ABE: Advances in Bioscience EducationABE: Advances in Bioscience Education

Dr. Kabi Neupane, Coordinator (co-PI, LCC)

Faculty PartnersJohn Berestecky (KCC)Ingelia White (WCC)Priscilla Millen (LCC)Janice Ito (LCC)Catherine Unabia (HPU)David Christopher (PI, UH, Manoa)

Bringing together students and faculty to explore Bringing together students and faculty to explore

research in the molecular and cellular biosciences.research in the molecular and cellular biosciences.

Summer 06Summer 06

Stepping into scientific research

What are our goals?

What kind of research are we doing ?

What is an Arabidopsis plant?

Research philosophy.

From the classroom to the lab bench with intensity.

• Reach for new learning and knowledge.

Goals

• Take risk, try something new, unfamiliar and break thru the fear barrier.

• To learn and grow - actively, by doing….to change.

• Move out of the comfort zone and into the stretch zone.

Willing to sail into Willing to sail into unchartered watersunchartered waters

To discover…To discover… make mistakes…make mistakes… … …change direction.change direction.

Research = Stretch ZoneResearch = Stretch Zone

Have FAITH that you can learn Have FAITH that you can learn from mistakes as you move from mistakes as you move along.along.

Scientific Research:Scientific Research:Learn by Trial and error. Learn by Trial and error. Embrace mistakesEmbrace mistakes

Persistance is more important Persistance is more important than strengththan strength

Scientific Research: Scientific Research: Discover new knowledge.Discover new knowledge.

Use tools of molecular and cellular biology Use tools of molecular and cellular biology to figure out the underlying biochemicalto figure out the underlying biochemical

processes that control how living cells processes that control how living cells

work.work.

Plant growth…Plant growth…How do leaves, roots, stems, flowers How do leaves, roots, stems, flowers develop from common precursor cells?develop from common precursor cells?

How can native and crop plants safely resist How can native and crop plants safely resist pests and diseases that kill them ? pests and diseases that kill them ?

RESEARCH QUESTIONS:RESEARCH QUESTIONS:

How can plants be protected from environmental How can plants be protected from environmental stress: drought, flood, salt, heat, UV, pollution ?stress: drought, flood, salt, heat, UV, pollution ?

““Arabidopsis thaliana:Arabidopsis thaliana: Research on a Research on a

lawn mower to understand a corvette”lawn mower to understand a corvette”

Research Philosophy to gain insight Research Philosophy to gain insight into complex systemsinto complex systems

Learn the inner workings of something Learn the inner workings of something complicated, then start by studying the simpler complicated, then start by studying the simpler version.version.

$ 2,000$ 2,000$ 65,0000$ 65,0000

Model System - essence of an automobile

Complex fascinating plants adapt to diverse Complex fascinating plants adapt to diverse environmentsenvironments

simplesimple

Arabidopsis thalianaArabidopsis thaliana Plants Plants

ComplexComplex

CornfieldCornfield ArabidopsisArabidopsis “field” in “field” in 4 inch petri plate4 inch petri plate

Economy of Size

Corn Corn 100 - 140 days 100 - 140 daysto seedto seed

ArabidopsisArabidopsis 30-40 days30-40 days

to seedto seed

Economy of Time

CornCorn ArabidopsisArabidopsis

Economy of Genes, Genome and DNAArabidopsis has smallest genome, vascular plants

48,000 genes 48,000 genes

10 chromosomes 10 chromosomes

~ 5 billion nucleotides~ 5 billion nucleotides

Much junk spacer DNAMuch junk spacer DNA

29,000 genes 29,000 genes

5 chromosomes 5 chromosomes

125 million nucleotides125 million nucleotides

small spacer DNAsmall spacer DNA AG TC

Arabidopsis = encapsulates the essence of all plants in a small package

First fully sequenced genome of any plantFirst fully sequenced genome of any plant

All genes mapped and isolatedAll genes mapped and isolated

Catalogue of genes can be ordered via mailCatalogue of genes can be ordered via mail

Knockouts of genes Knockouts of genes MUTATE THEM MUTATE THEM

Study the activity of 1000’s of genes Study the activity of 1000’s of genes

simultaneouslysimultaneously

Easy to genetically engineerEasy to genetically engineer

Used as a starting point to identify genes in other Used as a starting point to identify genes in other

plantsplants

ArabidopsisArabidopsis has facilitated the genetics of all plants has facilitated the genetics of all plants

Answer the question: What do the genes do?Answer the question: What do the genes do?

All of the genes in Arabidopsis have been found in other plants .

Amazing fact !

60% genes in plants have counterparts in human DNA60% genes in plants have counterparts in human DNA

Genes for …Basic cellular processesGenes for …Basic cellular processes

Energy production, ATPEnergy production, ATP

Cell divisionCell division

EnzymesEnzymes

Protein biosynthesis Protein biosynthesis

GGTTCCAAAAGTTTATTGGATGCCGTTTCAGTACATTTATCGTTTGCTTTGGATGCCCTAATTAAAAGTGACCCTTTCAAACTGAAATTCATGATACACCAATGGATATCCTTAGTCGATAAAATTTGCGAGTACTTTCAAAGCCAAATGAAATTATCTATGGTAGACAAAACATTGACCAATTTCATATCGATCCTCCTGAATTTATTGGCGTTAGACACAGTTGGTATATTTCAAGTGACAAGGACAATTACTTGGACCGTAATAGATTTTTTGAGGCTCAGCAAAAAAGAAAATGGAAATACGAGATTAATAATGTCATTAATAAATCAATTAATTTTGAAGTGCCATTGTTTTAGTGTTATTGATACGCTAATGCTTATAAAAGAAGCATGGAGTTACAACCTGACAATTGGCTGTACTTCCAATGAGCTAGTACAAGACCAATTATCACTGTTTGATGTTATGTCAAGTGAACTAATGAACCATAAACTTGGTCA

From DNA sequence (chemical) to Life

- Recombinant DNA technology

- Biochemistry

- Microscopy

- Molecular genetics

- Computers

Tools of molecular and cellular biology

Use these tools from an actual research project

• Complicated name: Complicated name:

What does it mean?What does it mean?

National Sciences Foundation (NSF) funds ABE:National Sciences Foundation (NSF) funds ABE:

““Functional Genomics of Protein Disulfide Isomerase Functional Genomics of Protein Disulfide Isomerase Gene Family: Unraveling Protein Folding and Gene Family: Unraveling Protein Folding and

Redox Regulatory Networks”Redox Regulatory Networks”

““Functional GenomicsFunctional Genomics of Protein Disulfide Isomerase of Protein Disulfide Isomerase Gene Family: Unraveling Protein Folding and Gene Family: Unraveling Protein Folding and

Redox Regulatory Networks”Redox Regulatory Networks”

Functional Genomics:Functional Genomics:

• New field of biological scienceNew field of biological science

• Rooted in GeneticsRooted in Genetics

• Genome:Genome: all of the genes encoded in DNA in a all of the genes encoded in DNA in a living organism.living organism.

• Function:Function: Research to figure out what the genes Research to figure out what the genes are doing. are doing.

• What proteins do they encode and what jobs in the What proteins do they encode and what jobs in the cell are they responsible for?cell are they responsible for?

What jobs do proteins do in a cell?What jobs do proteins do in a cell?

• 1. Structure: hold things up 1. Structure: hold things up

• 2. Enzymes: activity make and burn energy. 2. Enzymes: activity make and burn energy.

Stimulate growth and biomass production.Stimulate growth and biomass production.

• 1000’s different enzymes -> unique activities1000’s different enzymes -> unique activities

• Figure out their activities.Figure out their activities.

ENZENZA -----------> BA -----------> B

• Where the enzyme is located in the cell?Where the enzyme is located in the cell?

• Do they need other protein partners to do their job?Do they need other protein partners to do their job?

“Functional Genomics of Protein Disulfide Isomerase Gene Family: Unraveling Protein Folding and

Redox Regulatory Networks”

DNADNA

RNARNA

PROTEINPROTEIN

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Transcribed Transcribed

TranslatedTranslated

Making of a protein:Making of a protein: Converting the code in Converting the code in a polymer of nucleic acid to a polymer of amino acida polymer of nucleic acid to a polymer of amino acid

ENZYME: Protein Disulfide Isomerase = PDI

• Chain of amino acids representing a PDI.

• Disulfide: “Two sulfurs”

The amino acid containing sulfur is cysteine

Bond with 2 cysteines

|SH

|SH

|SH

ENZYME: Protein Disulfide Isomerase

• Isomer: Different molecules with same chemical formula.• Alter chemical bonding --> different “shapes” --> activities and functions.

•Isomerase: an enzyme that can make different molecular shapes out of the same substance.

•Disulfide Isomerase: emzyme that alters molecular shape by acting on the disulfide bonds.

PDI can make different protein shapes based on altered disulfide bonding

2 isomers with new activity !

|SH

|SH

|SH

-S-S-

|SH

-S

S- |

SH

OR

“Functional Genomics of Protein Disulfide Isomerase Gene Family: Unraveling Protein Folding and

Redox Regulatory Networks

Proteins do not do their job unless they are folded correctly

• So, PDIs fold other proteins correctly in cells.

• A major responsibility for keeping cells normal, development, metabolism and growth.

Protein Disulfide Isomerase (PDI) Gene Family

• Study all the PDIs in the genome of a small plant.

•All the PDIs in the same related family. • but they go off and have different jobs at various locations in the cell.

PDI Protein folding- oxidoreductase

PDI

= cys

Inactive state Active state

All proteins have to fold to proper states

• Oxidation Remove 2 electrons and 2 H+

2 cysteine sulfhydryls --> make disulfide bridge

• Reduction --> breaks bridge -->

– Add 2 electrons and 2 H+ to the 2 sulfhydryls

Chemical Mechanism REDOX

• But what about plants????

In Yeast and humans - PDIs located in the endoplasmic reticulum (ER)

Arabidopsis thaliana Plants

Primary structure of a generic PDI

Signal sequence

Directs a protein to a specific

location

Thioredoxin domains

Contains 2 cysteines and active catalytic site for oxidation-reduction and folding of proteins

ER retention motif

KDELC--C C--C

Research activities of workshop

Learn some recombinant DNA methods

Map genes that have been tagged by a T-DNA

Learn PCR and RT-PCR

Isolate proteins from leaves and detect proteins using antibodies

Use a microscope to find where PDIs and green fluorescent protein are located in the cell.

What kind of results might you expect?

Any kind of result is a success Learn by doing !!!

Have fun while you learn !

Nothing has to work perfectly to be a valuable learning experience.