone(Sagatal; 100 mg ⁄ kg i.p.) and transcardially perfused with 0.1 m

2 P. Long et al.

ª 2012 The Authors. European Journal of Neuroscience ª 2012 Federation of European Neuroscience Societies and Blackwell Publishing LtdEuropean Journal of Neuroscience, 1–10

phosphate-buffered saline (PBS) followed by 4% paraformaldehyde in0.1 m PBS. The brains were removed and post-fixed for 24 h at 4 �C in4% paraformaldehyde. The tissue was then transferred into 30% sucrosesolution containing 0.05% sodium azide and stored at 4 �C until thetissue had equilibrated. Coronal sections of tissue (30 lm) were cut at)20 �C using a cryostat (Bright Instruments Company Ltd, Hunting-don, UK) and stored as free-floating sections in 0.1 m PBS containing0.05% sodium azide at 4 �C for immunohistochemical use. Sectionswere incubated in 20% normal goat serum (NGS) solution in 0.1 m

PBS for 1 h followed by two 5-min washes in 0.1 m PBS with 1% NGSand 0.05% Triton X-100. Sections were incubated overnight in 0.1 m

PBS with 1% NGS plus mouse antirat OPN, 1 : 500 (DevelopmentalStudies Hybridoma Bank, IA, USA) and either goat antirat MAP1A orgoat antirat MAP1B, 1 : 500 (Santa Cruz) antibodies followed by 2 hwith Alexa Fluor 488 rabbit antimouse and Alexa Fluor 594 rabbitantigoat antibodies, 1 : 500 (Invitrogen). Sections were washed threetimes for 30 min in 0.1 m PBS, mounted onto poly-d-lysine-coatedslides and coverslipped with Vectashield mounting medium (VectorLaboratories in a darkened environment. An Axioskop microscope(Zeiss) was used to examine the sections.

Co-immunoprecipitation assays

Rat SN was removed using blunt dissection and homogenised in lysisbuffer containing: Triton, 1%; and, in mm, NaCl, 150; Tris, pH 7.6,50; EGTA, 5; Na orthovanadate, 1; PMSF, 1; and Complete ProteaseInhibitor Cocktail (Roche). Homogenates (2 mg of total protein) weresolubilised for 1 h at 4 �C and incubated with anti-MAP1A or anti-MAP1B antisera (5 lg) or control IgG for 1.5 h at 4 �C, followed byProtein A Sepharose beads (20 lL) for 1 h at 4 �C. Bound materialwas washed three times in the same buffer before elution with SDSsample buffer, subjected to SDS-PAGE and analysed with immuno-blotting using mouse anti-OPN antibody, 1 : 1000 and HRP-conju-gated rabbit anti-mouse secondary antibody, 1 : 2000 (Dako).

Production and purification of fusion proteins

OPN was cloned as BamH-XhoI fragments into pGEX4T3 (Pharma-cia, Piscataway, NJ, USA) for the production of glutathione-S-transferase (GST) fusion proteins. Sequenced DNA constructs weretransformed into E. coli (BL21 strain); 1-L cultures were grown andinduced with 1 mm isopropyl-B-d-thiogalactoylpyranoside and soni-cated. GST fusion proteins were purified with glutathione agarosebeads (Sigma) as described by Smith and Johnson (1988).

Affinity purification pull-down assays

Rat SN (2 mg of protein) was solubilised in lysis buffer and extractsincubated with fusion proteins (20 lg) at 4 �C for 2 h. Beads werewashed four times in lysis buffer, and bound material eluted with SDSsample buffer before being subjected to SDS-PAGE, and analysed byimmunoblotting using anti-MAP1A or anti-MAP1B (10 lg ⁄ mL)antibodies and HRP-conjugated antigoat secondary antibodies(1 : 2000; Dako).

Results

Generation of pGBKT7-OPN bait plasmid

Full-length human OPN bait sequence was generated by PCRamplification of pcDNA3.1-OPN. Agarose gel electrophoresis

revealed a band of 920 base pairs, the predicted size of OPN(Fig. 1). The purified PCR product was cloned into the pGBKT7vector and, following restriction enzyme digestion with NcoI andBamHI, agarose gel electrophoresis was performed to positivelyidentify plasmids containing OPN inserts. The presence of two bands,one of 7300 base pairs and one of 920 base pairs, corresponding toempty vector and bait OPN respectively, was observed (Fig. 2). Theseplasmids were then sequenced to confirm the presence of the OPNinsert.

Expression of OPN fusion protein in Y190 cells

In order to confirm the expression of the OPN bait fusion protein inyeast, competent Y190 cells were transformed with pGBKT7-OPN aswell as pGBKT7 containing no insert. The expression of OPN fusionprotein was shown by immunoblotting cell lysates with a specific OPNantibody, while no OPN expression was observed in Y190 cellstransformed with the empty pGBKT7 vector (Fig. 3).

Human foetal brain cDNA library screen

In order to identify novel OPN interactors, competent Y190 cells wereco-transformed with the pGBKT7-OPN bait and the pACT2 humanfoetal whole-brain cDNA library. Plasmid DNA was retrieved fromyeast colonies and pACT2 plasmids were sequenced to identify thecDNA inserts. A summary of the identified proteins encoded bycDNA clones is shown in Table 1. These included a number ofproteins, such as BCL2-associated athanogene 6 (BAG6), small

OPN (920 bp)

2072

600

1500

Fig. 1. Generation of OPN insert. Bait pGBKT7-OPN plasmid was generatedby PCR amplification of pcDNA3.1-OPN and the PCR product run on anagarose gel. A product corresponding to the size of OPN, 920 bp, was identified.

pGBKT7

OPN

7000

1000

2000

Fig. 2. Identification of plasmid. BamHI and NcoI were used to digest therecombinant pGBKT7-OPN plasmid. Two distinct bands were identified,corresponding to the expected sizes of OPN and pGBKT7.

Identification of osteopontin associated proteins 3


glutamine-rich tetratricopeptide repeat-containing protein alpha(SGTA), rich tetratricopeptide repeat protein 1 (TTC1), elongationfactor 1-alpha 1 (EF1A), DnaJB1, proteasome b1 subunit, RNF138,microtubule-associated protein (MAP)1A, MAP1B and pleiotrophin,which are associated with mechanisms attributed to neuronaldysfunction in PD.

Investigating the OPN interactor binding region

In order to investigate whether three known OPN protein-bindingregions were required for interactions with some of the proteinsidentified, OPN constructs were generated that would express OPNfusion proteins containing single amino-acid substitutions in thesesites, and protein interactions using the yeast two-hybrid assay wereinvestigated. The ten proteins highlighted in the previous section,BAG6, SGTA, TTC1, EF1A, DnaJB1, proteasome b1 subunit,RNF138, MAP1A, MAP1B and pleiotrophin, were chosen for thisinvestigation due to their potential interest in relation to thepathogenesis of PD. In order to identify potential protein bindingsites the interaction of full-length OPN with OPN containing singleamino-acid substitutions in regions known to bind to other proteins,specifically D139E, D161E or Y165A, were compared. Interestingly,disruption of the RGD domain had no effect on any of the interactionstested, while the interaction with MAP1A was disrupted by a D139Esubstitution and the interactions with BAG6, RNF138, proteasome b1,MAP1A, MAP1B, DnaJB1, pleiotrophin and EF1A were disrupted bythe Y165A substitution. None of these substitutions affected theinteractions with SGTA or TTC1 (Fig. 4).

Immunoreactivity of OPN, MAP1A and MAP1B in rat brain

In order to further study the interactions between OPN and some ofthese proteins, specifically MAP1A and MAP1B, double-fluorescenceimmunolabelling experiments were performed. OPN was seen to beco-expressed with both MAP1A and MAP1B in the SN and striatumof normal rat, two areas known to be affected in PD. Co-localisationwas observed between OPN and MAP1A and MAP1B in some cells inboth the SN and striatum (Fig. 5A and B).

OPN associates with MAP1A and MAP1B in rat brain

In order to verify the interaction of OPN with MAP1A and MAP1B,we expressed OPN as a soluble GST fusion protein. Using an affinitypull-down assay, OPN was demonstrated to associate with both

MAP1A and MAP1B in rat SN. No association was seen with GSTalone (Fig. 6A and B). To further examine this association, immu-noprecipitation experiments were performed using either anti-MAP1Aor anti-MAP1B antibodies or non-immune IgG as control. OPN wasshown to immunoprecipitate with MAP1A and MAP1B in both theSN and striatum. OPN, MAP1A and MAP1B did not immunoprecip-itate with non-immune IgG (Fig. 6C).

Discussion

This YTH library screen has revealed a number of novel OPN–proteininteractions that could conceivably play a role in the neuroprotectiveproperties of OPN in PD. Proteins identified as associating with OPNin this screen include guanine nucleotide exchange factors, calciumchannel subunits, kinases and proteins involved in exocytosis, such asGRIPAP, CACNG4, SBK1 and SNAPIN. However, we chose tofurther investigate ten proteins, BAG6, SGTA, TTC1, EF1A, DnaJB1,proteasome b1 subunit, RNF138, MAP1A, MAP1B and pleiotrophin,due to their links to apoptosis, microtubule regulation, proteinmisfolding and degradation pathways which are major causativefactors of neuronal loss in PD. Further investigation revealed that OPNassociates with MAP1A and MAP1B in the rat striatum and SN.

Proteins associated with the microtubule system: MAP1A,MAP1B and EF1A

Three of the proteins investigated, MAP1A, MAP1B and EF1A, areknown to interact with microtubules. Several lines of evidencesuggest that microtubules may contribute to PD pathogenesis.Stabilisation of microtubule dynamics is required for normal neuriteoutgrowth, axonal transport and synapse formation and henceneuronal function and survival. Additionally, tubulin, the proteinthat forms microtubules, is found in Lewy bodies and intraneuronalinclusions in PD brains (Alim et al., 2002), while an interactionbetween tubulin and both LRRK2, a protein associated with familialPD, and Parkin has been shown (Yang et al., 2005; Biskup et al.,2006; Gloeckner et al., 2006; Gillardon, 2009a). Additionally, thetoxicity of rotenone and MPP+ to dopaminergic neurones is partlydue to depolymerisation of microtubules (Yang et al., 2005; Jianget al., 2006). MAP1A and MAP1B are highly expressed in the soma,axons and dendrites of neurones where they bind to microtubules andregulate microtubule dynamics (Fink et al., 1996). A possibleinvolvement of MAP1B in PD has previously been suggested dueto its co-localisation with a-synuclein in Lewy bodies (Jensen et al.,2000). Links between these proteins and other neurodegenerativedisorders have also been postulated, including giant axonal neurop-athy, due to the interaction of MAP1B with gigaxonin (Ding et al.,2002). MAP1A and MAP1B have also been associated withautophagy, the degradation of organelles and proteins by lysosomaldegradation. Increasing evidence suggests that autophagy plays a rolein PD, as demonstrated by the increased amount of autophagicvacuoles (Anglade et al., 1997) and the reduced levels of autophagy-associated protein expression which have been shown in the SN ofpatients with PD (Alvarez-Erviti et al., 2010). MAP1A and MAP1Bboth associate with light-chain 3 (LC3), which is crucial forformation of autophagosomes (He & Klionsky, 2009). LC3 is knownto be localised to Lewy bodies in PD (Tanji et al., 2011), whileadministration of 6-OHDA results in increased levels of LC3 indopaminergic neurones of the rat SN (Li et al., 2011). Furthermore,MAP1B also interacts with DAPk (Harrison et al., 2008), anautophagy mediator (Inbal et al., 2002). MAP1A and MAP1B are

OPN

1 2

75

50

Fig. 3. Expression of OPN in yeast identified by Western blotting. (1) Y190transformed with pGBKT7-OPN. (2) Y190 transformed with empty pGBKT7.

4 P. Long et al.


known to be ubiquitously expressed throughout the brain (Schoenfeldet al., 1989; Fink et al., 1996), while OPN is known to be present inboth the SN and striatum (Lee et al., 1999; Iczkiewicz et al., 2004),two brain regions associated with neuropathology in PD. In thepresent study, our immunohistochemistry data show that OPNexpression overlaps with that of MAP1A and MAP1B in some cellsin the rat SN and striatum and, furthermore, co-immunoprecipitationand GST-affinity pull-down assays demonstrate that OPN associateswith MAP1A and MAP1B in both of these brain regions. Interest-ingly, mutations in another MAP, MAPT, are associated withautosomal dominant forms of parkinsonism (Nacharaju et al., 2001).It is also observed in Lewy bodies in the medulla of a large numberof PD patients (Arima et al., 1999). EF1A is also able to promoteassembly of microtubules, a function which was shown to beinhibited via an interaction with LRRK2. This study showed thatEF1A was also able to inhibit the kinase activity of LRRK2(Gillardon, 2009b). Interestingly, expression levels of EF1A mRNAwere shown to be altered in PD, specifically that the type 1 isoformis upregulated in the SN of PD patients while the type 2 isoform isdownregulated, providing further evidence that EF1A may play a rolein PD (Gillardon, 2009b). EF1A is also known to regulate OPN half-life by binding to the OPN 5¢-UTR in an actin-dependent manner(Zhang et al., 2008). EF1A is also known to be involved in detectionof misfolded proteins and proteasomal degradation (Abeliovich &Flint, 2006). It may be, therefore, that OPN’s interactions withMAP1A and MAP1B, in addition to EF1A, are involved in theregulation of microtubule dynamics and axonal transport systems,while a role in the regulation of autophagy can also be speculatedupon.

Table 1. OPN interactors identified in Y2H library screen

Identified proteins Abbreviation

Proteins associated with apoptosisHLA-B-associated transcript 3 BAT3Retinoblastoma binding protein 6 RBBP6Eukaryotic translation initiation factor 3, subunit K EIF3K

Proteins associated with protein degradation pathwaysComplement component 1, r subcomponent-like C1RLCopper metabolism (Murr1) domain-containing 1 COMMD1COP9 constitutive photomorphogenic homolog subunit 5 COPS5Nicastrin NCSTNProteasome (prosome, macropain) subunit, beta type 1 –Ring finger protein 138 (RNF138), transcript variant 1 –Ubiquitin-specific peptidase 42 USP42CDGSH iron sulfur domain 2 CISD2Ubiquitin-specific peptidase 42 USP42Ubiquitin-specific peptidase 8 USP8

Proteins linked to the cytoskeleton and traffickingAF4 ⁄ FMR2 family, member 4 AFF4Angiomotin-like 2 AMOTL2Cytohesin 2 (Pleckstrin homology, Sec7 and coiled-coildomains

–

Doublecortex; lissencephaly, X-linked (doublecortin) DCXEukaryotic translation elongation factor 1 alpha 1 EEF1A1KIAA1009 KIAA1009Microtubule-associated protein 1A MAP1AMicrotubule-associated protein 1B MAP1BMyristoylated alanine-rich protein kinase C substrate MARCKSNCK-associated protein 1 NCKAP1RAN binding protein 9 RANBP9SEC24-related gene family, member C (S. cerevisiae) SEC24CStaufen, RNA binding protein, homolog 1 (Drosophila) STAU1Tubulin, beta TUBB

Chaperone proteinsDnaJ (Hsp40) homolog, subfamily B, member 1 DNAJB1Retinoblastoma binding protein 6 RBBP6Small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha

SGTA

Tetratricopeptide repeat domain 1 TTC1Kinases

Protein kinase, cAMP-dependent, catalytic, beta PRKACBSerine threonine kinase 39 (STE20 ⁄ SPS1 homolog,yeast)

STK39

SH3-binding domain kinase 1(SBK1) –Guanine nucleotide exchange factors

GRIP1-associated protein 1 GRIPAP1Rap guanine nucleotide exchange factor (GEF) 2 RAPGEF2Tumor protein, translationally-controlled 1 TPT1TBC1 domain family, member 8 (with GRAM domain) TBC1D8

Proteins involved in neurite extension ⁄ axonal guidanceCoiled-coil and C2 domain-containing 1B CC2D1BPleiotrophin (heparin binding growth factor 8, neuritegrowth-promoting factor 1)

–

CytokinesCKLF-like MARVEL transmembrane domain-containing 3

CMTM3

Ribosomal proteinsMitochondrial ribosomal protein L23 MRPL23Ribosomal protein L5 RPL5Ribosomal protein L13 RPL13Ribosomal protein L15 RPL15Ribosomal protein L17 RPL17Ribosomal protein L23 RPL23Ribosomal protein S13 RPS13

ExocytosisisRegulating synaptic membrane exocytosis 4 RIMS4SNAP-associated protein SNAPIN

Calcium homeostasisATPase, Ca++ transporting, cardiac muscle, slowtwitch 2

ATP2A2

Calcium channel, voltage-dependent, gamma subunit 4 CACNG4Calmodulin 1 (phosphorylase kinase, delta) CALM1

Table 1. Continued.

Identified proteins Abbreviation

Adhesion proteinsLeucine-rich repeat-containing 4 LRRC4

Mitochondrial proteinsATP synthase, H+ transporting, mitochondrial F0complex, subunit B1

ATP5F1

TranscriptionChromodomain helicase DNA binding protein 1 CHD1Deoxynucleotidyltransferase, terminal, interactingprotein 2

DNTTIP2

Endothelial PAS domain protein 1 EPAS1High-mobility group nucleosome binding domain 1 HMGN1Solute carrier family 39 (zinc transporter), member 6 SLC39A6Zinc finger protein 638 ZNF638

Other ⁄ UnknownBromodomain-containing 3 BRD3Chromosome 2 open reading frame 50 C2orf50Complement component 1, r subcomponent-like C1RLCytochrome b5 reductase 3 CYB5R3Dermatan sulfate epimerase-like DSELFerritin, heavy polypeptide 1 FTH1Haemoglobin, alpha 2 HBA2KIAA1783 protein –Kv channel interacting protein 1 KCNIP1Metallophosphoesterase domain-containing 1 MPPED1Phosphatidylethanolamine N-methyltransferase PEMTPhospholipase D family, member 3 PLD3Prothymosin, alpha PTMANascent polypeptide-associated complex alpha subunit NACASjogren syndrome antigen B (autoantigen La) (SSB)Transmembrane protein 168 TMEM168Transmembrane protein 30A TMEM30ATumor protein, translationally-controlled 1 TPT1Zinc finger protein 804A ZNF804A



Chaperone proteins and mediators of apoptosis: SGTA, TTC1,DNaJB1 and BAG6

Four chaperone proteins, SGTA, TTC1, DnAJB1 and BAG6, wereidentified; three of these are also linked with apoptotic cell death.Chaperone proteins are of increasing interest in PD and otherneurodegenerative disorders where the formation of protein aggregatesare observed. Molecular chaperones are able to stabilise polypeptides

and aid folding of proteins into their native conformations, therebymodulating protein degradation pathways (Bandopadhyay & deBelleroche, 2009). The identification of proteins that are linked toapoptosis is also of interest as a large body of evidence links apoptoticcell death and PD. In post-mortem brains of PD patients morphologicalsigns of apoptosis such as staining for terminal deoxynucleotidyltransferase dUTP nick-end labelling (TUNEL), chromatin condensationand irregular nuclear morphology have been found (Kingsbury et al.,

FL OPN

pGBKT7

MAP1A MAP1BPROTEASOME

¬∇

OPN D161E

OPN Y165A

OPN D139E

BAG6 DNAJB1RNF138 pACT2SGTA Pleiotrophin TTC1 EF1A

Fig. 4. Effect of amino acid substitutions on OPN binding. OPN interacting proteins were co-transformed with pGBKT7-OPN, pGBKT7-OPN D139E, pGBKT7-OPN D161E, pGBKT7-OPN Y165A and empty pGBKT7, grown on selection media and tested for LacZ reporter gene activity.

MAP1A OPN MERGE

MAP1B OPN MERGE

SN

Striatum

SN

Striatum

A

B

Fig. 5. Double-immunofluorescence labelling of OPN with MAP1A and MAP1B. Co-expression of (A) OPN (green) with MAP1A (red) and (B) OPN (green) withMAP1B (red), rat SN and striatum. Scale bar, 50 lm.

6 P. Long et al.


1998; Hirsch et al., 1999). Furthermore, an increase in the expression ofthe apoptoticmarkersBax and caspase-3 (Hartmann et al., 2000; Tatton,2000), as well as an increase in the levels of the anti-apoptotic proteinbcl-2, have been observed (Mogi et al., 1996). SGTA and TTC1, anadaptor protein for Ras which has been shown to increase ERK1 ⁄ 2(p44 ⁄ 42) phosphorylation and play a role inG-protein signalling (Martyet al., 2003), are TPR motif-containing chaperones. In other proteins,such as CHIP (carboxyl terminus of Hsc70-interacting protein), thisdomain has been suggested to be involved in the regulation of theubiquitin–proteasome system (UPS), protein folding, protein transportand neurogenesis (D’Andrea & Regan, 2003; McDonough & Patterson,2003). Indeed, SGTA is found in a number of protein complexes in atransgenic C. Elegansmodel of Alzheimer’s disease, while knockdownof SGTA has been demonstrated to inhibit the toxicity of b-amyloid(Fonte et al., 2002). An interaction between SGTA and HSP70, as wellas HSP90, has also been shown to promote apoptosis in vivo (Wanget al., 2005) while, in apoptotic cells, nuclear import of SGTA wasfound to be significantly increased (Yin et al., 2006). DnaJB1, a type IImember of theHsp40 family, is a chaperone protein that has been shownto be required for protein folding (Freeman et al., 1995). It is also knownto co-operate with Hsp70 to inhibit translocation of Bax, an apoptosis-inducing factor, to the mitochondria, thereby reducing apoptotic celldeath (Gotoh et al., 2001, 2004). BAG6 is also implicated in the controlof apoptosis (Sasaki et al., 2007). Interestingly, BAG6 is encoded by agene, located within the HLA region, which was recently identified in aGWAS as a risk factor for PD (Hamza et al., 2010). Targets of BAG6include apoptosis-inducing factor and p53 (Desmots et al., 2007; Sasakiet al., 2007). Therefore, it may be that the association of OPNwith theseproteins can modulate their pro- or anti-apoptotic properties, or in othercases regulate their role in protein folding.

Proteins involved in the UPS – proteasome b1 subunit andRNF138

Two interactors, proteasome b1 and RNF138, are components of theUPS. The interaction of OPN with the proteasome b1 subunit is ofinterest as the proteasome is responsible for the majority of cellularprotein degradation (DeMartino & Slaughter, 1999), and it is thoughtthat disruption of the UPS plays a fundamental role in thepathogenesis of PD (McNaught & Jenner, 2001). The b subunitsform the two inner rings of the 26S proteasome which contain threecatalytic sites that mediate chymotrysin–, trypsin– and peptidylglut-amyl–peptide hydrolytic activity. Proteasomal activity has been shownto be reduced in the SN in PD (McNaught et al., 2001), while levels ofthe 20S-a subunit, including a4 and a6, are decreased (McNaughtet al., 2002; Bukhatwa et al., 2010). Furthermore, administration of

proteasomal inhibitors to rats has been shown to cause progressiveneuronal degeneration in the SN pars compacta with inclusion bodyformation (McNaught et al., 2004). RNF138 is a member of the E3ubiquitin ligase family, which also includes Parkin, a protein encodedby the PARK2 gene which is associated with autosomal recessivejuvenile PD. Although little is known about RNF138, it has beenshown to specifically interact with E2-25K, which regulates huntingtinin Huntington’s disease (Kalchman et al., 1996) and amyloidneurotoxicity in Alzheimer’s disease (Song et al., 2003). RNF138has also been shown to play a role regulating signalling of Wnt ⁄ b-catenin, pleiotrophic factors that are involved in various developmen-tal processes (Yamada et al., 2006) and that have recently beensuggested as contributing to the survival of midbrain DA neuronesfollowing 6-OHDA and MPP+ insult (L’episcopo et al., 2011).Interactions with these two proteins may therefore indicate thatOPN-mediated neuroprotection involves regulation of the UPS.

Growth factors – pleiotrophin

OPN is shown here to interact with pleiotrophin, a heparin-bindinggrowth factor which may be of relevance to PD due to its role in cellmigration and replication, angiogenesis, neurite outgrowth, axonguidance and synaptogenesis (Rauvala & Peng, 1997; Deuel et al.,2002). An increase in the number of neurones expressing pleiotrophinhas been observed in patients with PD (Marchionini et al., 2007), whilepleiotrophin expression has also been shown to be increased in theDA-depleted striatum and to promote the survival of DA neuronesin vitro (Hida et al., 2003). It has been demonstrated that pleiotrophinpromotes the survival of graftedDAneurons in vivo, probably owing to adecrease in cell death after transplantation (Hida et al., 2007). Aprotective effect against amphetamine-induced rotational behaviour inrats treated with 6-OHDA, both alone and in combination with GDNF,has been demonstrated, although no neuroprotective effect wasobserved on dopaminergic neurones when pleiotrophin alone wasadministered (Piltonen et al., 2009), suggesting either enhanced func-tion of the surviving terminals or neuritogenic effects (Kinnunen et al.,1999; Hida et al., 2003). Recently it has been shown that, in the 6-OHDA-lesioned rat, induction of pleiotrophin overexpression followingviral vector administration resulted in an increased number of tyrosinehydroxylase-expressing cells in the SN than in was seen in controls.

Alterations to OPN-protein binding domains disrupts someinteractions

We have previously shown that both full-length OPN and a smallpeptide fragment which incorporates the RGD binding sequence are

A

B

100

75OPN

IgG MAP1A

MAP1B

50

250

INPUTOPN-GST GST

MAP1A

MAP1B

INPUTOPN-GST GST

250

C

Fig. 6. Association of OPN with MAP1A and MAP1B in rat brain. Rat SN extracts were incubated with OPN-GST or GST and glutathione agarose beads. Afterwashing, bound material was subjected to SDS-PAGE and analysed by immunoblotting with (A) an anti-MAP1A or (B) anti-MAP1B antibody. (C) SN extracts wereincubated with anti-MAP1A or -MAP1B antibody and protein A Sepharose beads. After washing, bound material was subjected to SDS-PAGE and analysed byimmunoblotting with an anti-OPN antibody.



able to protect against MPP+-, 6-OHDA- and lipopolysaccharide-induced cell death in primary ventral mesencephalic neurones andagainst 6-OHDA and lipopolysaccharide insult in rat brain (Iczkiewiczet al., 2010). We have also observed that peptides corresponding toregions of OPN other than the RGD domain appear to have someprotective properties in ventral mesencephalic cultures treated withMPP+ (Iczkiewicz, J., Jenner, P. & Rose, S., unpublished observa-tions). Interestingly, the D161 amino acid substitution in the RGDdomain had no effect on OPN’s interactions with the proteinsinvestigated here. However, the D139E and Y165A substitutionsintroduced into two other known OPN protein-binding regions wereable to disrupt interactions between OPN and BAG6, RNF138,proteasome b1, MAP1A, MAP1B, DnaJB1, pleiotrophin and EF1A.None of the substitutions altered the association with SGTA andTTC1. These results suggest that, in addition to its RGD-mediatedeffects, other regions of OPN may have an important role to play in itsneuroprotective properties by facilitating interactions with proteinslinked to mechanisms of cell death in PD.

Concluding remarks and future directions

This library screen throws up a number of new interactions that mayprovide a valuable insight into the role of OPN in PD, as well as in otherneurological disorders. These studies indicate that the RGD domain ofOPN, which has been shown to be at least partly responsible for itsprotective properties in models of PD, is not involved in theseinteractions, although further investigation is required in order todefinitivelymap theOPNbinding site for these proteins. It must be notedthat, in the yeast two-hybrid system, interactions occur within the yeastnucleus and as such the biological significance of these results needs tobe investigated further in mammalian systems using methods such asco-immunoprecipitation, affinity pull-down assays and immunohisto-chemistry. In the case of two of the interactors uncovered here, MAP1AandMAP1B, the use of these techniques has provided more evidence oftheir association with OPN in rat brain tissue. Additionally, the use ofspecific functional assays will further determine the physiologicalrelevance of these interactions. These findings indicate a role for OPN inregulation of cytoskeleton dynamics, apoptosis and proteolysis in thebrain, suggesting that OPNmay act as amultifunctional neuroprotectiveagent in PD.

Acknowledgements

This work was funded by Parkinson’s UK. We are grateful to Professor RobHarvey (The School of Pharmacy, University of London) and Dr Rosa Sancho(KCL) for their help and technical advice. The mouse antirat OPN antibodydeveloped by Solursh and Franzen was obtained from the Developmental StudiesHybridoma Bank developed under the auspices of the NICHD andmaintained byThe University of Iowa, Department of Biology, Iowa City, IA 52242, USA.

Abbreviations

6-OHDA, 6-hydroxydopamine; BAG6, BCL2-associated athanogene 6; EF1A,elongation factor 1-alpha 1; GST, glutathione-S-transferase; MAP, microtu-bule-associated protein; OPN, osteopontin; PD, Parkinson’s disease; SGTA,small glutamine-rich tetratricopeptide repeat-containing protein alpha; SN,substantia nigra; TTC1, rich tetratricopeptide repeat protein 1; UPS, ubiquitinproteasome system; YTH, yeast two-hybrid.

References

Abeliovich, A. & Flint, B.M. (2006) Parkinsonism genes: culprits and clues.J. Neurochem., 99, 1062–1072.

Agnihotri, R., Crawford, H.C., Haro, H., Matrisian, L.M., Havrda, M.C. & Liaw,L. (2001) Osteopontin, a novel substrate for matrix metalloproteinase-3

(stromelysin-1) and matrix metalloproteinase-7 (matrilysin). J. Biol. Chem.,276, 28261–28267.

Alim, M.A., Hossain, M.S., Arima, K., Takeda, K., Izumiyama, Y., Nakamura,M., Kaji, H., Shinoda, T., Hisanaga, S. & Ueda, K. (2002) Tubulin seedsalpha-synuclein fibril formation. J. Biol. Chem., 277, 2112–2117.

Alvarez-Erviti, L., Rodriguez-Oroz, M.C., Cooper, J.M., Caballero, C., Ferrer,I., Obeso, J.A. & Schapira, A.H. (2010) Chaperone-mediated autophagymarkers in Parkinson disease brains. Arch. Neurol., 67, 1464–1472.

Anglade, P., Vyas, S., Javoy-Agid, F., Herrero, M.T., Michel, P.P., Marquez,J., Mouatt-Prigent, A., Ruberg, M., Hirsch, E.C. & Agid, Y. (1997)Apoptosis and autophagy in nigral neurons of patients with Parkinson’sdisease. Histol. Histopathol., 12, 25–31.

Arima, K., Hirai, S., Sunohara, N., Aoto, K., Izumiyama, Y., Ueda, K., Ikeda,K. & Kawai, M. (1999) Cellular co-localization of phosphorylated tau- andNACP ⁄ alpha synuclein-epitopes in lewy bodies in sporadic Parkinson’sdisease and in dementia with Lewy bodies. Brain Res., 843, 53–61.

Asou, Y., Rittling, S.R., Yoshitake, H., Tsuji, K., Shinomiya, K., Nifuji, A.,Denhardt, D.T. & Noda, M. (2001) Osteopontin facilitates angiogenesis,accumulation of osteoclasts, and resorption in ectopic bone. Endocrinology,142, 1325–1332.

Bandopadhyay, R. & de Belleroche, J. (2009) Pathogenesis of Parkinson’sdisease: emerging role of molecular chaperones. Trends Mol. Med., 16, 27–36.

Beninati, S., Senger, D.R., Cordella-Miele, E., Mukherjee, A.B., Chackalapa-rampil, I., Shanmugam, V., Singh, K. & Mukherjee, B.B. (1994)Osteopontin: its transglutaminase-catalyzed posttranslational modificationsand cross-linking to fibronectin. J. Biochem., 115, 675–682.

Biskup, S., Moore, D.J., Celsi, F., Higashi, S., West, A.B., Andrabi, S.A.,Kurkinen, K., Yu, S.W., Savitt, J.M., Waldvogel, H.J., Faull, R.L., Emson,P.C., Torp, R., Ottersen, O.P., Dawson, T.M. & Dawson, V.L. (2006)Localization of LRRK2 to membranous and vesicular structures inmammalian brain. Ann. Neurol., 60, 557–569.

Breeden, L. & Nasmyth, K. (1985) Regulation of the yeast HO gene. ColdSpring Harb. Symp. Quant. Biol., 50, 643–650.

Bukhatwa, S., Zeng, B.Y., Rose, S. & Jenner, P. (2010) A comparison ofchanges in proteasomal subunit expression in the substantia nigra inParkinson’s disease, multiple system atrophy and progressive supranuclearpalsy. Brain Res., 1326, 174–183.

Christensen, B., Kazanecki, C.C., Petersen, T.E., Rittling, S.R., Denhardt, D.T.& Sorensen, E.S. (2007) Cell type-specific post-translational modificationsof mouse osteopontin are associated with different adhesive properties.J. Biol. Chem., 282, 19463–19472.

D’Andrea, L.D. & Regan, L. (2003) TPR proteins: the versatile helix. TrendsBiochem. Sci., 28, 655–662.

DeMartino, G.N. & Slaughter, C.A. (1999) The proteasome, a novel proteaseregulated by multiple mechanisms. J. Biol. Chem., 274, 22123–22126.

Desmots, F., Russell, H.R., Michel, D. & McKinnon, P.J. (2007) Scytheregulates apoptosis-inducing factor stability during endoplasmic reticulumstress-induced apoptosis. J. Biol. Chem., 283, 3264–3271.

Deuel, T.F., Zhang, N., Yeh, H.J., Silos-Santiago, I. & Wang, Z.Y. (2002)Pleiotrophin: a cytokine with diverse functions and a novel signalingpathway. Arch. Biochem. Biophys., 397, 162–171.

Ding, J., Liu, J.J., Kowal, A.S., Nardine, T., Bhattacharya, P., Lee, A. & Yang,Y. (2002) Microtubule-associated protein 1B: a neuronal binding partner forgigaxonin. J. Cell. Biol., 158, 427–433.

Fink, J.K., Jones, S.M., Esposito, C. & Wilkowski, J. (1996) Humanmicrotubule associated protein 1a (MAP1A) gene: genomic organization,cDNA sequence, and developmental- and tissue-specific expression.Genomics, 35, 577–585.

Fonte, V., Kapulkin, V., Taft, A., Fluet, A., Friedman, D. & Link, C.D. (2002)Interaction of intracellular beta amyloid peptide with chaperone proteins.Proc. Natl. Acad. Sci. USA, 99, 9439–9444.

Freeman, B.C., Myers, M.P., Schumacher, R. & Morimoto, R.I. (1995)Identification of a regulatory motif in Hsp70 that affects ATPase activity,substrate binding and interaction with HDJ-1. EMBO J., 14, 2281–2292.

Gao, C., Guo, H., Wei, J. & Kuo, P.C. (2003) Osteopontin inhibits expressionof cytochrome c oxidase in RAW 264.7 murine macrophages. Biochem.Biophys. Res. Commun., 309, 120–125.

Gietz, R.D., Schiestl, R.H., Willems, A.R. & Woods, R.A. (1995) Studies onthe transformation of intact yeast cells by the LiAc ⁄ SS-DNA ⁄ PEGprocedure. Yeast, 11, 355–360.

Gillardon, F. (2009a) Leucine-rich repeat kinase 2 phosphorylates braintubulin-beta isoforms and modulates microtubule stability-a point ofconvergence in parkinsonian neurodegeneration. J. Neurochem., 110,1514–1522.

8 P. Long et al.


Gillardon, F. (2009b) Interaction of elongation factor 1-alpha with leucine-richrepeat kinase 2 impairs kinase activity and microtubule bundling in vitro.Neuroscience, 163, 533–539.

Gloeckner, C.J., Kinkl, N., Schumacher, A., Braun, R.J., O’Neill, E.,Meitinger, T., Kolch, W., Prokisch, H. & Ueffing, M. (2006) The Parkinsondisease causing LRRK2 mutation I2020T is associated with increased kinaseactivity. Hum. Mol. Genet., 15, 223–232.

Gotoh, T., Terada, K. & Mori, M. (2001) hsp70-DnaJ chaperone pairs preventnitric oxide-mediated apoptosis in RAW 264.7 macrophages. Cell Death.Differ., 8, 357–366.

Gotoh, T., Terada, K., Oyadomari, S. & Mori, M. (2004) hsp70-DnaJ chaperonepair prevents nitric oxide- and CHOP-induced apoptosis by inhibitingtranslocation of Bax to mitochondria. Cell Death. Differ., 11, 390–402.

Hamza, T.H., Zabetian, C.P., Tenesa, A., Laederach, A., Montimurro, J.,Yearout, D., Kay, D.M., Doheny, K.F., Paschall, J., Pugh, E., Kusel, V.I.,Collura, R., Roberts, J., Griffith, A., Samii, A., Scott, W.K., Nutt, J., Factor,S.A. & Payami, H. (2010) Common genetic variation in the HLA region isassociated with late-onset sporadic Parkinson’s disease. Nat. Genet., 42,781–785.

Harrison, B., Kraus, M., Burch, L., Stevens, C., Craig, A., Gordon-Weeks, P. &Hupp, T.R. (2008) DAPK-1 binding to a linear peptide motif in MAP1Bstimulates autophagy and membrane blebbing. J. Biol. Chem., 283, 9999–10014.

Hartmann, A., Hunot, S., Michel, P.P., Muriel, M.P., Vyas, S., Faucheux, B.A.,Mouatt Prigent, A., Turmel, H., Srinivasan, A., Ruberg, M., Evan, G.I.,Agid, Y. & Hirsch, E.C. (2000) Caspase-3: A vulnerability factor and finaleffector in apoptotic death of dopaminergic neurons in Parkinson’s disease.Proc. Natl. Acad. Sci. USA, 97, 2875–2880.

He, C. & Klionsky, D.J. (2009) Regulation mechanisms and signalingpathways of autophagy. Annu. Rev. Genet., 2009, 67–93.

Hida, H., Jung, C.G., Wu, C.Z., Kim, H.J., Kodama, Y., Masuda, T. & Nishino,H. (2003) Pleiotrophin exhibits a trophic effect on survival of dopaminergicneurons in vitro. Eur. J. Neurosci, 17, 2127–2134.

Hida, H., Masuda, T., Sato, T., Kim, T.S., Misumi, S. & Nishino, H. (2007)Pleiotrophin promotes functional recovery after neural transplantation in rats.Neuroreport, 18, 179–183.

Hirsch, E.C., Hunot, S., Faucheux, B., Agid, Y., Mizuno, Y., Mochizuki, H.,Tatton, W.G., Tatton, N. & Olanow, W.C. (1999) Dopaminergic neuronsdegenerate by apoptosis in Parkinson’s disease. Mov. Disord., 14, 383–385.

Iczkiewicz, J., Rose, S. & Jenner, P. (2004) Osteopontin (Eta-1) is present inthe rat basal ganglia. Brain Res. Mol. Brain Res., 132, 64–72.

Iczkiewicz, J., Rose, S. & Jenner, P. (2005) Increased osteopontin expressionfollowin intranigral lipopolysaccharide injection in the rat. Eur. J. Neurosci,21, 1911–1920.

Iczkiewicz, J., Jackson, M.J., Smith, L.A., Rose, S. & Jenner, P. (2006)Osteopontin expression in substantia nigra in MPTP-treated primates and inParkinson’s disease. Brain Res., 1118, 239–250.

Iczkiewicz, J., Broom, L., Cooper, J.D., Wong, A.M., Rose, S. & Jenner, P.(2010) The RGD-containing peptide fragment of osteopontin protectstyrosine hydroxylase positive cells against toxic insult in primary ventralmesencephalic cultures and in the rat substantia nigra. J. Neurochem., 114,1792–1804.

Inbal, B., Bialik, S., Sabanay, I., Shani, G. & Kimchi, A. (2002) DAP kinaseand DRP-1 mediate membrane blebbing and the formation of autophagicvesicles during programmed cell death. J. Cell Biol., 157, 455–468.

Jensen, P.H., Islam, K., Kenney, J., Nielsen, M.S., Power, J. & Gai, W.P.(2000) Microtubule-associated protein 1B is a component of cortical Lewybodies and binds alpha-synuclein filaments. J. Biol. Chem., 275, 21500–21507.

Jiang, Q., Yan, Z. & Feng, J. (2006) Neurotrophic factors stabilize microtu-bules and protect against rotenone toxicity on dopaminergic neurons. J. Biol.Chem., 281, 29391–29400.

Kalchman, M.A., Graham, R.K., Xia, G., Koide, H.B., Hodgson, J.G., Graham,K.C., Goldberg, Y.P., Gietz, R.D., Pickart, C.M. & Hayden, M.R. (1996)Huntingtin is ubiquitinated and interacts with a specific ubiquitin-conjugat-ing enzyme. J. Biol. Chem., 271, 19385–19394.

Keykhosravani, M., Doherty-Kirby, A., Zhang, C., Brewer, D., Goldberg,H.A., Hunter, G.K. & Lajoie, G. (2005) Comprehensive identification ofpost-translational modifications of rat bone osteopontin by mass spectrom-etry. Biochemistry, 44, 6990–7003.

Kingsbury, A.E., Mardsen, C.D. & Foster, O.J. (1998) DNA fragmentation inhuman substantia nigra: apoptosis or perimortem effect? Mov. Disord., 13,877–884.

Kinnunen, A., Niemi, M., Kinnunen, T., Kaksonen, M., Nolo, R. & Rauvala,H. (1999) Heparan sulphate and HB-GAM (heparin-binding growth-

associated molecule) in the development of the thalamocortical pathway ofrat brain. Eur. J. Neurosci, 11, 491–502.

Lampe, M.A., Patarca, R., Iregui, M.V. & Cantor, H. (1991) Polyclonal B cellactivation by the Eta-1 cytokine and the development of systemicautoimmune disease. J. Immunol., 147, 2902–2906.

Lee, M.Y., Shin, S.L., Choi, Y.S., Kim, E.J., Cha, J.H., Chun, M.H., Lee, S.B.& Kim, S.Y. (1999) Transient upregulation of osteopontin mRNA inhippocampus and striatum following global forebrain ischemia in rats.Neurosci. Lett., 271, 81–84.

L’episcopo, F., Tirolo, C., Testa, N., Caniglia, S., Morale, M.C., Cossetti, C.,D’Adamo, P., Zardini, E., Andreoni, L., Ihekwaba, A.E., Serra, P.A.,Franciotta, D., Martino, G., Pluchino, S. & Marchetti, B. (2011) Reactiveastrocytes and Wnt ⁄ beta-catenin signaling link nigrostriatal injury to repairin 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine model of Parkinson’s dis-ease. Neurobiol. Dis., 41, 508–527.

Li, L., Wang, X., Fei, X., Xia, L., Qin, Z. & Liang, Z. (2011) Parkinson’sdisease involves autophagy and abnormal distribution of cathepsin L.Neurosci. Lett., 489, 62–67.

Liaw, L., Birk, D.E., Ballas, C.B., Whitsitt, J.S., Davidson, J.M. & Hogan, B.L.(1998) Altered wound healing in mice lacking a functional osteopontin gene(spp1). J. Clin. Invest, 101, 1468–1478.

Maetzler, W., Berg, D., Schalamberidze, N., Melms, A., Schott, K., Mueller,J.C., Liaw, L., Gasser, T. & Nitsch, C. (2007) Osteopontin is elevated inParkinson’s disease and its absence leads to reduced neurodegeneration inthe MPTP model. Neurobiol. Dis., 25, 473–482.

Marchionini, D.M., Lehrmann, E., Chu, Y., He, B., Sortwell, C.E., Becker,K.G., Freed, W.J., Kordower, J.H. & Collier, T.J. (2007) Role of heparinbinding growth factors in nigrostriatal dopamine system development andParkinson’s disease. Brain Res., 1147, 77–88.

Marty, C., Browning, D.D. & Ye, R.D. (2003) Identification of tetratricopep-tide repeat 1 as an adaptor protein that interacts with heterotrimeric Gproteins and the small GTPase Ras. Mol.Cell Biol., 23, 3847–3858.

McDonough, H. & Patterson, C. (2003) CHIP: a link between the chaperoneand proteasome systems. Cell Stress Chaperones, 8, 303–308.

McNaught, K.S. & Jenner, P. (2001) Proteasomal function is impaired insubstantia nigra in Parkinson’s disease. Neurosci. Lett., 297, 191–194.

McNaught, K.S., Olanow, C.W., Halliwell, B., Isacson, O. & Jenner, P. (2001)Failure of the ubiquitin-proteasome system in Parkinson’s disease. Nat. Rev.Neurosci, 2, 589–594.

McNaught, K.S., Belizaire, R., Jenner, P., Olanow, C.W. & Isacson, O. (2002)Selective loss of 20S proteasome alpha-subunits in the substantia nigra parscompacta in Parkinson’s disease. Neurosci. Lett., 326, 155–158.

McNaught, K.S., Perl, D.P., Brownell, A.L. & Olanow, C.W. (2004) Systemicexposure to proteasome inhibitors causes a progressive model of Parkinson’sdisease. Ann. Neurol., 56, 149–162.

Mogi, M., Harada, M., Kondo, T., Mizuno, Y., Narabayashi, H., Riederer, P. &Nagatsu, T. (1996) bcl-2 protein is increased in the brain from parkinsonianpatients. Neurosci. Lett., 215, 137–139.

Nacharaju, P., Lewis, J., Easson, C., Yen, S., Hackett, J., Hutton, M. & Yen,S.H. (2001) Accelerated filament formation from tau protein with specificFTDP-17 missense mutations. FEBS Lett., 447, 195–199.

Nau, G.J., Guilfoile, P., Chupp, G.L., Berman, J.S., Kim, S.J., Kornfeld, H. &Young, R.A. (1997) A chemoattractant cytokine associated with granulo-mas in tuberculosis and silicosis. Proc. Natl. Acad. Sci. USA, 94, 6414–6419.

Nemir, M., DeVouge, M.W. & Mukherjee, B.B. (1989) Normal rat kidney cellssecrete both phosphorylated and nonphosphorylated forms of osteopontinshowing different physiological properties. J. Biol. Chem., 264, 18202–18208.

Noti, J.D. (2000) Adherence to osteopontin via alphavbeta3 suppresses phorbolester-mediated apoptosis in MCF-7 breast cancer cells that overexpressprotein kinase C-alpha. Int. J. Oncol., 17, 1237–1243.

Piltonen, M., Bespalov, M.M., Ervasti, D., Matilainen, T., Sidorova, Y.A.,Rauvala, H., Saarma, M. & Mannisto, P.T. (2009) Heparin-bindingdeterminants of GDNF reduce its tissue distribution but are beneficial forthe protection of nigral dopaminergic neurons. Exp. Neurol., 219, 499–506.

Rauvala, H. & Peng, H.B. (1997) HB-GAM (heparin-binding growth-associated molecule) and heparin-type glycans in the development andplasticity of neuron-target contacts. Prog. Neurobiol., 52, 127–144.

Rollo, E.E., Laskin, D.L. & Denhardt, D.T. (1996) Osteopontin inhibits nitricoxide production and cytotoxicity by activated RAW264.7 macrophages. J.Leukoc. Biol., 60, 397–404.

Sasaki, T., Gan, E.C., Wakeham, A., Kornbluth, S., Mak, T.W. & Okada, H.(2007) HLA-B-associated transcript 3 (Bat3) ⁄ Scythe is essential for p300-mediate acetylation of p53. Genes Dev., 21, 848–861.



Schoenfeld, T.A., McKerracher, L., Obar, R. & Vallee, R.B. (1989) MAP 1Aand MAP 1B are structurally related microtubule associated proteins withdistinct developmental patterns in the CNS. J. Neurosci., 9, 1712–1730.

Senger, D.R., Perruzzi, C.A., Papadopoulos-Sergiou, A. & Van de, W.L.(1994) Adhesive properties of osteopontin: regulation by a naturallyoccurring thrombin cleavage in close proximity to the GRGDS cell-bindingdomain. Mol. Biol. Cell, 5, 565–574.

Shanmugam, V., Chackalaparampil, I., Kundu, G.C., Mukherjee, A.B. &Mukherjee, B.B. (1997) Altered sialylation of osteopontin prevents itsreceptor mediated binding on the surface of oncogenically transformed tsB77cells. Biochemistry, 36, 5729–5738.

Shin, S.L., Cha, J.H., Chun, M.H., Chung, J.W. & Lee, M.Y. (1999)Expression of osteopontin mRNA in the adult rat brain. Neurosci. Lett., 273,73–76.

Smith, D.B. & Johnson, K.S. (1988) Single-step purification of polypeptidesexpressed in Escherischia coli as fusions with glutathione S-transferase.Gene, 67, 31–40.

Smith, J.H. & Denhardt, D.T. (1987) Molecular cloning of a tumor promoter-inducible mRNA found in JB6 mouse epidermal cells: induction is stable athigh, but not at low, cell densities. J. Cell Biochem., 34, 13–22.

Song, S., Kim, S.Y., Hong, Y.M., Jo, D.G., Lee, J.Y., Shim, S.M., Chung,C.W., Seo, S.J., Yoo, Y.J., Koh, J.Y., Lee, M.C., Yates, A.J., Ichijo, H. &Jung, Y.K. (2003) Essential role of E2-25K ⁄ Hip-2 in mediating amyloid-beta neurotoxicity. Mol. Cell, 12, 553–563.

Sorensen, E.S., Hojrup, P. & Petersen, T.E. (1995) Posttranslational modifi-cations of bovine osteopontin: identification of twenty-eight phosphorylationand three O glycosylation sites. Protein Sci., 4, 2040–2049.

Tanji, K., Mori, F., Kakita, A., Takahashi, H. & Wakabayashi, K. (2011)Alteration of autophagosomal proteins (LC3, GABARAP and GATE-16) inLewy body disease. Neurobiol. Dis., 43, 690–697.

Tatton, N.A. (2000) Increased caspase 3 and Bax immunoreactivity accompanynuclear GAPDH translocation and neuronal apoptosis in Parkinson’s disease.Exp. Neurol., 166, 29–43.

Wang, H., Shen, H., Wang, Y., Li, Z., Yin, H., Zong, H., Jiang, J. & Gu, J.(2005) Overexpression of small glutamine-rich TPR-containing proteinpromotes apoptosis in 7721 cells. FEBS Lett., 579, 1279–1284.

Weber, G.F., Adler, G. & Ashkar, S. 1999. Osteopontin in oxidative stressresponses. In Ruffolo, R.R. Jr, Feuerstein, G.Z., Hunter, A.J., Poste, G. &Metcalf, B.W. (Eds), Inflammatory Cells and Mediators in CNS Diseases.Harwood Academic Publishers, Amsterdam, pp. 97–112.

Yamada, M., Ohnishi, J., Ohkawara, B., Iemura, S., Satoh, K., Hyodo-Miura,J., Kawachi, K., Natsume, T. & Shibuya, H. (2006) NARF, an nemo-likekinase (NLK) associated ring finger protein regulates the ubiquitylation anddegradation of T cell factor ⁄ lymphoid enhancer factor (TCF ⁄ LEF). J. Biol.Chem., 281, 20749–20760.

Yang, F., Jiang, Q., Zhao, J., Ren, Y., Sutton, M.D. & Feng, J. (2005) Parkinstabilizes microtubules through strong binding mediated by three indepen-dent domains. J. Biol. Chem., 280, 17154–17162.

Yin, H., Wang, H., Zong, H., Chen, X., Wang, Y., Yun, X., Wu, Y., Wang, J. &Gu, J. (2006) SGT, a Hsp90beta binding partner, is accumulated in the nucleusduring cell apoptosis. Biochem. Biophys. Res. Commun., 343, 1153–1158.

Zhang, J.,Guo,H.,Mi,Z.,Gao,C.,Bhattacharya,S.,Li, J.&Kuo,P.C. (2008)EF1A1-actin interactions alter mRNA stability to determine differential osteopontinexpression in HepG2 and Hep3B cells. Exp.Cell Res., 315, 304–312.

10 P. Long et al.


Documents

A yeast two-hybrid screen reveals that osteopontin associates with MAP1A and MAP1B in addition to other proteins linked to microtubule stability, apoptosis and protein degradation