Embed Size (px)
Citation preview
1
Transmission of dapsone resistant leprosy detected by molecular epidemiological 1
approaches 2
Wei Li1, Rama M. Sakamuri1, Danielle E. Lyons 1, Florenda M. Orcullo2, Vidyagouri Shinde3, 3
Edred Lao Dela Pena2, Armi A. Maghanoy2, Irene B. Mallari2, Esterlina V. Tan2, Indira Nath3, 4
Patrick J. Brennan 1, Marivic Balagon2, and Varalakshmi Vissa1* 5
6
1 Department of Microbiology, Immunology, and Pathology, Colorado State University, Fort 7
Collins, CO 80523, USA 8
2 Leonard Wood Memorial Center for Leprosy Research, Cebu Skin Clinic, Cebu, Philippines 9
3 Blue Peter Public Health and Research Centre, Hyderabad, India 10
11
12
13
14
15
Running title: Drug resistance and strain types of clinical M. leprae 16
* Corresponding author: 17
VARALAKSHMI VISSA, PhD 18
E-MAIL: [email protected] 19
PHONE: 970-491-075220
Copyright © 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Antimicrob. Agents Chemother. doi:10.1128/AAC.05236-11 AAC Accepts, published online ahead of print on 22 August 2011
on June 23, 2018 by guesthttp://aac.asm
.org/D
ownloaded from
2
ABSTRACT 21
Drug resistance surveillance identified six untreated leprosy patients in the Philippines with 22
Mycobacterium leprae folP1 mutations which confer dapsone resistance. Five patients share a 23
village of residence; four who carried the mutation, Thr53Val, were also linked by M. leprae 24
VNTR strain types. In India, folP1 mutations were detected in two relapse patients with a history 25
of dapsone treatment. Mutations were not found in the rifampicin target gene rpoB. These 26
findings indicate that dapsone resistance is being transmitted. 27
on June 23, 2018 by guesthttp://aac.asm
.org/D
ownloaded from
3
Leprosy is an infection of the skin and nerves which can result in disabilities and social stigma; it 28
remains endemic in many parts of the world and is listed as a neglected tropical disease (19). 29
Molecular surveillance of resistance to anti-microbial therapies and Mycobacterium leprae strain 30
typing by mapping ‘variable number of tandem repeats’ (VNTRs) (7, 11) and single nucleotide 31
polymorphisms (SNPs) (20, 21) have applications in tracing transmission of disease and in 32
monitoring efficacy of control programs (23, 24,32). With the emergence of dapsone resistance, 33
multidrug therapy (MDT), which consists of dapsone and rifampicin for pauci-bacillary leprosy 34
and the additional drug clofazimine for multibacillary leprosy, was introduced by the World 35
Health Organization in the 1980s (34). As reports of rifampicin and dapsone resistance in 36
several countries began appearing (1, 5, 8, 9, 16, 17, 18), the WHO initiated a surveillance 37
program, particularly for relapse patients (35). Until recently, clinical drug resistance was 38
detected by mouse foot pad (MFP) assays which require specialized facilities and 6-12 months to 39
acquire results (4, 26, 27, 28, 29). On the other hand, PCR amplification followed by 40
sequencing of the drug resistance determining regions (DRDRs) in folP1 and rpoB genes can 41
detect resistance to dapsone and rifampicin; fluoroquinolones which are alternative drugs for 42
leprosy target the gyrase, encoded by gyrA and gyrB (3, 6, 10, 13, 33). 43
44
This report presents dapsone and rifampicin resistance surveillance findings for two Asian 45
countries where leprosy is endemic. Patients presenting at the Cebu Skin Clinic (CSC), Leonard 46
Wood Memorial (LWM) Leprosy Research Centre, Philippines (287 untreated new cases 47
detected during 2006-2009) and Blue Peter Research Centre (BPRC), Hyderabad, India [78 48
untreated new cases; 26 cases with previous treatment, nine of which were relapses (five had 49
on June 23, 2018 by guesthttp://aac.asm
.org/D
ownloaded from
4
dapsone monotherapy); all detected during 2007-2008] were studied following human research 50
approval and informed consent procedures (23, 24, 30). Total DNA extraction from biopsies 51
(LWM-CSC) and smears (BPRC), multiplex PCR using the Qiagen DNeasy and Multiplex PCR 52
kits, and amplicon sequencing methods, have been described previously (11). The PCR primers 53
for folP1, rpoB, gyrA and gyrB DRDRs are shown in Table 1. M. leprae strain NHDP63 was 54
used as a positive control (11). Only the rpoB and folP1 amplicons were sequenced in this study 55
as fluoroquinolones were not prescribed to the patients. Genotypes for 202 rpoB and 212 56
folP1DRDRs in Philippine samples, and for 52 rpoB and 57 folP1 DRDRs in Indian samples 57
were obtained. PCR or sequence failure occurred in samples with low bacteriological index (24, 58
30). Mutations in rpoB were not detected in the studied populations. Six patients had folP1 59
mutations with known dapsone resistance phenotypes (13, 16, 33): four in codon 53 [ACC(Thr)-60
GCC(Ala) in an Indian relapse case, and ACC(Thr)-GTC(Val) in three new Cebu cases] and two 61
in codon 55 [CCC(Pro)-CTC(Leu); a relapse case in India, and a new case in Cebu]. The folP1 62
Thr53Val genotype identified in the current study was seen in a prior study in a Cebu patient 63
(coded as 01Mat02) (16). This mutation was shown to confer a high degree of resistance by MFP 64
assays (16). The case history revealed that 01Mat02 was a relapsed patient who had also sought 65
treatment at LWM-CSC. The identification of four Cebu cases with the same folP1 mutation 66
prompted us to explore their clinical histories and epidemiological background. It was found that 67
all three new patients reside in the village of Jagobiao, in Mandaue city within a leprosy 68
sanitarium (Eversley Childs Sanitarium, ECS); 01Mat02 was a previous resident of ECS. The 69
three new cases reported knowledge of contact with leprosy patients in the family and/or 70
community. Querying the database of LWM-CSC patients included in ongoing molecular 71
on June 23, 2018 by guesthttp://aac.asm
.org/D
ownloaded from
5
epidemiology studies (since 2006) identified a total of 15 patients residing in Jagobiao (23, 24). 72
From the M. leprae VNTR strain types (Table 2), it can be noted, that there are at least three 73
transmission clusters. I49 clustered with the folP1 mutant L121, L257 and L259 samples 74
(Cluster A) and was also found to have the same Thr53Val mutation. These strains have a rare 75
combination of matching alleles within the Cebu VNTR database such as two copies at 21-3, 10 76
copies at (TA)10 and (AC)9 and 12 and 14 copies at (AT)17 and (AT)15 and an unusually high 77
copy number at the (TTC)21 locus. L121 and I49 are neighbors, and their houses are located near 78
those of L257 and L259. All of these patients attended the same high school and all but L259 79
attended the same primary school. They and their presumed index cases are residents of ECS 80
(see Table 3). 81
82
Patient I2-20, a close neighbor of I49 and L121 has a closely related VNTR strain type, but did 83
not have the folP1 mutation. I2-20 diagnosed later than the other four, may have acquired the 84
infection at an earlier stage or divergent transmission pathway within this community where 85
several generations of leprosy patients reside (Table 3). Strain typing of 01Mat02 from an 86
archived biopsy homogenate yielded partial VNTR results; however, available data indicated that 87
it does not closely match those of the new cases of cluster A. Hence 01Mat02 may not be a direct 88
infectious source strain for this cluster. The folp1 mutation may have been acquired from an 89
individual (diagnosed or undetected) not in the studied cohort. Cluster B is comprised of I09 90
linked to patients L003 and L057 reported previously (24), and cluster C includes I65 and L146. 91
I2-01, an un-clustered strain was found to have a Pro55Arg mutation. 92
on June 23, 2018 by guesthttp://aac.asm
.org/D
ownloaded from
6
93
Although MDT has been a simple and effective regimen for treating large numbers of leprosy 94
cases, these investigations highlight at least five new patients in Jagobiao, four with the same 95
strain, for whom dapsone would have been ineffective. Prior surveillance involving LWM-CSC 96
patients showed varying levels of primary resistance to dapsone: 2/55 in 1975-1978, 3/37 in 97
1979-1982, 20/38 in 1988-1992 (5) and 3/77 in 2001-2006 (16). Moreover, 7.9% of the isolates 98
in 1988-1992 were highly resistant to dapsone by MFP assays (5). The duration of MB-MDT has 99
been reduced to 1 year from 2 years since 1988. In the present study, of the 287 patients, 110 100
self-reported knowledge of contact with other leprosy patients. In the Indian study, the folP1 101
mutations were detected in 2 of the 9 relapse patients, both reporting residence in leprosy 102
colonies; one was treated with dapsone from 1965-66 and irregular MB-MDT at a later 103
undisclosed time. The patient’s mother also had leprosy. The second patient received dapsone in 104
1970, MB-MDT in 1995 and was released from treatment on smear negativity. This patient could 105
be a relapse or re-infection case. The emergence and persistence of such strains raises concerns 106
about the current passive case detection and treatment methods for interruption of leprosy and 107
transmission of drug resistance. Such communities with previously treated cases and their 108
families are candidates for surveillance and follow-up with corresponding treatment, perhaps 109
devoid of dapsone (2). While, genetics and physical environment (15) are perhaps factors for 110
clustering within communities, the carriage, spread and evolution of leprosy in humans within 111
families, between communities, and across continents have been demonstrated by strain typing 112
of M. leprae (20, 21, 23, 24, 32). 113
114
on June 23, 2018 by guesthttp://aac.asm
.org/D
ownloaded from
7
Drug resistance by molecular tests is being reported from several countries through the current 115
WHO drug surveillance campaign; however, this is largely a voluntary, limited exercise for 116
relapse cases (35). Combining reports from 2009 and 2010, the dapsone resistance per the 117
number of relapse cases were as follows: 0/8 (Pakistan), 0/3 (Yemen), 2/135 (Brazil), 1/18 118
(China), 4/44 (Myanmar), 5/58 (India), 6/18 (Vietnam), and 3/8 (Colombia) (36, 37); in 119
laboratories that include primary cases, the estimates are 0-18% (9, 16, 25, 31). Latest studies in 120
Cebu, Philippines, indicate that after 1 year MDT for MB patients the relapse rate was 0.52 121
per1000 patient years at risk (12). Operational factors preclude generalization of this statistic 122
across clinics in varied settings. Therefore, to objectively and quantitatively measure the true 123
global level of resistance and its impact on MDT efficacy at the patient and community level, 124
and the re-transmission potential, widespread and routine molecular surveys combined with 125
classic epidemiology should be implemented. Availability of standardized methods and 126
centralization of efforts, decreasing costs of DNA sequencing, in parallel with the development 127
of alternative rapid screening molecular methods (14, 31) make this feasible. 128
129
ACKNOWLEDGEMENTS: 130
These studies were funded by NIH-NIAID grants AI-063457, ARRA supplements to AI-063457, 131
and contract NO1-AI-25469. We thank staff at LWM-CSC, and BPRC for clinical work; patients 132
who volunteered to participate in the research. 133
134
on June 23, 2018 by guesthttp://aac.asm
.org/D
ownloaded from
8
REFERENCES: 135
1. Balagon, M. F., R. V. Cellona, E. D. Cruz, J. A. Burgos, R. M. Abalos, and G. 136
P.Walsh. 2009. Long-term relapse risk of multibacillary leprosy after completion of 2 137
years of multiple drug therapy (WHO-MDT) in Cebu, Philippines. Am. J. Trop. Med. 138
Hyg. 81:895-899. 139
2. Balagon, M. F., R. V. Cellona, R. M. Abalos, R. H. Gelber, and P. R. Saunderson. 140
2010. The efficacy of a four-week, ofloxacin-containing regimen compared with standard 141
WHO-MDT in PB leprosy. Lepr Rev. 81:27-33. 142
3. Cambau, E., L. Carthagena, A. Chauffour, B. Ji, and V. Jarlier. 2006. 143
Dihydropteroate synthase mutations in the folP1 gene predict dapsone resistance in 144
relapsed cases of leprosy. Clin. Infect. Dis. 42:238-241. 145
4. Colston, M. J., G. R. F. Hilson, and D. K. Banerjee. 1978. The ‘proportional 146
bactericidal test’: a method for assessing bactericidal activity of drugs against 147
Mycobacterium leprae in mice. Lepr. Rev. 49:7- 15. 148
5. dela Cruz, E., R. V. Cellona, M. V. Balagon, L. G. Villahermosa, T. T. Fajardo, Jr., 149
R. M. Abalos, E. V. Tan, and G. P. Walsh. 1996. Primary dapsone resistance in Cebu, 150
the Philippines; cause for concern. Int. J. Lepr. Other Mycobact Dis. 64:253-256. 151
6. Fukuda, H., and K. Hiramatsu. 1999. Primary targets of fluoroquinolones in 152
Streptococcus pneumoniae. Antimicrob. Agents Chemother. 43:410-412. 153
on June 23, 2018 by guesthttp://aac.asm
.org/D
ownloaded from
9
7. Groathouse, N. A., B. Rivoire, H. Kim, H. Lee, S. N. Cho, P. J. Brennan, and V. D. 154
Vissa. 2004. Multiple polymorphic loci for molecular typing of strains of Mycobacterium 155
leprae. J. Clin. Microbiol. 42:1666-16672. 156
8. Gupta, U. D., K. Katoch, and V. M. Katoch. Study of rifampicin resistance and 157
comparison of dapsone resistance of M. leprae in pre- and post-MDT era. Indian J Lepr. 158
81:131-134. 159
9. Kai, M., N. H. Nguyen Phuc, H. A. Nguyen, T. H. B. D. Pham, K. H. Nguyen, Y. 160
Miyamoto, Y. Maeda, Y. Fukutomi, N. Nakata, M. Matsuoka, M. Makino, and T. T. 161
Nguyen. 2011. Analysis of drug-resistant strains of Mycobacterium leprae in an endemic 162
area of Vietnam. Clin. Infect. Dis. 52:e127-e132. 163
10. Kapur, V., L. L.Li, S. Iordanescu, M. R. Hamrick, B. N. Kreiswirth, and J. M. 164
Musser. 1994. Characterization by automated DNA sequencing of mutations in the gene 165
(rpoB) encoding the RNA polymerase beta subunit in rifampin-resistant Mycobacterium 166
tuberculosis strains from New York City and Texas. J. Clin. Microbiol. 32:1095–1098. 167
11. Kimura, M., R. M. Sakamuri, N. A. Groathouse, B. L. Rivoire, D. Gingrich, S. 168
Krueger-Koplin, S.-N. Cho, P. J. Brennan, and V. Vissa. 2009. Rapid variable-number 169
tandem-repeat genotyping for Mycobacterium leprae clinical specimens. J. Clin. 170
Microbiol. 47:1757-1766. 171
on June 23, 2018 by guesthttp://aac.asm
.org/D
ownloaded from
10
12. Maghanoy, A., I. Mallari, M. Balagon, and P. Saunderson. 2011. Relapse study in 172
smear positive multibacillary (MB) leprosy after 1 year WHO-multi-drug therapy (MDT) 173
in Cebu, Philippines. Lepr Rev. 82:65-69. 174
13. Matsuoka, M. 2010. Drug resistance in leprosy. Jpn. J. Infect. Dis. 63:1-7. 175
14. Matsuoka, M., K. S. Aye, K. Kyaw, E. V. Tan, M. V. Balagon, P. Saunderson, R. 176
Gelber, M. Makino, C. Nakajima, and Y. Suzuki. 2008. A novel method for simple 177
detection of mutations conferring drug resistance in Mycobacterium leprae, based on a 178
DNA microarray, and its applicability in developing countries. J. Med. Microbiol. 179
57:1213-1219. 180
15. Matsuoka, M., L.F. Zhang, T. Budiawan, K. Saeki, and S. Izumi. 2004. Genotyping of 181
Mycobacterium leprae on the basis of the polymorphism of TTC repeats for analysis of 182
leprosy transmission. J. Clin Micro. 42:741-745. 183
16. Matsuoka, M., T. Budiawan, K. S. Aye, K. Kyaw, E. V. Tan, E. D. Cruz, R. Gelber, 184
P. Saunderson, V. Balagon, and V. Pannikar. 2007. The frequency of drug resistance 185
mutations in Mycobacterium leprae isolates in untreated and relapsed leprosy patients 186
from Myanmar, Indonesia and the Philippines. Lepr. Rev. 78:343-352. 187
17. Matsuoka, M., Y. Kashiwabara, and M. Namisato. 2000. A Mycobacterium leprae 188
isolate resistant to dapsone, rifampin, ofloxacin and sparfloxacin. Int. J. Lepr. Other 189
Mycobact Dis. 68:452-435. 190
on June 23, 2018 by guesthttp://aac.asm
.org/D
ownloaded from
11
18. Matsuoka, M., Y. Suzuki, I. E. Garcia, M. Fafutis-Morris, A. Vargas-González, C. 191
Carreño-Martinez, Y. Fukushima, and C. Nakajima. 2010. Possible mode of 192
emergence for drug-resistant leprosy is revealed by an analysis of samples from Mexico. 193
Jpn. J. Infect. Dis. 63:412-416. 194
19. Molyneux, D. H. 2004. "Neglected" diseases but unrecognised successes--challenges and 195
opportunities for infectious disease control. Lancet. 364:380-383. 196
20. Monot, M., N. Honoré, T. Garnier, R. Araoz, J.Y. Coppée, C. Lacroix, S. Sow, J.S. 197
Spencer, R.W. Truman, D.L. Williams, R. Gelber, M. Virmond, B. Flageul, S.N. Cho, 198
B. Ji, A. Paniz-Mondolfi, J. Convit, S. Young, P.E. Fine, V. Rasolofo, P.J. Brennan, 199
and S.T. Cole. 2005. On the origin of leprosy. Science. 308:1040-1042. 200
21. Monot, M., N. Honoré, T. Garnier, N. Zidane, D. Sherafi, A. Paniz-Mondolfi, M. 201
Matsuoka, G. M. Taylor, H. D. Donoghue, A. Bouwman, S. Mays, C. Watson, D. 202
Lockwood, A. Khamesipour, A. Khamispour, Y. Dowlati, S. Jianping, T. H. Rea, L. 203
Vera-Cabrera, M. M. Stefani, S. Banu, M. Macdonald, B. R. Sapkota, J. S. Spencer, 204
J. Thomas, K. Harshman, P. Singh, P. Busso, A. Gattiker, J. Rougemont, P. J. 205
Brennan, and S. T. Cole. 2009. Comparative genomic and phylogeographic analysis of 206
Mycobacterium leprae. Nat. Genet. 41:1282-1289. 207
22. Ridley, D. S., and W. H. Jopling. 1962. A classification of leprosy for research purposes. 208
Lepr. Rev. 33:119-128. 209
on June 23, 2018 by guesthttp://aac.asm
.org/D
ownloaded from
12
23. Sakamuri, R.M., J. Harrison, R. Gelber, P. Saunderson, P.J. Brennan, M. Balagon, 210
and V. Vissa. 2009. Continuation: study and characterisation of Mycobacterium leprae 211
short tandem repeat genotypes and transmission of leprosy in Cebu, Philippines. Lepr. 212
Rev. 80:272-279. 213
24. Sakamuri, R. M., M. Kimura, W. Li, H.-C. Kim, H. Lee, M. D. Kiran, W. C. Black, 214
M. Balagon, R. Gelber, S.-N. Cho, P. J. Brennan, and V. Vissa. 2009. Population-215
based molecular epidemiology of leprosy in Cebu, Philippines. J. Clin. Microbiol. 216
47:2844-2854. 217
25. Sekar, B., K. Arunagiri, B. N. Kumar, S. Narayanan, K. Menaka, and P. K. Oommen. 2011. 218
Detection of mutations in folP1, rpoB and gyrA genes of M. leprae by PCR- direct sequencing--a 219
rapid tool for screening drug resistance in leprosy. Lepr. Rev. 82:36-45. 220
26. Sekar, B., N. Elangeswaran, E. Jayarama, M. Rajendran, S.S. Kumar, R. 221
Vijayaraghavan, D. Anandan, and K. Arunagiri. 2002. Drug susceptibility of 222
Mycobacterium leprae: a retrospective analysis of mouse footpad inoculation results from 223
1983 to 1997. Lepr. Rev. 73:239-244. 224
27. Shepard, C. C. 1967. A kinetic method for the study of the activity of drugs against 225
Mycobacterium leprae in mice. Int. J. Lepr. 35:429–435. 226
28. Shepard, C. C. 1982. Statistical analysis of results obtained by two methods for testing 227
drug activity against Mycobacterium leprae. Int. J. Lepr. Other Mycobact. Dis. 50:96–228
101. 229
on June 23, 2018 by guesthttp://aac.asm
.org/D
ownloaded from
13
29. Shetty, V. P., A. V. Wakade, S. Ghate, V. V. Pai, R. Ganapati, and N. H. Antia. 2003. 230
Viability and drug susceptibility testing of M. leprae using mouse footpad in 37 relapse 231
cases of leprosy. Int. J. Lepr. Other. Mycobact. Dis. 71:210-217. 232
30. Shinde, V., H. Newton, R.M. Sakamuri, V. Reddy, S. Jain, A. Joseph, T. Gillis, I. 233
Nath, G. Norman, and V. Vissa. 2009. VNTR typing of Mycobacterium leprae in South 234
Indian leprosy patients. Lepr. Rev. 80:290-301. 235
31. Singh, P., P. Busso, A. Paniz-Mondolfi, N. Aranzazu, M. Monot, N. Honore, A. D. F. 236
F. Belone, M. Virmond, M. E. Villarreal Olaya, C. Rivas, and S. T. Cole. 2011. 237
Molecular drug susceptibility testing and genotyping of Mycobacterium leprae from South 238
America. Antimicrob. Agents Chemother. 55:2971-2973. 239
32. Weng, X., J. Vander Heiden, Y. Xing, J. Liu, and V. Vissa. 2011. Transmission of 240
leprosy in Qiubei County, Yunnan, China: insights from an 8-yearmolecular epidemiology 241
investigation. Infect Genet Evol. 11:363-374. 242
33. Williams, D.L., L. Spring, E. Harris, P. Roche, and T.P. Gillis. 2000. Dihydropteroate 243
synthase of Mycobacterium leprae and dapsone resistance. Antimicrob. Agents 244
Chemother. 44:1530-1537. 245
34. World Health Organization. 1982. Chemotherapy of leprosy for control programmes. 246
WHO, Geneva, Switzerland. WHO Technical Report Series. 768. 247
on June 23, 2018 by guesthttp://aac.asm
.org/D
ownloaded from
14
35. World Health Organization. 2009. Guidelines for global surveillance of drug resistance 248
in leprosy. Who, India. http://www.searo.who.int/LinkFiles/Situation_1-249
Guidelines_GSDRL _GLP-09.pdf. 250
36. World Health Organization. 2010. Surveillance of drug resistance in leprosy: 2009. 251
Wkly. Epidemiol. Rec. 85:281-284. 252
37. World Health Organization. 2011. Surveillance of drug resistance in leprosy: 2010. 253
Wkly. Epidemiol. Rec. 86:237-240. 254
255
on June 23, 2018 by guesthttp://aac.asm
.org/D
ownloaded from
Table 1: Primers used for multiplex PCR amplification of M. leprae drug resistance determining regions (DRDRs)
Target Amplicon size (bp) Primer name Primer location Primer sequence (5’ to 3’)
rpoB 386 rpoB-U 2275587-2275568 CAGGACGTCGAGGCGATCAC
rpoB-L 2275202-2275218 TCGTCAGCGGTCAAGTA
folP1 281 folP1-U 296746-296765 TTCGTTCTCAGATGGCGGAC
folP1-L 297026-297007 GCCCACCAGACACATCGTTG
gyrA 160 gyrA-U 7521-7539 CCGTAGCCACGCTAAGTCA
gyrA-L 7678-7660 CCGGCGAACCGAAATTGCC
gyrB 186 gyrB-U 6579-6602 ACTGATCCTCGAAGTTCTGAACTG
gyrB-L 6764-6749 CAATGCCGTAATAATTTGCTTGAA
The amplicon size and primer nucleotide positions are per the M. leprae TN strain as found in the Leproma website
(http://genolist.pasteur.fr/Leproma/).
on June 23, 2018 by guesthttp://aac.asm
.org/D
ownloaded from
Table 2: M. leprae VNTR strain types identify transmission clusters in Jagobiao, Mandaue City, Cebu, Philippines.
Patient ID Cluster VNTR pattern at locusd
(AC)8b (GTA)9 (GGT)5 (AT)17 21-3 (AC)9 (AT)15 (AC)8a 27-5 6-7 (TA)18 (TTC)21 18-8 12-5 23-3 (TA)10
01Mat02 NA N N 5 12 N 10 11 8 4/5 7 15 21 8 N 2 15
I49a
Cluster A
8 9 5 12 2 10 14 9 5 7 15 48/63 7/8 4 2 10
L121c 8 9 5 12 2 10 14 9 5 7 15 68 8 4 2 10
L257c 8 8 5 12 2 10 14 9 5 7 15 50 9 4 2 10
L259c 8 9 5 12 2 10 14 9 5 8 15 52 8 4 2 10
I2-20c 8 9 5 12 2 11 14 9 5 7 17 51 8 4 2 10
I09a
Cluster B
6 9 5 10 2 8 17 9 5 7 15 16 7 5 2 7
L003b 6 9 5 10 2 8 17 9 5 7 16 17 7 5 2 7
L057b 6 9 5 10 2 8 18 9 5 7 17 17 7 5 2 7
I65a Cluster C
7 9/10 6 N 3 9 16 10 5 7 15 23 8 4 2 12
L146c 7 9 6 16 3 8 22 10 5 7 14 24 8 4 2 12
L063b 8 9 6 17 N 9 N 12 5 7 19 23 8 4 2 N
I2-01c 8 9 5 13 3 9 14 8 5 7/8 16 17/18 8 4 2 10
L046b NA 8 11 5 13 3 10 15 9 5 7 22 21 8 4 2 10
L198c 10 10 5 15 3 9 14 8 N 7 N 23 7 5 2 13
L141c 7 N 4 13/15 2 8 20 9 5 6 18 12 8 4 2 8
NA, not applicable N, PCR negative a,b,c sample references: a(23), b(24),c unpublished dVNTR pattern indicates the number of copies found at the specified locus Samples from patients shown in boldface have folP1 mutations
on June 23, 2018 by guesthttp://aac.asm
.org/D
ownloaded from
Table 3: Clinical information of Jagobiao patients with folP1 Thr53Val mutation and VNTR Cluster A
Patient information Leprosy Contact information Patients ID
Year of Diagnosis
R-J Classa
Treatment Regimen Relationship Year of
DiagnosisTreatmentStatus
Treatment Center Treatment Regimen
I49 Jun-07 LL MDT-MB Father 1980 Treated ECS NA Mother 1975 Treated ECS NA Relative NA Treated NA NA
Neighbor NA Treated NA NA L121 Oct-07 BL MDT-MB Grandfather 1975 Treated ECS NA Neighbor NA Treated ECS Dapsone L257 Mar-09 BL MDT-MB Mother 1973 Treated ECS Dapsone x 6 yrs or more
Father 1969 Treated ECS Dapsone x 6 yrs or more Brother 1990 Treated ECS w/ Brown tablets x 4yrs Neighbor NA Treated ECS NA
Schoolmate NA Untreated NA NA L259 Apr-09 LL MDT-MB Neighbor NA NA NA NA
I2-20 Oct-09 BL MDT-MB Father 2005 Treated LWM Clinical Branch MDT-MB x 1yr
Neighbor NA Treated 01Mat02b 1978 BL DDS (1978-1984)
NA B663(1984) 2011 BL MDT-MB (1yr)
NA, Not available MDT-MB, multidrug therapy for multibacillary (MB) patients DDS, dapsone monotherapy B663, clofazimine w/Brown tablets, as recalled by the patient; this may refer to clofazimine a per Ridley-Joplin classification (22) LL lepromatous leprosy, BL borderline lepromatous leprosy b carrying folP1Thr53Val mutation, but not the Cluster A VNTR type Samples from patients shown in boldface have folP1 mutations
on June 23, 2018 by guesthttp://aac.asm
.org/D
ownloaded from
