Adenosine Deaminase Inhibition Prevents Clostridium ...As blocking adenosine deaminase can elevate the adenosine concentration in biological systems, the objective of this study was

INFECTION AND IMMUNITY, Feb. 2011, p. 653–662 Vol. 79, No. 20019-9567/11/$12.00 doi:10.1128/IAI.01159-10Copyright © 2011, American Society for Microbiology. All Rights Reserved.

Adenosine Deaminase Inhibition Prevents Clostridium difficile ToxinA-Induced Enteritis in Mice�

Ana Flavia Torquato de Araujo Junqueira,2 Adriana Abalen Martins Dias,3 Mariana Lima Vale,2Graziela Machado Gruner Turco Spilborghs,3 Aline Siqueira Bossa,3

Bruno Bezerra Lima,2 Alex Fiorini Carvalho,3 Richard Littleton Guerrant,4Ronaldo Albuquerque Ribeiro,2 and Gerly Anne Brito1*

Department of Morphology, Faculty of Medicine, Federal University of Ceara, Ceara, Brazil1; Department of Physiology andPharmacology, Faculty of Medicine, Federal University of Ceara, Ceara, Brazil2; Hospital AC Camargo,

Sao Paulo, Brazil3; and Center for Global Health, Division of Infectious Diseases and International Health,University of Virginia School of Medicine, Charlottesville, Virginia4

Received 26 April 2010/Returned for modification 5 October 2010/Accepted 12 November 2010

Toxin A (TxA) is able to induce most of the classical features of Clostridium difficile-associated disease inanimal models. The objective of this study was to determine the effect of an inhibitor of adenosine deaminase,EHNA [erythro-9-(2-hydroxy-3-nonyl)-adenine], on TxA-induced enteritis in C57BL6 mice and on the geneexpression of adenosine receptors. EHNA (90 �mol/kg) or phosphate-buffered saline (PBS) was injectedintraperitoneally (i.p.) 30 min prior to TxA (50 �g) or PBS injection into the ileal loop. A2A adenosine receptoragonist (ATL313; 5 nM) was injected in the ileal loop immediately before TxA (50 �g) in mice pretreated withEHNA. The animals were euthanized 3 h later. The changes in the tissue were assessed by the evaluation of ilealloop weight/length and secretion volume/length ratios, histological analysis, myeloperoxidase assay (MPO), thelocal expression of inducible nitric oxide synthase (NOS2), pentraxin 3 (PTX3), NF-�B, tumor necrosis factoralpha (TNF-�), and interleukin-1� (IL-1�) by immunohistochemistry and/or quantitative reverse transcrip-tion-PCR (qRT-PCR). The gene expression profiles of A1, A2A, A2B, and A3 adenosine receptors also wereevaluated by qRT-PCR. Adenosine deaminase inhibition, by EHNA, reduced tissue injury, neutrophil infiltra-tion, and the levels of proinflammatory cytokines (TNF-� and IL-1�) as well as the expression of NOS2,NF-�B, and PTX3 in the ileum of mice injected with TxA. ATL313 had no additional effect on EHNA action.TxA increased the gene expression of A1 and A2A adenosine receptors. Our findings show that the inhibitionof adenosine deaminase by EHNA can prevent Clostridium difficile TxA-induced damage and inflammationpossibly through the A2A adenosine receptor, suggesting that the modulation of adenosine/adenosine deami-nase represents an important tool in the management of C. difficile-induced disease.

Clostridium difficile is the most common cause of nosocomialbacterial diarrhea and accounts for 10 to 20% of the cases ofantibiotic-associated diarrhea (3, 27). C. difficile infection canresult in asymptomatic carriage, mild diarrhea, or fulminantpseudomembranous colitis (31). Increased incidence, severity,and mortality associated with C. difficile infection has beenreported worldwide, being the attributable cause of death in upto 6.9% of cases (4, 28). The increased incidence and severityof C. difficile-induced disease has been accredited to the emer-gence of a new strain called NAP1/BI/027, which has beenshown to produce �16-fold more toxin A (TxA) and 23-foldmore toxin B in vitro (53).

Although a recent report using toxin A or toxin B mutants ofC. difficile showed that toxin B, not toxin A, is an essentialvirulence factor for the development of the disease after in-fection (35), purified toxin A still is used extensively in animalmodels of enteritis, since it clearly induces most of the classicalfeatures of the disease in animal models. TxA causes intestinal

secretion, the destruction of the intestinal epithelium, andhemorrhagic colitis when introduced in vivo to the intestinallumen (25, 42). The mechanism of TxA-induced enteritis in-volves toxin binding to enterocyte receptors, leading to theactivation of sensory and enteric nerves that results in en-hanced intestinal secretion and motility, the degranulation ofmast cells, and the infiltration of the mucosa by neutrophils (9,27, 39). In addition to its proinflammatory and prosecretoryactivities, TxA induces cell death in human and murine cells,which could contribute to intestinal mucosal disruption (7, 10).

PTX3 is a soluble protein belonging to the pentraxin super-family that is highly conserved in evolution. Unlike the classicalshort pentraxins (CRP and SAP), PTX3 is produced locally atthe sites of infection and inflammation by a variety of celltypes, including fibroblasts, endothelial cells, mononuclearphagocytes, and myelomonocytic dendritic cells, in response toproinflammatory signals, such as tumor necrosis factor alpha(TNF-�), interleukin-1� (IL-1�), and Toll-like receptor ago-nists (14, 32). Since PTX3 plays a pivotal role in innate resis-tance to many infectious agents (particularly fungi) (13, 18)and in the orchestration of the inflammatory response (12, 48),in this study we also investigated the involvement of PTX3 inTxA-induced enteritis.

It is well known that the expression of inducible nitric oxidesynthase (NOS2) is stimulated in a variety of cells by inflam-

* Corresponding author. Mailing address: Departamento de Morfo-logia–Faculdade de Medicina da Universidade Federal do Ceara, RuaDelmiro de Farias, sn-CEP 60.416-030, Fortaleza, Ceara, Brazil.Phone: 55 85 3366 8588. Fax: 55 85 3366 8333. E-mail: [email protected].

� Published ahead of print on 29 November 2010.

653

on January 25, 2021 by guesthttp://iai.asm

.org/D

ownloaded from

http://iai.asm.org/

matory cytokines, such as TNF-�, IL-1�, and gamma inter-feron (IFN-�), resulting in the production of high levels of NO,which is involved in the pathogenesis of several inflammatorydiseases (26, 33). Because TxA is a potent inducer of inflam-matory cytokines, as is shown here, it is reasonable to proposethat NO produced by NOS2 has a role in the pathogenesis ofTxA-induced damage. Since the role of NO on TxA-induceddamage still is ambiguous, we evaluated the expression ofNOS2 in murine ileal loops treated with TxA and the effect ofEHNA on this expression.

Adenosine is an endogenous purine nucleoside that, follow-ing its release from cells or after being formed from the break-down of nucleotides, diffuses to the plasma membranes ofsurrounding cells, where it binds to specific cell surface recep-tors (17, 41). Four types of G protein-coupled adenosine re-ceptors (A1AR, A2AAR, A2BAR, and A3ARs) were identified(17). Although adenosine is constitutively present in the extra-cellular space at low concentrations, metabolic stress condi-tions dramatically increase its levels (21).

The binding of adenosine to its receptors on the neutrophilsurface may produce either proinflammatory or anti-inflam-matory effects, depending on its concentration and the types ofreceptors stimulated. A1AR engagement induces a proinflam-matory response, such as an increase in neutrophil adhesion,recruitment, and phagocytosis. On the other hand, the bindingof adenosine to A2AARs results in anti-inflammatory effects,including the decreased neutrophil release of reactive oxygenspecies (10, 11, 51). A2BAR has a role as a modulator ofinflammatory cytokines, adhesion molecules, leukocyte adhe-sion, and mast cell activation (24, 56). A3AR also is involved inimmune function and is particularly important in regulatingmast cell function (44, 54). It has been suggested that adeno-sine enhances the inflammatory response when present in lowconcentrations. However, at a site where there is significanttissue injury, adenosine is generated in high concentrations bydamaged tissues or cells, acting as an inhibitor of neutrophilinflammatory functions (21). Therefore, the overall result ofadenosine action is an anti-inflammatory effect due mainly to adominant A2A response that exceeds the A1 response (11).However, newly formed adenosine is removed very quicklyfrom tissues by adenosine-metabolizing enzymes such as aden-osine deaminase (ADA) (1). A previous study from our grouphas demonstrated that TxA increases ADA activity in murineileal tissue (10). As blocking adenosine deaminase can elevatethe adenosine concentration in biological systems, the objective ofthis study was to determine the effect of EHNA [erythro-9-(2-hydroxy-3-nonyl)-adenine], an inhibitor of adenosine deaminase,on TxA-induced enteritis in mice and to study the effect of TxAon the gene expression of adenosine receptors.

MATERIALS AND METHODS

Animals. We used 104 male C57BL/6 mice, 25 to 30 g of body weight, from theanimal colony of the Federal University of Ceara. The animals received bothsterilized water and food ad libitum. All experimental protocols were approvedby the local Animal Care and Use Committee.

Drugs and toxins. Purified TxA from Clostridium difficile (strain 10463; mo-lecular mass, 308 kDa) was kindly provided by David Lyerly (Techlab, Blacks-burg, VA) and was diluted in phosphate-buffered saline (PBS), pH 7.4; EHNA,[eritro-9-(2-hidroxi-3-nonil)adenine; molecular weight, 313.83; Sigma E114], di-luted in PBS plus dimethylsulfoxide (DMSO) and 4-{3-[6-amino-9-(5-cyclopro-pylcarbamoyl-3,4-dihydroxytetrahydrofuran-2-yl)-9H-purin-2-yl]prop-2-ynyl}pi-

peridine-1-carboxylic acid methyl ester (ATL313), was kindly provided byPGxHealth, LLC (through Adenosine Therapeutics).

EHNA inhibitory action of adenosine deaminase on ileal tissue. Adenosinedeaminase activity was assessed by following the method of Giusti (19). Briefly,EHNA (10, 30, or 90 �mol/kg of body weight) or PBS was injected intraperito-neally (i.p.) 30 min before TxA (50 �g) or PBS injection in the ileal loop, and 3 hlater the mice were sacrificed and intestinal loops were removed for the evalu-ation of ADA activity by measuring ammonia resulting from the adenosinedeamination.

Induction of intestinal inflammation. Mice were fasted overnight with freeaccess to water and then were anesthetized with ketamine and xylazine (60 and5 mg/kg intramuscularly, respectively). Through a midline laparotomy, one 4-cmileal loop was ligated and injected with either 0.1 ml of PBS, pH 7.4 (control), orbuffer containing TxA (10 to 100 �g). A dose response was carried out todetermine the dose of TxA that caused a significant increase in ileal weight andfluid volume in C57BL/6 mice. The abdomen was closed, and the animals wereallowed to regain consciousness. Three hours after the administration of TxA,mice were sacrificed, intestinal loops were removed, and the loop length, weight,and fluid volume were recorded. A portion of the loop was frozen at �70°C forthe measurement of myeloperoxidase activity (MPO), and tumor necrosis factoralpha (TNF-�) and interleukin-1� (IL-1�) concentrations were determined byELISA; another portion was immediately embedded in RNA Later solution forposterior RNA extraction and quantitative reverse transcription-PCR (qRT-PCR) analysis. The remaining tissue was fixed in 10% formalin and processed forhistology. Alternatively, mice were injected with EHNA, the adenosine deami-nase inhibitor (90 �mol/kg, i.p.), 30 min before the TxA (50 �g) injection in theileal loop. Some mice pretreated with EHNA were injected with ATL313 (5 nMfinal concentration) in the ileal loop immediately before the TxA (50 �g) injec-tion.

Histology. The severity of inflammation was scored in coded slides by a pa-thologist on a scale of 0 (absence of alterations) and 1 (mild) to 3 (severe) forepithelial damage, edema, and neutrophil infiltration as previously described (29,10). At least six slides were analyzed per group.

Determination of myeloperoxidase activity. The extent of neutrophil accumu-lation in ileal tissue was estimated by measuring MPO activity as previouslydescribed (6). Briefly, 50 to 100 mg of ileal tissue was homogenized in 1 ml ofhexadecyltrimethylammonium bromide (HTAB) buffer for each 50 mg of tissue.The homogenate then was centrifuged at 4,000 � g for 7 min at 4°C. MPOactivity in the resuspended pellet was assayed by measuring the change in ab-sorbance at 450 nm using o-dianisidine dihydrocloride and 1% hydrogen perox-ide. The results were reported as U of MPO/mg of tissue. A unit of MPO activitywas defined as the amount of enzyme that converts 1 �mol of hydrogen peroxideto water in 1 min at 22°C.

Quantification of proinflammatory cytokines by ELISA. TNF-� and IL-1�concentrations in ileal tissue were measured by enzyme-linked immunosorbentassay (ELISA) as described previously (43).

Total RNA extraction, reverse transcription, and real-time PCR. Total RNAwas isolated from ileum using Trizol reagent (Invitrogen), and 2 �g was reversetranscribed using ImProm-II reverse transcriptase (Promega) and oligo(dT)primer according to the manufacturer’s instructions. Real-time RT-PCR (qRT-PCR) was performed on the 7900HT fast real-time PCR system (Applied Bio-systems) apparatus using the following specific primers (IDT, Coralville, IA):adenosine receptors A1 (forward, CTGGCTCTGCTTGCTATTGCT; reverse,CGCTGAGTCACCACTGTCTTGTA), A2A (forward, GCTATTGCCATCGACAGATACATC; reverse, TGCCCTTCGCCCTCATAC), A2B (forward, CGACCGATATCTGGCCATTC; reverse, TGTCCCAGTGACCAAACCTTT), andA3 (forward, GGCCATTGCTGTAGACCGATA; reverse, TTCTTCTTTGAGTGGTAACCGTTCT). Also used were primers for PTX3 (forward, GGACAACGAAATAGACAATGGACTT; reverse, CGAGTTCTCCAGCATGATGAAC), IL-1� (forward, TCCACCTCAATGGACAGAATATCA; reverse, GGTTCTCCTTGTACAAAGCTCATG), and TNF-� (forward, CCACGCTCTTCTGTCTACTGAACTT; reverse, TGAGAGGGAGGCCATTTGG). qRT-PCRs, ina final volume of 20 �l, consisted of 10 �l of 2� master mix SYBR green(Applied Biosystems), 10 ng of cDNA, and 5 �l each of forward and reverseprimers (concentration from 0.4 to 1.6 �M, in accordance with the gene). PCRassays were performed in duplicate with the following steps: 10 min at 95°C(initial denaturation), 15 s at 95°C and 60 s at 60°C for 40 cycles, and a coolingstep to 4°C. The relative gene expression ratios of the TxA-injected samplesversus those of the noninjected controls were calculated considering the real-time PCR amplification efficiencies of each pair of primers and the CP (crossingpoint) as described by Pfaffl (38a). The amplification of the housekeeping genehypoxanthine-guanine phosphoribosyltransferase (Hprt) (forward, TGGATATG

654 DE ARAUJO JUNQUEIRA ET AL. INFECT. IMMUN.


.org/D

ownloaded from

http://iai.asm.org/

CCCTTGACTATAATGAGT; reverse, GGCTTTTCCAGTTTCACTAATGACA) was used for the normalization of the data.

Immunohistochemical reaction for NOS2 and NF-��. Immunohistochemis-tries of NOS2 and NF-� were performed in ileal tissue using the streptavidin-biotin-peroxidase method (23) in formalin-fixed, paraffin-embedded tissue sec-tions (4 �m thick) mounted on poly(L)-lysine-coated microscope slides. Thesections were deparaffinized and rehydrated through xylene and graded alcohols.After antigen retrieval, endogenous peroxidase was blocked (15 min) with 3%(vol/vol) hydrogen peroxide and washed in phosphate-buffered saline. Sectionswere incubated overnight (4°C) with primary rabbit anti-mouse NOS2 (SantaCruz Biotechnology) or primary rabbit anti-NF-� p50 nuclear localization se-quence (NLS; sc-114) (Santa Cruz Biotechnology) antibody diluted 1:400 in PBSplus bovine serum albumin (PBS-BSA). The slides then were incubated withbiotinylated goat anti-rabbit or donkey anti-rat IgG and diluted 1:400 in PBS-BSA. After being washed, the slides were incubated with avidin-biotin-horserad-ish peroxidase conjugate (ABC complex; Santa Cruz Biotechnology) for 30 minaccording to the Santa Cruz protocol. NF-� and NOS2 were visualized with thechromogen 3,3diaminobenzidine (DAB). Negative-control sections were pro-cessed simultaneously as described above but with the first antibody being re-placed by PBS–5% BSA. Slides were counterstained with Harry’s hematoxylin.

Statistics. Results are reported as means � standard errors of the means(SEM) or as median values and ranges, where appropriate. Univariate analysis ofvariance (ANOVA) followed by Bonferroni’s test was used to compare means,and the Kruskal-Wallis test followed by the Dunn’s test was used to comparemedians. For PCR, one-way ANOVA followed by Newman-Keuls multiple com-parison was used. A probability value of P � 0.05 was considered significant.

RESULTS

EHNA inhibitory action on adenosine deaminase activity onileal tissue. Systemic pretreatment with EHNA (30 and 90�mol/kg) significantly (P � 0.05) reduced ADA activity in theileal tissue (PBS, 2.968 � 0.4532; EHNA at 90 �mol/kg,0.3491 � 0.07186 �mol NH3/mg protein/h) (Fig. 1A). Thedose of 90 �mol/kg of EHNA also reduced significantly (P �0.05) the TxA-induced increase in ADA activity on ileal tissue(TxA, 9.067 � 3.299 �mol NH3/mg protein/h; EHNA and TxAat 90 �mol/kg, 2.274 � 0.574 �mol NH3/mg protein/h) and wasadopted for the following experiments (Fig. 1B).

Effect of Clostridium difficile TxA in murine ileal loops. Toevaluate the inflammatory and secretory effects of TxA in mu-rine ileal loops, we observed enteritis in responses to increas-ing amounts of TxA (10, 20, 50, and 100 �g), measuring bothloop weight and the accumulation of fluid in the intestinallumen as endpoints. TxA induced a significant (P � 0.05)increase of ileal weight/length and volume/length ratios at 50and 100 �g compared to results for the PBS controls (Fig. 2Aand C). The dose of 50 �g was adopted for the followingexperiments.

Effect of EHNA on murine ileal loops injected with Clostrid-ium difficile TxA. Pretreatment with EHNA, the adenosinedeaminase inhibitor (90 �mol/kg, i.p.), significantly (P � 0.05)but not completely reduced the TxA (50 �g/loop)-inducedincrease in weight/ileal loop length (TxA, 73.24 � 5.68 mg/cm;EHNA plus TxA, 54.62 � 4.98 mg/cm; Fig. 2B) and secretionvolume/ileal loop length ratios (TxA, 39.26 � 5.30 mg/cm;EHNA plus TxA, 27.05 � 4.39 mg/cm; Fig. 2D). ATL313 didnot increase the effect of EHNA in weight/ileal loop lengthand secretion volume/ileal loop length ratios. In the absenceof TxA, EHNA (90 �mol/kg, i.p.) did not affect weight/ilealloop length or secretion volume/ileal loop length ratios (Fig.2B and D).

Histological analysis demonstrated that TxA (50 �g/loop), asexpected, induced intense mucosal disruption, hemorrhage,

edema, and inflammatory cell infiltration, resulting in a medianinjury score of 3 and a range of 2 to 3 (Fig. 3B), while thecontrol group, injected with PBS, presented a median score of0 (0 to 0) (Fig. 3A). The median score of the group pretreatedwith EHNA was 1 (range, 0 to 2), which was a significant (P �0.05) reduction of the disruptive effects of TxA compared toresults for the PBS-pretreated control group (Fig. 3C). How-ever, three out of six animals in the EHNA-plus-TxA groupstill presented discrete mucosal disruption, hemorrhage,edema, and inflammatory cell infiltration (score of 1), and oneanimal presented a moderate histological alteration (score of2). The ileal mucosa was normal in mice that received onlyEHNA without TxA (Fig. 3D).

We assessed neutrophil infiltrates by measuring myeloper-oxidase activity in the ileal tissue (6). MPO is an enzymepresent in the azurophil granules of neutrophils, and its activityhas been used to indicate the neutrophil infiltration of thetissues (6). TxA (50 �g/loop) caused a statistically significantincrease (P � 0.05) in MPO activity in ileal tissue compared todata for the loops from the control group, which were injectedonly with PBS (TxA, 21.07 � 4.15 U/mg; PBS, 3.82 � 0.75U/mg). The group pretreated with EHNA and then challengedwith TxA had markedly reduced MPO activity (P � 0.05)

FIG. 1. Effect of EHNA on adenosine deaminase (ADA) activity inmurine ileum tissue. EHNA (10, 30, 90 �mol/kg) or PBS was injectedi.p. 30 min before the injection of PBS (A) or TxA (50 �g) (B) in theileal loop. Three hours later, the mice were sacrificed and intestinalloops were removed for the evaluation of ADA activity by the Giustimethod. Bars on the graphs represent the ADA-specific activity (�molof NH3/mg of protein/h) in the ileum tissue as means � standarderrors of the means (SEM) (n 5 to 6). *, P � 0.05 compared to thecontrol (PBS); **, P � 0.05 compared to the group pretreated withPBS and injected with TxA into the loop. ANOVA with Bonferroni’scorrection was used.

VOL. 79, 2011 ADA INHIBITION IN C. DIFFICILE TxA ENTERITIS 655


.org/D

ownloaded from

http://iai.asm.org/

(EHNA plus TxA, 8.78 � 1.81 U/mg; TxA, 21.07 � 4.15U/mg)(Fig. 4).

Effect of EHNA on Clostridium difficile TxA-induced pro- andanti-inflammatory cytokines. The injection of TxA (50 �g/loop) into mouse ileal loops significantly increased the localtissue production of both TNF-� and IL-1� (P � 0.05) com-pared to that of the control group (PBS). Pretreatment withEHNA significantly (P � 0.05) reduced TxA-induced TNF-�(PBS and TxA, 1,767 � 249.9 pg/ml; EHNA plus TxA, 1,054 �26.61 pg/ml; Fig. 5A) and IL-1� (PBS and TxA, 4,307 � 346.4pg/ml; EHNA plus TxA, 2,430 � 289.9 pg/ml; Fig. 5B) pro-duction in ileal tissue compared to that of loops injected withTxA in animals pretreated with PBS. This reduction also wasaccompanied by the significant downmodulation of the tran-scripts for these cytokines in the ileum of EHNA-pretreatedmice (Fig. 6A and B).

Effect of EHNA on Clostridium difficile TxA-induced NOS2expression. Immunohistochemical staining for NOS2 was sig-nificantly (P � 0.05) increased in ileal tissue of mice treatedwith TxA compared to levels for PBS-injected mice. The TxA-induced expression of NOS2 was significantly (P � 0.05) de-creased by the pretreatment of the animals with EHNA (PBSplus PBS, 11 � 2.23 cells/fields; PBS and TxA, 129.2 � 11.65cells/fields; EHNA plus TxA, 58.50 � 4.88 cells/fields; Fig. 7).No immunostaining for NOS2 was found in the negative con-

trol (ileum tissue incubated in the absence of anti-mouseNOS2 antibody) (Fig. 7E).

Effect of EHNA on Clostridium difficile TxA-induced NF-�Bexpression. Increased immunostaining for the NF-�B-p50 NLS(which specifically binds to the dissociated fraction p50 ofNF-�B in the nucleus or in the cytoplasm) was detected in ilealtissue of mice with TxA-induced enteritis (Fig. 8B) but not inPBS-injected mice (Fig. 8A) and was paralleled by a TxA-promoted increase in cytokine gene expression (Fig. 6A andB). Moreover, the immunostaining for NF-�B-p50 NLS wassubstantially reduced by the pretreatment of the animals withEHNA (Fig. 8C), which was accompanied by the drastic down-modulation of the cytokines gene expression shown in Fig. 6Aand B. No immunostaining for NF-�B was found in the nega-tive control (ileal tissue incubated in the absence of anti-NF-�B-p50 NLS antibody) (Fig. 8D).

Effect of EHNA on Clostridium difficile TxA-induced Ptx3expression. We also investigated the participation of the longpentraxin 3 (PTX3) in TxA-induced enteritis based on our pre-vious findings pointing out the pivotal role of this protein in injuryfollowing intestinal ischemia and reperfusion (49, 50). TxA pro-moted an increase in Ptx3 gene expression in ileal tissue of micewith TxA-induced enteritis compared to that of PBS-injectedmice (Fig. 6C). Moreover, EHNA drastically downmodulated thepentraxin gene expression shown in Fig. 6C.

FIG. 2. Effect of Clostridium difficile TxA on ileal loop weight and secretion volume. Ileal loops were injected with 0.1 ml of TxA (10, 20, 50,or 100 �g/loop) or phosphate-buffered saline (PBS) (A and C). Alternatively, mice received systemic pretreatment with EHNA (90 �mol/kg, i.p.)or PBS 30 min prior to the local injection of TxA (50 �g/loop) or PBS (B and D). A group of mice pretreated with EHNA were injected withATL313 (5 nM final concentration) in the ileal loop immediately before TxA (50 �g). Three hours after the administration of TxA and PBS, micewere sacrificed. Weight/ileal loop length (mg/cm) (A and B) and secretion volume/ileal loop length (�l/cm) (C and D) are presented as means �SEM (n 6 to 9). *, P � 0.05 compared to the control group (PBS); **, P � 0.05 compared to group pretreated with PBS and injected with TxAinto the loop. ANOVA with Bonferroni’s correction was used.



.org/D

ownloaded from

http://iai.asm.org/

Effect of Clostridium difficile TxA in the presence or absenceof EHNA on adenosine receptor gene expression. TxA pro-moted an increase in A1 and A2A adenosine receptor geneexpression (Fig. 9A and B) but did not alter the expression of

A2B and A3 receptors (Fig. 9C and D). Moreover, the pretreat-ment with EHNA reduced toxin A-induced A1 and A2A aden-osine receptor gene expression, but this effect did not reachstatistical significance (Fig. 9A and B).

DISCUSSION

During inflammatory and ischemic episodes, endogenousadenosine is produced and acts as a protective metabolite.Newly formed adenosine, however, is removed very quicklyfrom tissues by adenosine-metabolizing enzymes, ADA, andadenosine kinase. Previous studies from our laboratory showedthat TxA increased adenosine deaminase activity in ileal tissue(10). ADA is an important deaminating enzyme that convertsadenosine and 2deoxyadenosine to inosine and 2-deoxyino-sine, respectively (52). In this study, we tested the anti-inflam-matory effect of EHNA, a potent and reversible inhibitor of theenzyme adenosine deaminase 1, which has been shown to beless toxic than other ADA inhibitors, because it preserves thecellular capacity for the deamination of purines (1). Using amethod previously described (19), we determined the EHNAinhibitory action on ADA activity in ileal tissue, and based ona dose-response curve, we chose the dose of 90 �mol/kg toperform the experiments with TxA. Our in vivo data showedthat EHNA considerably reduced the mucosal disruption andinflammation induced by TxA in the mouse ileal loop. Consis-tently with our findings, it has been demonstrated that the

FIG. 3. Effect of EHNA on Clostridium difficile TxA-induced histological alterations. (A) Histological status when ligated ileal loops weretreated with PBS only. (B) Mucosal disruption in ligated ileal loop injected with TxA (50 �g/loop). (C) Substantial prevention of mucosaldisruption induced by TxA when the mouse was pretreated with EHNA (90 �mol/kg i.p.). (D) Normal aspect of the ileal mucosa of animalpretreated with EHNA (90 �mol/kg i.p.) without TxA. Hematoxylin and eosin staining was used; magnification, �100.

FIG. 4. Effect of EHNA on Clostridium difficile TxA-induced myeloper-oxidase (MPO) activity. The mice received systemic pretreatment withEHNA (90 �mol/kg i.p.) or PBS 30 min prior to the local injection of TxA (50�g/loop) or PBS. Three hours later, mice were euthanized and the intestinalloops were removed and frozen (�70°C) for the measurement of MPOactivity. Bars on the graph represent the MPO activity (U/mg) as means �standard error of means (SEM) (n 6 to 7). *, P � 0.05 compared to controlgroup (PBS); **, P � 0.05 compared to control group pretreated with PBSand injected with TxA into the loop. ANOVA with Bonferroni’s correctionwas used.



.org/D

ownloaded from

http://iai.asm.org/

elevation of endogenous adenosine concentrations through theinhibition of adenosine kinase by GP515 downregulates localinflammation in a model of dextran sulfate sodium (DSS)-induced colitis (46). It also has been reported that adenosinehas a potent anti-inflammatory effect, mainly through activa-tion of its A2A and A2B receptors, leading to a reduction incytokine production, inflammatory cell infiltration, and celldamage (5, 11, 15, 21). These anti-inflammatory effects ofadenosine could provide an explanation for the effects ofEHNA reported herein.

We also report herein that TxA increased the expression ofA1AR and A2AAR in ileal tissue without modulating the ex-pression of A2BAR and A3AR, and that the pretreatment withEHNA reduced TxA-induced A1AR and A2AAR gene expres-sion, but this effect did not reach statistical significance. Ourresults suggest that the anti-inflammatory effect of EHNA re-lies on the ability to enhance the concentration of adenosine inthe ileal tissue following TxA challenge, affecting more mod-estly the expression of the adenosine receptors. It is unlikelythat pretreatment with EHNA is interfering with TxA bindingto its receptor, since EHNA was administered systemically byi.p. injection and the toxin was administered directly in the ilealloop. We also have found that EHNA injected systemically(i.p.) 1 h after the local (intraloop) administration of TxA

abolished the TxA-induced increase in MPO activity (data notshown).

The binding of adenosine to its receptors on the neutrophilsurface may produce either proinflammatory or anti-inflam-matory effects, depending on its concentration and the types ofreceptors stimulated. A1AR engagement induces a proinflam-matory response, such as an increase in neutrophil adhesion,recruitment, and phagocytosis. On the other hand, the bindingof adenosine to A2AARs results in anti-inflammatory effects,including the decreased neutrophil release of reactive oxygenspecies (10, 11, 51). It is suggested that adenosine enhances theinflammatory response when present in low concentrations(21). Here, we used an adenosine deaminase inhibitor, EHNA,to enhance the concentration of adenosine in the ileal tissuechallenged with TxA. Previous studies have shown that aden-osine in high concentrations has an anti-inflammatory effect,mainly due to a dominant A2A response that exceeds the A1

response (11). Our group previously has demonstrated that anadenosine A2AR agonist (ATL313), in the absence of EHNA,

FIG. 5. Effect of EHNA on Clostridium difficile TxA-induced in-crease of concentration of cytokines. The mice received systemic pre-treatment with EHNA (90 �mol/kg i.p.) or PBS 30 min prior to thelocal injection of TxA (50 �g/loop) or PBS. Three hours later, micewere euthanized and the intestinal loops were removed for cytokineassay by ELISA. Bars on the graph represent TNF-� and IL-1� con-tent (means � SEM; n 5 to 7). *, P � 0.05 compared to controlgroup (PBS); **, P � 0.05 compared to the group pretreated with PBSand with TxA injected into the loop. ANOVA with Bonferroni’s cor-rection was used.

FIG. 6. Effect of EHNA on Clostridium difficile TxA-induced geneexpression for cytokines and pentraxin 3 (PTX3). The mice receivedsystemic pretreatment with EHNA (90 �mol/kg i.p.) or PBS 30 minprior to the local injection of TxA (50 �g/loop) or PBS. Three hourslater, mice were sacrificed, and the intestinal loops were removed forgene expression analysis by qRT-PCR. Graphs represent the expres-sion ratios of TNF-�, IL-1�, and PTX3 mRNAs obtained from TxA-injected ileum relative to the controls injected with PBS (means; n 6). *, P � 0.05 compared to control group (PBS); **, P � 0.05compared to the TxA group. ANOVA was used with the Newman-Keuls test.



.org/D

ownloaded from

http://iai.asm.org/

almost completely abolishes the TxA-induced increase inweight/ileal loop length and secretion volume/ileal loop lengthratios and reduced TxA-induced mucosal disruption, celldeath, TNF-� release, and inflammatory cell infiltration. Wenow show that in the presence of EHNA, the effects ofATL313 are much weaker than when the agonist is used alone,which indicates that most of the anti-inflammatory effects ofEHNA observed in our model rely on its ability to enhance theconcentration of adenosine in the ileal tissue that maximallystimulates A2A receptors.

The abundant presence of neutrophils within TxA-inducedpseudomembranes is well known (9, 34), as is their importantrole in the pathogenesis of ileal damage induced by C. difficileTxA (2, 27). Here, we showed that EHNA reduced TxA-in-duced MPO activity, suggesting a potent effect of EHNA toinhibit neutrophil infiltration into ileal tissue. Thus, it is rea-sonable to propose that, at least in part, the protective effectsof EHNA are related to this inhibitory effect, since the activa-tion of A2AAR has been reported to inhibit neutrophil diape-desis (20, 56).

It has been shown that TxA induces the release of cytokines,such as TNF-� and IL-1�, that contribute to the pathogenesisof TxA-induced colitis (8, 16). Our findings confirmed the datashowing that TxA induces gene expression and leads to thesynthesis of TNF-� and IL-1� in the mouse ileum. The datapresented here demonstrated that the inhibition of adenosinedeaminase by EHNA reduced the production of both cytokinesin the ileum in response to TxA. It has been shown that aden-osine reduces the release of TNF-� by mouse peritoneal mac-rophages via A2AR and A2BR (30) and of IL-1� by humanmonocytes via A1R, A2AR, and A3R (47). Furthermore, aprevious study from our group showed that an adenosineA2AR agonist significantly reduced TxA-induced TNF-� syn-thesis in the mouse ileal loop (10). The increased expression ofA1R and A2AR in ileal tissue of animals treated with TxA andEHNA could be an explanation for the inhibitory effect ofEHNA on cytokine production, which may have a critical im-plication for its preventive action on neutrophil infiltration andtissue damage. This inhibitory effect on cytokine productionmight be due to the suppression of the NF-�B pathway pro-

FIG. 7. Effect of EHNA on Clostridium difficile TxA-induced increase in immunostaining for inducible nitric oxide synthase (NOS2). (A) Ilealtissue of animal treated with PBS (control). (B and C) Increased number of cells immunostained for NOS2 (stained brown) in the ligated ileal loopinjected with TxA (50 �g/loop). (D) Substantial prevention of TxA-induced NOS2 expression in animals pretreated with EHNA. (E) Negativecontrol (ileal tissue not treated with NOS2 antibody). The graph represents means � SEM of the number of cells immunostained/field.Magnification, � 400.



.org/D

ownloaded from

http://iai.asm.org/

moted by the activation of the A2A receptor (45). Our datashowing the decreased expression of NF-�B-p50 NLS in theileal tissue of mice treated with EHNA supports this hypoth-esis.

Our results clearly show an increased expression of NOS2 inileal tissue of mice treated with TxA. The role of NO onTxA-induced damage still is ambiguous. Melo Filho and co-workers reported that TxA and TxB did not induce the pro-duction of NO by macrophages in vitro, and that the use of aninhibitor of NOS (L-NIO) did not modify the cellular damageinduced by these toxins (37). On the other hand, TxB has beenshown to promote the increased expression of NOS2 by inac-tivating the G protein of the Rho family (22, 38). Qiu andcoworkers demonstrated that inhibitors of NOS, L-NAME and7-NI, caused an increase in TxA-induced secretion and man-nitol permeability in rat ileal loops. These effects were ob-served only when L-NAME and 7-NI were administered be-fore, but not after, TxA. These findings suggest an inhibitoryaction of L-NAME and 7-NI on constitutive rather than in-ducible NOS, because the latter is upregulated several hoursafter the onset of acute inflammation. Moreover, a more se-lective NOS2 inhibitor, aminoguanidine, had no effect on TxA-induced secretion and permeability (40). It is well known thatthe expression of NOS2 is induced in a variety of cells byinflammatory cytokines such as TNF-�, IL-1�, and IFN-�, re-sulting in the production of high levels of NO, which areinvolved in the pathogenesis of several inflammatory diseases(26, 33). Since TxA is a potent inducer of inflammatory cyto-kines, as has been shown here, it is reasonable to propose that

NO produced by NOS2 has a role in the pathogenesis ofTxA-induced damage. Here, we also demonstrated that theinhibition of adenosine deaminase by EHNA reduced TxA-induced NOS2 expression. In accordance with our findings,other studies have revealed that adenosine A2BR, A1R, andA3R agonists also reduce the expression of NOS2 (36, 55).

In the current study, we demonstrated for the first time thatTxA upmodulates pentraxin 3 expression in the ileum of mice.Previously, in a model of intestinal ischemia and reperfusion,we showed that Ptx3 overexpression led to a higher mortalityrate correlated with increased inflammation, intestinal dam-age, and augmented levels of TNF-�, IL-1�, and CxCL1(KC)(50), while in Ptx3 knockout mice tissue injury was markedlyinhibited and lethality prevented (49). Our findings suggestthat Ptx3 is among the mediators of the pathogenesis of TxA-induced colitis and that pentraxin is a potential serologicalmarker of tissue inflammation and damage in C. difficile-in-duced disease. The reduction of Ptx3 local levels promoted byEHNA may be related to the reduced ileal inflammation seenin EHNA-pretreated animals.

In conclusion, the present study reports that EHNA, aninhibitor of adenosine deaminase 1, significantly reduces C.difficile TxA-induced mouse ileal secretion, edema, inflamma-tory cell infiltration, mucosal disruption, TNF-� and IL-1�production, and NOS2 expression, presumably by augmentingthe availability of adenosine to act through its receptors thatpromote the transduction of anti-inflammatory signals. In ad-dition, we report that pentraxin 3 also is involved in TxA-

FIG. 8. Effect of EHNA on Clostridium difficile TxA-induced increase in immunostaining for NF-�B-p50 NLS. (A) Ileal tissue of animal treatedwith PBS only. (B) Increased number of cells immunostained for NF-�B-p50 NLS (stained brown) in the ligated ileal loop injected with TxA (50�g/loop). Arrows identify cells with immunostained nuclei. (C) Substantial prevention of TxA-induced NF-�B-p50 NLS immunostaining in animalspretreated with EHNA. (D) Negative control (ileal tissue not treated with NF-�B-p50 NLS antibody). Magnification, �400. Smaller micrographsrepresent areas with a magnification of �1,000.



.org/D

ownloaded from

http://iai.asm.org/

induced inflammation, and that its expression is downregulatedby EHNA.

These findings suggest a role for adenosine/adenosinedeaminase in the pathogenesis of C. difficile-induced disease.These data are particularly important in light of recent reportsof the increased incidence and severity of C. difficile-induceddisease and the need for the additional clarification of itspathogenesis and new therapeutic strategies.

ACKNOWLEDGMENTS

We gratefully acknowledge Ricardo Renzo Brentani for the criticalreview of the manuscript and Maria Silvandira F. Pinheiro and JoseIvan R. de Sousa for technical assistance.

This work was supported by a grant from Conselho Nacional dePesquisa (CNPq) number 472019/2007-4.

REFERENCES

1. Barankiewicz, J., et al. 1997. Regulation of adenosine concentration andcytoprotective effects of novel reversible adenosine deaminase inhibitors.J. Pharmacol. Exp. Ther. 283:1230–1238.

2. Barreto, A. R., et al. 2008. Fucoidin prevents Clostridium difficile toxin-A-induced ileal enteritis in mice. Dig. Dis. Sci. 53:990–996.

3. Bartlett, J. G. 2002. Clinical practice. Antibiotic-associated diarrhea.N. Engl. J. Med. 346:334–339.

4. Blossom, D. B., and L. C. McDonald. 2007. The challenges posed by re-emerging Clostridium difficile infection. Clin. Infect. Dis. 45:222–227.

5. Bours, M. J., E. L. Swennen, V. F. Di, B. N. Cronstein, and P. C. Dagnelie.2006. Adenosine 5-triphosphate and adenosine as endogenous signalingmolecules in immunity and inflammation. Pharmacol. Ther. 112:358–404.

6. Bradley, P. P., R. D. Christensen, and G. Rothstein. 1982. Cellular andextracellular myeloperoxidase in pyogenic inflammation. Blood 60:618–622.

7. Brito, G. A., et al. 2005. Clostridium difficile toxin A induces intestinal epi-

thelial cell apoptosis and damage: role of Gln and Ala-Gln in toxin A effects.Dig. Dis. Sci. 50:1271–1278.

8. Brito, G. A., et al. 2002. Mechanism of Clostridium difficile toxin A-inducedapoptosis in T84 cells. J. Infect. Dis. 186:1438–1447.

9. Brito, G. A., et al. 2002. Clostridium difficile toxin A alters in vitro-adherentneutrophil morphology and function. J. Infect. Dis. 185:1297–1306.

10. Cavalcante, I. C., et al. 2006. Effect of novel A2A adenosine receptor agonistATL313 on Clostridium difficile toxin A-induced murine ileal enteritis. Infect.Immun. 74:2606–2612.

11. Cronstein, B. N. 1994. Adenosine, an endogenous anti-inflammatory agent.J. Appl. Physiol. 76:5–13.

12. Dias, A. A., et al. 2001. TSG-14 transgenic mice have improved survival toendotoxemia and to CLP-induced sepsis. J. Leukoc. Biol. 69:928–936.

13. Diniz, S. N., et al. 2004. PTX3 function as an opsonin for the dectin-1-dependent internalization of zymosan by macrophages. J. Leukoc. Biol.75:649–656.

14. Doni, A., et al. 2003. Production of the soluble pattern recognition receptorPTX3 by myeloid, but not plasmacytoid, dendritic cells. Eur. J. Immunol.33:2886–2893.

15. Eigler, A., et al. 2000. Suppression of TNF-alpha production in humanmononuclear cells by an adenosine kinase inhibitor. J. Leukoc. Biol. 68:97–103.

16. Flegel, W. A., et al. 1991. Cytokine response by human monocytes to Clos-tridium difficile toxin A and toxin B. Infect. Immun. 59:3659–3666.

17. Fredholm, B. B., A. P. Ijzerman, K. A. Jacobson, K. N. Klotz, and J. Linden.2001. International Union of Pharmacology. XXV. Nomenclature and clas-sification of adenosine receptors. Pharmacol. Rev. 53:527–552.

18. Garlanda, C., et al. 2002. Non-redundant role of the long pentraxin PTX3 inanti-fungal innate immune response. Nature 420:182–186.

19. Giusti, G. 1974. Adenosine deaminase, p. 1092–1099. In H. U. Bergmeyer(ed.), Methods of enzymatic analysis., vol. 2. Academic Press, Inc., NewYork, NY.

20. Glover, D. K., et al. 2005. Reduction of infarct size and postischemic inflam-mation from ATL-146e, a highly selective adenosine A2A receptor agonist,in reperfused canine myocardium. Am. J. Physiol. Heart Circ. Physiol. 288:H1851–H1858.

FIG. 9. Effect of Clostridium difficile TxA with or without EHNA on adenosine receptor gene expression. The mice received systemic treatmentwith EHNA (90 �mol/kg i.p.) or PBS 30 min prior to the local injection of TxA (50 �g/loop) or PBS. Three hours later, mice were sacrificed, andthe intestinal loops were removed for gene expression analysis by qRT-PCR. Graphs represent the expression ratios of A1 (A), A2A (B), A2B (C),and A3 (D) adenosine receptor mRNAs obtained from TxA-injected ileum relative to the controls injected with PBS (means; n 4 to 5). *, P �0.05 compared to the control group (PBS). ANOVA was used with the Newman-Keuls test.



.org/D

ownloaded from

http://iai.asm.org/

21. Hasko, G., and B. N. Cronstein. 2004. Adenosine: an endogenous regulatorof innate immunity. Trends Immunol. 25:33–39.

22. Hausding, M., et al. 2000. Inhibition of small G proteins of the rho family bystatins or clostridium difficile toxin B enhances cytokine-mediated inductionof NO synthase II. Br. J. Pharmacol. 131:553–561.

23. Hsu, S. M., L. Raine, and H. Fanger. 1981. The use of antiavidin antibodyand avidin-biotin-peroxidase complex in immunoperoxidase technics. Am. J.Clin. Pathol. 75:816–821.

24. Hua, X., et al. 2007. Enhanced mast cell activation in mice deficient in theA2b adenosine receptor. J. Exp. Med. 204:117–128.

25. Humphrey, C. D., C. W. Condon, J. R. Cantey, and F. E. Pittman. 1979.Partial purification of a toxin found in hamsters with antibiotic-associatedcolitis. Reversible binding of the toxin by cholestyramine. Gastroenterology76:468–476.

26. Jeremy, J. Y., A. P. Yim, S. Wan, and G. D. Angelini. 2002. Oxidative stress,nitric oxide, and vascular disease. J. Card. Surg. 17:324–327.

27. Kelly, C. P., et al. 1994. Neutrophil recruitment in Clostridium difficile toxinA enteritis in the rabbit. J. Clin. Investig. 93:1257–1265.

28. Kelly, C. P., and J. T. LaMont. 2008. Clostridium difficile–more difficult thanever. N. Engl. J. Med. 359:1932–1940.

29. Kirkwood, K. S., et al. 2001. Deletion of neutral endopeptidase exacerbatesintestinal inflammation induced by Clostridium difficile toxin A. Am. J.Physiol. Gastrointest. Liver Physiol. 281:G544–G551.

30. Kreckler, L. M., T. C. Wan, Z. D. Ge, and J. A. Auchampach. 2006. Aden-osine inhibits tumor necrosis factor-alpha release from mouse peritonealmacrophages via A2A and A2B but not the A3 adenosine receptor. J. Phar-macol. Exp. Ther. 317:172–180.

31. Kyne, L., M. Warny, A. Qamar, and C. P. Kelly. 2000. Asymptomatic car-riage of Clostridium difficile and serum levels of IgG antibody against toxin A.N. Engl. J. Med. 342:390–397.

32. Lee, T. H., G. W. Lee, E. B. Ziff, and J. Vilcek. 1990. Isolation and charac-terization of eight tumor necrosis factor-induced gene sequences from hu-man fibroblasts. Mol. Cell. Biol. 10:1982–1988.

33. Leitao, R. F., et al. 2007. Role of nitric oxide on pathogenesis of 5-fluo-rouracil induced experimental oral mucositis in hamster. Cancer Chemother.Pharmacol. 59:603–612.

34. Lyerly, D. M., H. C. Krivan, and T. D. Wilkins. 1988. Clostridium difficile: itsdisease and toxins. Clin. Microbiol. Rev. 1:1–18.

35. Lyras, D., et al. 2009. Toxin B is essential for virulence of Clostridium difficile.Nature 458:1176–1179.

36. Martin, L., S. C. Pingle, D. M. Hallam, L. P. Rybak, and V. Ramkumar.2006. Activation of the adenosine A3 receptor in RAW 264.7 cells inhibitslipopolysaccharide-stimulated tumor necrosis factor-alpha release by reduc-ing calcium-dependent activation of nuclear factor-kappaB and extracellularsignal-regulated kinase 1/2. J. Pharmacol. Exp. Ther. 316:71–78.

37. Melo Filho, A. A., et al. 1997. Role of tumor necrosis factor and nitric oxidein the cytotoxic effects of Clostridium difficile toxin A and toxin B on mac-rophages. Toxicon 35:743–752.

38. Muniyappa, R., R. Xu, J. L. Ram, and J. R. Sowers. 2000. Inhibition of Rhoprotein stimulates iNOS expression in rat vascular smooth muscle cells.Am. J. Physiol. Heart Circ. Physiol. 278:H1762–H1768.

38a.Pfaffl, M. W. 2001. A new mathematical model for relative quantification inreal-time PCR. Nucleic Acids Res. 29:e45.

39. Pothoulakis, C., I. Castagliuolo, and J. T. LaMont. 1998. Nerves and intes-tinal mast cells modulate responses to enterotoxins. News Physiol. Sci. 13:58–63.

40. Qiu, B., C. Pothoulakis, I. Castagliuolo, Z. Nikulasson, and J. T. LaMont.1996. Nitric oxide inhibits rat intestinal secretion by Clostridium difficile toxinA but not Vibrio cholerae enterotoxin. Gastroenterology 111:409–418.

41. Ralevic, V., and G. Burnstock. 1998. Receptors for purines and pyrimidines.Pharmacol. Rev. 50:413–492.

42. Rehg, J. E. 1980. Cecal toxin(s) from guinea pigs with clindamycin-associatedcolitis, neutralized by Clostridium sordellii antitoxin. Infect. Immun. 27:387–390.

43. Safieh-Garabedian, B., S. Poole, A. Allchorne, J. Winter, and C. J. Woolf.1995. Contribution of interleukin-1 beta to the inflammation-induced in-crease in nerve growth factor levels and inflammatory hyperalgesia. Br. J.Pharmacol. 115:1265–1275.

44. Salvatore, C. A., et al. 2000. Disruption of the A(3) adenosine receptor genein mice and its effect on stimulated inflammatory cells. J. Biol. Chem. 275:4429–4434.

45. Sands, W. A., A. F. Martin, E. W. Strong, and T. M. Palmer. 2004. Specificinhibition of nuclear factor-kappaB-dependent inflammatory responses bycell type-specific mechanisms upon A2A adenosine receptor gene transfer.Mol. Pharmacol. 66:1147–1159.

46. Siegmund, B., et al. 2001. Adenosine kinase inhibitor GP515 improves ex-perimental colitis in mice. J. Pharmacol. Exp. Ther. 296:99–105.

47. Sipka, S., et al. 2005. Adenosine inhibits the release of interleukin-1beta inactivated human peripheral mononuclear cells. Cytokine 31:258–263.

48. Soares, A. C., et al. 2006. Dual function of the long pentraxin PTX3 inresistance against pulmonary infection with Klebsiella pneumoniae in trans-genic mice. Microbes. Infect. 8:1321–1329.

49. Souza, D. G., et al. 2009. The long pentraxin PTX3 is crucial for tissueinflammation after intestinal ischemia and reperfusion in mice. Am. J.Pathol. 174:1309–1318.

50. Souza, D. G., et al. 2002. Increased mortality and inflammation in tumornecrosis factor-stimulated gene-14 transgenic mice after ischemia and reper-fusion injury. Am. J. Pathol. 160:1755–1765.

51. Sullivan, G. W., J. M. Rieger, W. M. Scheld, T. L. Macdonald, and J. Linden.2001. Cyclic AMP-dependent inhibition of human neutrophil oxidative ac-tivity by substituted 2-propynylcyclohexyl adenosine A(2A) receptor ago-nists. Br. J. Pharmacol. 132:1017–1026.

52. Van der Weyden, M. B., and W. N. Kelley. 1976. Human adenosine deami-nase. Distribution and properties. J. Biol. Chem. 251:5448–5456.

53. Warny, M., et al. 2005. Toxin production by an emerging strain of Clostrid-ium difficile associated with outbreaks of severe disease in North Americaand Europe. Lancet 366:1079–1084.

54. Wu, W. P., et al. 2002. Decreased inflammatory pain due to reduced carra-geenan-induced inflammation in mice lacking adenosine A3 receptors. Neu-roscience 114:523–527.

55. Xaus, J., et al. 1999. Adenosine inhibits macrophage colony-stimulatingfactor-dependent proliferation of macrophages through the induction ofp27kip-1 expression. J. Immunol. 163:4140–4149.

56. Yang, D., et al. 2006. The A2B adenosine receptor protects against inflam-mation and excessive vascular adhesion. J. Clin. Investig. 116:1913–1923.

Editor: B. A. McCormick



.org/D

ownloaded from

http://iai.asm.org/

Documents

Adenosine Deaminase Inhibition Prevents Clostridium ...As blocking adenosine deaminase can elevate the adenosine concentration in biological systems, the objective of this study was