Agricultural BiotechnologyAgricultural Biotechnology

Altering Genes in Plants to Altering Genes in Plants to Fight Pests and Improve NutritionFight Pests and Improve Nutrition

Unique Methods for PlantsUnique Methods for Plants Entire plants can be cultivated from Entire plants can be cultivated from

a single non-reproductive cella single non-reproductive cell

Add gene

cell withcell withnew genenew gene

mass of mass of cells cells (callus)(callus)

new plantnew plant

Unique MethodsUnique Methods for Plants for Plants

RhizosecretionRhizosecretion

Transgenic plant Transgenic plant grown in water grown in water

Expression of Expression of gene in root cellsgene in root cells

Secretion of gene Secretion of gene product into product into surrounding surrounding mediummedium

Tools of Agricultural Tools of Agricultural BiotechnologyBiotechnology

Vectors Vectors

Ti plasmidTi plasmid(tumor inducing)(tumor inducing)

From a bacterium that From a bacterium that infects plantsinfects plants

Causes tumors Causes tumors

Used for dicots Used for dicots

VirusesViruses Specific for plant typesSpecific for plant types

Used for monocotsUsed for monocots

Ti PlasmidTi Plasmid

Tumor-inducing plasmid Tumor-inducing plasmid from bacteria that integrates from bacteria that integrates into plant DNAinto plant DNA

• Tumor-inducing genes Tumor-inducing genes removedremoved

• Insertion genes retainedInsertion genes retained

• Foreign genes positioned Foreign genes positioned after bacterial promoterafter bacterial promoter

• Antibiotic resistance gene Antibiotic resistance gene as markeras marker

Clarification PauseClarification Pause

• With a partner, identify differences With a partner, identify differences in biotechnological methods used in biotechnological methods used for plants and animals for plants and animals – items to consideritems to consider

• gene deliverygene delivery• transgenic organismstransgenic organisms• gene expressiongene expression• collection of the gene productcollection of the gene product

Plant ImprovementsPlant Improvements

Resistance Resistance to Peststo Pests

Bt Corn: ProducesBt Corn: Producesits own Pesticideits own Pesticide

Insect Insect pestspests

Gene for Bt toxin inserted into plantsGene for Bt toxin inserted into plants

Bt = Bt = Bacillus thuringiensisBacillus thuringiensisBt toxin = crystals that dissolve Bt toxin = crystals that dissolve connections between cells in insect gutconnections between cells in insect gut

Plant ImprovementsPlant ImprovementsResistance to PestsResistance to Pests

VirusesViruses •Ti plasmid carrying genes for viral Ti plasmid carrying genes for viral capsid proteins into tomato and capsid proteins into tomato and tobacco plants tobacco plants•Mechanism of protection against Mechanism of protection against viruses is unclear viruses is unclear

•Possibilities:Possibilities:

•viral protein blocks replication viral protein blocks replication

•viral proteins bind cellular viral proteins bind cellular receptorsreceptors

Plant ImprovementsPlant Improvements

Resistance to HerbicidesResistance to Herbicides

GlyphosateGlyphosate

(Roundup)(Roundup)

Insert gene for mutant EPSPS Insert gene for mutant EPSPS enzyme that is less sensitive to enzyme that is less sensitive to RoundupRoundup

EPSPS = enzyme needed to EPSPS = enzyme needed to synthesize amino acids essential synthesize amino acids essential for growthfor growth

Use of Ti plasmid to transfer Use of Ti plasmid to transfer genegene

Effects of Treatment with RoundupEffects of Treatment with Roundup

Roundup Ready SoybeansRoundup Ready Soybeans

Traditional SoybeansTraditional Soybeans

Plant ImprovementsPlant ImprovementsImproved Food QualityImproved Food Quality

Improved Improved Handling and Handling and StorageStorage

Flavr-Savr TomatoFlavr-Savr Tomato

Potato that Resists BruisingPotato that Resists Bruising

Flavr-Savr TomatoFlavr-Savr Tomatosoftens more slowly softens more slowly

after ripeningafter ripening

Plant ImprovementsPlant Improvements

Improved Food QualityImproved Food Quality

Flavr- SavrFlavr- Savr

TomatoTomato

•Interference with the production of the enzymeInterference with the production of the enzyme polygalacturonase (polyGal) by antisense polygalacturonase (polyGal) by antisense technology technology

•antisense sequence to polyGal mRNA is antisense sequence to polyGal mRNA is producedproduced

•antisense sequence binds to polyGal mRNA antisense sequence binds to polyGal mRNA and blocks production of the enzymeand blocks production of the enzyme

•Vector also contains antibiotic resistance to Vector also contains antibiotic resistance to kanamycin as marker kanamycin as marker

Antisense TechnologyAntisense TechnologyBlocks the expression of a gene by producing Blocks the expression of a gene by producing a product that combines with mRNA from the genea product that combines with mRNA from the gene

3’-TACGGTCGCCTG-5’3’-TACGGTCGCCTG-5’5’-ATGCCAGCGGAC-3’5’-ATGCCAGCGGAC-3’SenseSense

strandstrand

Original GeneOriginal GeneTemplateTemplate

Antisense construct Antisense construct

5’-ATGCCAGCGGAC-3’5’-ATGCCAGCGGAC-3’3’-TACGGTCGCCTG-5’3’-TACGGTCGCCTG-5’

AUGCCAGCGGACAUGCCAGCGGACmRNAmRNA

UACGGUCGCCUGUACGGUCGCCUG AntisenseAntisenseproductproduct

mRNA cannot be translated mRNA cannot be translated

5’-AUGCCAGCGGAC-3’5’-AUGCCAGCGGAC-3’mRNAmRNA

3’-UACGGUCGCCUG-5’3’-UACGGUCGCCUG-5’ AntisenseAntisenseproductproduct

Promoter Promoter

Plant ImprovementsPlant ImprovementsImproved Food QualityImproved Food Quality

Nutrient Nutrient Enhanced Enhanced FoodsFoods

Rice with beta-carotene and extra Rice with beta-carotene and extra iron iron

Improved Protein CornImproved Protein Corn

Improved Oil CanolaImproved Oil Canola

““Golden” riceGolden” rice

Plant ImprovementsPlant Improvements

Pharmaceutical Production in PlantsPharmaceutical Production in Plants

1.1. Soy and Corn seeds Soy and Corn seeds for production and for production and storage of protein storage of protein productsproducts

CytokinesCytokines

Blood Clotting FactorsBlood Clotting Factors

2.2. Transgenic vegetables Transgenic vegetables as vaccinesas vaccines

Vaccine against Vaccine against travelers diarrhea in travelers diarrhea in potatoespotatoes

3.3. Pharmaceutical Pharmaceutical delivery by delivery by RhizosecretionRhizosecretion

Tested with jellyfish Tested with jellyfish proteinprotein

Plant ImprovementsPlant ImprovementsTextile, paper and wood productsTextile, paper and wood products

1.1. Changes to facilitate Changes to facilitate manufacturingmanufacturing

Gene for biodegradable Gene for biodegradable plastic introduced into cottonplastic introduced into cotton

Bacteria producing blue dyeBacteria producing blue dye

2.2. Introduction of Introduction of herbicide resistance herbicide resistance

Roundup Ready CottonRoundup Ready Cotton

3.3. Resistance to pestsResistance to pests Bt cotton, Bt treesBt cotton, Bt trees

Applying Your KnowledgeApplying Your Knowledge

A.A. Which Which plantplant ha has a gene for an altered amino acid s a gene for an altered amino acid synthesis EPSPS enzymesynthesis EPSPS enzyme? ?

B.B. Which Which plant makes its own pesticideplant makes its own pesticide??

C.C. Which Which plant plant provides beta-caroprovides beta-carotene, a precursor tene, a precursor to Vitamin Ato Vitamin A? ?

1.1. Golden RiceGolden Rice2.2. Improved Oil CanolaImproved Oil Canola3.3. Roundup Ready SoybeansRoundup Ready Soybeans4.4. Bt cornBt corn5.5. Flavr-Savr TomatoFlavr-Savr Tomato

What Are the Concerns?What Are the Concerns?