Adaptation Mating Pheromone by G Protein p Subunits of ... · PDF filedia used for growing yeast (WD, SD) ... Correct orientation of the GPAI gene with re- gard to the PGKl promoter

Copyright 0 1994 by the Genetics Society of America

Control of Adaptation to Mating Pheromone by G Protein p Subunits of Saccharomyces cerevisiae

Anatoly V. Grishin, Jennifer L. Weiner and JSendall J. Blumer Department of Cell Biology and Physiology, Washington University School of Medicine, St. Louis, Missouri 631 10

Manuscript received June 10, 1994 Accepted for publication August 30, 1994

ABSTRACT The STE4 gene of the yeast Saccharomyces cerevisiae encodes the P subunit of a heterotrimeric G

protein that mediates response to mating pheromones and influences recovery from pheromone-induced growth arrest. To explore how G, subunits regulate response and recovery (adaptation), we isolated and characterized signaling-defective STE4 alleles ( STE4’d). STEPd mutations resulted in amino acid s u b stitutions in the N-terminal region of Ste4p, proximal to the first of seven repeat units conserved in G protein P subunits. Genetic tests indicated that STE4sd mutations disrupted functions of Ste4p required for inducing pheromone responses. Wild-type cells that overexpressed STEPd alleles displayed apparently normal initial responses to pheromone as judged by quantitative mating, G, arrest and transcriptional assays. However, after undergoing initial G, arrest, wild-type cells overexpressing STEPd alleles recovered more quickly from division arrest, suggestive of a hyperadaptive phenotype. Because hyperadaptation occurred when STE4sd alleles were overexpressed in cells lacking Sstlp (Barlp), Sst2p or the Gterminal domain of the a-factor receptor, this phenotype did not involve three principal modes of adaptation in yeast. However, hyperadaptation was abolished when STETd mutations were combined in cis with a deletion that removes a segment of Ste4p (residues 310-346) previously implicated in adaptation to pheromone. These results indicate that G, subunits possess two independent activities, one required for triggering pheromone response and another that promotes adaptation. Potential models for G, subunit- mediated adaptation are discussed.

H ETEROTRIMERJC guanine nucleotide-binding proteins (G proteins) consisting of a, p and sub-

units are ubiquitous transducers of signals between cell surface receptors and intracellular effectors in eukary- otic cells (GILMAN 1987; STRYER and BOURNE 1986). In the GDP-bound form G proteins are inactive, but upon binding GTP, G, subunits are activated and can disso- ciate from G,, dimers. Activated G, subunits have dual functions in signaling. They initiate signalling by regu- lating the activity of enzymes such as adenylyl cyclase or ion channels, and terminate signalling by hydrolyzing GTP and reassociating with G,, dimers.

G,, dimers also have multiple roles in signalling path- ways. Besides their role in promoting the formation of inactive G,,, complexes, G,, dimers in mammalian sys- tems regulate certain intracellular effectors, including adenylyl cyclase (FEDERMAN et al . 1992; INIGUEZ-LLUHI et al. 1992; TANG and GILMAN 1991; TAUSSIG et al . 1993) and phospholipase Cp (BLANK et al. 1992; BOYER et al . 1992; CAMPS et al . 1992; QTZ et al. 1992). Furthermore, G,, dimers can stimulate the activity and facilitate membrane localization of regulatory protein kinases that phosphorylate G protein-coupled receptors (HAGA and HACA 1992; PITCHER et al. 1992). In this way, G,, dimers may participate in processes that negatively regulate signalling by receptors, thereby promoting desensitization or adaptation mechanisms that blunt cellular responses.

Genetics 198 1081-1092 (December, 1994)

Genetic analysis of the mating pheromone response pathway in the yeast Saccharomyces cerevisiae under- scores the multiple regulatory roles of G protein subunits in cell-to-cell signalling. In yeast, G,, G, and G, subunit homologs are encoded, respectively, by the GPA1 ( D I E T Z E L ~ ~ ~ KURJAN 1987a; NAKAFUKU et al. 1987), STE4 and STEl8 genes (WHITEWAY et al. 1989). Because disruption of the GPA1 gene constitutively activates the pheromone response pathway (BLINDER et al . 1989; DIETZEL and KURJAN 1987a; MIYAJIMA et al . 1987) and overexpression of GPAI causes pheromone resistance (DIETZEL and KURJAN 1987a), G, subunits negatively regulate the response pathway. G,, dimers on the other hand activate the response pathway because overexpression of G, subunits (STE4 gene product) in wild-type cells evokes cellular responses characteristic of pheromone-treated cells, including arrest in the G, phase of the cell cycle (COLE et al . 1990; NOMOTO et al. 1990; WHITEWAY et al . 1990). Genetic analysis of signalingdefective G, subunits has led to the identifi- cation of STE20, which encodes a protein kinase homolog that apparently functions between G dimers and other signaling components downstream P, In the response pathway (LEBERER et al . , 1992a,b; SPRAGUE and THORNER 1992).

Yeast G, subunits also participate in adaptive processes that promote recovery from pheromone action. Deletion of a nonconserved region of Ste4p (residues

1082 A. V. Grishin, J. L. Weiner and IL J. Blumer

TABLE 1

S. cerevisiae strains

Strain Genotype Source or reference

WH102 MATa ade2 his3 lys2 ura3 leu2 SIKORSIU and HIETER (1989) YM2061 J57D

MATa ade2 his3 lys2 ura3 kssl Gal’ FLICK and JOHNSTON (1991) MATa ade2 his3 ura3 leu2 trpl can1

AG43 A. GRISHIN (unpublished)

J57D STE4D62N,A63T::LEU2 AG44

This study J57D STE4D62N::LEU2 This study

AG45 J57D STE4A56P::LEU2 AG46

This study J57D STE4A63S::LEU2 This study

AG47 J57D STE4D62H::LEU2 This study

AG48 MATa ade2 his3 ura3 leu2 trpl Gal’ This study AG38-18B ste4::URA3 This study

AG49 AG38-18B ste4::ura3 AG5 1

This study AG38-18B STE4D62N

AG52 This study

AG38-18B STE4D62N,A63T This study AG53 AG38-18B STE4A56P AG54

This study AG38-18B STE4A63S This study

AG55 AG38-18B STE4D62H AG56

This study AG3&18B sstIA

AG57 This study

AG3&18B sst2A This study AG58 AG38-18B ste2::LEU2 AG59

This study AG38-18B sstlA sst2A ste2::LEU2 This study

AG38-18B

310-346) abolishes signaling-induced phosphorylation of the protein, increases cellular sensitivity to pheromone severalfold, and delays recovery from pheromone- induced cell cycle arrest (COLE and REED 1991). Adaptive functions of G, subunits do not require the SST2 gene or the C-terminal domain of a mating pheromone (CY- factor) receptors (COLE and REED 1991), which regulate two principal modes of adaptation in yeast (CHAN and OTTE 1982; DIETZEL and KURJAN 1987b; KONOPKA et al. 1988; RENEE et al. 1988). Although the mechanism of G,-mediated adaptation is unknown, phosphorylation (or presence of the putative phosphorylation site) could inhibit the signaling activity of G, subunits, or enable G, subunits to induce an adaptation circuit.

To address how G, subunits promote recovery from pheromone action, we have isolated and characterized signalingdefective alleles of the STE4 gene (STE4”). G, subunits expressed from these STEPd alleles have been analyzed for their intrinsic ability to activate the pheromone response pathway, block signaling, or promote adaptation when overexpressed in wild-type cells or in mutants defective in known adaptation processes. Results of these studies suggest that yeast G, subunits act as positive elements that activate the pheromone response pathway and promote a genetically distinct adaptation process.

MATERIALS AND METHODS

Strains and media. Strains of S. cerevisiae used in this study are listed in Table 1. AG3&18B is a meiotic segregant obtained from cross between the MATa derivative ofJ57D and YM2061. Other strains were constructed in the course of this study. Me- dia used for growing yeast (WD, SD) have been described (SHERMAN 1991). YPGal and SGal media were the same as WD and SD, respectively, except that they contained 2% galactose and 0.1 % raffinose instead of glucose. Growth of cells in liquid

cultures was monitored by measuring turbidity with a Klett photocolorimeter.

Genetic methods, plasmids, mutagenesis and recombinant DNAmethods: Crosses and asci dissections were performed as described (SHERMAN and HICKS 1991). To disrupt the chromosomal STE4 allele, the 1.1-kb PstI-XhoI fragment of STE4 was cloned into Bluescript (Stratagene), and the URA3 marker on a BgZII fragment was inserted into a BgZII site in the STE4 coding region. The resultant plasmid (pAG4) cutwith PstI and XhoI was used for one-step gene replacement (ROTHSTEIN 1991). To enable transformation of the ste4::URA3 disruptant with URA3-marked plasmids, a Ura- derivative of the ste4::URA3 disruptant strain was selected on SD complete medium containing 0.1% 5fluoroorotic acid (5FOA). Disruption of chromosomal copies of the SST1 (using SalI/EcoRI-cut pJGsstl) and SST2 genes (using NheI-cut pBC14; W. COURCHESNE and J. THORNER, unpublished) was performed as described (RENEKE et al. 1988), and confirmed by phenotypic and complementation tests. To replace the chromosomal STE4 allele with various mutant alleles, STEPd coding sequences excised as 1.3-kb BamHI-Sua fragments from various pAG3STEPd plasmids (see below) were ligated with a BamHI/ SaZI-cut derivative of Bluescript that carried the LEU2 gene (a 2.2-kb SaZI-XhoI fragment containing the LEU2 gene was inserted in XhoI site of Bluescript). The resultant plasmids were cleaved at a unique PstI site in the STE4 coding region (this site is upstream of the mutations that we have identified), and integrated at the STE4 locus of the recipient strain J57D. In- tegration created a duplication of STE4 coding sequences that was separated by Bluescript sequences and the LEU2 gene: the upstream copy carried the STEPd allele joined to the STE4 promoter whereas the downstream wild-type STE4 coding region lacked a promoter. To obtain true replacements, the same integrations were made in a ste4:: URA3 strain (AG48), and then integration was reversed by selecting for 5-FOA- resistant Leu- colonies. Excision of integrated sequences re- stored the structure of the STE4 locus, leaving a mutation in the chromosome. All gene replacements and disruptions were confirmed by Southern blotting (SOUTHERN 1975) or polym- erase chain reactions.

The following plasmids were used to overexpress G protein subunits in yeast: G, subunit-pPGK-GPA 1 ( CEN PGK-GPA 1

Adaptive Role of Yeast G, Subunits 1083

TRPl); G, subunit-pAG3STE4( CEN GALl-STE4 HZS3) and pL19 (CEN GALl-STE4 URA3; WHITEWAY et al. 1990). pPGK-GPAl was constructed by cloning a 1.9-kb EcoRI fragment encompassing the GPAl gene into the EcoRI site of the PGKl promoter-terminator cassette (KANG et al. 1990) that had been introduced into pRS314 (CEN TRPl; SIKORSKI and HIETER 1989). Correct orientation of the GPAI gene with re- gard to the PGKl promoter was verified by restriction map ping. pAG3STE4 was constructed by ligating BamHI-SalI-cut pRS313 (CEN HZSR SIKORSKI and HIETER 1989) with a 2.2-kb Sau3A-SalI fragment from pL19, which contains the STE4 gene fused to GAL1 promoter. Derivatives of pL19 carrying STE4"d alleles were constructed by replacing the 1.3-kb BamHI-SalI STE4 fragment of pL19 with the corresponding fragments derived from various P A G ~ S T E ~ ' ~ plasmids. Plas- mid pyE106ste2A296 (CEN TRPl; RENEKE et al. 1988) was used to express a-factor receptors entirely lacking their Gterminal cytoplasmic domains.

To generate mutations in the STE4 gene, plasmid pAG3STE4 was treated with hydroxylamine as described (SIKORSKI and BOEKE 1991). Following hydroxylamine treat- ment, DNA was precipitated with isopropanol, dissolved in wa- ter and used directly for yeast transformation (IT0 et ul. 1983). Plasmid DNA was recovered from yeast and introduced into Escherichia coli by standard methods (PHILIPPSEN et al. 1991). The entire coding regions of STE4sd mutant alleles were se- quenced from double-stranded templates by using the Seque- nase kit (U.S. Biochemical Corp.) and oligonucleotide prim- ers synthesized according to the published STE4 sequence (WHITEWAY et al. 1989).

To delete codons 310-346 of the STE4 gene, a 0.48-kb HindIII-SalI fragment carrying the 3' portion of the STE4 gene from pL19 was first cloned in M13mp18 and then mu- tagenized in vitro by using the oligonucleotide TCTATEC- TACTTITT'CTTATCTAGACAACCAAGGC and the Amer- sham Version 2 mutagenesis kit. The structure of the deletion was confirmed by sequencing. To introduce the deletion into the STE4 coding region, the wild-type 0.48-kb HindIII-SalI fragment was replaced by the corresponding fragment carrying the deletion. Other recombinant DNA methods were performed as described (SAMBROOK et al. 1989).

Pheromone response and mating assays: MATa strains were scored as pheromone-resistant if cells plated or streaked at low density were able to form colonies on media containing synthetic a-factor (1 PM, Washington University Protein Chem- istry Laboratory). Assays of pheromone sensitivity (halo assays), qualitative and quantitative mating tests were performed as described by SPRAGUE (1991). For halo assays, approximately lo5 cells were suspended in 7 ml of molten top agar at 42", and the suspension was poured onto an SGal selective plate. After the agar solidified, sterile discs containing various amounts of a-factor were applied and plates were incubated at 30". For quantitative matings, lo7 cells of a strain to be tested and a fivefold excess of a mating type tester (strain YPH102) were mixed, placed on filters, and incubated 8 hr at 30" on WGal plates. Mating was scored by complementation of auxotrophic markers in diploids, and mating efficiencies were expressed relative to controls employing isogenic wild-type cells. For pheromone-induced growth arrest and recovery experiments, cells were grown overnight in SGal selective medium, inocu- lated into fresh SGal selective medium to approximately lo4 cells/ml and grown for 4 hr. a-Factor was then added to specified final concentrations. Viable cells were quantified at various times by plating appropriately diluted culture aliquots on WD plates. To quantify pheromone-induced expression from the FUSl promoter, cells containing the FUSI-lac2 plasmid pSL307 (McCAFFREY et al. 1987) were grown to log phase in

selective SGal media (Klett = 20); aliquots of the culture were either left untreated or treated with various specified concentrations of a-factor for 2 hr. PGalactosidase assays were performed by using permeabilized cells, as described by MILLER (1972). For morphological and culture density determinations, cells grown in liquid cultures were sonicated and fixed with formaldehyde. Photographs were taken under Nomarski optics (1OOX objective) using an Olympus BH2 microscope equipped with an Olympus OM-2.9 camera.

Immunoblotting methods: Cells overexpressing various STE4 alleles from pAG3STE4 derivatives were grown overnight in selective SGal liquid media. Overnight cultures were diluted into fresh SGal liquid media, own 6-8 hr at 30" until reaching mid logarithmic phase (10 F cells/ml), harvested by centrifugation and lysed by agitation with glass beads in sodium dodecyl sulfate-polyacrylamide gel electrophoresis sample buffer containing 8 M urea (RENEKE et al. 1988). Im- munoblotting methods employed rabbit polyclonal antisera raised against a TrpE-Ste4 fusion protein (J. HIRSCHMAN and D. JENNESS, unpublished), and an enhanced chemilumines cence detection system (Amersham Corp.).

RESULTS

Isolation, sequencing and initial characterization of STMSd mutations: Previous studies (COLE and REED,

1991; LEBERER et al. 1992a) have established that: (1) cells expressing G, subunits lacking residues 310-346 (a region required for pheromone-induced phosphorylation of the protein) respond to pheromone but are defective in adaptation; and (2) wild-type cells overexpressing signalingdefective G, subunits are pheromone- resistant (in this report, signalingdefective G, subunits refer specifically to mutant G, subunits that can associate with G, and G, subunits but are defective for inducing pheromone responses). These findings are consistent with at least two alternate models for Go-mediated adaptation: one in which the amino acids 310-346 of Ste4p are required for inhibiting the ability of Gay subunits to activate the pheromone response pathway, and a second in which the residues 310-346 are required for G,, subunits to promote adaptation, for example by inducing a hypothetical adaptation circuit or pathway.

We considered that models for G, subunit-mediated adaptation might be distinguished through further analysis of signalingdefective G, subunits, as follows. As- sume that pheromone-induced modification (presumably phosphorylation) of wild-type G, subunits within residues 310-346 inhibits the downstream signaling activity of G,, subunits. In this case, if signalingdefective G, subunits are overexpressed in wild-type cells, they may compete with wild-type G, subunits for a limiting pool of an essential signaling component, such as G, subunits or downstream effectors, and cause a signaling blockade. Accordingly, signaling blockade by this mechanism should occur whether o r not signalingdefective G, subunits possess residues 310-346. Alter- natively, assume that G, subunits have separable functional domains that are responsible for two activities, one that causes pheromone response and another that

1084 A. V. Grishin, J. L. Weiner and K J. Blumer

C

60 fAqNKAKHKiQDASLFQMAt!

70

STf4456P P ST€4D62H ST€4D62N r\ H

N STE4D62N,A63T N T STE4A63S S

FIGURE 1.-Amino acid sequences altered by STEFd mu@- tions. The seven G, repeats of Ste4p are shown as open boxes; filled boxes indicate sequences absent in mammalian G, subunits. A portion of the Ste4p sequence in a region proximal to the first G, repeat is shown in the single letter amino acid code; underlined are residues in this region that are conserved in Ste4p, mammalian P,, P2 and Drosophila melanogaster G, (GAUTAM and SIMON 1990). Residues affected by STEFd mutations are indicated. Numbers indicate amino acid positions of Ste4p beginning from the N terminus.

induces adaptation by a mechanism that requires residues 310-346 of Ste4p. In this instance, overexpression of signaling-defective (and presumably adaptation- proficient) G, subunits in wild-type cells might enhance recovery from pheromone action.

To isolate signaling-defective STE4 alleles we used an approach similar to that described by LEBERER et al. (1992a). STE4sd alleles were identified based on their ability to confer a pheromone-resistant phenotype when overexpressed in wild-type cells. Briefly, a plasmid (pAG3STE4) carrying the STE4 gene under the control of the inducible GAL1 promoter was treated with hydroxylamine i n v i t r o and introduced by transformation into wild-type MATa cells (AG38-18B). Pheromone- resistant transformants were selected on SGal plates containing M a-factor. Colonies that were pheromone- resistant under repressing conditions (glucose) were discarded because they presumably bear chromosomal ste or s i r mutations. Plasmids from colonies that were pheromone-resistant only under inducing conditions (galactose) were recovered in E. coli. Sequence analysis of six independently isolated STE4sd alleles revealed five mutations that resulted in the following amino acid substitutions (Figure 1): A56P (one isolate); D62N (two iso- lates) ; D62H (one isolate) ; D62N,A63T (double mutant, one isolate) and A63S (one isolate). All of these substitutions cluster proximal to the first of seven repeat units characteristic of G, subunits (Figure 1; GAUTAM and SIMON 1990), in one of the two regions defined previously (LEBERER et al. 1992a) as being important for signaling activity. Except for the D62N substitution, which was also described by LEBERER et al. (1992a), all of the mutations we have identified represent new STEPd alleles. We did not recover mutations that affect the second site described by LEBERER et al. (1992a), possibly because our screens were not exhaustive and C to T transitions produced by hydroxylamine mutagenesis in- frequently yielded appropriate mutations in this region.

To determine whether STE4sd mutations we have identified inactivate the signaling function of G, subunits, we replaced the chromosomal STE4 allele of two haploid strains (AG38-18B and J57D) with each of the five STEPd alleles, and evaluated the pheromone responsiveness of the resultant strains. As expected, cells expressing chromosomal STEPd alleles from the STE4 promoter as the sole source of GB subunits were sterile (mating efficiencies <lop5 of wild type), failed to undergo pheromone-induced cell cycle arrest, or to induce expression of a pheromone-responsive gene FUSl-lacZ (data not shown). In addition, each of five STEPd chromosomal replacements suppressed the haploid-lethal phenotype of a GPAl (G, subunit gene) disruption, as demonstrated by tetrad analysis (data not shown). Thus the phenotypes of cells bearing STEPd chromosomal replacements were similar to those of cells bearing ste4A mutations. These STEPd alleles therefore encoded signalingdefective G, subunits.

Although the phenotypes of STEPd replacements indicated a strong signaling defect, mutant G, subunits may nevertheless retain a residual degree of signaling activity. To explore this possibility, we overexpressed various STEqd alleles from the GAL promoter in a ste4A strain (AG49). Overexpression of STEPd alleles failed to cause constitutive growth arrest or to restore a significant level of pheromone responsiveness, as judged by assays of pheromone-induced growth arrest (halo assays; Figure 2), FUSl-lacZ expression and projection formation (data not shown). However, overexpression of STEPd alleles partially corrected the mating defect of ste4A mutants (Table 2). Mating was most efficient in cells that overexpressed either the STE4D62N or STE4D62N,A63T allele (6.4% and 2.5% of wild-type mating efficiency, respectively). ste4A cells overexpressing STE4A56P, STE4D62H or STE4A63S mated with much lower efficiencies (less than 0.02% of wild type). These results indicated that G, subunits encoded by STEPd alleles retain a low degree of residual signaling activity. In this respect, the STEPd alleles we have identified are similar to some of those previously described by LEBERER et al. (1992a).

Signal transduction in wild-type cells overexpressing STEPd alleles: To test whether the pheromone- resistant phenotype of wild-type cells overexpressing STEPd alleles was due to a signaling blockade, we first determined whether overexpression of STE4sd alleles in wild-type cells reduced the efficiency of mating and pheromone-induced transcription. Dose-response curves for pheromone-inducible expression of FUSl- lacZ provide a sensitive means of detecting reductions in signaling efficiency as small as threefold (WEINER et al. 1993), as indicated by shifts in dose-response curves to higher pheromone concentrations. Table 2 summarizes the results obtained from quantitative mating assays and assays of Pgalactosidase activity expressed from the


FIGURE 'L.--O\,crexprrssion of S7'1:'4"' alleles does not restore pheromone sensitivitv to s1~4;;UIU3 mutants. I l a l o assays were performed with wiltl-typr cclls (AG38-18B) carrying a control plasmid (pRS313) (left), and a slr4::URA3 mutant (AG48) carrying pAG3STE4D62N (middle) or a control plasmid (pRS313, right). Amounts of a-factor applied to discs (10, 2, 0.4, 0.08 and 0.016 pg) decrease clockwise from the top. SChl-histidine plates were incubated for 3 days at 30" before photographs were taken.

TABLE 2

Phenotypes conferred by overexpression of STE4" alleles

Host strain

FUSI-lac% expression Constitutive (Miller units) Relative

Overexpressed morphological mating ~ 7 x 4 ' ~ allele" changes Basal Induced efficiency

AG58-18R STI:4

AG49 st~4::ura3 None ' <5 <5 - STK4D62N - <5 <5 6.4X10-? STI.:4D62N,A63T - <5 <5 2.5x10-? STE4A56P - <5 <5 1 . 2 ~ 1 ~ ~ STK4D62H STE4A6JS - <5 <5 1.6x10-'

STP,'4D62H,AS10-346 - <5 <5 2.0x IO"#

None" - <5 510 1 .W1.:4D62N + 80 280 1 STfE4D62N,A63T + 80 280 1 STI~4A56P + 80 2.50 1 STIC4D62H + 70 250 0.58

- <5 <5 1.7X IO-'

STE4D62N,AS10-546 - <5 <5 6.8 X 10"

. Y ~ I ~ ~ A ~ S S + 80 250 0.66 S71;4D62N,AS10-346 + 80 280 NI) STlC4D62H,AS10-546 + 80 250 ND

AC58-18B [pPGKGPAI] STE4D62N - <5 N 1) ND <5 ND ND STL4D62H -

Mating efficiencies and Pgalactosidase levels are the averages of four independent determinations; standard errors were less than 20%. +, phenotype observed; -, phenotype not observed; ND, not determined.

" STX4'" alleles were overexpressed from pAG5SW4S" plasmids. 'Cells carrying the I.'USI-lar% reporter plasmid pSL307 were incubated 2 hr without a-factor (basal) with a-factor (10- '~) (induced). 'Control cells carried plasmid pR'jsIs.

FUS1-ladgene; representative dose-response curves for FUSI-lad induction are shown in Figure 3A. These results indicated that overexpression of STEP' alleles did not dramatically reduce the mating efficiency or maximal levels of pheromone-induced gene expression in wild-type cells (maximum FUSI-lad expression was -8590% of wild-type controls), in agreementwith a previous study (LE- RERER et al. 1992a). Moreover, they indicated that overexpression of STE4"' alleles failed to shift dose-response curves for FUSI-ladinduction to higher concentrations of pheromone. These data therefore provided an initial sug- gestion that pheromone responses are not blocked suk stantially in wild-type cells overexpressing S77F' alleles.

To further characterize phenotypes caused by overexpression of STE4"d alleles in wild-type cells, we deter-

mined the dose-response relationships for imposition of pheromone-induced growth arrest. Cells in liquid culture were treated with various concentrations of a-factor for 4 hr, and the fraction of G1-arrested (unbudded) cells was determined microscopically. Dose-response curves for control cells and cells overexpressing a SE4"' allele were essentially identical (Figure 3B), indicating that overexpression of S E P ' alleles neither blocked pheromoneinduced cell cycle arrest, nor shifted the dose- response curve to higher pheromone concentrations.

Because a signal blockade was not evident in short- term assays of pheromone response (transcriptional induction and cellcycle arrest), the ability of wild-type cells overexpressing STE4"" alleles to form colonies in the presence of high concentrations of pheromone may

1086 A. V. Grishin, J. L. Weiner and K. J. Blumer

400

c x A .-

-10 -9 -8 -7 -6 -5 log ([a-factor] MI

20' -10 -9 -8 -7 -6

log([a-factor] M)

FIGURE 3.-Effects of STE4sd allele overexpression on pheromone-induced transcription and pheromone-induced cell cycle arrest in wild-type cells. (A) Wild-type cells (AG38- 18B) carrying the FUS1-lac2 reporter plasmid pSL307 and pRS313 (control, squares), pAG3STE4D62N (diamonds) or pAG3STE4D62H (circles) were grown in SGal-histidine-uracil to early log phase (Nett = 20) and treated for 2 hr with a-factor at the indicated concentrations. malactosidase activity was measured in permeabilized cells as described (MILLER 1972). Similar results were obtained with the sstl strain AG56, except that higher basal levels of FUSI-lucZ expression were observed in cells overexpressing STE4'd alleles (not shown). (B) An sstl mutant (AG56) carrying pRs313 (squares), or pAG3STE4D62H (diamonds) was grown in SGal-histidine medium (Nett = 20), treated for 4h with the indicated concentrations of a-factor, sonicated, and fixed with formaldehyde. Budded and unbudded cells were counted by using a hemo- cytometer. The curves represent averages of two determinations for each of two independent transformants. Vertical bars show standard errors.

be acquired, under the conditions we have used, after initial responses have occurred. However, it is also possible that short-term responses to pheromone would also be blocked if S T E P d alleles were overexpressed at significantly higher levels.

Genetic evidence that mutant G, subunits can associate with G, and G, subunits: In the course of con- ducting transcriptional induction experiments we noted that wild-type cells overexpressing any of the five S T E P d alleles had elevated basal expression of the FUSl-lac2 reporter (approximately 25% of the fully induced level, Figure 3A; Table 2). Because this phenotype was observed in the absence of exogenously added a-factor, it

None

D62H D62H; GPAI

D62H,A3 1 0-346 +a-factor FIGURE 4.-Morphological phenotypes caused by overex-

pression of STEP' alleles in wild-type cells. Wild-type cells (AG38-18B) overexpressing the indicated STE4* alleles from pAG3STE4 derivatives alone or in combination with GPAl from pPGK-GPA 1 were grown in selective medium under inducing conditions (galactose) to mid-log phase, concentrated, fixed and photographed at the same magnification. Wild-type cells in the lower left panel overexpressed G subunits bearing the D62N substitution and a deletion of residgues 310-346. The lower right panel shows wild-type control cells treated 12 hr with a-factor M).

appeared to reflect a partial constitutive activation of the pheromone response pathway. This partial constitutive activation was also evident because wild-type cells overexpressing STE4sd alleles (D62N or D62H) frequently (1030% of cells in the culture) were large and dis- torted, which resembled the appearance of cells chroni- cally treated with a-factor (Figure 4). Furthermore, cells overexpressing STE4sd alleles grew somewhat more slowly than control cells (generation times in selective SGal medium 260 and 190 min, respectively), presumably because of these morphological abnormalities. However, partial constitutive activation of the signaling pathway did not significantly delay progression through the G, phase of the cell cycle, as judged by the fraction of unbudded cells in the culture (32-40% for both control cells and cells overexpressing STEPd alleles).

Adaptive Role of Yeast GB Subunits 1087

FIGURE 5.-Halo phenotypes of cells overexpressing S7'1:4"' alleles. Wild-type cells (AGS8-18R) carrying a control plasmid (pRS313, left), a plasmid for overexpressing S 7 E P ' allele (pAG3ST1:'4D62H; middle), or a plasmid for overexpressing a double mutant STE4 allele (pAG3STE4D62H,A310-346; right) were analyzed by halo assay as described in legend to Figure 2.

The partial constitutive signaling phenotype of wild- type cells overexpressing STE4" alleles could be due to competition between mutant and wild-type G,, dimers for a limiting amount of G, subunits. As a consequence, wild-type G,, dimers would be liberated that partially activate the response pathway. Consistent with this possibility, we found that partial constitutive activation of the response pathway occurred when STE4" alleles were overexpressed in wild-type cells but not in the ste4A strain AG49 (Table 2 ) . Furthermore, overexpression G, subunits (from plasmid pPGK-GPAl) suppressed the constitutive pathway activation phenotype, as judged by morphological criteria (Figure 4) and basal FUSl-lucZ expression (Table 2 ) . These results therefore suggested that mutant G, subunits can associate with G, and G, subunits, a conclusion that remains to be tested biochemically.

Adaptation in wild-type cells overexpressing STE4" alleles: Although wild-type cells overexpressing STE4" alleles apparently do not experience a dramatic block in initial signaling efficiency, their profound pheromone- resistant phenotypes may reflect an unusually strong adaptive capacity that enables them to recover more readily from pheromone-induced G, arrest. To test this idea, we studied adaptation in cells overexpressing STE4" alleles by using halo assays, and by following the time course of recovery from pheromone-induced growth arrest. In halo assays, control cells and wild-type cells overexpressing STE4D62H gave rise to zones of pheromone-induced growth inhibition that were of similar diameter (Figure 5, although halo sizes repro- duced poorly in photographs). Similar halo phenotypes also resulted when wild-type cells overexpressed any of the other STEPd alleles (not shown). These results were consistent with observations that control cells and wild- type cells overexpressing STE4" alleles undergo division arrest at similar concentrations of pheromone.

In contrast to results obtained with wild-type controls, halos formed by wild-type cells overexpressing STE4" alleles were turbid. Although a turbid halo phenotype could imply that GI arrest was not fully imposed (KURJAN

1992), this possibility can be excluded because 4 hr after exposure to pheromone (>3 X lo-* M), essentially all cells in the population were arrested in GI, regardless of whether they overexpressed a STE4sd allele (Figure 3B). Alternatively, turbid halo phenotypes could imply that wild-type cells overexpressing STE4'" alleles recover, or adapt, rapidly from pheromone action.

To follow adaptation kinetics directly, we monitored the rate of recovery from pheromone-induced division arrest. For these experiments, a-factor M ) was added to logarithmically growing cultures of sstlA cells (control) and the same cells overexpressing a STE4sd allele. The kinetics with which cells underwent and recovered from growth arrest were determined by measuring the number ofviable cells (colony-forming units) present as a function of time. Figure 6 shows the results of experiments with control cells (AG56, an sstl mutant) and the same cells overexpressing the STE4D62H allele; similar results were obtained with cells overexpressing other STEP' alleles (not shown). Control cells and those overexpressing STE4D62H arrested with similar kinetics (cells overexpressing STEP' alleles arrested slightly more slowly because they grew more slowly). Dramatic differences were seen, however, in the rates of recovery from growth arrest. Whereas control cells remained arrested during the course of experi- ment (>34 hr after the addition of a-factor), cells overexpressing STEC' alleles resumed division 10-13h after the onset of pheromone-induced arrest. There- fore, these experiments indicated that wild-type cells overexpressing STEP' alleles initially arrest, but they recover more rapidly than control cells, a phenom- enon we term hyperadaptation.

Hyperadaptation cawed by overexpression of STE4'd alleles requires the segment of G, subunits previously implicated in adaptation: Prior studies have indicated that deleting residues 310-346 of wild-type Ste4p abolishes pheromone-induced phosphorylation of G, sub units and causes a modest adaptation defect without in- activating the signaling function of the protein (COLE and REED 1991). We therefore tested whether this region


.o i 69-

“ 1 I

0 10 20 30 40 Time (h)

FIGURE 6.-Imposition of and recovery from pheromone- induced growth arrest. An S S t l mutant (AG56) containing a control plasmid pRS313 (squares, diamonds) or pAG3STE4D62H (circles, triangles) was grown in SGal- histidine liquid medium at 30”. After a 4hr incubation (ar- row), cultures were split into halves; one half received a-factor (final concentration IO-* M; squares, circles), whereas the other half was untreated (diamonds, triangles). At 1-hr inter- vals, appropriately diluted aliquots were plated on YF’D plates to determine the number of viable cells present as a function of time. Colonies that appeared after a 2-day incubation at 30” were counted and scored for mating ability; non-maters were not detected (data not shown). Each curve represents the av- erage of data collected from three parallel cultures; the standard errors were within 20%. Cell viability of control cultures decreased slightly with time apparently because prolonged exposure to pheromone was toxic.

of signalingdefective G, subunits is required in cis for expression of the hyperadaptive phenotype in wild-type cells. If hyperadaptation is due to competition between wild-type and overexpressed mutant G, subunits for a components of the signaling pathway, such as G, subunits or downstream targets of GB, dimers, then wild- type cells overexpressing signalingdefective G, subunits lacking residues 310-346 might still be hyperadaptive. Alternatively, if residues 310-346 of G, subunits are required to induce an adaptive process, then deletion of this region of signalingdefective G, subunits should disrupt hyperadaptation.

To test these predictions, we constructed GAL-STE4 plasmids in which the D62N or D62H mutations were combined in cis with a deletion that removes codons 310-346. Halo assays were used to determine whether overexpression of these doubly mutant G, subunits in wild-type cells caused a hyperadaptive phenotype. Wild- type cells overexpressing the intragenic double mutant allele STE4D62H,A310-346 gave rise to clear halos (Figure 5, data for STE4D62N,A310-346 were similar and are not shown), indicating that hyperadaptation was disrupted. Moreover, wild-type cells overexpressing either of the two double mutant STE4 alleles were pheromone-sensitive because they failed to form colonies on plates containing IO-‘ M a-factor (data not shown). Thus, residues 310-346 in signalingdefective forms of Ste4p were required in cis for expression of the hyperadaptive phenotype.

rD d

0

m

‘? Y

a

30-

FIGURE 7.-Expression levels ofwild-type and mutant G, subunits. A ste4::URA3 strain (AG48) expressing the indicated STE4 alleles from pAG3STE4 derivatives were grown in SGal- histidine medium. Cell extracts (100 pg protein) resolved on 10% sodium dodecyl sulfate-polyacrylamide gels were trans- ferred to nitrocellulose and probed with polyclonal antiSte4p antibodies. Positions of protein size standards are indicated.

An inability to promote adaptation might simply indicate that the STE4”,A310-346 double mutant alleles encode completely nonfunctional G, subunits. How- ever, this possibility is unlikely because G, subunits expressed from STE4””,310-346 double mutant alleles apparently were able to compete with wild-type G, subunits for G, subunits and cause a partial constitutive signaling phenotype, as judged by cell morphology (Figure 4) and elevated basal expression ofFUS1-lacZ (Table 2). Therefore, residues 310-346 of signalingdefective G, subunits were dispensable for the constitutive activation phenotype, but they were required for expression of the hyperadaptive phenotype. These results also indicated that partial constitutive activation of the pheromone response pathway is insufficient to cause hyperadaptation.

Another possibility is that STE4”,A310-346 double mutant alleles failed to promote hyperadaptation because deletion of amino acids 310-346 potentiates the weak residual signaling activity of mutant G, subunits, and thereby counteracts adaptive processes. This expla- nation was unlikely because overexpressed STEPd and STE4’d,A310-346 alleles were similarly ineffective at complementing a ste4A mutation, as judged by quantitative mating assays (Table 2), as well as assays of pheromone-induced transcription, G, arrest and morphological changes (data not shown).

We also examined whether deletion of residues 310-346 of signalingdefective G, subunits might abol- ish the hyperadaptive phenotype by reducing the expression levels of mutant G, subunits. However, immunoblotting experiments (Figure 7) employing anti- Ste4p antibodies (a gift from J. HIRSCHMAN and D. JENNESS, unpublished) indicated that ste4:: URA3 strains expressing the wild-type STE4, STE4‘”, or the double mutant STE4””,310-346 alleles from the GAL promoter expressed similar levels of G, subunits.

Adaptive Role of Yeast G, Subunits

none

SSt l A

FIGURE 8.-SSTl, SST2 and the a-factor receptor Gterminal domain are dispensable for the pheromone-resistant phenotype caused by overexpression of a STE4'd allele. AG38-18B derivatives carrying the indicated mutations (horizontal rows) and either control the plasmid pRS313 (left) or pAG3STE4D62N (right) were used in halo assays as described in legend to Figure 2. To express Gterminally ste2A296 truncated receptors (ste2A296), the AG38-18B derivative bearing a ste2::LEU2 mutation (AG58) carried plasmid pYJE106ste28296; halo assayswith these cells were performed on SGal lacking histidine and tryptophan.

1089

STE4-D62N

Hyperadaptation conferred by overexpressed STE4'd alleles does not involve three major adaptation mechanisms in yeast: A further possibility we considered was that wild-type cells overexpressing STEqd alleles are hyperadaptive because the function of known adaptation mechanisms is emphasized or enhanced. This effect might occur if a certain balance normally exists between signaling and adaptation mechanisms, such that even small reductions in signaling capacity allow adaptation to occur more effkiently (KURJAN 1992). Accordingly, the hyperadaptive phenotype of cells overexpressing STE4sd alleles could be mediated through known adap tive processes.

To test this idea, we overexpressed STE4'd alleles in s s t l , sst2 and ste2A296 mutants. These mutants are supersensitive to a-factor because each of them is defective in one of the three major adaptive processes: a-factor degradation (carried out by the secreted protease Sstlp;

MACKAY et al. 1988), post-receptor adaptation (regulated by the SST2 gene product; BLINDER and JENNES 1989; DIETZEL and KURJAN 1987b), and receptor desensitization and endocytosis (mediated by the Gterminal domain of the a-factor receptor (STE2 gene product; KONOPKA et al. 1988; RENEKE et al. 1988). However, none of these mutations was able to suppress the hyperadap tive phenotype caused by overexpression of STEP' alleles, as judged by halo assays (Figure 8 shows results for D62H allele; results for other STEP' alleles were similar and are not shown). This observation agrees with data of LEBERER et al. (1992a), which indicate that the pheromone-resistant phenotype is expressed in wild- type cells as well as in sstl sst2 double mutants. We also constructed an sstl sst2 ste2A296 triple mutant that is defective for all three adaptive mechanisms. In this back- ground, overexpression of STE4d alleles still allowed cells to form colonies in the presence of pheromone


(1 PM; data not shown). Therefore the hyperadaptive phenotype caused by overexpression of STE4sd alleles does not require the three principal adaptive mechanisms in yeast. We therefore suggest that hyperadaptation is due to the ability of signaling-defective G, subunits to promote the function of a distinct adaptation process.

DISCUSSION

We have identified and characterized five signalingdefective alleles of the STE4 gene of S. cereuisiae, which encodes the p subunit of a heterotrimeric G protein that is required for response to mating pheromone. These mutations result in amino acid substitutions at positions 56, 62 and 63 in Ste4p, which are proximal to the first of seven repeat units characteristic of G protein p s u b units (GAUTAM and SIMON 1990). STE4sd mutations that affect this region, and other mutations that affect a region between repeat 2 and 3 of Ste4p, have been identified previously by others (LEBERER et al. 1992a). Ge- netic analysis described here and by LEBERER et al. (1992a) are in accord in two respects. First, G, subunits expressed from STE4sd alleles are signaling-defective. Second, mutant G, subunits are not completely nonfunctional because when they are overexpressed in wild- type haploid cells they confer a pheromone-resistant phenotype (cells form colonies at concentrations of pheromone that are 100-fold greater than those need to inhibit growth of wild-type cells). Two independent a p proaches have therefore yielded functionally similar, and in one case identical (STE4D62N), STE45d alleles.

A significant distinction exists, however, between our studies and those of LEBERER et al. (1992a) concerning potential mechanisms whereby overexpression of STE4'* alleles causes a pheromone-resistant phenotype in wild-type cells. Resolution of this issue is important for understanding how G, subunits control pheromone response and adaptation. LEBERER et aZ. (1992a) suggest that pheromone resistance could be explained in two ways. First, overexpression of mutant G, subunits in wild- type cells might interfere with signaling for growth arrest while permitting signaling for transcriptional induction and morphological alterations, as might occur if G,, dimers have distinct effectors for transmitting signals for growth arrest us. other aspects of mating. Second, overexpression of mutant G, subunits in wild-type cells could reduce a single signal to a level that is sufficient for inducing pheromone-responsive genes, morphological changes and mating, but is insufficient for causing normal growth arrest. However, neither of these models is consistent with the results we have obtained from division arrest, transcriptional induction and mating assays, which failed to indicate significant reductions in initial pheromone responsiveness.

Accordingly, we suggest that wild-type cells overexpressing STE4Sd alleles are pheromone resistant specifi-

cally because they have an increased capacity to recover from pheromone action. Indeed, physiological assays described here (halo assays and recovery from growth arrest experiments) indicate that wild-type cells overexpressing Si'Wsd alleles acquire a pheromoneresistant phenotype after they have mounted an initially normal response to pheromone, the hallmark of an adaptive process.

How might overexpression of STE45d alleles promote adaptation in wild-type cells? At least three possibilities can be suggested. First, overexpression of signalingdefective G, subunits might cause a signaling blockade that is evident once cells induce known adaptation processes. We do not currentlyfavor this hypothesis because overexpression of STE4sd alleles causes pheromone resistance in s s t l , s s t 2 and ste2A296 mutants, which are defective for three major adaptive mechanisms in yeast (pheromone proteolysis, post-receptor desensitization, and receptor desensitization and endocytosis). Further- more, expression of the hyperadaptive phenotype does not require MSG5 (A. GRISHIN, unpublished data), which encodes a protein tyrosine phosphatase that can control adaptation to pheromone (Do1 et al. 1994). In this respect, hyperadaptation promoted by overexpression of STE45* alleles is distinct from enhanced recovery promoted by overexpression of the GPA1 vu150 allele (MIYAJIMA et al. 1989), because only the latter process is affected by an msg5 mutation (DOI et al. 1994).

In a second model, overexpression of STE4'* alleles could cause hyperadaptation because it results in partial constitutive activation of the pheromone response pathway that could induce an as yet unknown adaptation process. This possibility seems unlikely because overexpression of double mutant forms of G, subunits ( STE4"d,A310-346) causes a partially constitutive signaling phenotype, but not hyperadaptation.

We currently favor a third model in which G, subunits are proposed to have two independent activities, one for inducing the pheromone response pathway and another for triggering adaptation. Consistent with this idea, signaling and adaptation functions of G, subunits are genetically separable: STE4'* alleles encode signalingdefective but adaptation-proficient G, subunits, whereas the STE4A310-346 allele expresses signaling-proficient but adaptationdefective G, subunits. Moreover, these two functions involve different regions of the G, subunit. Missense mutations that disrupt signaling affect amino acids proximal to the first of seven repeat units, or between repeats 2 and 3 (this study; LEBERER et al. 1992a), whereas a deletion that disrupts the adaptation function of G, removes a nonconserved region between repeats 5 and 6 (COLE and REED 1991).

Possible mechanisms for G, subunit-mediated adaptation in yeast can be considered in light of the ways that G, subunits can promote adaptation in mammalian cells. G,, dimers are thought to promote membrane localization and activation of protein kinases such as


PARK, that desensitize G protein-coupled receptors by phosphorylating their cytoplasmic Gterminal domains (HAGA and HACA 1992; PITCHER et al. 1992). However, this mechanism is excluded because results described here and elsewhere (COLE and REED 1991) indicate that Gpubunit mediated adaptation occurs independently of desensitization events that involve phosphorylated C-terminal cytoplasmic domains of pheromone receptors. GBmediated adaptation in yeast may therefore involve other kinds of regulatory mechanisms.

We propose two speculative mechanisms for G, subunit-mediated adaptation in yeast, although other models are also possible. First, depending on their modification state, G,, subunits might be capable of activating or inhibiting a component of the pheromone response pathway. Initially, G,, subunits would interact produc- tively with a signaling component to induce pheromone response. After initial responses have occurred, modified G,, subunits (for example, by phosphorylation) would accumulate and inhibit the signaling effector. In a second model, GPr subunits are proposed to have two targets with physiologically opposing functions, one for inducing pheromone response and another for triggering adaptation. Activation of the adaptation target or pathway would be favored as cells accumulate modified G,, subunits. These models can be distinguished by identifjmg the molecules involved in G,aubunit- mediated adaptation. To this end we have recently isolated several mutants in which overexpression of STEPd alleles fails to cause a hyperadaptive phenotype (M. ROTHENBERG, A. V. GRISHIN and K J. BLUMER, unpublished). Analysis of these mutants is in progress.

We thank W. ~ U R C H E S N E , P. HIETER, M. JOHNSTON, K MATSUMOTO, J. THORNER and M. WHmwAYfor @ts of strains and plasmids, D. JENNFSS for anti4te.l~ antibodies, and our colleagues who provided comments on the manuscript. This work was supported by National Institutes of Health grant GM44592 and the Lucille Markey Charitable Trust (to K.J.B).

LITERATURE CITED

BLANK, J. L., IC A. BRAITAIN and J. H. EXTON, 1992 Activation of cy- tosolic phosphoinositide phospholipase C by Gprotein fly subunits. J. Biol. Chem. 267: 23069- 23075.

BLINDER, D., and D. D. JENNESS, 1989 Regulation of postreceptor signaling in the pheromone response pathway of Saccharomyces cereuisiae. Mol. Cell. Biol. 9: 3720-3726.

BLINDER, D., S. BOUVIER and D. D. JENNESS, 1989 Constitutive mutants in the yeast pheromone response: Ordered function of the gene products. Cell 56: 479-486.

BOER, J. L., G. L. WALDO and T. K H A R D E N , 1992 Pysubunit activation of Gprotein-regulated phospholipase C. J. Biol. Chem.

CAMPS, M., A. CAROZZI, P. SCHNABEL, A. SCHEER, P. J. PARKER et al . , 1992 Isozyme-selective stimulation of phospholipase (32 by G protein Pr subunits. Nature 360 684-686.

CHAN, R. IC, and C. O m , 1982 Isolation and genetic analysis of S. cereuisiae mutants supersensitive to G, arrest by a-factor and a-factor pheromones. Mol. Cell. Biol. 2: 11-20.

COLE, G. M., and S. I. REED, 1991 Pheromone-induced phosphorylation of a G protein P subunit in s. cereuisiae is associated with an adaptive response to mating pheromone. Cell 6 4 703-716.

COLE, G. M., D. E. STONE and S. I. REED, 1990 Stoichiometry of G protein subunits affects the Saccharomyces cereuisiae mating

267: 25451-25456.

pheromone signal transduction pathway. Mol. Cell. Biol. 10:

DIETZEL, C., and J. KURJAN, 1987a The yeast SCGI gene: a G,-like protein implicated in the a- and a-factor response pathway. Cell 5 0 1001-1010.

DIETZEL, C., and J. KURJAN, 1987b Pheromonal regulation and sequence of the Saccharomyces cereuisiae SST2 gene: a model for desensitization to pheromone. Mol. Cell. Biol. 7: 4169- 4177.

Dor, IC, A. GARTNER, G. AMMERER, B. ERREDE, H. SHINKAWA et al., 1994 A protein tyrosine phosphatase promotes adaptation to pheromone in S. cereuisiae. EMBO J. 13: 61-70.

FEDERMAN, A. D., B. R. CONCLIN, IC A. SCHRADER, R. R REED and H. R. BOURNE, 1992 Hormonal stimulation of adenylyl cyclase through G,protein Py subunits. Nature 356 154 161.

FLICK, J. S., and M. JOHNSTON, 1991 GRRI of Saccharomyces cereuisiae is required for glucose repression and encodes a protein with leucine-rich repeats. Mol. Cell. Biol. 11: 5101-5112.

GAUTAM, N., and M. SIMON, 1990 P subunits of G proteins, pp. 371- 380 in ADP-ribosylating Toxins and G Proteins: Insights into Signal Transduction, edited by J. Moss and M. VAUGHAN. Ameri- can Society for Microbiology, Washington, D.C.

GILMAN, A,, 1987 G proteins: transducers of receptorgenerated signals. Annu. Rev. Biochem. 5 6 615-649.

HAGA, K., and T. HAGA, 1992 Activation by G protein Py subunits of agonist- or lightdependent phosphorylation of muscarinic acetylcholine receptors and rhodopsin. J. Biol. Chem. 267:

INIGUEZ-LLUHI, J. A,, M. I. SIMON, J. D. ROBISHAW and A. G. GILMAN, 1992 G protein Py subunits synthesized in Sf9 cells. Functional characterization and the significance of prenylation of y. J. Biol. Chem. 267: 23409-23417.

ITO, H., Y. FUKUDA, K MURATA and A. KIMURA, 1983 Transformation of intact yeast cells treated with alkali cations. J. Bacteriol. 153:

KANG, Y.-S., J. KANE, J. KURJAN, J. M. STADEL and D. J. TIPPER, 1990 Ef- fects of expression of mammalian G,, and hybrid mammalian- yeast G, proteins on the yeast pheromone response signal tranc duction pathway. Mol. Cell. Biol. 1 0 2582-2590.

KATZ, A., D. WU and M. I. SIMON, 1992 Subunits Py of heterotrimeric G protein activate p2 isoform of phospholipase C. Nature 360

KONOPKA, J. B., D. D. JENNESS and L. H. HARTWELL, 1988 The Cterminus of the S. cereuisiae a-pheromone receptor mediates an adaptive response to pheromone. Cell 54: 609-620.

KURJAN, J., 1992 Pheromone response in yeast. Annu. Rev. Biochem.

LEBERER, E., D. DIGNARD, L. HOUGAN, D. Y. THOMAS and M. WHITEWAY, 1992a Dominant-negative mutants of yeast G protein P subunit identify two functional regions involved in pheromone signaling.

LEBERER, E., D. DIGNARD, D. HARCUS, D. Y. THOMAS and M. WHITEWAY, 1992b The protein kinase homologue Ste2Op is required to link the yeast pheromone response G protein beta gamma subunits to downstream signaling components. EMBO J. 11: 4815-4824.

MACKAY, V. L., S. K. WELCH, M. Y. INSLEY, T. R. MANNEY, J. HOLLY et al., 1988 The S. cereuisiae BAR1 gene encodes an exported protein with homology to pepsin. Proc. Natl. Acad. Sci. USA 85: 55-59.

M C ~ R E Y , G., F. J. CLAY, K &Emand G. F. SPRAGUE, JR., 1987 Iden- tification and regulation of a gene required for cell fusion during mating of the yeast Saccharomyces cereuisiae. Mol. Cell. Biol. 7:

MILLER, J., 1972 Experiments in Molecular Genetics. Cold Spring Har- bor Laboratory, Cold Spring Harbor, N.Y.

MIYAJIMA, I., M. NAKAFUKU, N. NAKAYAMA, C. BRENNER, A. MIMJIMA et al . , 1987 GPAI: a haploid-specific essential gene, encodes a yeast homolog of mammalian G protein which may be involved in mating factor signal transduction. Cell 50: 1011-1019.

MIYAJIMA, I., K ARAI and K. MATSUMOTO, 1989 GPAI"""' mutation in the mating-factor signaling pathway in Saccharomyces cereuisiae. Mol. Cell. Biol. 9: 2289-2297.

MOORE, S. A., 1983 Comparison of dose-response curves for a-factor-induced cell division arrest, agglutination and

510-517.

2222-2227.

163-168.

686-689.

61: 1097-1129.

EMBO J. 11: 4805-4813.

2680-2690.

projection formation of yeast a cells. J. KGl. Chem. 258: 13849-13856.


NAKAFUKU, M., H. HOH, S. NAKAYAMA and Y. KAZIRO, 1987 Occurrence in Saccharomyces cerevisiae of a gene homologous to the cDNA coding for the (Y subunit of mammalian G proteins. Proc. Natl. Acad. Sci. USA 84: 2140-2144.

NOMOTO, S. N., N. NAKAYAMA, K. ARAI and K. MATSUMOTO, 1990 Regu- lation of the yeast pheromone response pathway by G protein subunits. EMBO J. 9: 691-696.

PHILIPPSEN, P., A. STOTZ and C. SCHERF, 1991 DNA of Saccharomyces cerevisiae. Methods Enzymol. 194 169-181.

PITCHER, J. A., J. INGLESE, J. B. HIGGINS, J. L. ARRIZA, P. J. C U E Y et al . , 1992 Role of Py subunits of G proteins in targeting the p- ad- renergic receptor kinase to membrane-bound receptors. Science

RENEKE, J. E., K. J. BLUMER, W. E. COURCHESNE and J. THORNER, 1988 The carboy-terminal segment of the yeast a-factor receptor is a regulatory domain. Cell 55: 221-234.

ROTHSTEIN, R., 1991 Targeting, disruption, replacement and allele rescue: integrative DNA transformation in yeast. Methods Enzy- mol. 194: 281-301.

SAMBROOK, J., E. F. FRITSCH and T. MANIATIS, 1989 Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.

SHERMAN, F., 1991 Getting started with yeast. Methods Enzymol. 194

SHERMAN, F., andJ. B. HICKS, 1991 Micromanipulation and dissection of yeast asci. Methods Enzymol. 194 21-37.

SIKORSKI, R. S., and J. D. BOEKE, 1991 In vitro mutagenesis and plasmid shuffling: from cloned gene to mutant yeast. Method Enzy- mol. 194 302-318.

SIKORSKI, R. S., and P. HIETER, 1989 A system of shuttle vectors and yeast host strains for efficient manipulation of DNA in Saccha- romyces cerevisiae. Genetics 122: 19-27.

257: 1264-1267.

3-20.

SOUTHERN, E. M., 1975 Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98: 503-517.

SPRAGUE, G. F., JR., 1991 Assay of yeast mating reaction. Methods Enzymol. 194: 77-93.

SPRAGUE, G. F., JR., andJ. W. THORNER, 1992 Pheromone response and signal transduction during the mating process of Saccharomyces cerevisiae, pp. 657-744 in The Molecular and Cellular Biology of the Yeast Saccharomyces,Vol. 2, edited hy E. W. JONES, J. R. PIUNCLE and J. R. BROACH. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.

STRYER, L., and H. BOURNE, 1986 G proteins: a family of signal transducers. Annu. Rev. Cell Biol. 2 391-419.

TANG, W.-J., and A. G. GILMAN, 1991 Type-specific regulation of adenylyl cyclase by G protein Py subunits. Science 254 1500-1503.

TAUSSIG, R., L. M. QUARMBY and A. G. GILMAN, 1993 Regulation of purified type I and type I1 adenylyl cyclases by G protein Py s u b units. J. Biol. Chem. 268: 9-12.

WEINER, J. L., C. GUTTIEREZ-STEIL and K J. BLUMER, 1993 Disruption of recept0r-G protein coupling in yeast promotes the function of an SSTZdependent adaptation pathway. J. Biol. Chem. 268: 8070-8077.

WHITEWAY, M., L. HOUGAN, D. DIGNARD, D. Y. THOMAS, L. BELL et al., 1989 The STE4 and STEIB genes encode potential P and y subunits of the matingfactor receptorcoupled G protein. Cell 56: 467-477.

WHITEWAY, M., L. HOUGAN and D. Y. THOMAS, 1990 Overexpression of the STE4 gene leads to mating response in haploid Saccharomyces cerevisiae. Mol. Cell. Biol. 10: 217-222.

Communicating editor: F. WINSTON

Documents

Adaptation Mating Pheromone by G Protein p Subunits of ... · PDF filedia used for growing yeast (WD, SD) ... Correct orientation of the GPAI gene with re- gard to the PGKl promoter