Upload
others
View
6
Download
0
Embed Size (px)
Citation preview
All genes available for an organism to use -- a
very important tool for biologists
ليتوافر كل جينات الكائن الحي لإلستخدام بواسطة علماء األحياء
Not just sequence of genes, but also positioning
of genes and sequences of regulatory regions
تسلسل الحمض النووي يعني تحديد مواقع الجينات وتسلسل مواقع التنظيم
New recombinant DNA constructs must be
sequenced to verify construction or positions of
mutations
بناء الحمض النووي المؤتلف لتحقيق البناء أو تموضع الطفرات
Nitrogenous Bases القواعد النيتروجينية
Nucleosides النيكليوتيدات
Base linked to a 2-deoxy-D-ribose at 1’ carbon
1إرتباط القاعدة النيتروجينة مع السكر عند ذرة الكربون’
• Nucleosides with a phosphate at 5’ carbon
5-إرتباط النيكليوسايد مع الفوسفات عند ذرة الكربون •
Determining the Sequence of DNA تحديد تسلسل الحمض النووي
• Methods:
:الطرق •
Chain termination or dideoxy method
ديوكسي-فك إرتباط السلسلة أو دي. 1
– F. Sanger
سانقر –
Shotgun sequence method
طريقة التسلسل القسري
2nd generation sequence methods
(بايرو التسلسل)طرق الجيل الثاني
– Pyrosequencing
(Sanger) Method طريقة سانقر
• 4 Steps:
أربع خطوات •
Denaturation
المسخ
Primer attachment and extension of bases
لصق البادئات وتوسيع القواعد
Termination
اإلنتهاء
Gel electrophoresis
هالم الرحالن الكهربي
for dideoxy sequencing you need: :اإلحتياجات -
Single stranded DNA template
خيط مفرد من الحمض النووي كقالب
A primer for DNA synthesis
بادئة لتخليق الحمض النووي
DNA polymerase
إنزيم بولي ميريز الحمض النووي
Deoxynucleoside triphosphates and
dideoxynucleotide triphosphates
دينيكليوتايد ثالثي الفوسفتيز-ديوكسي نيكايوتايد ثالثي الفوسفتيز ودي
Oligonucleotide primers can be synthesized by phosphoramidite chemistry--usually designed manually and then purchased
نيكليوتايد أحادي، عادة يتم تصميمها يدويا ومن ثم شراؤها
Sequence of the oligo must be complimentary to DNA flanking sequenced region
يجب أن يكون تسلسل األحادي مكمال ألجنحة الحمض النووي في منطقة التسلسل
Oligos are usually 15-30 nucleotides in length
نيكليوتيدة في طولها 30-15األحاديات تكون دائما
Single stranded DNA isolated from
recombinant M13 bacteriophage containing
DNA of interest
يعزل الخيط األحادي للحمض النووي من البكتريا التي تحوي الحمض
النووي تحت الدراسة
Double-stranded DNA that has been
denatured
خيط مزدوج من الحمض النووي الممسوخ
Non-denatured double stranded DNA (cycle
sequencing)
خيط مزدوج من الحمض النووي غير الممسوخ
Should be highly processive, and incorporate ddNTPs efficiently
يجب أن يكون عالي المعالجة له القدرة على دمج اإلنزيم بكفاءة عالية
Should lack exonuclease activity
يفتقد للنشاط خارج النواة
Thermostability required for “cycle sequencing”
مستقر حراريا، مطلوبة لدورات التسلسل
(Sanger) Method مختصر طريقة سانقر
(Sanger) Method مختصر طريقة سانقر
• Run four separate reactions each with different ddNTPs
إجراء أربع تفاعالت •
مختلفة• Run on a gel in four separate lanes
إجراء اإلختبار على •
الهالم• Read the gel from the bottom up
قراءة الهالم من أسفل •
الى أعلي
The dideoxy method is good only for 500-750bp reactions
زوج 750-500تعتبر هذه الطريقة مثالية فقط للتفاعالت من
قواعد نيتروجينة
Expensive
مكلفة
Takes a while
تأخذ الكثير من الوقت
The human genome is about 3 billion bp
بليون زوج قاعدة 3)ال يمكن إستخدامها في الجينوم البشري
نيتروجينة
Began in 1990
1990بدأ في العام
Why?
األسباب
Human evolution
التطور البشري
Nature versus nurture
الطبيعة مقابل التغذية
Causes of disease
مسببات األمراض
Used to sequence whole genomes
يستخدم لتسلسل كل الجينوم
Steps:
الخطوات
DNA is broken up randomly into smaller fragments
كسر الحمض النووي عشوائيا
ألجزاء صغيرة
Dideoxy method produces reads
تطبيق طريقة سانقر
Look for overlap of reads
تحديد التداخالت
Strand Sequence
First Shotgun Sequence AGCATGCTGCAGTCATGCT-------
-------------------TAGGCTA
Second Shotgun Sequence AGCATG--------------------
------CTGCAGTCATGCTTAGGCTA
Reconstruction AGCATGCTGCAGTCATGCTTAGGCTA
Sequencing by synthesis
التسلسل بالتخليق
Advantages:
المزايا:
Accurate
دقيق
Parallel processing
معالجة متوازية
Easily automated
سهولة في عمله آليا
Eliminates the need for labeled primers and nucleotides
ال يحتاج الى بادئات معرفة ونيكليوتيدات
No need for gel electrophoresis
ال يحتاج لهالم الرحالن الكهربي
Basic idea:
الفكرة األساسية
Visible light is generated and is proportional to the number of incorporated nucleotides
تسليط إضاءة مرئية تتناسب مع عدد النيكليوتيدات المدرجة
1pmol DNA = 6*1011 ATP = 6*109 photons at 560nm
Smaller sequences
تسلسالت صغيرة
Nonlinear light response after more than 5-6 identical nucleotides
نيكليوتيدات متماثلة 6-5عدم وجود رد فعل للضوء بعد