Allison L H Jack Curriculum vitae September 15, 2013

NSF-IRFP Postdoctoral fellow allison.jack@wur.nl Phytopathology, Jos Raaijmakers’ group Skype allison.jack Wageningen University 6706 ET Wageningen, The Netherlands Currently on one-year leave from: Agroecology Faculty Member, Director Jenner Farm allison.jack@prescott.edu Prescott College www.agroecologyaz.wordpress.com Prescott, AZ 86303 www.facebook.com/PrescottCollegeJennerFarm

www.youtube.com/AllisonLHJack

EDUCATION 2012 PhD Cornell University, Ithaca, NY Plant Pathology, Department of Plant Pathology and Plant-Microbe Biology Concentrations: Microbiology, Adult and Extension Education

Dissertation: Vermicompost suppression of Pythium aphanidermatum seedling disease: Practical applications and an exploration of the mechanisms of disease suppression

2005 MS Cornell University, Ithaca, NY

Major: Soil Science, Department of Crop and Soil Sciences

Thesis: Microbial ecology of compost amendments in organic agriculture 2000 BA Reed College, Portland, OR

EMPLOYMENT 2013 - 2014 Postdoctoral fellow [NSF-IRFP]

Harnessing biodiversity for sustainable agriculture: The metagenomics of disease suppressive soils Wageningen University: Phytopathology

2012 - present Agroecology Faculty Member, Director Prescott College Jenner Farm Environmental Studies Program Prescott College, Prescott, AZ

PUBLICATIONS

Research articles Chen, M-H, ALH Jack, IC McGuire, EB Nelson (2012) Seed-colonizing bacterial communities

associated with the suppression of Pythium seedling disease in a municipal biosolids compost. Phytopathology 102(5): 478-489.

http://dx.doi.org/10.1094/PHYTO-08-11-0240-R Jack, ALH, A Rangarajan, SW Culman, T Sooksa-Nguan and JE Thies (2011) Choice of

organic amendments in tomato transplants has lasting effects on bacterial rhizosphere communities and crop performance in the field. Applied Soil Ecology 48(1): 94-101.

http://dx.doi.org/10.1016/j.apsoil.2011.01.003 Shelly, T, E Villalobos and the students of the 1997 OTSUSAP (2000) Buzzing bees

(Hymenoptera: Apidae, Halictidae) on Solanum (Solanaceae): Floral choice and handling time track pollen availability. Florida Entomologist 83(2): 180-187.

http://www.jstor.org/stable/3496153 Research articles – In preparation Jack, ALH and EB Nelson. Seed colonizing microbes alter zoospore chemotaxis and

encystment of the oomycete plant pathogen Pythium aphanidermatum. PLoS Pathogens

Liu, Y, I deBruijn, ALH Jack, K Drynan, H van den Berg, I Skaar, E Thoen, JV Sandoval-Sierra,

P van West, J Dieguez-Uribeondo, M van der Voort, R Mendes, M Mazzola, JM Raaijmakers. Deciphering the salmon egg microbiome: Towards mitigation of the emerging disease Saprolegniosis. Nature

Jack, ALH, EA Carr, TE Herlihy, EB Nelson. Untangling the complex world of liquid compost

extracts: A case study on the development and characterization of a disease suppressive non-aerated liquid vermicompost extract. Renewable Agriculture and Food Systems

Bonhotal, J, M Schwarz, ALH Jack, D Olmstead, EZ Harrison. Compost quality assessment for

use in horticulture: impact of the composting process. Biological Agriculture and Horticulture

Jack, ALH, E Chapelle, R Gomez-Esposito, JM Raaijmakers. Comparative metagenomics of

disease suppressive soils. Conference papers, abstracts & book chapters Jack, ALH (2010) The suppression of plant pathogens by vermicomposts. in Vermiculture

Technology: Earthworms, Organic Wastes and Environmental Management Edwards,

CA, Arancon, NQ, and Sherman, RL eds. CRC Press Boca Raton, FL Pp. 165-181 Jack, ALH and EB Nelson (2008) Modification of seed exudates by seed-colonizing microbes

from vermicompost alters pre-infection behavior of Pythium aphanidermatum zoospores. Phytopathology 98:6 S73 (meeting abstract)

Jack, ALH and JE Thies (2006) Compost and vermicompost as amendments promoting soil

health, in Biological Approaches to Sustainable Soil Systems NT Uphoff, Ed. CRC

Press: Boca Raton, FL Pp. 453-466. Hornor, AL, A Rangarajan, BA Ingall, M Wells, JE Thies (2004) Bacterial communities in

potting mix amendments and the rhizospheres of organic tomato starts: Effects on seedling vigor and yield. Proceedings of the 14th Annual USCC meeting: San Antonio, TX

Adult and Extension Education – Agriculture Education – Extension publications Interviewed in Cherney, M (2013) Society of the Quarter: Sustainable Agriculture Education

Association. Journal of Agricultural and Food Information 14(2): 98-102.

http://dx.doi.org/10.1080/10496505.2013.776457 Jack, ALH and SJ Peters (2010) “A Sense of Communion” A Profile of Anu Rangarajan in

Democracy and Higher Education: Traditions and Stories of Civic Engagement. Peters,

SJ Michigan State University Press, 400 p. http://msupress.msu.edu/bookTemplate.php?bookID=4059 Peters, SJ, DJ O’Connell, TR Alter, and ALH Jack eds. (2006) Catalyzing Change: Profiles of

Cornell Cooperative Extension Educators from Greene, Tompkins, and Erie Counties,

NY. Cornell University 190 pgs. http://srdc.msstate.edu/tide/files/resources/catalyzingchange-peters.pdf

Jack, ALH (October 27, 2006) This election season, a vote for worms is a vote for

sustainability. Ithaca Journal - Down to Earth Column.

GRANTS & AWARDS As a principal investigator 2013 Prescott College Sustainability Council (ALH Jack & M Hyde) Connecting the

dots for solar power infrastructure at Prescott College Jenner Farm [$1,500 with a private donor match]

2012 NSF International Research Fellowship Program (ALH Jack) Harnessing

biodiversity for sustainable agriculture: The metagenomics of disease suppressive soils [$173,056] to work in Dr. Jos Raaijmakers’ lab at Wageningen University in the Netherlands

As a collaborator – co-author 2008-2010 USDA Small Business Innovation Research Phase I & II [USDA-SBIR] (ALH

Jack, EB Nelson, TE Herlihy) Development of plant protection products based on

vermicomposted dairy manure In collaboration with RT Solutions, makers of Worm Power vermicompost [I $80,000 II $350,000]

2007-2010 NY State Foundation for Science, Technology and Innovation [NYSTAR] (ALH

Jack, EB Nelson, TE Herlihy) matching funds for USDA SBIR project [$95,000]

2008 New York Farm Viability Institute [NYFVI] (ALH Jack, EB Nelson, A Rangarajan,

C Nicholson, J Bonhotal) Potential use of vermicompost as a substitute for synthetic inputs to horticulture and nursery production [$120,000]

2007-2008 Organic Farming Research Foundation [OFRF] (ALH Jack & EB Nelson)

Suppression of Pythium damping off with compost and vermicompost [$20,000] 2006 USDA-CSREES Hatch: Research funds (EB Nelson, A Rangarajan & ALH Jack)

Compost use for biological control of Pythium damping-off in cucumber and peas [$20,000]

2004-5 Toward Sustainability Foundation [TSF]: Research grant (JE Thies, A

Rangarajan, AL Hornor, T Pilinaro [2005 only]) Evaluating impacts of organic

transplant media on plant growth and root rhizosphere bacterial communities [$16,000]

2004 Organic Farming Research Foundation [OFRF]: Research grant (AL Hornor &

JE Thies): Detecting and monitoring human pathogens in vermicompost and compost tea – Year 2 [$8,203]

2003 Organic Farming Research Foundation [OFRF]: Research grant (AL Hornor):

Brewing and handling vermicompost tea to avoid human and plant pathogens – Year 1 [$4,500]

2002 Metro Regional Parks and Greenspaces (AL Hornor and S Taylor) Greenspaces

Program Environmental Education Grant for Environmental Middle School’s “Wildlife Tours” providing natural history educational experiences in Portland’s parks for at risk grade school students taught by middle school students

1999 National Science Foundation Award for the Integration of Research and

Education [NSF-AIRE] (AL Hornor and DA Dalton) Fellowship Recipient

1999 Howard Hughes Medical Institute Research Grant [HHMI] (AL Hornor & DA

Dalton) Seasonal and spatial variation of superoxide dismutase and glutathione reductase in an old-growth Pseudotsuga menziesii canopy

Awards - Scholarships 2011 ChloroFilms Plant Videos on YouTube, American Society of Plant Biologists:

Second Prize – General category [$250] Vermicompost and Pythium suppression (ALH Jack, J Bonhotal, A Michel and P Wilde producers)

2010 American Phytopathological Society (APS) Office of Public Relations and

Outreach video contest: Grand prize winner [$500] Vermicompost and Pythium suppression (J Bonhotal, ALH Jack, A Michel and P Wilde producers)

2010 CU Center for Life Science Enterprise: Second prize poster at the Public

Engagement and Science Communication event hosted by the Cornell Center for Life Science Enterprise [$1,000] (ALH Jack, E Carr, TE Herlihy, EB Nelson) How

does vermicomposted dairy manure protect plants from disease?

2008 CU Center for Life Science Enterprise: First prize poster at the Public

Engagement and Science Communication event hosted by the Cornell Center for Life Science Enterprise [$10,000] (ALH Jack, TE Herlihy, EB Nelson)

Developing plant protection products from vermicomposted dairy manure 2007 Organic Crop Improvement Association [OCIA]: Student Research Scholarship to

ALH Jack [$1,000]

2006 Cornell University College of Agriculture and Life Sciences: Andrew W. Mellon

Student Research Grant to ALH Jack [$1,100]

2004 Cornell University Department of Crop and Soil Science: MacDonald/Musgrave

Graduate Student Award for Excellence to AL Hornor [$1,500]

2003 Cornell University College of Agriculture and Life Sciences Office of Academic

Programs: Outstanding Teaching Assistant to AL Hornor

PRESENTATIONS

Scientific conference presentations 2013 The host microbiome and plant health: Seed colonizing microbes from disease

suppressive vermicompost alter zoospore chemotaxis, encystment and germination of Pythium aphanidermatum. Bacterial Genetics and Genomics meeting in Ljubljana, Slovenia June 9-13 (Poster with EB Nelson)

2010 Seed colonizing microbes alter zoospore chemotaxis and encystment of the oomycete plant pathogen Pythium aphanidermatum. International Society for

Microbial Ecology meeting in Seattle, WA August 22-17 (Poster with EB Nelson)

2010 Seed colonizing microbes alter zoospore chemotaxis and encystment of the oomycete plant pathogen Pythium aphanidermatum. Ecology and Evolution of

Infectious Diseases conference, Ithaca, NY June 2-5 (Poster with EB Nelson) 2008 Modification of seed exudates by seed-colonizing microbes from vermicompost alters

pre-infection behavior of Pythium aphanidermatum zoospores. American

Phytopathological Society Minneapolis, MN July 26-28 (Talk, EB Nelson co-author) 2004 Human pathogens in compost tea: development of a PCR-based assay for the

detection of shiga-toxin producing human pathogens & Potting mix amendments for organic tomato production: Bacterial rhizosphere communities. Soil and Compost Eco-biology, Leon, Spain September 15-17 (2 posters with JE Thies)

Conference presentations and invited talks – grower and industry events

2013 Liquid compost extracts: Fact and fiction. Glenstone Roundtable for landscape managers, Potomac, MD October 11-12 (Invited talk via videoconference)

2012 Disease suppressive composts and liquid compost extracts: The importance of microbial ecology in product development and use. Northeast Organic Research Symposium, Saratoga Springs, NY January 20-22 (Invited talk)

http://youtu.be/wXyy3qaDmgY Q&A http://youtu.be/101YdSjJ4I0 2011 Suppression of Pythium aphanidermatum with vermicompost and non-aerated liquid

vermicompost extract. Elzinga-Hoeksema, Kalamazoo, MI (Invited greenhouse industry talk)

2011 Vermicomposted dairy manure for Pythium suppression and plant nutrient

management. Bioworks, Victor, NY (Invited biocontrol industry talk) 2010 Disease suppressive soils and composts: What does the science tell us? Midwest

Organic and Sustainable Education Service 21st annual Organic Farming Conference, La Crosse, WI February 25-27 (Invited talk with A. Stone, Oregon State University)

2010 What makes compost disease suppressive? Empire State Fruit and Vegetable Expo

& Farmer’s Direct Marketing Conference, Syracuse, NY January 25-27 (Invited talk)

2010 Vermicompost use in greenhouse production: Nutrient management and disease suppression. Cornell Cooperative Extension Suffolk County 29th annual Long Island Agricultural Forum, Riverhead, NY January 14-15 (Invited talk)

2009 Compost and microbial disease suppression. Cornell Cooperative Extension Hudson Valley High Tunnel Production Seminar, Kingston, NY December 8 (Invited talk with N. Mattson, Cornell University)

2006,8,9 Vermicompost and Non-aerated liquid vermicompost extract use in horticulture. North Carolina State University Vermicomposting Workshop, Raleigh, NC various dates (Invited talks)

2007 Master Gardener Training, Cornell University. The world beneath our feet: Exploring

soil life (Invited talk with J. Gruttadaurio, Cornell University) 2006 Vermicompost production and use. Small Farms Expo: Cornell, Rutgers and Penn

State Cooperative Extension, Augusta, NJ (Invited talk) 2005 Compost and compost tea: The nuts and bolts of biological control. Pennsylvania –

Delaware Integrated Pest Management: Soil Health Conference, Villanova University, PA (Invited talk)

2005 Compost teas: plant disease suppression and NOP regulations. New York Certified

Organic, Geneva, NY (Invited talk) 2005 Compost tea: Plant disease suppression and organic regulations. Northeast Organic

Farming Association, Syracuse, NY (Invited talk with M. Ryan Pennsylvania State University/ Rodale Institute)

2005 Potting mix amendments for organic tomato production: Bacterial rhizosphere communities, growth promotion and disease suppression. US Composting Council, San Antonio, TX (Compost industry talk)

2004 Human pathogens in vermicompost and compost teas. Organic Farming Research

Foundation – Green Grange, Santa Cruz, CA (Invited talk) 2004 Compost teas in organic agriculture. Northeast Organic Farming Association,

Syracuse, NY (Invited talk with B. Caldwell, NOFA-NY Farm Education Coordinator) 2004 Microbial ecology of vermicompost and compost teas. US Composting Council, Las

Vegas, NV (Compost industry talk) Conference presentations and invited talks – Education

2010 Building a sustainable agriculture education program at your institution. Midwest Organic and Sustainable Education Service 21st annual Organic Farming Conference, La Crosse, WI February 25-27 (Invited workshop with R Ritson, Iowa State, and A. Anderson-Mba, Iowa Farmers’ Union)

CAMPUS TALKS 2013 Panel: Political ecology of justice and bio-cultural diversity for PhD students in

Sustainability Education at Prescott College. A life scientist’s adventures in community organizing. Prescott College, Prescott, AZ (Invited panel)

2008 Cornell Department of Crop and Soil Sciences Seminar Series. Vermicompost:

Horticultural applications and impacts on plant-associated microbial communities (Invited seminar with T. Herlihy, RT Solutions, LLC)

2006 Cornell Institute for Food Agriculture and Development – Agroecological

Perspectives for Sustainable Development seminar series. Vermicompost production and use for plant disease suppression (Invited seminar)

2004 Cornell Institute for Food Agriculture and Development – Agroecological

Perspectives for Sustainable Development seminar series. Using vermicompost and compost teas: Emerging practices in sustainable agriculture (Invited seminar)

TEACHING Instructor of record 2012 Security, Equality and Ecology of Global Food Production

Land Stewards Prescott College, Environmental Studies Program

2008 Symbiotic Associations in Nature Cornell University, Department of Plant Pathology and Plant-Microbe Biology

Teaching Assistant Positions 2011 Magical Mushrooms, Mischievous Molds

Cornell University, Department of Plant Pathology and Plant-Microbe Biology 2006 Issues in Sustainable Agriculture Education

Cornell University, Department of Horticulture 2003-2005 Soil Ecology

Introductory Soil Science Cornell University, Department of Crop and Soil Sciences

RESEARCH 2007-2012 Graduate Research Assistant [USDA-SBIR – NYSTAR – OFRF]

Vermicompost mediated suppression of Pythium damping off Cornell University, Department of Plant Pathology and Plant-Microbe Biology

2008-2010 Project coordinator [NY Farm Viability Institute] Potential use of vermicompost as a substitute for synthetic inputs to horticulture and nursery production Cornell University, Department of Plant Pathology and Plant-Microbe Biology Project outreach site: http://www.css.cornell.edu/cwmi/vermicompost.htm

2005-2007 Graduate Research Assistant [USDA-CSREES] Seed colonizing microbial communities

Cornell University, Department of Plant Pathology and Plant-Microbe Biology 2003-2004 Graduate Research Assistant [TSF & OFRF]

Organic transplant media amendments and rhizosphere bacterial communities & Human pathogens in compost teas Cornell University, Department of Crop and Soil Sciences

2002 Graduate Research Assistant [USDA-CSREES] Apple replant disease & Non-target effects of Bt corn

Cornell University, Department of Crop and Soil Sciences

SERVICE TO PROFESSION Ad hoc reviewer (2007 to present):

Applied Soil Ecology Phytopathology European Journal of Plant Pathology Plant Disease FEMS Microbiology Ecology Pedobiologia Scientia Horticulturae Biocontrol Science and Technology Compost Science and Utilization

Sustainable Agriculture Education Association 2007 Conference Steering Committee

2nd National Conference on Facilitating Sustainable Agriculture Education http://sustainableaged.org/Conferences/2007CornellUniversity/tabid/68/Default.aspx

2009 - present Curriculum Library Committee (Chair since 2013) Manage online curriculum database, working with National Agriculture Library to develop a new digital platform

UNIVERSITY SERVICE

2012 Prescott College Environmental Studies Program Fall colloquium organizer, Speakers:

Scott Perez, La Plata Open Space Conservancy http://agroecologyaz.wordpress.com/2012/11/07/land-conservancies-in-the-sw/

Sandor Katz (for National Food Day), Author of “The Art of Fermentation” http://agroecologyaz.wordpress.com/sandor-katz-10-24/

2005-2012 New World Agriculture and Ecology Group at Cornell – Secretary, Treasurer

Cornell University Graduate Student Association Hosted 2005 NWAEG International Annual Meeting

2006 – 2012 Managing Organic Residuals Program Work Team (run by Cornell Waste Management Institute)

2006 – 2012 Organic Production and Marketing Program Work Team (run by Cornell Small

Farms Program & Northeast Organic Network: NEON) 2004-2005 Soil and Crop Science Graduate Student Association – Treasurer

COMMUNITY INVOLVEMENT

2006-2008 Project Growing Hope: Ithaca Community Garden Composting system coordinator

2003-2009 Master Composters Tompkins County Cornell Cooperative Extension Taught community composting classes and trained new MC volunteers 2000-2002 Master Recycler Volunteer Oregon State University Cooperative Extension Community waste reduction education and vermicompost consulting

MEDIA COVERAGE

Interviewed in Ungerman, G and Wear, S (2013) Respectful Revolution [documentary film project] Allison Jack – The Art and Science of Compost http://respectfulrevolution.org/#/road/videos/allison_jack_art_science_compost

Quoted in Robbins, J (January 1, 2013) Worms produce another kind of gold for growers. New York Times Science section.

http://www.nytimes.com/2013/01/01/science/worms-produce-another-kind-of-gold-for-farmers.html

Quoted in Munzer, A (December 21, 2011) Worm compost can suppress plant disease, regulate

nutrients, research finds. Cornell Chronicle Online. http://www.news.cornell.edu/stories/Dec11/Vermicompost.html

Brief television interview on Rochester PBS affiliate WXII’s “Innovation Trail” Seward, Z

(November 9, 2010) Worm Power: High tech composting? http://www.innovationtrail.org/post/worm-power-high-tech-composting

Now online at: http://youtu.be/Dx-3zWbs1YM

Interviewed in Jin, J (November 3, 2010) Earthworm compost prevents crop diseases. Cornell Daily Sun http://cornellsun.com/node/44518

Quoted in Stinson, J (October 8, 2010) Business keeps worms “fat, dumb and happy” Rochester

Democrat and Chronicle, Business section http://cwmi.css.cornell.edu/businesskeepsworms.pdf

Interviewed for the blog Redwormcomposting.com by Christie, B (November 7, 2008) Interview

with Allison Jack http://www.redwormcomposting.com/interviews/interview-with-allison-jack/

LANGUAGES

Spanish

Reading - fluent Speaking - proficient Writing - proficient

PROFESSIONAL ASSOCIATIONS

Member since:

2010 International Society for Microbial Ecology (ISME) 2010 eOrganic – Vegetable Disease Management Group 2008 American Phytopathological Society (APS) 2007 American Association for the Advancement of Science (AAAS) 2007 Sustainable Agriculture Education Association (SAEA)

PROFESSIONAL DEVELOPMENT 2012 Border Food Summit, Southwest Marketing Network annual meeting Rio Rico,

AZ & Urban agriculture tour in Tucson, AZ 2012 Sustainable Agriculture Education Association, The campus food system, a

learning laboratory, Corvallis, OR

2007 Science Communication Workshop, semester long workshop on communicating

science to the public through various media 2006 Communication in Science, Biogeochemistry and Environmental Biocomplexity

Workshop/Retreat, Institute for Ecosystem Studies (IES) Millbrook, NY 2006 Advanced Facilitation Training, open space and world café group facilitation

techniques, Cornell Small Farms Program, Syracuse, NY 2006 Facilitating Sustainable Agriculture Education, A Participatory National

Conference on Post-Secondary Education, Hosted by UC Davis and UC Santa Cruz, Pacific Grove, CA

2004 Grow Biointensive, Three day workshop on sustainable mini-farming with

“greenhouse guru” Steve Moore, John Jeavons and John Doran Spring Grove, PA

2004 BioCycle Annual conference: Composting, Organics Recycling and Renewable

Energy, Philadelphia, PA 2003 Compost Short Course, Three day workshop on large-scale agricultural

composting hosted by Cornell Waste Management Institute 2003 National Summit on Human Pathogens from Livestock Manures, Hosted by

Oregon Tilth and Oregon State University Cooperative Extension 2003 Pennsylvania Association for Sustainable Agriculture, Northeast Organic Network

field days Nordell’s Farm Beech Grove, PA REFERENCES Jos Raaijmakers Wageningen University Laboratory of Phytopathology PO Box 8025 6700 EE Wageningen The Netherlands +31 0317 48 34 27 jos.raaijmakers@wur.nl

Eric Nelson Cornell University Department of Plant Pathology and Plant-Microbe Biology 334 Plant Science Building Ithaca, NY 14853 (607) 255-7841 ebn1@cornell.edu Scott Peters Syracuse University

This article appeared in a journal published by Elsevier. The attachedcopy is furnished to the author for internal non-commercial researchand education use, including for instruction at the authors institution

and sharing with colleagues.

Other uses, including reproduction and distribution, or selling orlicensing copies, or posting to personal, institutional or third party

websites are prohibited.

In most cases authors are permitted to post their version of thearticle (e.g. in Word or Tex form) to their personal website orinstitutional repository. Authors requiring further information

regarding Elsevier’s archiving and manuscript policies areencouraged to visit:

http://www.elsevier.com/copyright

Author's personal copy

Applied Soil Ecology 48 (2011) 94–101

Contents lists available at ScienceDirect

Applied Soil Ecology

journa l homepage: www.e lsev ier .com/ locate /apsoi l

Choice of organic amendments in tomato transplants has lasting effects onbacterial rhizosphere communities and crop performance in the field

Allison L.H. Jacka,∗, Anusuya Rangarajanb, Steven W. Culmanc, Thanwalee Sooksa-Nguand,1,Janice E. Thiese

a Department of Crop and Soil Sciences, Cornell University, 706 Bradfield Hall, Ithaca, NY 14853, United Statesb Department of Horticulture, Cornell University, 121 Plant Science, Ithaca, NY 14853, United Statesc Kellogg Biological Station, Michigan State University, 3700 E Gull Lake, Hickory Corners, MI 49060, United Statesd Department of Crop and Soil Sciences, Cornell University, 610 Bradfield Hall, Ithaca, NY 14853, United Statese Department of Crop and Soil Sciences, Cornell University, 719 Bradfield Hall, Ithaca, NY 14853, United States

a r t i c l e i n f o

Article history:Received 12 October 2010Received in revised form23 December 2010Accepted 6 January 2011

Keywords:Tomato (Lycopersicon esculentum)VermicompostCompostSesame mealAlfalfa mealRhizosphere bacteriaOrganic agricultureTransplant mediaT-RFLPANOSIMAMMIperMANOVA

a b s t r a c t

Vegetable transplant media used in certified organic crop production must both comply with regulationsand meet seedling nutrient demand. Transplant media amendments allowable in organic productionoften contain complex microbial communities, however little is known about their effects on transplantrhizosphere microorganisms and if these effects carry over to mature plants in the field. To address this,we compared (i) plant-based (sesame meal, alfalfa meal) amendments, (ii) composted manure-based(vermicompost, thermogenic compost, industry standard) amendments and (iii) a non-amended peatand vermiculite base mix for organic tomato (Lycopersicon esculentum) production. Organic transplantmedia amendments affected germination rates, transplant growth in the greenhouse, crop growth in thefield and final yields. Transplant biomass and early yield were highest for vermicompost and plant-basedamendments. Total yield was highest for 20% alfalfa and sesame meal amendments in the first season,however this high rate of amendment negatively impacted germination. No significant differences inyield were found among amended treatments in the second season where plant-based amendment rateswere reduced to1 and 2.5% for sesame meal and 5% for alfalfa meal. Amendments also influenced bac-terial community structure in both the transplant media and in the rhizosphere of the tomato plants.Terminal restriction fragment length polymorphism (T-RFLP) analysis showed significant differences inbacterial communities between all amendments and these differences persisted for at least one monthafter seedlings were transplanted to the field. Amendment-associated differences in bacterial commu-nities diminished over the course of the field season. By harvest only vermicompost and the base mediahad unique T-RFLP profiles. Comparing thermogenic compost and vermicompost made from the samestarting material showed that the composting process influenced the bacterial community in the trans-plant material as well as subsequent communities in the crop rhizosphere. Overall, our results showthat the type and rate of organic transplant media amendment can strongly influence transplant qualityand subsequent crop performance in the field as well as rhizosphere bacterial communities long afterseedlings are transplanted to field soil.

© 2011 Elsevier B.V. All rights reserved.

1. Introduction

Production of uniform, vigorous vegetable transplants is thefirst step to ensuring rapid crop establishment and good perfor-

∗ Corresponding author. Current address: Department of Plant Pathology andPlant Microbe Biology, Cornell University, 335 Plant Science Building, Ithaca, NY14853, United States. Tel.: +1 607 255 7842; fax: +1 607 255 4471.

E-mail address: alh54@cornell.edu (A.L.H. Jack).1 Current address: Faculty of Medical Technology, Nakhonratchasima College, 290

Mittraphap Rd., Muang, Nakhonratchasima 30000, Thailand.

mance in the field. In certified organic crop production, transplantmedia ingredients need to comply with USDA National OrganicProgram Standards (USDA-NOP, 2002) and provide adequate lev-els of essential plant nutrients to produce high quality transplants(Russo, 2005). Finding amendments that meet both of these criteriacan be a challenge for organic growers. Organic transplant mediausually consist of peat and vermiculite or perlite amended withdolomitic limestone, rock phosphate and greensand. Nitrogen (N)is supplied by either plant-based (alfalfa or soy meal, sesame cake,kelp/seaweed, etc.) or animal-based (composted manure, bloodmeal, fish emulsion or meal) amendments. In contrast to syntheticsources of N, these organic amendments contain and/or support

0929-1393/$ – see front matter © 2011 Elsevier B.V. All rights reserved.doi:10.1016/j.apsoil.2011.01.003

Author's personal copy

A.L.H. Jack et al. / Applied Soil Ecology 48 (2011) 94–101 95

complex microbial communities whose impact on crop perfor-mance is difficult to predict.

Composts are one type of organic transplant medium amend-ment that provide plant available nutrients (Sanders et al., 2006;Stoffella and Kahn, 2001) and can suppress plant diseases (Hoitinkand Fahy, 1986; Litterick et al., 2004; Weltzien, 1989). Althougha wide variety of composting methods and technologies exist,the two main types are thermogenic compost (self-heating) andvermicompost (earthworm-driven). Alternatives to compost intransplant media for organic production include plant- or animal-based amendments. Alfalfa meal can supply a balanced set ofnutrients when added to soil (Hammermeister et al., 2006), butcan also inhibit plant growth at higher application rates (Biern-baum, unpublished observations). Alfalfa and sesame meals cansuppress diseases caused by certain plant pathogens in pot exper-iments (Gilpatrick, 1969; Hafez and Sundararaj, 1999), but theirdisease suppressive characteristics have not been as thoroughlyinvestigated as soil amendments of Brassica seed meals (Friberget al., 2009; Mazzola et al., 2001). To date, neither alfalfa norsesame meals have been scientifically evaluated as transplantmedia amendments with regards to nutrient management perfor-mance or potential influences on rhizosphere microbial communitystructure.

Composts have well documented impacts on soil and plant-associated microbial communities. Soil microbial communitystructure is transiently altered by compost amendments (Roset al., 2006; Saison et al., 2006) with outcomes depending onfeedstocks used in the composting process (Perez-Piqueres et al.,2006). In some cases these changes were primarily due to thephysiochemical characteristics of the amendment (Saison et al.,2006). However, additional evidence points to the persistenceof amendment-derived microbes especially in association withplants. Germinating seeds are colonized by amendment-derivedmicrobes and this community changes during the transition fromspermosphere to rhizosphere (Green et al., 2006). The rhizospherebacterial community is distinct in compost-amended soil com-pared to non-amended soil (Benitez et al., 2007; Tiquia et al., 2002)and can be comprised of both soil- and compost-derived species(Inbar et al., 2005). Directly amending transplant media and soilswith composts clearly has the potential to alter rhizosphere micro-bial communities. However, it is not known if amendments totransplant media will continue to affect the rhizosphere microbialcommunities of the resulting mature plants after being trans-planted to field soil.

Here, we examined how organic transplant media amendmentsaffected the growth, field performance and rhizosphere bacte-rial communities of organically produced tomato plants. Compost-and plant-based amendments were evaluated as viable substitutesfor synthetic fertilizer in certified organic vegetable transplantproduction. We hypothesized that different amendments wouldsignificantly affect seedling growth and associated rhizospherebacterial communities during production in the greenhouse. Ourgoal was to determine if these early differences in plant-associatedmicroorganisms would persist once seedlings were transplanted tofield soil and if the choice of transplant media amendment wouldinfluence overall agronomic performance of the tomato crop.

2. Materials and methods

2.1. Transplant media preparation and planting

Seven transplant media were prepared for use in greenhouseand field trials (Table 1). A commercially available organic trans-plant medium (SUN) containing peat moss, vermiculite, turkeylitter compost and blood meal (Sungro, Bellevue, WA) was used

Table 1Organic transplant media amendments and ingredients.

Amendment type Abbreviation Medium

None BASE Base medium (control) a

Compostedmanure-based

SUN Sungrob

TC Thermogenic compostc

VC Vermicompost c

Plant-based

AM5 Alfalfa meal 5%AM20 Alfalfa meal 20%SM1 Sesame meal 1%SM2.5 Sesame meal 2.5%SM20 Sesame meal 20%

a Used as a base for all other amendments (except Sungro). Consists of 70 peatmoss: 30 vermiculite (v:v) and ground limestone (2.97 kg m−3).

b Commercial media made of Canadian sphagnum peat moss amended with bloodmeal and turkey litter, perlite, dolomitic lime, and organic wetting agent (Yuccaextract).

c Composts were obtained from different sources in 2004 and 2005 but derivedfrom the same feedstock (dewatered dairy manure solids) using similar compostingprocesses, see Section 2.1 for details.

as an industry standard. A mixture of 70:30 (v:v) peat moss andvermiculite with ground limestone (2.97 kg m−3) was used as anunamended control treatment (BASE) to which organic amend-ments were added. Compost-based amendments were made fromde-watered dairy manure and bedding either thermogenicallycomposted and windrow-cured (TC) or vermicomposted (VC) atthe same facility (2004 – Pacific Garden Company, Millheim, PA,2005 – Worm PowerTM Avon, NY). To make vermicompost, dairysolids were partially thermogenically composted and then fed inthin layers to Eisenia fetida in a continuous flow-through system(Edwards, 1998) for approximately 60 days. Both TC and VC com-posts were sieved to 4 mm before mixing at 20% (v:v) with the BASEmedium. Plant-based organic amendments included; sesame meal(SM) and alfalfa meal (AM) (Eagle Mix 3-1-5 Alfalfa Meal, Bradfield,Inc., Springfield, MO). In 2004, both SM and AM were added to thebase mix at 20% (v:v). In 2005, these amendments were ground to2 mm before incorporating into the BASE medium and rates werereduced to 5% (v:v) for alfalfa meal (AM5), and 1 or 2.5% (v:v) forsesame meal (SM1, SM2.5) (Table 1). Immediately after mixing,each, medium was placed into 98-cell transplant trays and wateredfor one week prior to seeding.

Before planting, sub-samples of all transplant media treatmentsand raw amendments were sent to the University of MassachusettsSoil and Plant Tissue Testing Laboratory (Amherst, MA) for chemi-cal analysis. DNA was extracted from these subsamples as describedbelow. Sampling dates and experimental conditions for both yearsare given in Table 2. Untreated seed of fresh market tomato (Lycop-ersicon esculentum) cv ‘Mt. Fresh’ (Seedway, Elizabethtown, PA)was planted into one 98 cell tray of each transplant medium ina randomized complete block design with five blocks in an organ-ically managed research greenhouse (Guterman Research Facility,Cornell University, Ithaca, NY). Plants were watered daily and noexternal nutrients were added. Germination rates and abovegroundtransplant biomass were recorded 17 and 37 days after planting(DAP), respectively in 2004, and 14 and 30 DAP, respectively in 2005(Table 2). Leaf petiole nitrate was measured with a Cardy meterbefore transplant in 2005.

2.2. Field trials

Field experiments were conducted in certified organic fieldsat the Cornell Organic Research Farm (Freeville, NY), soil type:Howard gravelly loam (Loamy-skeletal, mixed, active, mesic Glos-sic Hapludalfs) (USDA-NRCS, 2008). In both 2004 and 2005, a ryeand vetch cover crop was mowed and then tilled into the soilprior to transplanting. In 2005, a low rate of dairy manure com-

Author's personal copy

96 A.L.H. Jack et al. / Applied Soil Ecology 48 (2011) 94–101

Table 2Crop management and sampling dates of the study. Microbial analyses are in italics.

Event 2004 2005

Transplant media mixed and sampledfor community measurements(Pre-planting media samples)

5/3 5/10

Tomatoes seeded into treatments 5/10 5/17Tomato germination counts 5/27 5/31Transplant biomass recorded and roots

sampled6/16 6/16

(Transplant rhizosphere samples)Field cover crop plowed down 5/12 5/11Raised beds formed 6/15 6/18Tomatoes transplanted to field 6/20 6/21Plants staked and pruned 7/7 7/11Aboveground biomass recorded and

roots sampled (Anthesis rhizospheresamples)

8/9 7/20

Fruit harvest 9/14, 9/20, 9/23,9/27, 10/5

9/14, 9/20,9/27, 10/5

Roots sampled (Harvest rhizospheresamples)

10/5 10/5

post (11.2 MT ha−1) was broadcast over the mowed rye and vetchcover crop prior to tilling it into the soil. No other nutrients wereadded. Each transplant plug contained a small volume of the orig-inal organic amendment that carried over to field soil; 7.35, 1.84,0.92 and 0.37 mL for the amendment rates 20, 5, 2.5 and 1% respec-tively. Raised beds were formed and covered in black plastic anduniformly sized seedlings from each treatment were transplantedin a randomized complete block design with four blocks in 2004and five blocks in 2005. Tomato plants were staked and prunedand copper-based pesticides were applied periodically for diseasecontrol (Table 2).

Three plants from each treatment were cut at the soil line tomeasure anthesis above-ground biomass and leaf petiole nitratewas measured with a Cardy meter. Tomato fruits were harvestedand graded by size for marketability. Weight and number of unmar-ketable or cull fruit were recorded. On October 5, 2004 all greenfruit was picked because of an impending early frost. Fruit yielddata from the first 3 (2004) or 2 (2005) harvests were combined asa measure of early yield.

2.3. Microbial community analyses

DNA was extracted from each medium at pre-planting and fromtomato rhizosphere samples taken at transplanting, anthesis andharvest to track changes in the bacterial community compositionover time (Table 2). Bacterial community composition was exam-ined in 2004 with denaturing gradient gel electrophoresis (DGGE),but high gel-to-gel variability restricted the combined analysis of allreplicate samples (data not shown). As a result, terminal restrictionfragment length polymorphism (T-RFLP) was used as an alternatemethod for bacterial community profiling the following season.DNA for bacterial community analyses was extracted using thePowerSoilTM DNA Isolation Kit (MO BIO Laboratories, Inc., Carlsbad,CA). For each amended medium pre-planting, two separate DNAextractions from two separate grab samples were carried out. Forrhizosphere samples, tomato roots were gently shaken to removeloosely adhering soil/transplant medium particles and then theroots with remaining adhered soil/transplant medium were usedfor DNA extraction. Roots were harvested from 3 plants in eachtreatment at transplanting (n = 3) and from 3 plants in each of the5 replicate field blocks for each treatment (n = 15) at the anthesisand harvest sampling dates for DNA extraction.

Using methods described previously, members of the bacteriadomain were targeted by amplifying 16S rRNA genes from the soilDNA extracts with primers 27f and 1492r (Culman et al., 2006). Two,

replicate 50 �L PCR reactions per sample were performed and sub-jected to separate restriction enzyme digests with both HhaI andSau96I restriction enzymes. Digested DNA was purified and sub-mitted for terminal fragment-size analysis to Cornell University’sBiotechnology Resource Center, Ithaca, NY. The use of multiplerestriction enzymes confirmed trends found in the bacterial data,thus only data from HhaI digests are reported here.

2.4. Statistical analyses

Tomato seed germination rates, aboveground biomass and yielddata were subjected to analysis of variance (ANOVA) using the gen-eral linear model (SAS, Cary, NC) with an ˛ level of 0.05.

Terminal restriction fragment (T-RF) profiles were analyzedin a variety of ways to assess the effects of time, transplantmedia treatments and type of organic amendment (none, com-posted manure-based, plant-based) on bacterial communities.Permutational multivariate analysis of variance (perMANOVA)was used to test the significance of the media amendments andsampling time on bacterial community structure. This test in anal-ogous to multivariate ANOVA, but allows for a more ecologicallyappropriate distance measure than Euclidian distance to be used(Anderson, 2001). PerMANOVA analyses were performed in R (RCore Development Team, 2009) with the adonis function in thevegan package with the Bray-Curtis distance measure and all otherdefault parameters.

T-RF profiles were also analyzed using additive main effectsand multiplicative interaction (AMMI) model to visualize rela-tionships and examine variance between media treatments andsampling time. AMMI analyses were performed with the onlinesoftware T-REX (Culman et al., 2009) using the following settings:noise filtering (peak area, standard deviation multiplier = 1), T-RFAlignment (clustering threshold = 0.5). Finally, pairwise compar-isons of individual transplant media amendments and pairwisecomparisons of amendment type, (i) none (BASE), (ii) composted,manure-based (Sungro, thermogenic, vermicompost) or (iii) plant-based (alfalfa and sesame meals) were run using analysis ofsimilarity (ANOSIM) to determine which individual medium ortype of amendments resulted in significantly different communitycompositions. ANOSIM was run using Primer-E (Primer-E, Ltd., Ivy-bridge, UK) on a Bray-Curtis similarity matrix and significance wasassessed at an ˛ level of 0.05.

3. Results

3.1. Transplant media characteristics

Nutrients and chemical properties of the transplant media var-ied greatly depending on the organic amendment (Table 3). Theinitial pH for all treatments ranged from 4.5 to 6.3 in 2004, andfrom 6.0 to 7.0 in 2005. The BASE medium had the lowest electri-cal conductivity (EC), below 1 dS m−1 in both years. The EC valuesof the various media were closely correlated to the K contentthe mixes in 2004 (r2 = 0.98) and 2005 (r2 = 0.92) and not to sol-uble N (NO3

−–N plus NH4+–N) levels (data not shown). VC had

the high concentration of NO3−–N in both years (Table 3). Dif-

ferences in growth among seedlings in the amended transplantmedia were significantly correlated with the nitrate content of themedium (p < 0.0001, r2 = 41.7%), but not the leaf petiole nitrate con-tent (p = 0.658, r2 = 0.5%, only 2005 data available). Abovegroundplant biomass in the field was correlated with K content of trans-plant media in 2004 (p = 0.046, r2 = 20.4%), however in 2005 nosignificant correlations between media nutrient content and plantgrowth were found.

Author's personal copy

A.L.H. Jack et al. / Applied Soil Ecology 48 (2011) 94–101 97

Table 3Chemical analysis of transplant media amendments used for tomato transplant production.

Media pH EC (dS m−1) Total N (%) NO3–N (mg kg−1) NH4–N (mg kg−1) P (mg kg−1) K (mg kg−1) Organic C (%) C:N

Mixes (2004)BASE 5.9 0.34 0.56 32 53 47 555 32.6 58.1SUN 6.3 0.50 0.61 29 571 168 243 32.5 53.2TC04 4.5 0.64 0.75 111 81 318 1490 35.5 50.0VC04 5.0 2.45 1.32 1313 71 906 2828 36.6 27.7AM20 5.6 10.50 2.07 53 237 752 19,956 37.6 18.2SM20 5.1 1.11 2.37 18 35 1666 2903 37.0 15.6Mixes (2005)BASE 7.0 0.68 0.64 38 9 42 642 35.7 55.6SUN 6.0 0.95 0.73 361 296 220 322 33.3 45.8TC05 7.1 1.43 1.21 67 60 997 3989 30.8 25.4VC05 6.7 1.86 1.33 721 92 779 2462 32.5 24.4AM5 6.1 4.02 1.42 13 89 686 10,805 33.0 23.3SM1 6.5 0.74 1.26 213 75 543 1004 29.3 23.3SM2.5 6.4 0.75 1.91 169 79 1259 1551 32.2 16.9

3.2. Field experiments

Significant differences in germination rates were found amongtreatments for both years (p < 0.0001; Table 4). In 2004, the germi-nation rate was above 90% for all treatments except for AM20 andSM20, which had rates around 50%. In 2005, the AM5 treatmentagain had a lower germination rate (60%) than the other treatments(Table 4), despite reducing the rate of AM to 5% v:v. While BASE andTC treatments had excellent germination rates and the TC amend-ment provided some nutrients (Table 3), the final seedling biomasswas similar between these two treatments in both years (Table 4).In 2005, VC and SM1 had the highest seedling dry biomass. A verylow rate of sesame meal (1% v:v) supported similar plant growth toVC amended at a higher rate (20% v:v).

Once transplanted to the field, tomato plants continued toshow differences in above ground biomass, which were not alwaysrelated to their size at transplanting. In 2004, biomass of the trans-plants amended with AM20 and SM20 was low (Table 4), but byanthesis these were the largest plants in the trial. In 2005, thetwo SM treatments resulted in higher transplants biomass andthe highest anthesis biomass (Table 4). Despite similar biomass attransplanting, seedlings grown in the BASE medium were signifi-cantly smaller and stunted and were unable to recover in the fieldto the same extent as the seedlings from the TC treatment in 2005(Table 4).

Table 4Percent germination of tomato seeds and above ground plant biomass at trans-planting and anthesis after growth in transplant media containing different organicnutrient amendments.

In greenhouse At transplanting AnthesisMedia Germination (%) Dry biomass (g plant−1)

2004BASE 94 a* 0.03 cd 91 dSUN 93 a 0.12 b 151 bcTC 93 a 0.10 bc 112 cdVC 92 a 0.24 a 146 bcAM20 46 b 0.01 d 200 aSM20 54 b 0.03 d 181 ab2005BASE 96 a 0.02 e 12 eSUN 95 a 0.23 d 58 dTC 96 a 0.11 e 62 dVC 96 a 0.37 ab 77 bcAM5 60 b 0.27 cd 72 cSM1 95 a 0.43 a 83 bSM2.5 91 a 0.33 bc 101 a

* Means in the same year followed by the same letter are not significantly differentat p < 0.05.

Differences in early and total marketable yield were foundamong treatments in both years (Table 5). There were no dif-ferences in percent marketable fruit between treatments, whichaveraged 97% across all treatments in both years, suggesting thatamendments did not affect the incidence of fruit disease or phys-iological disorders under our field conditions (data not shown). In2004, the SM20 treatment had the highest early yields, and theAM20, and SM20 treatments had higher marketable yields thanthe compost-based and BASE treatments. In 2005, treatments withhigher anthesis plant biomass (VC, AM5, SM1, SM2.5) also hadhigher earlier yields. Yet, by the end of the season, total marketableyields were similar among all the amended transplant media and allhad significantly higher yields than the BASE treatment (Table 5).The smaller 2005 TC transplants demonstrated significant growthcompensation once in the field and had yields similar to the othertreatments (Table 5).

3.3. Bacterial community analyses

Bacterial community composition was significantly affectedby sampling time and transplant media treatment. PerMANOVArevealed that approximately half of the variation found in bac-terial communities could be explained by sampling time (28.9%)and media amendment treatment (18.7%) when all sampling timeswere examined simultaneously (Table 6). When analyzed by indi-vidual sampling times, transplant medium treatment explained86.7 and 86.4% of the variance in the bacterial community com-position in the pre-planting and transplant rhizosphere samplesrespectively. However, as time progressed, the explanatory powerof treatment diminished to 57.9% at anthesis and 34.6% at har-vest. Despite the lower explained variance, all perMANOVA resultswere significant (p < 0.01). ANOVA results from the AMMI modelsupported the perMANOVA findings (Table 6). The percent of inter-action pattern (i.e. interaction between T-RFs and transplant mediaamendment treatments) was highest at the first two samplingtimes (43.0% at pre-planting and 28.1% at transplanting), and thendiminished over time (19.4% at anthesis and 4.4% at harvest).Decreasing total interaction effects (pattern + noise) over time indi-cate that the bacterial communities had become more similar as thecrop matured.

The ordination plots generated from the AMMI analysis revealedrelationships of the media treatments with one another (Fig. 1)and the analysis of similarity (ANOSIM) tested the significance ofthese relationships. Even though the AMMI and perMANOVA anal-yses showed a decrease in community differences over time, therewere significant treatment differences in bacterial communitycomposition for all sampling times (Table 7). Bacterial T-RFs frompre-planting media formed unique groups according to the type of

Author's personal copy

98 A.L.H. Jack et al. / Applied Soil Ecology 48 (2011) 94–101

Table 5Tomato yields from different organic transplant media.

Media Early yield (ha−1)* Marketable yield (ha−1)

Fruit # (1000s) Yield (MT) Av. fruit weight (g) Fruit # (1000s) Yield (MT) Av. fruit weight (g)

2004BASE 0.00 b 0.00 b 0 b 266.6 b 61.1 b 234 aSUN 0.30 b 0.08 b 58 b 334.3 ab 74.6 ab 223 abTC 0.30 b 0.04 b 35 b 276.0 ab 66.5 b 241 aVC 0.30 b 0.09 b 75 b 293.1 ab 61.7 b 211 bAM20 1.19 b 0.34 b 94 b 383.4 a 92.9 a 242 aSM20 28.57 a 7.99 a 234 a 354.5 ab 84.7 a 239 a2005BASE 9.16 d 2.66 d 285 a 116.4 c 32.8 b 285 aSUN 85.79 bc 22.91 bc 252 bc 288.1 ab 72.7 a 252 bcTC 69.06 c 19.67 c 257 b 284.0 b 72.9 a 257 bVC 119.67 a 33.32 a 255 bc 332.7 ab 84.6 a 255 bcAM5 102.84 ab 26.83 abc 242 cd 315.4 ab 76.2 a 242 cdSM1 112.41 ab 28.62 ab 232 d 340.1 a 79.0 a 232 dSM2.5 117.07 a 30.17 ab 232 d 330.1 ab 76.7 a 232 d

* Early yield calculated by combining yield from first three (2004) or first two (2005) harvests.

organic amendment; plant-based amendments were statisticallydistinct from composted manure-based amendments and non-amended media (Fig. 1A and Table 7). For transplant rhizospheresamples, T-RFs for amendment types; non-amended, compostedmanure-based and plant-based, were statistically distinct (Fig. 1Band Table 7). Rhizosphere bacterial T-RFs from anthesis fieldsamples showed significant differences between all individualtreatments (Fig. 1C and Table 7). By harvest, there were fewermeasureable treatment differences for rhizosphere bacterial T-RFs.When grouped by amendment type, composted manure-based andplant-based amendments had statistically distinct communitiesat harvest (Fig. 1D and Table 7). However, pairwise comparisonsshowed that only the VC and BASE treatments still had bacte-rial communities that were statistically distinct from the othertreatments at harvest, while all other treatments were no longerdistinguishable as unique sets of T-RFs (Fig. 1D). Analysis of T-RFsover the entire season showed that sampling time was a significantdriver of community composition as bacterial communities sepa-rated by sampling time along IPCA1 (Fig. 1E). In the full dataset, alltreatments, except for SM1, SM2.5 and AM5, resulted in statisticallyunique T-RFs (Table 7).

Table 6PerMANOVA and AMMI analysis of bacterial T-RFs over all dates and for individualsampling times (pre-planting media, transplant rhizosphere, anthesis rhizosphere,and harvest rhizosphere). PerMANOVA values represent the proportion of variationeach factor contributes to the total variation in the dataset (R2 values). All factorsmeasured were significant at ˛ = 0.01.

Sampling time

Source All dates Pre-planting Transplanting Anthesis Harvest%

perMANOVATime 28.9Amendment 18.7 86.7 86.4 57.9 34.6AMMIMain effects

T-RFs 48.7 38.6 58.5 72.1 89.2Environments 1.1 2.0 0.5 0.3 0.2

InteractionPatterna 42.6 43.0 28.1 19.4 4.4Noise 7.6 16.4 12.9 8.2 6.2

AMMI values represent the percent of variation that each source contributes to thetotal variation in the dataset. R2 perMANOVA values and AMMI interaction pat-tern values follow a similar seasonal pattern, indicating that bacterial communitiesbecame more similar over time.

a Interaction pattern has been shown to be a useful indicator of T-RFLP communitysimilarity (Culman et al., 2008).

4. Discussion

Selecting an appropriate amendment type and rate for trans-plant media is a key factor in determining the success of organictransplant production. In this study, both plant-based and com-posted manure-based organic amendments differed in their effectson tomato germination, growth, yields and rhizosphere bacte-rial microbial communities. Germination and early growth of thetomato seedling was most affected by the type of amendment.In 2004, a standard rate of material (20% v:v) was added to thepeat:vermiculite mix (BASE). For the plant-based amendments,however, this rate proved excessive. For amendment rates of both20 and 5%, high K levels in the alfalfa meal (Table 2) contributed tohigh soluble salts in the medium (Table 3), which correspondedwith reduced seedling germination (Table 4). For sesame meal,low germination rates at 20% amendment were not related to saltcontent and may have been due to the formation of allelopathiccompounds as the meal underwent decomposition. These resultsconfirm previous findings that high rates of sesame meal amend-ment can damage plants (Hafez and Sundararaj, 1999) and lowerrates of 5% AM, 1 and 2.5% SM were found to be effective in thesecond field season. Observed differences in seedling growth werecorrelated with the nitrate content of the transplant amendment,however were not correlated with the nitrate content of leaf peti-oles.

Although high rates of plant-based amendments led todecreased germination and early seedling growth, by mid-seasonplants in these treatments had the highest biomass (Table 4).In 2004, between the transplant date and the mid-season sam-pling date, the AM20 treatments averaged 2.9 g day−1 increasein dry biomass, which was more than twice the relative growthrate of the BASE treatment, 1.3 g day−1, a finding supported byprevious reports of seed meals being phytotoxic at higher ratesin the short term, but providing plant available N in the longterm (Snyder et al., 2009). In contrast, compost-based amend-ments consistently resulted in germination rates over 90% and, insome cases, higher transplant biomass (VC), but did not result inhigher plant biomass in the field (Table 4). This trade-off betweenhigh germination percent and longer-term plant growth has beendocumented previously for comparisons of alfalfa meal and vermi-compost (Hammermeister et al., 2006). Differences in plant growthin the field were most likely due to biological factors of the trans-plant media as only minimal correlations between plant growthand amendment nutrient content were found (K content in 2004)and no correlation existed between leaf petiole nitrate content andplant growth. Plant-based amendments along with vermicompost

Author's personal copy

A.L.H. Jack et al. / Applied Soil Ecology 48 (2011) 94–101 99

Fig. 1. AMMI plots of T-RFLP bacterial communities with each point representing a replicated sample. (A) Pre-planting media, (B) transplant rhizosphere, (C) anthesis fieldrhizosphere, (D) harvest field rhizosphere, (E) averaged data for the entire 2005 growing season (ovals indicate sampling time (1) transplant media, (2) transplant rhizosphere,(3) mid-season field rhizosphere, (4) harvest field rhizosphere; each data point represents the averaged value of 5 replicates). For rhizosphere samples (B–D) each pointrepresents a replicate DNA extraction from a separate plant in a different block of the experiment.

Table 7ANOSIM pairwise comparison results of bacterial T-RFs (graphically represented in Fig. 1) analyzed by individual transplant media and by amendment type. Transplantmedia or amendment type followed by different letters are significantly different (˛ = 0.05). Pre-planting and transplanting sampling for transplant media lacked sufficientreplication for inclusion in this analysis.

Treatment All dates Pre-planting Transplanting Anthesis Harvest

Media BASE a NA NA a aSUN b b bTC c c cVC d d dAM5 e e bceSM1 f f bceSM2.5 f g e

Amendmenttype

None ab a a a abCompost a a b b aPlant b b c c b

Author's personal copy

100 A.L.H. Jack et al. / Applied Soil Ecology 48 (2011) 94–101

led to significant increases in early yield (SM20 in 2004, and VC05,SM1, SM2.5 and AM5 in 2005) and highest total yield was foundfor plant-based amendments in 2004 and all amendments in 2005(Table 5).

Transplant media and rhizosphere bacterial communities weresignificantly affected by organic amendments, and in some casesthese differences persisted after seedlings were transplanted intofield soil. Detectable differences between treatments diminishedover time as indicated by the AMMI and perMANOVA analyses(Fig. 1 and Table 6). Amendment of transplant media with differ-ent types of organic materials led to distinct bacterial communitycompositions (Fig. 1). AMMI analysis of T-RFLP profiles showed asignificant distinction between, plant-based and compost-basedamendments in pre-planting media and transplant rhizospheresamples (Fig. 1A, B and Table 7). At anthesis, pairwise comparisonsgenerated with ANOSIM showed that all individual treatmentsresulted in unique rhizosphere bacterial community profiles. Atharvest, only the base and vermicompost treatments had uniqueprofiles, while bacterial communities present in all other treat-ments had become indistinguishable from each other (Fig. 1C, Dand Table 7). This convergence of bacterial communities as theseason progressed is further evidenced in the decreasing total inter-action effects (pattern + noise) over time seen in the AMMI analysis(Table 6).

Previous studies have confirmed that high rates of compost andother organic matter amendments can affect soil (Saison et al.,2006) and rhizosphere (Benitez et al., 2007) bacterial communi-ties. It is not surprising that organic matter amendments affectedbacterial communities in both the unplanted media and the tomatorhizosphere during production in the greenhouse. However, find-ing significant treatment effects up to one month after seedlingswere transplanted to field soil was unexpected. The total volume oforganic amendment in each transplant plug was no more than 7 mL.Additionally, fine roots sampled in the field at anthesis and har-vest were up to 0.5 m away from the original transplant plug. Thefindings reported here support the idea that organic amendmentsto transplant media can influence a crop’s rhizosphere bacterialcommunity well into the field season. One possible explanationfor the observed differences is that transplant media amendmentsinfluence which taxa colonize the root during early plant devel-opment, then the introduced bacterial community multiplies inthe rhizosphere at a higher rate than indigenous soil taxa. There isevidence that individual rhizosphere bacterial species can switchfrom a non-motile to a motile phenotype in order to “swim” alongthe rhizoplane during root proliferation (Achouak et al., 2004; vanBruggen et al., 2000). Additionally, when plant growth promotingrhizobacteria (PGPR) are applied to transplant media, they can per-sist in the rhizosphere after the seedling is transplanted to fieldsoil (Kokalis-Burelle et al., 2006). However, observed differencesbetween rhizosphere communities may not be due to the con-tinued presence of amendment derived taxa, but may instead bedue to the early influence of the introduced taxa changing the tra-jectory of rhizosphere community succession. For example, singlebacterial species used as a seed treatment can affect the result-ing rhizosphere bacterial community long after the added speciesis no longer detectable (Gilbert et al., 1993, 1996). More work isneeded to determine whether the observed differences in rhizo-sphere bacterial communities are due to the continued presenceof amendment derived taxa, or due to early changes in communitycomposition that influence the way the rhizosphere communitydevelops over time. The findings from this study add a differentangle to the ‘rhizosphere buffering’ concept (Inbar et al., 2005). Notonly can the root influence which amendment-derived taxa per-sist in the rhizosphere when the amendment is applied directly tosoil, but also a similar phenomenon occurs when amendments aresupplied only to the transplant plug prior to both the plant and the

plug being transplanted into field soil. Therefore while optimizingseedling growth is a key consideration when choosing transplantmedia amendments, their role in establishing and/or influencingthe rhizosphere bacterial community for much of the growing sea-son cannot be ignored.

In this study, factors influencing plant growth and rhizospherebacterial community development included not only the type oforganic matter in transplant media amendments, but also the wayin which that organic matter was processed prior to amendment.We found that vermicompost and thermogenic compost madefrom the same feedstock had unique effects. Previous compar-isons of vermicompost and thermogenic compost with respectto microbial communities (Anastasi et al., 2005; Chaoui et al.,2003; Fracchia et al., 2006) and plant growth (Atiyeh et al., 2000;Hammermeister et al., 2006; Hashemimajd et al., 2004) are dif-ficult to interpret because different feedstocks were used foreach composting process. Compost feedstocks, or starting mate-rials, are known to alter the material’s effects on plant growth(Hashemimajd et al., 2006; Rodda et al., 2006) and resulting micro-bial communities (Lores et al., 2006), so it is essential to usecomposts made from the same feedstock in order to draw validcomparisons between the two composting processes. The ver-micomposting process appeared to result in elevated NO3

−–Ncontent compared to thermogenic composting, although % totalN was similar for both compost types (Table 3). Earthworms areknown to increase N mineralization rates in soils (Parkin andBerry, 1999; Postma-Blaauw et al., 2006), but less is known abouttheir effects on N mineralization in decomposing manure. In ourstudy, vermicompost-amended transplant media supported higherseedling biomass in both years, higher mid-season biomass in 2005and higher early yield in 2005 compared to thermogenic compost(Table 5). Vermicompost amendments of 20% (v:v) to transplantmedia have previously been shown to increase tomato transplantbiomass, but in this study had no impact on growth or yield in thefield (Paul and Metzger, 2005). Rhizosphere bacterial communi-ties from tomato plants started in vermicompost and thermogeniccompost amended transplant media were statistically distinct atboth anthesis and harvest (Fig. 1 and Table 7), indicating that thecomposting process can change the way in which the resultingmaterial influences root-associated microbial communities. Thelimited availability of large-scale composting operations that couldcarry out thermogenic and vermicomposting on the same organicmaterial restricted our study to one batch of vermicompost andthermogenic compost made from separated dairy manure in eachyear. More work is clearly needed that systematically comparesmultiple batches of compost made with different composting pro-cesses using the same starting materials to more fully understandhow the composting process may influence the finished material’seffects on plant growth and root-associated microbial communi-ties.

Knowing how organic amendments may affect rhizospheremicrobial communities could help in developing transplant mediaspecifically designed to influence plant growth and health throughchemical, physical and biological mechanisms. Here, we foundthat certain organic transplant media amendments promoted earlyyield in tomato and were responsible for unique rhizospherebacterial communities, however, uncovering causal relationshipsbetween root-associated microbes and crop responses remains asignificant challenge. Links between specific agricultural practices,T-RFLP profiles and observed plant disease suppression are begin-ning to be elucidated (Benitez et al., 2007; Perez-Piqueres et al.,2006). Definitively connecting observed differences in bacterialcommunities with the ecosystem services provided by those com-munities, such as disease suppression or enhanced growth, shouldaid in managing rhizosphere microbial communities in agroecosys-tems to increase plant and soil health and reduce reliance on

Author's personal copy

A.L.H. Jack et al. / Applied Soil Ecology 48 (2011) 94–101 101

synthetic fertilizers and pesticides (Morrissey et al., 2004; Sturzand Christie, 2003).

Acknowledgements

We thank the Toward Sustainability Foundation for funding thisresearch in both years. We also thank Betsy Leonard and MargueriteWells for their assistance with field and greenhouse research.

References

Achouak, W., Conrod, S., Cohen, V., Heulin, T., 2004. Phenotypic variation of Pseu-domonas brassicearum as a plant root-colonizing strategy. Mol. Plant MicrobeInteract. 17, 872–879.

Anastasi, A., Varese, G.C., Marchisio, V.F., 2005. Isolation and identification of fungalcommunities in compost and vermicompost. Mycologia 97, 33–44.

Anderson, M., 2001. A new method for non-parametric multivariate analysis ofvariance. Austral Ecol. 26, 32–46.

Atiyeh, R.M., Subler, S., Edwards, C.A., Bachman, G., Metzger, J.D., Shuster, W., 2000.Effects of vermicomposts and composts on plant growth in horticultural con-tainer media and soil. Pedobiologia 44, 579–590.

Benitez, M.-S., Tustas, F.B., Rotenberg, D., Kleinhenz, M.D., Cardina, J., Stinner, D.,Miller, S.A., McSpadden Gardener, B.B., 2007. Multiple statistical approaches ofcommunity fingerprint data reveal bacterial populations associated with gen-eral disease suppression arising from the application of different organic fieldmanagement strategies. Soil Biol. Biochem. 39, 2289–2301.

Chaoui, H.I., Zibilske, L.M., Ohno, T., 2003. Effects of earthworm casts and composton soil microbial activity and plant nutrient availability. Soil Biol. Biochem. 35,295–302.

Culman, S.W., Bukowski, R., Gauch, H.G., Cadillo-Quiroz, H., Buckley, D.H., 2009. T-REX: software for the processing and analysis of T-RFLP data. BMC Bioinformatics10, 171.

Culman, S.W., Gauch, H.G., Blackwoodb, C.B., Thies, J.E., 2008. Analysis of T-RFLPdata using analysis of variance and ordination methods: A comparative study. J.Microbiol. Methods 75 (1), 55–63.

Culman, S.W., Duxbury, J.M., Lauren, J.G., Thies, J.E., 2006. Microbial communityresponse to soil solarization in Nepal’s rice-wheat cropping system. Soil Biol.Biochem. 38, 3359–3371.

Edwards, C.A., 1998. The use of earthworms in the breakdown and managementof organic wastes. In: Edwards, C.A. (Ed.), Earthworm Ecology. CRC Press, BocaRaton, pp. 327–354.

Fracchia, L., Dohrmann, A.B., Martinotti, M.G., Tebbe, C.C., 2006. Bacterial diversityin a finished compost and vermicompost: differences revealed by cultivation-independent analyses of PCR-amplified 16S rRNA genes. Appl. Microbiol.Biotechnol. 71, 942–952.

Friberg, H., Edel-Hermann, V., Faivre, C., Gautheron, N., Fayolle, L., Faloya, V.,Montfort, F., Steinberg, C., 2009. Cause and duration of mustard incorpo-ration effects on soil-borne plant pathogenic fungi. Soil Biol. Biochem. 41,2075–2084.

Gilbert, G.S., Clayton, M.K., Handelsman, J., Parke, J.L., 1996. Use of cluster and dis-criminant analyses to compare rhizosphere bacterial communities followingbiological perturbation. Microb. Ecol. 32, 123–147.

Gilbert, G.S., Parke, J.L., Clayton, M.K., Handelsman, J., 1993. Effects of an introducedbacterium on bacterial communities on roots. Ecology 74, 840–854.

Gilpatrick, J.D., 1969. Role of ammonia in control of avocado root rot with alfalfameal soil amendment. Phytopathology 59, 973.

Green, S.J., Inbar, E., Michel Jr., F.C., Hadar, Y., Minz, D., 2006. Succession of bac-terial communities during early plant development: transition from seed toroot and effect of compost amendment. Appl. Environ. Microbiol. 72, 3975–3983.

Hafez, S.L., Sundararaj, P., 1999. Efficacy of seed crop meals for the management ofColumbia root-knot nematode Meloidogyne chitwoodi on tomato under green-house conditions. Nematropica 29, 171–177.

Hammermeister, A.M., Astatkie, T., Jeliazkova, E.A., Warman, P.R., Martin, R.C., 2006.Nutrient supply from organic amendments applied to unvegetated soil, lettuceand orchardgrass. Can. J. Soil Sci. 86, 21–33.

Hashemimajd, K., Kalbas, M., Golchin, A., Knicker, H., Shariatmadari, H., Rezaei-Nejad, Y., 2006. Use of vermicomposts produced from various solid wastes aspotting media. Eur. J. Hort. Sci. 71, 21–29.

Hashemimajd, K., Kalbasi, M., Goichin, A., Shariatmadari, H., 2004. Comparison ofvermicompost and composts as potting media for growth of tomatoes. J. PlantNutr. 27, 1107–1123.

Hoitink, H.A.J., Fahy, P.C., 1986. Basis for the control of soilborne plant pathogenswith composts. Ann. Rev. Phytopathol. 24, 93–114.

Inbar, E., Green, S.J., Hadar, Y., Minz, D., 2005. Competing factors of compost concen-tration and proximity to root affect the distribution of streptomycetes. Microb.Ecol. 50, 73–81.

Kokalis-Burelle, N., Kloepper, J.W., Reddy, M.S., 2006. Plant growth-promotingrhizobacteria as transplant amendments and their effects on indigenous rhi-zosphere microorganisms. Appl. Soil Ecol. 31, 91–100.

Litterick, A.M., Harrier, L., Wallace, P., Watson, C.A., Wood, M., 2004. The role ofuncomposted materials, composts, manures, and compost extracts in reducingpest and disease incidence and severity in sustainable temperate agriculturaland horticultural crop production – a review. Crit. Rev. Plant Sci. 23, 453–479.

Lores, M., Gomez-Brandon, M., Perez-Diaz, D., Dominguez, J., 2006. Using FAME pro-files for the characterization of animal wastes and vermicomposts. Soil Biol.Biochem. 38, 2993–2996.

Mazzola, M., Granatstein, D.M., Elfving, D.C., Mullinix, K., 2001. Suppression of spe-cific apple root pathogens by Brassica napus seed meal amendment regardlessof glucosinolate content. Phytopathology 91, 673–679.

Morrissey, J.P., Dow, J.M., Mark, G.L., O’Gara, F., 2004. Are microbes at the rootof a solution to world food production? Rational exploitation of interactionsbetween microbes and plants can help to transform agriculture. EMBO Rep. 5,922–926.

Parkin, T.B., Berry, E.C., 1999. Microbial nitrogen transformations in earthworm bur-rows. Soil Biol. Biochem. 31, 1765–1771.

Paul, L.C., Metzger, J.D., 2005. Impact of vermicompost on vegetable transplant qual-ity. HortScience 40, 2020–2023.

Perez-Piqueres, A., Edel-Hermann, W., Alabouvette, C., Steinberg, C., 2006. Responseof soil microbial communities to compost amendments. Soil Biol. Biochem. 38,460–470.

Postma-Blaauw, M.B., Bloem, J., Faber, J.H., van Groenigen, J.W., de Goede, R.G.M.,Brussaard, L., 2006. Earthworm species composition affects the soil bacterialcommunity and net nitrogen mineralization. Pedobiologia 50, 243–256.

Rodda, M.R.C., Canellas, L.P., Facanha, A.R., Zandonadi, D.B., Guerra, J.G.M., deAlmeida, D.L., Santos, G.D., 2006. Improving lettuce seedling root growth andATP hydrolysis with humates from vermicompost. II – effect of vermicompostsource. Rev. Bras. Cienc. Solo 30, 657–664.

Ros, M., Klammer, S., Knapp, B., Aichberger, K., Insam, H., 2006. Long-term effects ofcompost amendment of soil on functional and structural diversity and microbialactivity. Soil Use Manage. 22, 209–218.

Russo, V.M., 2005. Organic vegetable transplant production. HortScience 40,623–628.

Saison, C., Degrange, V., Oliver, R., Millard, P., Commeaux, C., Montange, D., Le Roux,X., 2006. Alteration and resilience of the soil microbial community followingcompost amendment: effects of compost level and compost-borne microbialcommunity. Environ. Microbiol. 8, 247–257.

Sanders, D.C., Reyes, L.M., Monks, D.W., Jennings, K.M., Louws, F.J., Driver, J.G., 2006.Influence of compost on vegetable crop nutrient management. HortScience 41,508–1508.

Snyder, A., Morra, M.J., Johnson-Maynard, J., Thill, D.C., 2009. Seed meals from Brassi-caceae oilseed crops as soil amendments: influence on carrot growth, microbialbiomass nitrogen, and nitrogen mineralization. HortScience 44, 354–361.

Stoffella, P., Kahn, B. (Eds.), 2001. Compost Utilization in Horticultural CroppingSystems. Lewis Publishers, Boca Raton, FL, p. 414.

Sturz, A.V., Christie, B.R., 2003. Beneficial microbial allelopathies in the root zone:the management of soil quality and plant disease with rhizobacteria. Soil Till.Res. 72, 107–123.

R Development Core Team, 2009. A language and environment for statisticalcomputing. R Foundation for Statistical Computing, Vienna, Austria. ISBN: 3-900051-07-0, URL http://www.R-project.org.

Tiquia, S.M., Lloyd, J., Herms, D.A., Hoitink, H.A.J., Michel Jr., F.C., 2002. Effectsof mulching and fertilization on soil nutrients, microbial activity and rhizo-sphere bacterial community structure determined by analysis of TRFLPs ofPCR-amplified 16S rRNA genes. Appl. Soil Ecol. 21, 31–48.

Department of Agriculture Agricultural Marketing Service, National Organic Pro-gram Final Rule (Volume 65, Number 246) FR p. 13511-13560 accessed throughhttp://wais.access.gpo.gov (01.06.08).

USDA-NRCS, 2008. Official Soil Series Descriptions, United States Depart-ment of Agriculture – Natural Resources Conservation Servicehttp://soils.usda.gov/technical/classification/osd/index.html (accessed01.06.08).

van Bruggen, A.H., Semenov, A.M., Zelenev, V.V., 2000. Wavelike distributions ofmicrobial populations along an artificial root moving through soil. Microb. Ecol.40, 250–259.

Weltzien, H.C., 1989. Some effects of composted organic materials on plant health.Agric. Ecosyst. Environ. 27, 439–446.

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

1

Seed-recruited microbes protect developing seedlings from disease by altering pre-1

infection behavior of Pythium aphanidermatum zoospores 2

3

Allison L. H. Jack1,2 and Eric B. Nelson3* 4

1 NSF-IRFP visiting postdoctoral fellow, Phytopathology, Wageningen University, The 5

Netherlands 6

2Agroecology Faculty, Environmental Studies Program, Prescott College, Prescott, 7

Arizona, United States of America 8

2 Professor, Department of Plant Pathology and Plant-Microbe Biology, Cornell 9

University, Ithaca, New York, United States of America 10

* Email: ebn1@cornell.edu 11

12

Abstract 13

Host associated microbiota recruited from the environment at early stages of 14

development can protect plants from disease. However, effective crop health 15

interventions based on manipulation of host associated microbiota are constrained by a 16

limited understanding of disease suppression mechanisms. We sought to uncover 17

potential mechanisms by which plant infections by Pythium aphanidermatum were 18

altered in the presence of a disease suppressive substrate: vermicomposted dairy 19

manure (VDM). Our studies focused on the interactions between seed-associated 20

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

2

microbial communities and P. aphanidermatum zoospores. In vivo disease suppression 1

bioassays demonstrated that vermicompost microbes colonizing seeds within 8 h 2

effectively prevented zoospore arrival at the seed surface. This was confirmed by the 3

low levels of zoospore DNA detected on seed surfaces and a reduction in diseased 4

seedlings from seeds colonized with a suppressive microbial community. In vitro 5

zoospore assays demonstrated the impact of seed-associated microbial communities 6

on zoospore pre-infection events. Exudates were collected from seeds either with or 7

without a suppressive microbial community and filter sterilized. Modification of seed 8

exudates by vermicompost microbes that colonized seeds within 8 h resulted in the 9

inhibition of zoospore chemotaxis and encystment compared to these responses to non-10

modified exudates. In addition, germination of mechanically encysted zoospores was 11

reduced. Combining microbially modified seed exudate (MMSE) with non-modified seed 12

exudates failed to restore suppression, resulting in extensive zoospore lysis. 13

Fractionation and subsequent metabolomic profiling of MMSE from vermicompost-14

treated seeds revealed that the lytic activity and inhibition of cyst germination partitioned 15

into the ethyl acetate fraction where several putative zoosporolytic compounds were 16

identified. We hypothesize that the observed zoospore lysis and suppression of cyst 17

germination is likely due to a specific compound or set of compounds produced in the 18

spermosphere by one or more members of the vermicompost-derived microbial 19

community recruited to seeds within the first 8 h of germination, thus protecting the seed 20

from P. aphanidermatum zoospore infection. 21

22

Author Summary 23

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

3

Understanding how host-associated microbial communities protect plants from 1

disease is crucial in the development of biologically-based crop protection strategies. 2

Pythium aphanidermatum is a seed-infecting pathogen that produces motile zoospores 3

which actively seek out their host in the soil environment. We focused on the 4

interactions between cucumber seeds, the host-associated microbial community from 5

vermicomposted dairy manure and the pathogen’s swimming zoospores. We pre-6

germinated seeds in vermicompost for 8 h, transplanted them to sand and added the 7

pathogen. These seeds were almost completely protected from disease. We collected 8

the chemicals released from germinating seeds both with and without colonization by 9

vermicompost microbes, filtered out the bacterial cells and gave active zoospores a 10

choice of which chemicals were more attractive as a target for directional swimming. 11

Zoospores preferred to swim towards and attempt to infect the chemicals collected from 12

seeds lacking colonization by vermicompost microbes. Chemicals collected from seeds 13

colonized by vermicompost microbes actually exploded the zoospores. A comparison of 14

the chemicals from treated and untreated seeds identified compounds that are likely 15

preventing the zoospores from initiating infection. These findings will aid in the 16

development of vermicompost-based seed treatments that can protect crops from 17

disease without using synthetic chemical fungicides. 18

19

Introduction 20

There has been much interest over the years in understanding the mechanisms by 21

which microbes prevent pathogen infections in soils naturally suppressive to disease [1-22

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

4

3] and also in soils in which suppressiveness is induced by organic matter amendments 1

[4-6]. Despite the clear involvement of microbial communities in both naturally 2

suppressive and induced suppressive soils, an understanding of the mechanisms by 3

which these microbial communities prevent pathogens from infecting their hosts has 4

been elusive [7]. One of the more common approaches for dissecting microbial 5

mechanisms of disease suppression has been the comparative microbial analysis of 6

disease-suppressive and non-suppressive soils in the absence of plants [8-10]. The 7

basic hypothesis driving this approach is that microbial taxa present or differentially 8

more abundant in suppressive soil than in conducive soil are likely to be involved in 9

disease suppression. This approach may provide potential candidate microbes that can 10

be studied further for their mechanisms of disease suppression [10]. However, a 11

problem with this approach is that the presence, absence, or differential abundance of 12

one or a few microbes is not likely to explain suppressiveness, since soil microbial 13

communities are often too complex and dynamic to detect clear differences between 14

suppressive and conducive communities [5]. Furthermore, many of the microbial 15

differences detected may have nothing to do with disease suppression and because 16

pathogen infections of plants are a spatially and temporally-dynamic process, focusing 17

solely on the soil or compost itself would fail to detect any microbial interactions that 18

directly impact pathogenesis. 19

Given that plants drive many of their associated interactions with soil microbes 20

[11], an alternative approach for understanding which microbes may be involved in 21

disease suppression and how they may prevent infection, is to focus on a subset of the 22

soil microbial community most likely to interact with the host and the pathogen at the 23

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

5

site and time of plant infection. Focusing on microbial interactions in this way has been 1

valuable in understanding mechanisms by which seed-associated bacteria suppress 2

pathogen infections [12-14] as well as in providing insight into the mechanisms of 3

compost-induced disease suppression [15-17]. For example, the use of this approach 4

revealed that microbes recruited from composts to seeds within the first 8 h after sowing 5

provide the most significant suppression of seed infection by Pythium ultimum and 6

could explain the levels of disease suppression observed [15,16]. Such an approach 7

enables the filtering out of many soil and compost microbes that have nothing to do with 8

disease suppression and provides a more directed analysis of the microbes and 9

activities that can explain disease suppression. 10

In our current work, we have adopted this approach to better understand the 11

mechanisms by which infections of seedlings by Pythium aphanidermatum are 12

suppressed when seeds are sown in a vermicomposted dairy manure (VDM) substrate. 13

A number of important aspects of this system facilitate the use of this approach. First, 14

vermicomposts, like thermogenic composts, are suppressive to diseases caused by a 15

number of different major soil-borne pathogens [18-21]. The vermicompost used in this 16

study is produced in a highly engineered and rigorously-controlled flow-through system, 17

the end product is chemically and physically quite uniform and consistently disease 18

suppressive compared to the high variability associated with some thermogenic 19

composts. Second, P. aphanidermatum is an especially relevant target pathogen for our 20

studies. Aside from being one of the most important seed- and root-infecting plant 21

pathogens with a host range of over 650 species [22], P. aphanidermatum, like other 22

Pythium species, is inherently sensitive to microbial competition and interference [23], 23

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

6

making it an ideal model to assess microbial-based disease suppression. Third, P. 1

aphanidermatum is believed to infect seeds and roots largely via the formation of motile 2

zoospores [24-26], which display a complex, but well-characterized homing response 3

and series of pre-infection events from the time of zoospore release to plant infection. 4

During pathogenesis, zoospores respond to chemical cues from the host (in the form of 5

seed or root exudates) to detect and swim to the infection court [27]. This chemotactic 6

response is followed rapidly by the attachment and encystment of the zoospore on the 7

seed, radical, or root surface, and subsequent germination of the zoospore cyst and 8

host penetration. 9

Although the homing cues are largely unknown, they appear to be species- [28-30] 10

and developmental stage specific [28,29], and interference with these cues has been 11

shown to be an effective means of suppressing infection by zoosporic pathogens. For 12

example, zoospores exhibit a weaker chemotactic response to exudates from roots or 13

seeds directly treated with microbes than they do towards exudates from untreated 14

roots or seeds [12,31-34]. In some cases, altered zoospore behavior appears to be due 15

to modification of exudates by host-associated microbes [34]. However, it is not always 16

clear if this chemical modification results from the degradation of a zoospore attractant, 17

or the production of a zoospore repellant/toxin [33], or a combination of both [12]. 18

Therefore in order to fully understand the mechanisms by which host-associated 19

microbes might interfere with plant infection, it is necessary to examine interactions at 20

each of these stages of pathogenic development along with the chemical cues that elicit 21

these responses. 22

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

7

Building off of our previous work [15-17], the goal of our current work is to 1

understand how seed-colonizing microbes recruited from a disease suppressive VDM 2

substrate alter zoospore responses of Pythium aphanidermatum to plants and provide 3

protection from disease. Our study attempts to explain disease suppression by relating 4

reductions in seed colonization by P. aphanidermatum with changes in zoospore 5

behavior that result from direct chemical alterations of seed exudates by seed-recruited 6

microbes. Examining these tripartite interactions between the host, pathogen and 7

microbial community will allow us to answer the following questions; 1) can the seed-8

colonizing community that colonizes seeds prior to and during seed infection explain the 9

observed suppression?, 2) which stages of the zoospore homing response does the 10

suppressive seed-colonizing community alter?, 3) are altered zoospore responses due 11

to the modification of seed exudates by the seed-colonizing microbial community?, and 12

if so, 4) does this modification of seed exudates involve (a) the degradation of a 13

chemotactic cue, (b) the production of a zoospore repellant/lytic agent or both? We 14

believe that an understanding of the mechanism of pathogen suppression will increase 15

our knowledge of the role of host associated microbiota in health and disease. 16

17

Results 18

A. Suppressiveness of vermicompost to P. aphanidermatum-incited seedling disease 19

The presence of VDM significantly reduced the incidence and severity of disease 20

relative to the non-amended control. Inoculated seedlings in non-amended sand had 21

97% mortality after 7 d (Figure 1, Table 2). However, seedlings sown in sand amended 22

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

8

with 40% v:v VDM had significantly lower seedling mortality at 7 d than seedlings sown 1

in sand with a range of 11 – 20% mortality for three different VDM batches (Figure 1, 2

Table 2). Seedlings sown in sterile VDM had a seedling mortality rate of 54% at 7 d, 3

which was significantly lower than for seeds sown in sand, but significantly greater than 4

for seeds sown in 2 out of the 3 batches of vermicompost (Figure 1, Table 2). Non-5

inoculated seedling mortality (0%) could not be included in the statistical analyses as 6

this would confound the logistic regression procedure. The only non-inoculated 7

seedlings with any level of mortality were those sown in sterile VDM (mortality of 3%). 8

Seedling health rating was highest for all non-inoculated seedlings in every treatment 9

followed by the inoculated vermicompost batches in descending order (Batch 1 > 3 > 2), 10

inoculated sterile vermicompost and finally inoculated sand with the lowest health rating 11

(Table 1). 12

B. In situ zoospore homing response 13

To eliminate the possibility of zoospores arriving at the seed surface through mass flow, 14

we mechanically encysted zoospores to prevent them from swimming, which clearly 15

limited their ability to cause infection when added to funnels 2 cm away from 16

germinating seeds. A significantly greater number of seedlings survived when seeds 17

were sown 2 cm from the encysted zoospore inoculation point (73% survival) than those 18

sown 2 cm from the swimming zoospore inoculation point (4% survival, p<0.0001) and 19

this pattern was reflected in the proportion of seeds colonized with P. aphanidermatum 20

48 hpi. Mechanically encysted zoospores were still viable, causing high seedling 21

mortality when added directly to germinating seeds (7% survival). 22

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

9

i. Development of the seed-colonizing microbial community 1

To determine when a suppressive microbial community develops on seed surfaces, 2

seeds were pre-germinated in vermicompost for 8, 12 or 24 h then transplanted to 3

sterile sand. Significantly less Pa58 DNA was present at 18 and 24 hpi on seeds 4

exposed to vermicompost for 8 h than on seeds sown in sand for 8 h prior to transplant 5

and inoculation (Table 2). The vermicompost derived seed-colonizing microbial 6

community gave rise to significantly lower seedling disease incidence at 9 d (Table 2). 7

The highest level of Pa58 colonization in seeds with the suppressive microbial 8

community was equivalent to 95.3 ug dry mycelial biomass (=~70 zoospores per seed). 9

The presence of vermicompost on the seed surface did not appreciably affect the 10

extraction or amplification of DNA and thus did not interfere with our ability to detect 11

Pa58 zoospores on seeds that had been pre-germinated in vermicompost. The 12

standard curve equation for DNA extracted from Pa58 mycelia (Ct = 28.9 + 3.15 log ng 13

DNA, R2 = 99.7%) and for DNA extracted from seeds sown in vermicompost combined 14

with Pa58 mycelia (Ct = 28.2 + 3.13 log ng DNA, R2 = 98.9%). 15

C. Zoospore homing responses to MMSE 16

i. Zoospore chemotaxis & encystment assay 17

Exudates collected from seeds sown in sand attracted high numbers of zoospores that 18

subsequently encysted; significantly higher numbers of zoospores encysted in response 19

to exudates from later time points compared to those from earlier time points (24 h post 20

transplant > 12 and 18 h post transplant, Table 2). The number of encysted zoospores 21

exposed to MMSE from seeds sown in vermicompost did not differ from those encysting 22

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

10

in water for any of the time points tested (Table 2). Combining exudate from seeds 1

sown in sand with MMSE failed to restore zoospore chemotaxis and encystment 2

response (Table 3). Zoospores appeared to lyse when exposed either to seed exudates 3

modified by the 8 h suppressive seed-colonizing microbial community or to a mixture of 4

MMSE and non-modified exudate from sand (Figure 2). A significantly greater number 5

of zoospore cysts lysed when cysts were exposed to vermicompost MMSE than when 6

exposed to water or non-modified exudates from seeds sown in sand (Table 3). 7

A simple ethyl acetate fractionation of both the sand and vermicompost MMSE 8

significantly impacted zoospore responses. Higher numbers of zoospores swam to and 9

encysted on the organic fraction of MMSE collected from seeds germinating in sand 10

compared to the aqueous fraction (Table 4). No differences were observed in zoospore 11

numbers for both fractions of MMSE collected from seeds germinated in vermicompost 12

and the water and ethyl acetate controls. The highest percentage of zoospore 13

germination was observed in response to the aqueous fraction of MMSE collected from 14

seeds germinated in sand followed by the aqueous fraction of MMSE collected from 15

seeds germinated in vermicompost. The germination rate in response to the organic 16

fraction of MMSE from vermicompost was significantly lower than the ethyl acetate and 17

water controls. A significantly higher proportion of zoospores lysed in response to the 18

organic fraction compared to the aqueous fraction of MMSE collected from seeds 19

germinated in vermicompost (Table 4). Zoospores exposed to the ethyl acetate fraction 20

of MMSE from vermicompost lacked germ tubes and showed signs of membrane 21

disruption (Figure 3). This lysis and consistent lack of germ tube emergence was not 22

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

11

observed in the aqueous fraction of MMSE from vermicompost, either fraction of MMSE 1

from sand or in the water or ethyl acetate controls (Figure 3). 2

ii. Zoospore germination 3

Pre-encystment incubation of zoospores with exudates from seeds sown in sand 4

resulted in a significantly higher germination rate than that observed for zoospores 5

exposed to water or MMSE from seeds sown in vermicompost (Table 3). No difference 6

in germination percentages was observed between cysts exposed to water or to MMSE 7

from seeds sown in vermicompost and no differences were observed among the 12, 18 8

and 24 h time points. For post-germination exposure, cyst germination rates declined 9

over time for MMSE collected from both sand and vermicompost. However, cyst 10

germination rates in response to MMSE from seeds germinated in vermicompost for 24 11

h were significantly lower than those observed in response to 24 h sand MMSE (Table 12

3). No significant differences in germ tube lengths were observed between MMSE 13

treatments (p = 0.299). 14

iii. Partial characterization of MMSE 15

A total of 286 individual compounds were identified in the MMSE analysis of which 146 16

were of an unknown structure and 41 of which had not previously appeared in any 17

Metabolon analysis. Identified compounds fell into the following classes; amino acids, 18

carbohydrates, cofactors, lipids, nucleotides, secondary metabolism and xenobiotics. A 19

total of 106 compounds were found to differ significantly in relative abundance between 20

control (no microbial modification) and MMSE treatments (p < 0.05). Of those 21

compounds, only 20 were more abundant in MMSE collected from seeds germinated in 22

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

12

vermicompost (Figure 4) and 86 at a higher abundance in control MMSE (Figure S1). 1

The baseline False Discovery Rates (FDR) for a dataset of this size (n=286) is 14.3%, 2

indicating that q-values under 10% offer high confidence in the result. 3

4

5

Discussion 6

Examining the tripartite interactions among germinating seeds of the host, the 7

host-associated microbiota recruited from a disease-suppressive substrate, and pre-8

infection behavior of the pathogen, P. aphanidermatum has offered several insights into 9

the nature of microbially-based disease suppression. First, our results confirm the 10

important role the spermosphere microbial community plays in disease suppression and 11

further adds to the growing body of evidence indicating that microbes that are recruited 12

and rapidly colonize host surfaces directly modulate the activities of soil pathogens [15-13

17]. In the absence of these host-associated microbes, zoospores were able to swim to 14

seeds and colonize seed surfaces within 12 h after inoculation. In contrast, the 15

presence of a spermosphere microbial community recruited from a vermicompost 16

substrate within 8 h after sowing greatly reduced pathogen colonization of germinating 17

seeds and provided nearly complete protection from disease. It is important to note that 18

our qPCR assay cannot distinguish between viable and non-viable zoospores, making it 19

possible that the low levels of P. ahanidermatum detected in the spermosphere of 20

seeds colonized by vermicompost microbes was not necessarily an indication of low 21

levels of infection but in fact a reflection of DNA from non-viable or lysed zoospores, 22

such as those that we frequently observed in our in vitro zoospore attraction and 23

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

13

encystment assays. It is also not clear if the increase over time of P. aphanidermatum 1

biomass on seeds sown in sand is due to the arrival of and cumulative increase in 2

zoospores or to the rapid growth of mycelia as it colonized the host, or a combination of 3

the two. Nonetheless, the qPCR and transplant bioassay data indicate that the 4

observed suppression of disease in seedlings grown in in vermicompost (61% reduction 5

in disease incidence compared to sand) appears to be almost entirely due to reductions 6

in the biomass of P. aphanidermatum on seeds as imposed by the microbial community 7

colonizing seeds within 8 h of sowing (67% reduction in disease incidence compared to 8

sand). This does not, however, exclude the possibility that microbes present in the 9

vermicompost but not intimately associated with the host also play a role in the 10

suppression of disease. In fact, non-host-associated soil microbial communities can be 11

major contributors to reductions of pathogen biomass, or fungistasis, for plant 12

pathogens like Fusarium culmorum [35]. 13

Our indirect assessment of the suppressive microbiota via monitoring of the 14

pathogen’s response uncovered several changes in zoospore pre-infection behavior. 15

Since chemotaxis and encystment of P. aphanidermatum zoospores occur in direct 16

response to chemical compounds present in seed exudates from the host [28,29], we 17

hypothesized that any interference with these homing responses by seed colonizing 18

microbes would be due to the microbial modifications of seed exudates and not the 19

direct microbial attack of incoming zoospores by seed-associated microbes. Although 20

we have no evidence for or against direct microbial attack of zoospores, we did observe 21

that zoospores responded differently to exudates collected from seeds colonized by a 22

suppressive microbial community, with fewer encysted zoospores observed in the in 23

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

14

vitro assays. It’s tempting to infer that the presence of a lower number of encysted 1

zoospores in MMSE from seeds germinated in vermicompost indicates that both 2

chemotaxis and encystment were inhibited by the microbes recruited to seeds that 3

modified seed exudates. However, it is possible that zoospores swam chemotactically 4

to the MMSE from vermicompost, but did not encyst or attach to the agarose and 5

therefore were not present in the final zoospore cyst counts in the assay. In addition, 6

zoospores may have been attracted to germinating seeds in the in vivo assays, but then 7

lysed before encysting leaving their DNA to degrade before it could be detected via 8

qPCR assays. Therefore, we have no conclusive evidence that the zoospore 9

chemotactic response was not inhibited, but we can clearly conclude that encystment 10

and germination were significantly impacted. 11

Previously this “pathogen as biosensor” approach has led to important biological 12

insights about the interactions between zoospores, plant hosts and individual host-13

associated microbes. For example, exudates collected from cucumber roots colonized 14

with Pseudomonas spp. attracted fewer P. aphanidermatum zoospores than exudates 15

from untreated roots [33]. Similarly, exudates from roots colonized with the arbuscular 16

mycorrhizal fungus Glomus intraradices attracted fewer Phytophthora nicotianae 17

zoospores than water [34]. HPLC characterization of the control and MMSE identified 18

isocitric acid and proline as potential zoospore repellants in this system [34]. Results 19

from our experiments where P. aphanidermatum zoospores were exposed to mixtures 20

of control (non-modified) and MMSE suggest the presence of a zoospore repellant as 21

the predominant factor restricting P. aphanidermatum biomass accumulation on seed 22

and not simply the microbial removal of zoospore chemoattractants. If mixing exudates 23

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

15

from both non-modified and MMSE treatments had successfully restored zoospore 1

attraction and encystment, this would have provided evidence that an important 2

chemotaxis and/or encystment cue was missing from the MMSE. Instead, zoospore 3

chemotactic and encystment response to the mixture of exudates was no different than 4

that to MMSE from vermicompost, indicating the presence and overriding impact of a 5

potential zoosporocidal toxin or repellant. 6

Others have demonstrated that microbially modified root exudates can 7

differentially impact pre-infection behavior of zoospores. For example, exudates from 8

Bacillus cereus-treated tobacco roots, including both antibiotic-producing (zwittermicin A 9

and kanosamine) and antibiotic mutant strains, reduced the number of Pythium 10

torulosum zoospores actively swimming towards and successfully encysting on roots 11

[32]. However, only the antibiotic producing strain reduced zoospore cyst germination 12

indicating that multiple mechanisms of homing response interference may occur [32]. 13

Additional evidence for such a dual mechanism was found in another system where 14

both antibiotic-producing and antibiotic mutant strains of Burkholderia cepacia 15

eliminated the attraction of pea seed exudates for P. aphanidermatum zoospores [12]. 16

However only the antibiotic-producing strain caused zoospore lysis, prevented cyst 17

germination and reduced germ tube growth [12] indicating that B. cereus reduced 18

chemoattractants, but also produced a zoosporocidal toxin. 19

Our chemical fractionation of the seed exudates also suggests such a dual 20

mechanism of homing response interference with evidence for both the degradation of 21

attractants and the presence of a toxin. Zoospores exposed to the ethyl acetate 22

extracted aqueous fraction of MMSE from vermicompost responded with only low levels 23

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

16

of attraction and encystment compared to their response to the ethyl acetate extracted 1

aqueous fraction of MMSE collected from sand, indicating that chemoattractants may 2

have been degraded during microbial modification of cucumber seed exudates. 3

Although total dry mass of exudates collected was roughly equivalent for sand and VC 4

treatments across multiple samplings, it is unlikely that the changes in zoospore 5

response are due to a general reduction in total seed exudates in the spermosphere, 6

but instead the degradation of specific compounds that serve as cues for chemotaxis. 7

Whereas none of the individual 86 compounds present at lower concentrations in 8

MMSE from vermicompost treated seeds are known zoospore attractants or cyst 9

germination stimulants, only a very narrow range of compounds have ever been tested 10

with P. aphanidermatum zoospores [28], making it possible that some of these 11

compounds do serve as chemoattractants. Considering that over half of the compounds 12

present at lower concentration in MMSE from vermicompost treated seeds are 13

unknown, it is clear that the chemistry of the microbially-colonized spermosphere is ripe 14

for future exploration. In terms of general chemical classes, amino acids are important 15

zoospore chemoattractants [28], free fatty acids and their variants can trigger sporangial 16

germination [14] in Pythium spp., and both these chemical classes were well 17

represented as degraded or missing in MMSE from vermicompost treated seeds. 18

Conversely, zoospore cysts exposed to the ethyl acetate extracted organic 19

fraction of MMSE from vermicompost germinated at significantly lower rates and had 20

higher rates of lysis than those exposed to the ethyl acetate extracted aqueous fraction 21

of the same exudate, indicating that microbially-derived toxin/s or repellant/s may be 22

concentrated in the organic fraction. Out of 20 putative zoosporolytic compounds, 23

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

17

unknown compound X-19501 represented the greatest increase in abundance in the 1

MMSE from vermicompost relative to the MMSE from sand, over 9 fold difference. 2

Although this compound remains unidentified, it shares similarities with the hydroxylated 3

dioic acids and may be a structural isomer of 3-hydroxytetradecanediote (Alexander, D. 4

Metabolon Report) a class of lipids similar to the 3-hydroxydecanoic acid which is itself 5

anti-fungal [36] and can be present as a fatty acid tail of cyclic lipopeptides known to be 6

zoosporolytic [37]. 3-hydroxydecanoate was identified in this study as having a higher 7

relative abundance in exudates from vermicompost treated seeds according to the q 8

value of 0.06, indicating a low likelihood of false discovery. However the p-value 9

indicates only marginal statistical significance (p = 0.05). The remaining unknown 10

compounds and free fatty acids may be partially involved in anti-zoospore activity and 11

could represent fragments of larger compounds that were impacted by the EtOAc 12

fractionation process. However, the xenobiotic compounds found at a higher 13

concentration in exudates from vermicompost treated seeds including; 14

hydrochlorothiazide (a high blood pressure medication registered for use in dairy cattle) 15

and sucralose (an artificial sweetener), are both assumed carry overs from the dairy 16

manure and not likely to be involved in the observed changes in zoospore response. 17

Additional evidence for the presence of a zoosporocidal toxin came from the 18

microscopic observation of germinating zoospores in encystment assays. Zoospores 19

exposed to exudates from seeds sown in sand rapidly encysted and germinated through 20

the formation of germ tubes whereas a high proportion of zoospores exposed to MMSE 21

from vermicompost appeared to lyse during the process of encystment, or if they 22

ultimately encysted, they did not subsequently germinate. The lysis we observed 23

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

18

resembles the morphological alterations observed with zoospores other oomycete 1

pathogens, including Phytophthora cactorum exposed to the zwittermycin- producing 2

bacterium Bacillus cereus UW85 [38], Aphanomyces cochlioides exposed to cell free 3

Lysobacter sp. SB-K88 culture filtrate or its metabolite xanthobaccin A [39], 4

Phytophthora infestans exposed to the cyclic lipopeptide Mass A [40], Phytophthora 5

capsici exposed to the P. fluorescens metabolite rhamnolipid B [41] and Pythium spp. 6

exposed to saponins from oat roots [42]. In all of these cases, lysis is characterized by 7

highly granulated cysts with no visible cell wall whose contents appear to spill into the 8

surrounding medium. Collectively, these studies indicate that a wide range of 9

compounds could be responsible for lysis in our pathosystem. The structures of Pythium 10

aphanidermatum most susceptible to lysis are those lacking a cell wall, i.e. zoospores, 11

vesicles formed during zoosporogenesis, and zoospore cysts in early stages of 12

development. Based on our observed zoospore lysis we would predict that the plasma 13

membranes of vesicles formed during zoosporogenesis may also be susceptible as has 14

been observed previously for Phytophthora spp. [43,44]. This was recently confirmed for 15

P. aphanidermatum using liquid extracts from the same source of vermicomposted dairy 16

manure used in this study, finding that zoosporogenesis could be halted due to the lysis 17

of vesicles that ultimately give rise to zoospores [45]. 18

It should be kept in mind that not all compounds known to reduce zoospore 19

encystment are necessarily also lytic [46]. Our results revealed that MMSE from 20

vermicompost reduced the incidence of germination but not germ tube length in 21

mechanically encysted zoospores, further suggesting that more than one active 22

compound may be present in the spermosphere of seeds colonized by vermicompost 23

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

19

microbes. While pre-encystment exposure to MMSE from vermicompost did not 1

significantly reduce rates of cyst germination compared to a water control as we initially 2

predicted, this assay was not sufficiently sensitive to detect lysed zoospores. Therefore 3

calculating the rate of germination as: (the number of germinated cysts) / (the total 4

number of cysts), may have overestimated germination rates if many more zoospores 5

had initially been present and those that had lysed were not included in the total count. 6

The spermosphere is an ideal location to study disease suppression as it provides 7

a tractable system for fine-scale experimental manipulation in order to focus on the 8

precise location and timing of the interaction between the host microbiota and the 9

pathogen. It is important to note that the putative anti-zoospore compounds identified in 10

this study were found by examining the entire host microbiota in direct association with 11

the host. It is quite possible that whichever microbe/s producing these compounds may 12

only do so in the presence of the host and not while living in the bulk suppressive 13

substrate and may also depend on the presence and proximity of specific other taxa 14

[47]. While we only indirectly measured the seed-colonizing microbial community via 15

their impact on seed exudates, a wide range of bacteria could be responsible for the 16

observed seed exudate alterations that give rise to an interruption of zoospore pre-17

infection events. Other studies point to specific groups of compost-derived bacteria in 18

the spermosphere that are known to produce zoosporolytic compounds and are 19

associated with the suppression of Pythium spp. On the surface of cucumber seeds for 20

example, gammaproteobacteria (Pseudomonas spp.) were associated with the 21

suppression of Pythium ultimum [17] and Bacilli (members of the Paenobacillaceae) 22

were associated with the suppression of Pythium aphanidermatum [48]. On cotton 23

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

20

seeds, fatty acid-metabolizing bacteria and Actinobacteria were associated with the 1

suppression of Pythium ultimum [15]. 2

As the early establishment of plant microbiomes continues to be explored, we now 3

know that seed-associated microbiota are of relatively low complexity compared to 4

those of the rhizosphere. For example, while roots of plants grown in soil have between 5

~18,700 [49] and ~30,000 OTUs [1], cucumber seeds germinating in Pythium 6

suppressive composts have by 8 h ~350 [17] and by 24 h ~550 bacterial OTUs [48]. 7

These bacteria colonize primarily the intercellular crevices in emerging radicles, but are 8

present on the seed coat as well [48]. We found that the 8 h seed-associated 9

microbiota, present long before the development of a root system, can fully explain the 10

observed suppression of disease. The suppressive host-associated microbiota in this 11

pathosystem prevented the arrival of zoospores in vivo and chemically modified seed 12

exudates in such a way that altered zoospore pre-infection behavior in vitro, lysing 13

actively swimming zoospores and reducing cyst germination rates. We identified 14

putative anti-zoospore compounds produced by the suppressive host-associated 15

microbiota in the ethyl acetate extracted organic fraction of exudates from 16

vermicompost treated seeds. In addition to documenting the presence of a zoospore 17

repellant or toxin, we also found evidence that putative chemoattractants were 18

degraded by the suppressive microbial community present on the surface of 19

germinating seeds. Understanding the interference of zoospore pathogenesis by host-20

associated bacteria has implications beyond plant pathology, as Batrachochytrium 21

dendrobatidis, the causal agent of amphibian decline, produces zoospores that use 22

chemotaxis to find susceptible hosts [50] and are susceptible to interference by 23

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

21

metabolites produced by bacteria colonizing amphibian skin [51,52]. Additionally, 1

tracking the transformation of host metabolites by host-associated microbial 2

communities has recently led to major insights into inflammatory diseases of the human 3

gut [53]. As we begin to similarly understand plants as super organisms with both 4

external and internal microbiomes [49], we can increasingly ask questions, share 5

experimental approaches and draw connections across a wide range of pathosystems 6

in order to explore the ecology of disease. 7

8

Materials and Methods 9

A. Experimental materials: 10

Cucumber seeds (Cucumis sativus cv “Marketmore 76”, Johnny’s Seeds) were 11

sorted to remove damaged seeds, individually screened to 0.02 – 0.03 g biomass and 12

surface disinfested with a 0.5% sodium hypochlorite solution for 5 min. Quartz sand was 13

wet sieved to 0.5 - 1.0 mm diameter, oven dried and autoclaved 40 min on three 14

consecutive d before use. Vermicompost (Worm Power, Avon NY) was collected, stored 15

at -20⁰C and thawed at room temperature for 24 h before use in all experiments. 16

Vermicompost was prepared from dewatered dairy manure solids which were mixed 17

7:1:1 with spoiled corn and hay silage and cured hot compost. This mixture was 18

thermogenically composted in a forced air system for up to 2 weeks. Material was then 19

added to continuous flow-through vermicomposting systems stocked with Eisenia fetida 20

and Dendrobaena venata every 3-4 d in 5 cm layers. Finished vermicompost was 21

removed from the underside of the continuous flow-through system and sieved to 10 22

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

22

mm 75 d after the initiation of hot composting. Sterile vermicompost was prepared by 1

autoclaving for 40 min on three consecutive d. Before use in bioassays, 500 g of 2

vermicompost was placed in a 0.25 mm sieve and soaked in 4 L Nanopure® water for 5 3

min before being allowed to drain. This additional step was performed in order to 4

prevent excessive bacterial growth in tubing used in the bioassay apparatus. 5

Pythium aphanidermatum (Edson) Fitzp (Pa58) [54] was cultured on clarified V8 6

juice agar [55] plates at 27⁰C. To maintain virulence and prevent bacterial 7

contamination, cucumber seeds were inoculated with Pa58 zoospores weekly, infected 8

seeds were overlaid with KWARP (water agar with kanamycin sulfate 0.025 mg mL-1, 9

rifampicin 0.015 µg mL-1 and penicillin G 0.015 µg mL-1) and hyphal tips that emerged 10

24 h later were transferred to clarified V8. For zoospore preparation, a core borer (#15, 11

20 mm diam) was used to remove discs from 7 d Pa58 cultures. Each disk was placed 12

in a 70 mm petri dish with 10 mL sterile Nanopure® water for 17 h at 27⁰C. Liquid was 13

then replaced with 10 mL sterile nanopure water and discs were incubated at 27⁰C for 14

an additional 7 h. Zoospores were enumerated with an Improved Neubauer 15

Haemocytometer and diluted with sterile Nanopure® water if necessary. Zoospore 16

suspensions were used immediately after preparation. 17

B. Disease suppression bioassay 18

Bioassays were conducted in an apparatus that held matric potential (Ψm) at a 19

constant -3.5 kPa in a growth chamber at 27⁰C and 18 h photoperiod (Dimock growth 20

chamber facility, Cornell University). In the apparatus, fritted glass Büchner funnels 21

were attached to a water column held under vacuum with one end placed in an open 22

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

23

reservoir, based on the design of Chen and Nelson [16] (Figure S2). This strict level of 1

water control was necessary because of the exacting requirements for zoospore homing 2

responses and maintaining consistent conditions for examination of microbial action in 3

the spermosphere [56-58]. Cucumber seeds (10 per funnel) were sown in 150 cm3 of 4

one of three substrates in the funnels; sterile sand (0.5 – 1.0 mm d), sterile sand 5

amended with 40% (v:v) vermicompost, and sterile sand amended with 40% (v:v) sterile 6

vermicompost. Substrates were flooded for 30 min and 50 mL zoospore suspension 7

(1.2 x 104 zoospores mL-1) was added to inoculated funnels. Substrates were then 8

drained and covered with ventilated Parafilm M to create a moist chamber. Seedlings 9

were harvested 7 d after inoculation and assessed for disease symptoms as determined 10

by shoot height, seedling health rating, seedling survival, and disease incidence. 11

Seedling health was rated on a scale of 0-5 where 0=dead and completely rotted, 12

1=fallen over but not completely rotted, 2=cotelydon and stem lesions, 3=cotelydon 13

lesions only, 4=stem lesions only, and 5=healthy. Disease incidence data (presence or 14

absence of symptoms) were analyzed in SAS v9.3 using binary logistic regression with 15

Bonferroni’s correction for multiple comparisons. Health ratings were analyzed in SAS 16

v9.3 using ANOVA in the general linear model with Tukey’s correction for multiple 17

comparisons. 18

C. In situ zoospore swimming bioassay 19

Point source bioassays based on the design of Heungens and Parke were 20

conducted in the Büchner funnel apparatus described for disease suppression 21

bioassays [12]. Seeds were embedded into nylon mesh in a 4 cm diam circle before 22

sowing to ensure their position would not be disturbed during flooding. After sowing, 23

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

24

Erlenmeyer flasks holding the water column were raised to passively flood the 1

substrates through the fritted glass in the Büchner funnels (Figure S2). After substrates 2

were saturated (~5 min), flasks were then lowered to allow matric potentials (Ψm) to 3

equilibrate at -3.5 kPa. Zoospore suspensions (5 mL, 8 x 104 zoospores mL-1) were 4

added to the center of the substrate and the funnel was covered with ventilated Parafilm 5

to create a moist chamber. A portion of the seeds were destructively harvested at 6

various hours post inoculation (hpi) to test for the presence of Pa58, and the remaining 7

seeds were used to assess disease symptoms and survival at 9 d (point at which no 8

further emergence was recorded from non-inoculated controls) (Figure S.3). For 9-d-old 9

seedlings, disease incidence (presence or absence of symptoms) was analyzed in SAS 10

using binary logistic regression with Bonferroni’s correction for multiple comparisons. 11

Differences in Pa58 DNA on seed surfaces were analyzed using an ANOVA in the 12

general linear model of SAS with sliced interactions for treatment*hpi to generate a 13

means separation. 14

i. Zoospore mass flow 15

To ensure that zoospores added to the bioassay apparatus actively swim to 16

reach seeds and are not distributed throughout the funnel by mass flow, a 5 mL 17

suspension of either actively swimming or mechanically encysted non-motile Pa58 18

zoospores (8 x 104 zoospores mL-1) were added at a point source in the center of the 19

bioassay apparatus. Cucumber seeds were sown in sand with 4 cm spacing. The 20

viability of mechanically encysted non-motile zoospores was tested by adding 5 mL 21

encysted Pa58 zoospores (8 x 104 zoospores mL-1) to the center of the bioassay 22

apparatus. For this test, cucumber seeds were sown at 1 cm spacing. After 24 h, seeds 23

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

25

were transplanted to funnels containing sterile sand to prevent potential infections from 1

secondary zoospores. At 48 hpi half the seeds were removed and plated on KWARP to 2

score for the presence or absence of Pa58. Remaining seedlings were harvested 8 d 3

after sowing to assess disease symptoms and seedling stand. Disease incidence 4

(presence or absence of symptoms) was analyzed in SAS v9.3 using binary logistic 5

regression with Bonferroni’s correction for multiple comparisons. 6

ii. Transplant bioassays 7

To determine whether vermicompost microbes that colonize seeds can protect 8

seeds from zoospore infection, a transplant bioassay was carried out similar to that 9

described by Chen and Nelson [16]. Seeds were sown in sand and in vermicompost-10

amended sand in Büchner funnels as described above and allowed to germinate 8 h 11

before transplanting to sterile sand and point source inoculated with a zoospore 12

suspension. One third of the seeds were assessed for seedling survival and disease 13

symptoms at 9 d to assure the viability of zoospore inoculum and two thirds of the seeds 14

were destructively harvested 24 h post inoculation for assessments of Pa58 biomass via 15

quantitative PCR. 16

iii. Quantitative assessment of Pa58 biomass associated with seeds 17

Cucumber seeds were removed from their respective substrates at 12, 18 and 24 18

hpi and gently tapped to remove adhering sand and vermicompost particles, see overall 19

experimental schematic (Figure S3). Ten seeds were placed in initial DNA extraction 20

buffers (UltraClean® Soil DNA Isolation Kit, MoBio, USA) and frozen overnight at -20⁰C 21

before sample processing. Manufacturer’s protocol for samples with high humic acids 22

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

26

was used for DNA extraction. P. aphanidermatum-specific primer sets were designed 1

using a consensus sequence generated from an alignment of 42 ITS sequences from 2

the NCBI database and our laboratory reference strain, Pa58 (Lasergene® Megalign, 3

DNASTAR, USA). Five potential primer sets were identified using PrimerSelect 4

(DNASTAR, USA and subjected to a melting curve analysis. One primer pair was 5

selected for use in quantitative PCR analysis (PaITS-F 5’ 6

AATGTACGTTCGCTCTTTCTTG 3’, PaITS-R 5’ GGTTGCTTCCTTTAATGTCCTA 3’). 7

Quantitative PCR (qPCR) was carried out using an iQTM5 thermocycler (Bio-Rad, USA). 8

Each 25 µL reaction contained 12.5 µL iQTM SYBR® Green Supermix (Bio-Rad, USA), 9

1.25 µL PaITS4-F and PaITS4-R (500 mM), 1 µL template and 9 µL DNase, RNase free 10

water. P. ultimum mycelial DNA was used as a negative control and water was used as 11

a no template control. Reaction conditions were 40 cycles of 95⁰C for 15 s and 50⁰C for 12

30 s. To generate a standard curve Pa58 was cultured on V8 overlaid with sterile 13

cellophane. Mycelia were harvested after 7 d, lyophilized and weighed. DNA was 14

extracted as above and quantified using a Quant-iTTM PicoGreen® dsDNA quantification 15

kit (Invitrogen, USA) and a VersaFluorTM fluorometer (Bio-Rad, USA). DNA harvested 16

from lyophilized mycelia was used in each qPCR plate with a range of concentrations 1 17

fg to 10 ng µL-1. To ensure that the presence of the cucumber seed and/or the 18

vermicompost substrate did not interfere with DNA extraction or PCR amplification, 19

additional treatments were used. Cucumber seeds were sown in sand or sand amended 20

with 40% v:v vermicompost for 24 h. Seeds sown in vermicompost for 8 h were 21

combined with a known about of lyophilized Pa58 biomass and DNA was extracted and 22

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

27

used to generate additional standard curves in order to rule out potential deleterious 1

effects of residual vermicompost on DNA extraction or PCR efficiency. 2

D. Zoospore responses to MMSE 3

i. Preparation of MMSE 4

Seeds were sown in fritted glass Büchner funnels as described above for disease 5

suppression bioassay and allowed to germinate for 8 h in either sand or vermicompost 6

amended sand. Seeds were then transplanted to sterile sand for an additional 12, 18 or 7

24 h before being removed, see overall experimental schematic (Figure S3). The entire 8

sand matrix of three replicate funnels was then harvested, rinsed with 1 L sterile 9

Nanopure® water, strained through 4 layers of sterile cheesecloth, lyophilized, 10

reconstituted in 15 mL Nanopure® water, sterile filtered to 2 µm with cellulose acetate 11

syringe filters, lyophilized a second time and weighed. The resulting powder was stored 12

at -80°C and reconstituted to 35 X the initial concentration in the full 150 cm3 sand 13

matrix present in the bioassay apparatus (X = total dry seed exudate harvested/ total 14

liquid in sand at -3.5 kPa). This reconstitution rate was determined empirically as one 15

that would result in high numbers of zoospores responding to sand MMSE. Three 16

separate batches of extracts were prepared and used in zoospore assays immediately 17

following reconstitution. 18

Filter-sterilized MMSE was extracted with two 500 mL portions of ethyl acetate 19

per liter of MMSE sample. The organic layers were combined and dried over anhydrous 20

Na2SO4 and the solvent removed in vacuo. Residue was transferred to a tared vial with 21

ethyl acetate, dried under a N2 stream, and vacuum dried to constant weight. The water 22

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

28

soluble layer was lyophilized. All samples were stored in -80oC prior to use in zoospore 1

assays. 2

iii. Zoospore encystment assay 3

A zoospore suspension was prepared as described above and 100 mL (1.2 x 104 4

zoospores mL-1) was added to a 15 cm diam glass petri dish. Rubber gaskets (Grace 5

BioLabs, Bend OR) were adhered to microscope slides, filled with 305 µL 0.01% 6

agarose which was allowed to set for 25 min. Ten µL of 35x MMSE from each treatment 7

was added to the agarose discs and allowed to dry for 3 min. Slides were then 8

immersed in the zoospore suspension and incubated in the dark at room temperature 9

for 30 min. Slides were removed and 4 images were acquired at 10X magnification for 10

each treatment and used for zoospore enumeration (DP25 digital camera with DP2-11

BSW software, Olympus, USA). A mixture of exudate samples was prepared for an 12

additional assay to determine whether observed differences in zoospore encystment 13

were due to the absence of an attractant or the addition of a repellant/lytic agent in the 14

vermicompost MMSE samples. For the mixture treatment, freeze-dried seed exudates 15

were re-suspended at 70 X and then mixed at a 1:1 ratio so that their individual 16

concentration in the “mixture” treatment is equivalent to their concentration when tested 17

individually (35 X). The fate of zoospore cysts was monitored 1 h after initial imaging at 18

higher magnification (304X) to track the occurrence of lysis. Data were analyzed using 19

an ANOVA with a Tukey’s test for means separation (Minitab 16, USA). 20

iv. Zoospore germination assay 21

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

29

Zoospore cyst germination rates were calculated for pre-encystment and post-1

encystment exposure of zoospores to MMSE. For pre-encystment exposure, 10 µL of 2

the test substance (exudate or exudate fraction) was mixed with 6 mL swimming 3

zoospore suspension for 15 min after which suspensions were mechanically encysted 4

via vigorous agitation, and poured into a tissue culture well (Nunc 8 well square tissue 5

culture plates, Thermo Scientific, USA) containing a thin layer of molecular grade low 6

melt agarose and incubated for 1 h prior to imaging. For post-encystment exposure, 10 7

µL of the test substance was mixed with 6 mL mechanically encysted zoospore 8

suspension, immediately added to the tissue culture well and incubated for 1 h prior to 9

imaging. The proportion of germinated cysts (either via germ tubes or secondary 10

zoospores) and germ tube lengths were calculated through image analysis (Olympus 11

DP2-BSW software) for a total of 4 fields of view (~4 mm2) with a water immersion 12

objective (20X 0.5W Ph2, Zeiss). Germination rates were analyzed using binary logistic 13

regression and Bonferonni’s adjustment for multiple comparisons (SAS v.9.3). Germ 14

tube lengths were analyzed using an ANOVA with Tukey’s test for multiple comparisons 15

(Minitab 16). 16

17

v. Fractionation and analysis of MMSE 18

Six replicate samples of MMSE and control seed exudate were prepared from 19

seeds germinated for 24 h in sand or vermicompost and fractionated as described 20

above. Samples were resuspended in a small volume of methanol and shipped to 21

Metabolon (http://metabolon.com) for metabolomic analysis as described previously 22

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

30

using GC/MS [59] and LC/MS [60], except that samples were analyzed directly rather 1

than being subjected to the primary sample extraction procedure. Integrated peak ion 2

count data for each identified compound was used to represent the relative amount of 3

compound in each sample. Missing data were imputed using the minimum observed 4

value for each compound; test groups were compared by statistical analysis (R; Welch’s 5

two-sample t-test) using log-transformed imputed data. False Discovery Rates (FDR), 6

expressed as q-values, were calculated using the method of [61]. Ratios of the group 7

means (from imputed data) were used to construct a fold-change heat map, with fold-8

change values >1 as yellow, and fold-change values <1 as blue. 9

10

Acknowledgements 11

The authors wish to thank Mary Ann Karp, Eric Carr, Monica Minson, Hilary Davis and 12

Lauren Nelson for general technical support. Chemical fractionation of seed exudate 13

samples: Donna Gibson, Bioassay apparatus and seedling photo credits: Kent Loeffler 14

and Claire Smith, statistical consulting: Francoise Vermeylen, qPCR technical support: 15

Eric Markel. 16

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

31

References 1

1. Mendes R, Kruijt M, de Bruijn I, Dekkers E, van der Voort M, et al. (2011) 2

Deciphering the rhizosphere microbiome for disease-suppressive bacteria. 3

Science 332: 1097-1100. 4

2. Mazzola M (2002) Mechanisms of natural soil suppressiveness to soil diseases. 5

Antonie van Leeuwenhoek 81: 557-564. 6

3. Weller DM, Raaijmakers JM, Gardener BBM, Thomashow LS (2002) Microbial 7

populations responsible for specific soil suppressiveness to plant pathogens. 8

Annual Review of Phytopathology 40: 309-347. 9

4. Benitez M-S, Tustas FB, Rotenberg D, Kleinhenz MD, Cardina J, et al. (2007) 10

Multiple statistical approaches of community fingerprint data reveal bacterial 11

populations associated with general disease suppression arising from the 12

application of different organic field management strategies. Soil Biology & 13

Biochemistry 39: 2289-2301. 14

5. Kowalchuk GA, van Os GJ, Aartrijk J, Veen JA (2003) Microbial community 15

responses to disease management soil treatments used in flower bulb cultivation. 16

Biology and Fertility of Soils 37: 55-63. 17

6. van Os GJ, van Ginkel JH (2001) Suppression of Pythium root rot in bulbous Iris in 18

relation to biomass and activity of the soil microflora. Soil Biology & Biochemistry 19

33: 1447-1454. 20

7. Janvier C, Villeneuve F, Alabouvette C, Edel-Hermann V, Mateille T, et al. (2007) Soil 21

health through soil disease suppression: Which strategy from descriptors to 22

indicators? Soil Biology & Biochemistry 39: 1-23. 23

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

32

8. Postma J, Scheper RWA, Schilder MT (2010) Effect of successive cauliflower 1

plantings and Rhizoctonia solani AG 2-1 inoculations on disease 2

suppressiveness of a suppressive and a conducive soil. Soil Biology & 3

Biochemistry 42: 804-812. 4

9. Kyselkova M, Kopecky J, Frapolli M, Defago G, Sagova-Mareckova M, et al. (2009) 5

Comparison of rhizobacterial community composition in soil suppressive or 6

conducive to tobacco black root rot disease. ISME Journal 3: 1127-1138. 7

10. Borneman J, Becker JO (2007) Identifying microorganisms involved in specific 8

pathogen suppression in soil. Annual Review of Phytopathology 45: 153-172. 9

11. Hartmann A, Schmid, van Tuinen D, Berg G (2009) Plant-driven selection of 10

microbes. Plant and Soil 321: 235-257. 11

12. Heungens K, Parke JL (2000) Zoospore homing and infection events: Effects of the 12

biocontrol bacterium Burkholderia cepacia AMMDR1 on two oomycete 13

pathogens of pea (Pisum sativum L.). Applied and Environmental Microbiology 14

66: 5192-5200. 15

13. Windstam S, Nelson EB (2008) Differential interference with Pythium ultimum 16

sporangial activation and germination by Enterobacter cloacae in the corn and 17

cucumber spermospheres. Applied and Environmental Microbiology 74: 4285-18

4291. 19

14. Windstam S, Nelson EB (2008) Temporal release of fatty acids and sugars in the 20

spermosphere: Impacts on Enterobacter cloacae-induced biological control. 21

Applied and Environmental Microbiology 74: 4292-4299. 22

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

33

15. McKellar ME, Nelson EB (2003) Compost-induced suppression of Pythium 1

damping-off is mediated by fatty-acid-metabolizing seed-colonizing microbial 2

communities. Applied and Environmental Microbiology 69: 452-460. 3

16. Chen M-H, Nelson EB (2008) Seed-colonizing microbes from municipal biosolids 4

compost suppress Pythium ultimum damping-off on different plant species. 5

Phytopathology 98: 1012-1018. 6

17. Chen M-H, Jack ALH, McGuire IC, Nelson EB (2012) Seed-colonizing bacterial 7

communities associated with the suppression of Pythium seedling disease in a 8

municipal biosolids compost. Phytopathology 102: 478-489. 9

18. Scheuerell S, Sullivan DM, Mahaffee W (2005) Suppression of seedling damping-off 10

caused by Pythium ultimum, Pythium irregulare, and Rhizoctonia solani in 11

container media amended with a diverse range of Pacific Northwest compost 12

sources. Phytopathology 95: 306-315. 13

19. Szczech MM (1999) Suppressiveness of vermicompost against Fusarium wilt of 14

tomato. Journal of Phytopathology 147: 155-161. 15

20. Simsek-Ersahin YS, Haktanir K, Yanar Y (2009) Vermicompost suppresses 16

Rhizoctonia solani Kuhn in cucumber seedlings. Journal of Plant Diseases and 17

Protection 116: 182-188. 18

21. Jack ALH (2010) Suppression of Plant Pathogens with Vermicomposts. In: Edwards 19

C, Arancon, NQ, Sherman, RL, editor. Vermiculture Technology: Earthworms, 20

Organic Wastes and Environmental Management. Boca Raton, FL: CRC Press. 21

pp. 165-181. 22

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

34

22. Farr D, Bills G, Chamuris G, Rossman A (1989) Fungi on Plants and Plant Products 1

in the United States. St. Paul, MN: American Phytopathological Society. 2

23. Martin FN, Loper JE (1999) Soilborne plant diseases caused by Pythium spp: 3

Ecology, epidemiology, and prospects for biological control. Critical Reviews in 4

Plant Sciences 18: 111-181. 5

24. Nelson E (2006) Rhizosphere regulation of preinfection behavior of oomycete plant 6

pathogens. In: Mukerji KG, Manoharachary KG, Singh J, editors. Microbial 7

Activity in the Rhizoshere. Berlin: Springer Berlin Heidelberg. pp. 311-343. 8

25. Deacon JW, Donaldson SP (1993) Molecular recognition in the homing responses 9

of zoosporic fungi with special reference to Pythium and Phytophthora. 10

Mycological Research 97: 1153-1171. 11

26. Walker CA, van West P (2007) Zoospore development in the oomycetes. Fungal 12

Biology Reviews 21: 10-18. 13

27. Deacon JW (1996) Ecological implications of recognition events in the pre-infection 14

stages of root pathogens. New Phytologist 133: 135-145. 15

28. Donaldson SP, Deacon JW (1993) Effects of amino acids and sugars on zoospore 16

taxis, encystment and cyst germination in Pythium aphanidermatum (Edson) 17

Fitzp, P. catenulatum Matthews and P. dissotocum Drechs. New Phytologist 123: 18

289-295. 19

29. Donaldson SP, Deacon JW (1993) Differential encystment of zoospores of Pythium 20

species by saccharides in relation to establishment on roots. Physiological and 21

Molecular Plant Pathology 42: 177-184. 22

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

35

30. Reid B, Morris BM, Gow NAR (1995) Calcium-dependent, genus-specific, 1

autoaggregation of zoospores of phytopathogenic fungi. Experimental Mycology 2

19: 202-213. 3

31. Islam MT (2010) Mode of antagonism of a biocontrol bacterium Lysobacter sp SB-4

K88 toward a damping-off pathogen Aphanomyces cochlioides. World Journal of 5

Microbiology & Biotechnology 26: 629-637. 6

32. Shang H, Chen J, Handelsman J, Goodman RM (1999) Behavior of Pythium 7

torulosum zoospores during their interaction with tobacco roots and Bacillus 8

cereus. Current Microbiology 38: 199-204. 9

33. Zhou T, Paulitz TC (1993) In vitro and in vivo effects of Pseudomonas spp. on 10

Pythium aphanidermatum: Zoospore behavior in exudates and on the rhizoplane 11

of bacteria-treated cucumber roots. Phytopathology 83: 872-876. 12

34. Lioussanne L, Jolicoeur M, St-Arnaud M (2008) Mycorrhizal colonization with 13

Glomus intraradices and development stage of transformed tomato roots 14

significantly modify the chemotactic response of zoospores of the pathogen 15

Phytophthora nicotianae. Soil Biology & Biochemistry 40: 2217-2224. 16

35. Sipila TP, Yrjala K, Alakukku L, Palojarvi A (2012) Cross-site soil microbial 17

communities under tillage regimes: Fungistasis and microbial biomarkers. 18

Applied and Environmental Microbiology 78: 8191-8201. 19

36. Sjogren J, Magnusson J, Broberg A, Schnurer J, Kenne L (2003) Antifungal 3-20

hydroxy fatty acids from Lactobacillus plantarum MiLAB 14. Applied and 21

Environmental Microbiology 69: 7554-7557. 22

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

36

37. Raaijmakers J, de Bruijn I, de Kock M (2006) Cyclic lipopeptide production by plant-1

associated Pseudomonas spp.: Diversity, activity, biosynthesis, and regulation. 2

Molecular Plant-Microbe Interactions 19: 699-710. 3

38. Gilbert GS, Handelsman J, Parke JL (1990) Role of ammonia and calcium in lysis of 4

zoospores of Phytophthora cactorum by Bacillus cereus strain UW85. 5

Experimental Mycology 14: 1-8. 6

39. Islam MT, Hashidoko Y, Deora A, Ito T, Tahara S (2005) Suppression of damping-7

off disease in host plants by the rhizoplane bacterium Lysobacter sp. strain SB-8

K88 is linked to plant colonization and antibiosis against soilborne 9

Peronosporomycetes. Applied and Environmental Microbiology 71: 3786-3796. 10

40. de Bruijn I, de Kock MJD, Yang M, de Waard P, van Beek TA, et al. (2007) 11

Genome-based discovery, structure prediction and functional analysis of cyclic 12

lipopeptide antibiotics in Pseudomonas species. Molecular Microbiology 63: 417-13

428. 14

41. Kim BS, Y. LJ, Hwang BK (2000) In vivo control and in vitro antifungal activity of 15

rhamnolipid B, a glycolipid antibiotic, against Phytophthora capsici and 16

Colletotrichum orbiculare. Pest Management Science 56: 1029-1035. 17

42. Deacon JW, Mitchell RT (1985) Toxicity of oat roots, oat root extracts, and saponins 18

to zoospores of Pythium spp. and other fungi. Transactions of the British 19

Mycological Society 84: 479-487. 20

43. Meyer JR, Linderman RG (1986) Selective influence on populations of rhizosphere 21

or rhizoplane bacteria and actinomycetes by mycorrhizas formed by Glomus 22

fasciculatum. Soil Biology & Biochemistry 18: 191-196. 23

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

37

44. Norman JR, Hooker JE (2000) Sporulation of Phytophthora fragariae shows greater 1

stimulation by exudates of non-mycorrhizal than by mycorrhizal strawberry roots. 2

Mycological Research 104: 1069-1073. 3

45. Carr E, Nelson EB (In review) Disease-suppressive vermicompost induces a shift in 4

germination mode of Pythium aphanidermatum zoosporangia. Plant Disease. 5

46. Folman LB, De Klein M, Postma J, van Veen JA (2004) Production of antifungal 6

compounds by Lysobacter enzymogenes isolate 3.1T8 under different conditions 7

in relation to its efficacy as a biocontrol agent of Pythium aphanidermatum in 8

cucumber. Biological Control 31: 145-154. 9

47. Garbeva P, Silby MW, Raaijmakers JM, Levy SB, Boer Wd (2011) Transcriptional 10

and antagonistic responses of Pseudomonas fluorescens Pf0-1 to 11

phylogenetically different bacterial competitors. ISME J 5: 973-985. 12

48. Ofek M, Hadar Y, Minz D (2011) Colonization of cucumber seeds by bacteria during 13

germination. Environmental Microbiology 13: 2794-2807. 14

49. Lundberg DS, Lebeis SL, Paredes SH, Yourstone S, Gehring J, et al. (2012) 15

Defining the core Arabidopsis thaliana root microbiome. Nature 488: 86-90. 16

50. Moss AS, Reddy NS, Dortaj IM, San Francisco MJ (2008) Chemotaxis of the 17

amphibian pathogen Batrachochytrium dendrobatidis and its response to a 18

variety of attractants. Mycologia 100: 1-5. 19

51. Flechas SV, Sarmiento C, Cárdenas ME, Medina EM, Restrepo S, et al. (2012) 20

Surviving Chytridiomycosis: Differential anti-Batrachochytrium dendrobatidis 21

activity in bacterial isolates from three lowland species of Atelopus. PLoS ONE 7: 22

e44832. 23

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

38

52. Lam B, Walton D, Harris R (2011) Motile zoospores of Batrachochytrium 1

dendrobatidis move away from antifungal metabolites produced by amphibian 2

skin bacteria. EcoHealth 8: 36-45. 3

53. Berry D, Stecher B, Schintlmeister A, Reichert J, Brugiroux S, et al. (2013) Host-4

compound foraging by intestinal microbiota revealed by single-cell stable isotope 5

probing. Proceedings of the National Academy of Sciences of the United States 6

of America 110: 4720-4725. 7

54. Ben-Yephet Y, Nelson EB (1999) Differential suppression of damping-off caused by 8

Pythium aphanidermatum, P. irregulare, and P. myriotylum in composts at 9

different temperatures. Plant Disease 83: 356-360. 10

55. Miller P (1955) V-8 juice agar as a general purpose medium for fungi and bacteria. 11

Phytopathology 45: 461-462. 12

56. Mandelbaum R, Hadar Y, Chen Y (1993) Simple apparatus to study microbial 13

activity in organic substrates under constant water potential. Soil Biology & 14

Biochemistry 25: 397-399. 15

57. Duniway JM (1976) Movement of zoospores of Phytophthora cryptogea in soils of 16

various textures and matric potentials Phytopathology 66: 877-882. 17

58. Kliejunas JT, Ko WH (1974) Effect of motility of Phyophthora palmovira zoospores 18

on disease severity of papaya seedlings and substrate colonoization in soil 19

Phytopathology 64: 426-428. 20

59. Lawton KA, Berger A, Mitchell M, Milgram KE, Evans AM, et al. (2008) Analysis of 21

the adult human plasma metabolome. Pharmacogenomics 9: 383-397. 22

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

39

60. Evans AM, DeHaven CD, Barrett T, Mitchell M, Milgram E (2009) Integrated, 1

Nontargeted Ultrahigh Performance Liquid Chromatography/Electrospray 2

Ionization Tandem Mass Spectrometry Platform for the Identification and Relative 3

Quantification of the Small-Molecule Complement of Biological Systems. 4

Analytical Chemistry 81: 6656-6667. 5

61. Storey JD, Tibshirani R (2003) Statistical significance for genomewide studies. 6

Proceedings of the National Academy of Sciences of the United States of 7

America 100: 9440-9445. 8

9

10

11

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

40

Figure 1. Representative 7 d-old cucumber (Cucumis sativus cv. “Marketmore 76”) 1

seedlings from disease suppression bioassays. Surface disinfested cucumber seeds 2

were sown in A) sand amended with vermicomposted dairy manure (40% v:v), B) sterile 3

quartz sand, and C) sterile sand amended with sterile vermicompost (40% v:v). Each 4

group of 10 inoculated seedlings received 6 x 105 Pythium aphanidermatum zoospores. 5

Matric potential (Ψm) was held constant at -3.5 kPa. Scale bar = 5 cm. 6

7

8

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

41

Figure 2. Representative P. aphanidermatum zoospore germlings exposed to 1

microbially modified seed exudate (MMSE) for 30 min in the zoospore encystment 2

assay. Horizontal panels represent different microscopy images from the same 3

treatment. Treatments include; A) 24 h MMSE from seeds pre-germinated in sand for 8 4

h, then transplanted to sand for 24 h, B) 24 h MMSE from seeds pre-germinated in 5

vermicompost for 8 h, then transplanted to sand for 24 h and, C) a 1:1 mixture of A & B. 6

Scale bar = 25 µm. 7

8

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

42

Figure 3. Representative Pythium aphanidermatum zoospore germlings exposed to 1

fractionated microbially modified seed exudate (MMSE) for 30 min in the zoospore 2

encystment assay. Horizontal panels represent different microscopy images from the 3

same treatment. A) aqueous and B) EtOAc fractions respectively of MMSE from seeds 4

pre-germinated in sand for 8 h and transplanted to sand for 24 h; C) aqueous and D) 5

EtOAc fractions respectively of MMSE from seeds pre-germinated in vermicompost for 6

8 h and transplanted to sand for 24 h . Scale bar = 25 µm. 7

8

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

43

Figure 4. Heat map showing individual compounds detected at a significantly higher 1

relative abundance in vermicompost microbially modified seed exudate (MMSE) 2

compared to control seed exudate (n = 6 biological replicates per treatment as indicated 3

by column headings). Relative abundances derived from gas and liquid chromatography 4

combined with mass spectrometry (GC/LC-MS). Scaled imputed data derived from raw 5

integrated peak ion counts for individual compounds were natural log transformed and 6

subjected to a Welch’s two way t-test to calculate p-values for treatment differences. 7

Heat map colors as follows; blue = lower relative abundance, black = no change, yellow 8

= higher relative abundance. 9

10

11

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

44

Figure S.1 Heat map showing individual compounds detected at a significantly lower 1

relative abundance in vermicompost microbially modified seed exudate (MMSE) 2

compared to control seed exudate (n = 6 biological replicates per treatment as indicated 3

by column headings). Relative abundances derived from gas and liquid chromatography 4

combined with mass spectrometry (GC/LC-MS). Scaled imputed data derived from raw 5

integrated peak ion counts for individual compounds were natural log transformed and 6

subjected to a Welch’s two way t-test to calculate p-values for treatment differences. 7

Heat map colors as follows; blue = lower relative abundance, black = no change, yellow 8

= higher relative abundance. 9

10

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

45

1

2

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

46

Figure S.2 Bioassay apparatus; A) Arrows indicate where water column is exposed to 1

air, height of water column = 35 cm which gives -3.5 kPa matric potential in the fritted 2

glass Buchner funnel, B) Sand and seeds added to the funnel, funnel being passively 3

flooded while Erlenmeyer flask is on the upper shelf, C) Nylon membrane with surface 4

disinfested cucumber seeds sown in a 4 cm diameter circle, red X indicates location of 5

zoospore inoculation once the matrix has been equilibrated at -3.5 kPa matric potential. 6

7

8

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

47

Figure S.3 Schematic linking in vivo and in vitro experiments. Time points for the 1

collection of microbially modified seed exudates (MMSE) are indicated in the top portion 2

of the figure and time points for zoospore inoculation and harvest of seeds for DNA 3

extraction are indicated in the bottom portion of the figure. 4

5

6

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

48

Table 1. Mortality and disease of cucumber seedlings in disease suppression bioassaysa 1

Vermicompost Sand

Batch 1 2 3 Sterile Sterile

Inoculation + - + - + - + - + -

Seedling

mortality 0 11 c 0 20 b 0 11 c 3 28 b 0 97 a

lsmeans

health rating 5.00 a 4.38 b 5.00 a 4.05 c 5.00 a 4.25 bc 4.83 ab 3.35 d 5.00 a 0.78 e

a Replication: n = 90 seeds for all treatments except for sterile vermicompost n = 60 seeds. 2

b Seedling mortality means followed by the same letter are not significantly different (binomial logistic regression with 3

Bonferonni’s correction for multiple comparisons p < 0.0001). 4

c Health ratings least squared means followed by the same letter are not significantly different (ANOVA with Tukey’s 5

correction for multiple comparisons, p<0.0001). Health ratings for individual seedlings were designated as follows: 0=dead 6

and completely rotted, 1=damped off but not completely rotted, 2=cotelydon and stem lesions, 3=cotelydon lesions only, 7

4=stem lesions only, 5=healthy. 8

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

49

Table 2. In vitro and in vivo responses of Pythium aphanidermatum zoospores to microbially modified cucumber seed

exudates.a In vitro and in vivo assays linked in an overarching experimental design (Figure S3).

Sand hptb Vermicompost hpt

b Water

Developmental Stage 12 18 24 12 18 24 NA

Chemotaxis/encystmentc e *

Average # encysted zoospores

(per mm2)

16.6 bc 20.8 b 39.8 a 9.7 cd 7.1 d 5.1 d 2.3 d

Germination d e *

(exposure pre-encystment)

% germinated

zoospore cysts - - 55.0 a - - 46 b 43 b

Germinationd e *

(exposure post-encystment)

% germinated

zoospore cysts 63.0 a 59.0 ab 52.0 b 55.0 ab 51.0 b 35.0 c 27.0 d

Arrival/ colonizationf**

P. aphanidermatum biomass

(pg DNA 10 seeds-1

) 8.5 abc 14.4 ab 16.4 a 1.1 c 0.4 c 0.6 c NA

Infectiong**

Disease incidence

(% seedling stand at 9 d) 98.8 a 31.1 b NA

* In vitro analyses of zoospore exposure to seed exudates collected directly from bioassay apparatus

** In vivo analyses conducted in bioassay apparatus

a Values followed by the same letter in each row are not significantly different (α = 0.05).

b hpt = hours post transplant

c Zoospore chemotaxis and encystment response to seed exudates modified by the 8 h seed colonizing microbial

community derived from vermicompost and harvested 12, 18 or 24 h after transplanting colonized seeds to sterile sand.

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

50

Each value is an average of 4 fields of view from 1, 2 and 3 replications respectively for 3 different MMSE batches (n = 6,

p < 0.0001).

d Binary logistic regression for: pre-encystment exposure (n = 3, p < 0.0001, post-encystment exposure (n = 3, p <

0.0001). An average of 400 total zoospores from 4 fields of view and 3 replications were used to calculate germination

percentages for each treatment – time point combination with a total of over 9,000 individual zoospores scored.

e For in vitro zoospore assays “Sand” treatment consists of exudates collected from seeds pre-germinated in sand for 8 h,

then transplanted to sand for 24 h; “Vermicompost” treatment consists of exudates collected from seeds pre-germinated in

sand amended with 40% vermicompost for 8 h, then transplanted to sand for 24 h. Freeze-dried seed exudates were re-

suspended at 35 X their calculated concentration in the Buchner funnels (X = total dry seed exudate harvested/ total liquid

in sand at -3.5 kPa).

f Least squared means of P. aphanidermatum DNA for seeds removed from point source bioassay experiment at 12, 18

and 24 h. Each point is an average of 2 funnels within 3 full repetitions of the qPCR assay (n = 6). (treatment p < 0.0001,

total treatment*hpi p = 0.101, significant individual treatment*hpi interactions all p < 0.001).

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

51

g Seedling disease incidence for seeds sown in vermicompost or sand, transplanted to sand at 8 h, point-source

inoculated with 6x104 zoospores, and incubated at a matric potential (Ψm) of -3.5 kPa for 9 d with 16 h photoperiod at

27⁰C (n = 30) (p < 0.0001).

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

52

Table 3. Zoospore encystment and lysis in response to 24 h microbially modified seed

exudates (MMSE) from seeds originally sown in sand and vermicompost.a

Seed exudate treatmentsb c

Mean encysted

zoospores

(per mm2)

Proportion of

lysed zoospores

(%)

Sand 31.1 a 15 b

Vermicompost 13.1 b 34 a

Mixture of exudates from sand

and vermicompost 13.1 b 44 a

Water (no seed) 2.7 c 2 b

a Means were calculated by counting 4 fields of view for 2, 3 and 3 replicates

respectively of 3 different batches of MMSE. Means followed by the same letter in each

column are not significantly different (n = 8, ANOVA p < 0.0001). Over 1,000 total

zoospores were individually scored for lysis.

b “Sand” treatment consists of exudates collected from seeds pre-germinated in sand for

8 h, then transplanted to sand for 24 h; “Vermicompost” treatment consists of exudates

collected from seeds pre-germinated in sand amended with 40% vermicompost for 8 h,

then transplanted to sand for 24 h.

c Seeds were sown in sand or vermicompost for 8 h and then transplanted to sand for

24 h before exudates were collected. Freeze-dried seed exudates were re-suspended

at 35 X their calculated concentration in the Buchner funnels (X = total dry seed exudate

harvested/ total liquid in sand at -3.5 kPa). For the mixture treatment, freeze-dried seed

exudates were re-suspended at 65 X and then mixed at a 1:1 ratio so that their

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

53

individual concentration in the “mixture” treatment is equivalent to their concentration

when tested individually.

For internal review only

9/13/13 draft of manuscript in preparation for October submission to PLoS Pathogens

54

Table 4. Zoospore encystment, germination, and lysis in response to different chemical

fractionsa of 24 h MMSE from seeds pre-germinated in vermicompost or sand for 8 h.

a Aqueous fraction extracted with water, organic fraction extracted with ethyl acetate.

b Values followed by the same letter in a single column are not significantly different

(n=5, ANOVA p < 0.0001). Over 1,200 zoospores were individually scored for

germination and lysis (n=5, binary logistic regression p < 0.0001).

c “Sand” treatment consists of exudates collected from seeds pre-germinated in sand for

8 h, then transplanted to sand for 24 h; “Vermicompost” treatment consists of exudates

collected from seeds pre-germinated in sand amended with 40% vermicompost for 8 h,

then transplanted to sand for 24 h.

Seed exudate treatmentsb c lsmeans

encysted

zoospores

per 1 mm2

Proportion of

germinated

zoospores

(%)

Proportion of

lysed

zoospores

(%)

Sand - organic fraction 30.2 A 66 C 6 B

Sand - aqueous fraction 10.9 B 94 A 5 B

Vermicompost - organic fraction 3.0 C 35 D 16 A

Vermicompost - aqueous fraction 4.6 C 81 B 2 B

EtOAc (no seed) 7.5 C 58 C 6 AB

Water (no seed) 1.6 C 86 AB 6 AB