AlternativeSplicingofTypeIIProcollagenExon2Is ... · construct was sequenced to confirm correct orientation and the absence of mutations. Transient Transfections of the COL2A1 Mini-gene—The

Alternative Splicing of Type II Procollagen Exon 2 IsRegulated by the Combination of a Weak 5� Splice Site andan Adjacent Intronic Stem-loop Cis Element*

Received for publication, June 1, 2005, and in revised form, July 7, 2005 Published, JBC Papers in Press, August 2, 2005, DOI 10.1074/jbc.M505940200

Audrey McAlinden‡1, Necat Havlioglu‡§, Li Liang‡, Sherri R. Davies‡, and Linda J. Sandell‡¶

From the ‡Department of Orthopaedic Surgery and ¶Department of Cell Biology, Washington University School of Medicine,St Louis, Missouri 63110 and §Department of Pathology, St. Louis University, St. Louis, Missouri 63110

Alternative splicing of the type II procollagen gene (COL2A1) isdevelopmentally regulated during chondrogenesis. Chondropro-genitor cells produce the type IIA procollagen isoform by splicing(including) exon 2 during pre-mRNA processing, whereas differen-tiated chondrocytes synthesize the type IIB procollagen isoform byexon 2 skipping (exclusion). Using a COL2A1mini-gene and chon-drocytes at various stages of differentiation, we identified a non-classical consensus splicing sequence in intron 2 adjacent to the 5�

splice site, which is essential in regulating exon 2 splicing. RNAmapping confirmed this region contains secondary structure in theform of a stem-loop. Mutational analysis identified three cis ele-ments within the conserved double-stranded stem region that arefunctional only in the context of the natural weak 5� splice site ofexon 2; they are 1) a uridine-rich enhancer element in all cell typestested except differentiated chondrocytes; 2) an adenine-richsilencer element, and 3) an enhancer cis element functional in thecontext of secondary structure. This is the first report identifyingkey cis elements in the COL2A1 gene that modulate the cell type-specific alternative splicing switch of exon 2 during cartilagedevelopment.

Alternative precursor mRNA (pre-mRNA)2 processing is an impor-tantmechanism to increase proteomic diversity in eukaryotes. Throughthis process two or more mRNAmolecules are generated from a singlegene, leading to the synthesis of proteins that differ in structure and/orbiological function (1). Numerous reports have shown that some alter-native splicing events are cell type-specific or developmentally regulated(2–7). Constitutive removal of non-coding introns from pre-mRNA inthe nucleus occurs via a complex set of reactions at exon-intron junc-tions called splice sites. These splice site sequences are recognized byspecific small nuclear ribonucleoproteins and accessory protein factorsthat make up the spliceosome complex (8). Two bona fide intronicsequences are also required for constitutive splicing to occur in additionto the 5� and 3� splice sites; they are the branch point sequence and thepolypyrimidine tract sequence, both present upstream of the 3� splicesite (8–10). The information content present in these canonical splicingsignals is generally not sufficient to ensure correct assembly of the spli-

ceosome, especially in the case of regulated exons. Therefore, additionalsignals exist in the form of auxiliary cis elements (11–14), which can bepresent either within the exon or in the flanking introns. Subsequently,splicing can be affected in a positive or negative manner by trans-actingenhancer or silencer splicing factor proteins that bind to these cis ele-ments (15–20). In addition, other regulatory cis elements exist that arefunctional in the context of RNA secondary structure conformations(21–23).Although it has been recently estimated that more than half of all

human genes generatemore than onemRNAdue to alternative splicing,information on themolecular processes governing cell-type or develop-mentally regulated alternative splicing is limited. In this respect, theprocess of chondrogenesis is an attractive model to study alternativesplicing since a number of important cartilage molecules are splicedduring chondrocyte differentiation (24). In particular, the cartilageextracellular matrix proteins type II collagen (25), type XI collagen (26),fibronectin (27) and tenascin C (28) are all alternatively spliced duringcartilage developmentwhere a specific exon(s) encoding potential bind-ing domains are spliced (included) in mRNAs expressed by chondro-progenitor cells but are skipped (excluded) from mRNAs expressed bydifferentiated chondrocytes. Of these molecules, type II collagen repre-sents the simplest model and the best described alternative splicingevent that occurs during chondrogenesis. Type II collagen is the majorcollagen component of cartilage extracellular matrix and is synthesizedas a procollagen molecule of three identical � chains, �1(II), containingan amino and carboxyl propeptide (29). The amino and carboxylpropeptides are subject to cleavage resulting in mature, homotrimericcollagen fibers that form stable fibrils in the extracellular matrix. Onlyone of the 54 exons encoding COL2A1 is alternatively spliced, produc-ing two mRNA isoforms, type IIA and type IIB procollagen (25). Thetype IIA procollagen mRNA isoform contains the regulated, cassetteexon (exon 2) and is synthesized by chondroprogenitor cells, whereastype IIB procollagen mRNA, devoid of exon 2, is synthesized by differ-entiated chondrocytes. Transcription of type IIA procollagen occurs inother cell types during embryonic development (30–33), but the devel-opmentally regulated splicing switch from type IIA to type IIB procol-lagen apparently only occurs during chondrogenesis. In addition, thephenotype of a differentiated chondrocyte is defined by its expression ofthe type IIB procollagen isoform.Thus, theCOL2A1 alternative splicingevent essentially defines the process of chondrocyte differentiation and,as such, is an excellent model to study key mechanisms that controlcartilage development.Exon 2 encodes a cysteine-rich (CR) von Willebrand factor C-like

domain within the amino propeptide of type II procollagen. Homo-logues of this CR domain are present in other fibrillar collagen aminopropeptides as well as in extracellular matrix proteins including throm-bospondins, connective tissue growth factor, and chordin (34, 35). Pre-

* This work was supported by NIAMS, National Institutes of Health Grants AR48250 (toA. M.) and AR036994 (to L. J. S.). The costs of publication of this article were defrayedin part by the payment of page charges. This article must therefore be hereby marked“advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 To whom correspondence should be addressed: Dept. of Orthopaedic Surgery atWashington University, 660 South Euclid Ave., Box 8233, St Louis, MO 63110. Tel.:314-454-8860; Fax: 314-454-5900; E-mail: [email protected].

2 The abbreviations used are: pre-mRNA, precursor messenger RNA; COL2A1, humantype II procollagen gene; HEK-293, human embryonic kidney 293 cells; RCS, rat chon-drosarcoma; RT, reverse transcription; CR, cysteine-rich; snRNA, small nuclear RNA;MYPT-1, myosin phosphatase-targeting subunit-1; kb, kilobase(s).

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 280, NO. 38, pp. 32700 –32711, September 23, 2005© 2005 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A.

32700 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 280 • NUMBER 38 • SEPTEMBER 23, 2005

by guest on August 4, 2020

http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

vious studies have shown that the CR exon 2-encoded domain of type IIprocollagenmay have an important biological function during develop-ment by binding to growth factors such as bone morphogenetic pro-teins, similar to the function of chordin (35, 36). The presence of thetype IIA procollagen isoform in other non-cartilaginous embryonic tis-sues such as heart, lung, kidney, and eye (30, 32, 37, 38) also suggests animportant function for the CR domain during developmental processes.Furthermore, it has been reported that the immature IIA procollagenisoform is re-expressed during cartilage degradation, as seen in osteo-arthritis (39), suggesting an additional function for the exon 2-encodedCR domain during tissue repair.Two studies have been published on COL2A1 alternative splicing at

the pre-mRNA level. One report (40) showed that a murine Col2a1mini-gene was correctly spliced during insulin-dependent chondrocytedifferentiation of murine ATDC-5 cells. The same group subsequentlyshowed that deleting large portions of introns 1 and 2 still resulted incorrect splicing of the Col2a1 mini-gene in ATDC-5 cells (41). How-ever, to date, there are no reports of specific cis elements or trans-actingsplicing factor proteins that are important in regulating humanCOL2A1 exon 2 alternative splicing.Using a human COL2A1 mini-gene as a model system, the present

study is the first to identify functional cis elements in intron 2 ofCOL2A1 pre-mRNA that modulate splicing of exon 2. RNA mappinganalysis showed that a non-classical consensus splicing region adjacentto the 5� splice site of exon 2 contains RNA secondary structure in theform of a stem-loop. This is the first study to experimentally show theexistence of a stem-loop directly adjacent to a weak 5� splice site of anexon that is regulated in a tissue-specific manner during development.We report that the double-stranded stem sequence, which is 100% con-served between species, contains both enhancer and silencer cis ele-ments that are functional in regulating type II procollagen isoformexpression during chondrocyte differentiation. From the data reportedin the present study, we have proposed a model whereby the secondarystructure of the stem-loop functions to mask the weak 5� splice site.Functionally, it is the interaction of enhancer and/or silencer trans-acting splicing factor proteins with cis elements in the stem-loop regionthat determines the pattern of exon 2 splicing at a specific phase ofcartilage development.

MATERIALS AND METHODS

Construction of a Human COL2A1 Mini-gene—A human COL2A1mini-gene was constructed spanning exons 1–3, including full-lengthintron 1 and intron 2 sequences (Fig. 1). Three separate fragments of themini-gene were synthesized by PCR from human genomic DNA (Clon-tech) using the elongase amplification system (Invitrogen). Each frag-ment was amplified using the primer pairs listed in TABLE ONE con-taining specific restriction enzyme sites for sequential cloning intopcDNA3 vector (Invitrogen). The cloned mini-gene (�5.9 kb) is under

transcriptional control of the cytomegalovirus promoter. The DNAconstruct was sequenced to confirm correct orientation and theabsence of mutations.

Transient Transfections of the COL2A1 Mini-gene—The followingcell lines were transfected with the COL2A1 mini-gene: C3H 10T1/2murinemesenchymal cells (ATCC),MC615murine vertebral chondro-cytes (a gift from Dr. Frederic Mallein-Gerin, Lyon, France), T/C28I2chondrocytes from human costal cartilage (a gift from Dr. Mary Gold-ring, Harvard University), RCS (LTC) rat chondrosarcoma cells (42),and HEK-293 human embryonic kidney cells. COL2A1 mini-gene inpcDNA3 vector was transfected into each of the cell lines usingFuGENE 6 reagent (Roche Applied Science) following the manufactur-er’s protocol. Briefly, 1–3�g of themini-gene construct was transfectedinto each cell line at a ratio of 1:4 (�g/�l) DNA:FuGENE for 5 h inserum-free medium. Serum-containing medium was then added (finalconcentration, 10% fetal bovine serum), and the cells were cultured fora further 48 h until RNA isolation.

Analysis of Spliced mRNA Isoforms Derived from the COL2A1Mini-gene—Total RNA was harvested from each cell line 48 h aftertransfection using the Qiagen RNeasy kit. Approximately 1 �g of RNAwas reverse-transcribed using random primers in a final volume of 20�l, and the resulting cDNAwas diluted to 80 �l with sterile water. 10 �lof cDNAwas used for quantitative PCR in the presence of [�-32P]dCTP(10 mCi/ml, 3000 Ci/mmol; Amersham Biosciences). The primers,pcDNA3-COL2A1-Exon1 (5�-CAAGCTTACATGATTCGC-3�) andsp6, were used to amplify cDNA derived only from the exogenouslytransfectedCOL2A1mini-gene (Fig. 1). The linear range for these prim-ers was established, and PCRwas carried out for 20 cycles: 95 °C for 30 s;55 °C for 30 s; 72 °C for 30 s. 10 �l of 6� loading dye (30% glycerol,0.025% (w/v) bromphenol blue, 0.025% (w/v) cyanol blue) was added toeach reaction, and 7 �l was electrophoresed at 200 V through 6% poly-acrylamide gels. pBR322 DNA digested with MsbI was used as a sizemarker. Gels were dried and exposed to PhosphorImager screens(Amersham Biosciences) for 1 h and then scanned on the STORMTM 840PhosphorImager (Amersham Biosciences). Bands corresponding to thetype IIA (�390 bp) and IIB (�180 bp) mRNA isoforms were quantifiedusing ImageQuantTM software. From these values, ratios of IIA:IIBmRNA spliced products were calculated for each cell type.

Detection of Aggrecan and Type I Collagen mRNA—Primers weredesigned (TABLE TWO) to amplify aggrecan or type I collagen fromtotal RNA extracted from each of the five cell lines (HEK-293, C3H10T1/2, MC615, T/C28I2, and RCS). RT-PCR was carried out in thelinear range as determined for each primer pair. Briefly, 2 �g of RNAwas reverse-transcribed using random primers in a total reaction vol-ume of 20 �l. An equal volume of water was added to the RT reaction,and 3 �l was used for PCR in the presence of [�-32P]dCTP (10 mCi/ml,3000 Ci/mmol; Amersham Biosciences) in a total volume of 50 �l. PCRproducts (6 �l) were electrophoresed through 6% polyacrylamide gels.

TABLE ONE

Primer pairs for amplification of the human COL2A1 mini-geneThree sets of forward (F) and reverse (R) primer pairs were used to amplify fragments 1, 2, and 3 of the COL2A1mini-gene (Fig. 1). Restriction enzyme sites at the5� and 3� ends of each amplified product are shown in bold and also underlined in the primer sequence. Numbers in parentheses denote the nucleotide positionsof the region amplified from genomic DNA based on the numbering of the published COL2A1 sequence (accession number L10347).

Fragment Primer pairs Size

kb1. Ex1(1)- In1(2550) F, CCCAAGCTTACATGATTCGCCTGCGGGCTC �2.55�-HindIII-BamHI-3� R, GCCGTAACCGGATCCCCTAG2. In1(2531)-In2 (5132) F, CTAGGGGATCCGGTTACGGC �2.65�-BamHI-EcoRV-3� R, GATAGGATATCTTGTATTGAATGCTGGGGAAG3. In 2(5114)-Ex3(5908) F, AATACAAGATATCCTATCTCCCCTGCAGAG �0.85�-EcoRV-XhoI-3� R, CCGCTCGAGCTTTGGTCCTGGTTGCCCTGCAAGGA

Regulation of COL2A1 Exon 2 Alternative Splicing

SEPTEMBER 23, 2005 • VOLUME 280 • NUMBER 38 JOURNAL OF BIOLOGICAL CHEMISTRY 32701


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Gels were dried and exposed to a PhosphorImager screen (AmershamBiosciences) and scanned on a STORMTM840 PhosphorImager (Amer-shamBiosciences). Bands corresponding to aggrecan, type I collagen, or�-actin were quantified using ImageQuantTM software. Levels of aggre-can and type I collagen mRNA in each cell type were expressed relativeto �-actin.

Conservation Analysis of COL2A1 Genomic Sequence—The May2004 genomic assembly of the human COL2A1 gene (chr12: 46, 679,680, 700–746,778) was accessed on the UCSC Genome Browser(genome.ucsc.edu). The species conservation tracks showing the pair-wise alignments were obtained through the conservation link. Twelvepairwise-aligned sequence blocks derived from Blastz alignments (43)were scored by phastCons (44). The resulting annotation alignmentusingMultiz (45) was done using the following assemblies: human (May2004), chimp (Nov 2003), mouse (May 2004), rat (June 2003), dog (July2004), zebrafish (Nov 2003), and fugu (Aug 2002). Genomic sequencespanning the 5� and 3� splice site junctions of exon 2 was taken fromblocks 3–9 and reverse-complemented to generate the final alignment(Fig. 4).

Prediction of RNA Secondary Structure in Intron 2 of COL2A1—Astretch of nucleotides in intron 2 of COL2A1, directly adjacent to the 5�splice site of exon 2, was predicted to contain RNA secondary structurein the form of a stem-loop (29). The Zuker Mfold program (46, 47) wasused to locate the potential site of interest in intron 2. The mRNAsequence corresponding to nucleotides 4191–4455 of COL2A1 (acces-sion number L10347) was entered into the Mfold program accessed viatheMacfarlane Burnet CentreMfold server (mfold.burnet.edu.au). ThismRNA fragment corresponds to the entire 207 bp of human exon 2 andthe first 58 nucleotides of intron 2. The predicted stem-loop site isbetween nucleotides �4 and �41 of intron 2.

RNAMapping—RNase digestions were carried out to map the site ofRNA secondary structure within intron 2 of COL2A1. A 265-bp frag-ment spanning exon 2 and the first 58 nucleotides of intron 2 wereamplified by PCR using the wild-type COL2A1 mini-gene construct asthe substrate. This fragment was subcloned into pcDNA3 using BamHIand EcoRI sites. RNA, corresponding to the antisense strand of the265-bp exon 2-intron 2 fragment was synthesized by in vitro transcrip-tion (MAXIscript SP6 TM; Ambion) in the presence of [�-32P]UTP (10mCi/ml, 3000 Ci/mmol; Amersham Biosciences). The resulting, radio-labeled RNA probe was purified by phenol/chloroform extraction andethanol precipitation in the presence of 3 M sodium acetate (pH 5.2).Before enzymic probing, RNA was heated for 1 min at 65 °C and rena-tured by slowly cooling to 37 °C. 1 �l of either RNase T1 at 0.4 or 4

units/�l (Invitrogen), S1 nuclease at 2 or 20 units/�l (Invitrogen), orRNase V1 at 0.002 or 0.02 units/�l (Ambion) was added to 1 �g ofradiolabeledRNA fragment in a total volumeof 20�l and digested for 15min at 30 °C. A control aliquot of RNA without the addition of RNaseswas processed simultaneously with the digested samples. After diges-tion, RNA was purified by phenol/chloroform extraction, and 1 pmolwas reverse-transcribed for 1 h at 37 °C using SuperscriptTM II RNaseH� reverse transcriptase (Invitrogen) with a sense primer that hybrid-ized to a region in exon 2 (5�-GTGAAGACGTGAAAGACTGCCTCA-3�) (Fig. 6). Samples were then treated with RNase H (0.5 units) for 20min at 37 °C. After a final phenol/chloroform extraction, RNA wasresuspended in gel loading buffer (95% formamide, 18 mM EDTA,0.025% SDS, 0.025% (w/v) xylene cyanol, 0.025% (w/v) bromphenolblue), and 3 �l was electrophoresed through 6% urea, polyacrylamidedenaturing gel. The gels were dried and exposed to a PhosphorImagerscreen (Amersham Biosciences) overnight and scanned on aSTORMTM 840 PhosphorImager (Amersham Biosciences). To localizethe sites of RNA digestion, the dideoxy chain termination reaction wascarried out on the original pcDNA3 construct containing the 265-bpcDNA sequence encoding exon 2 and the first 58 nucleotides of intron2 using a commercially available kit (U. S. Biochemical Corp.). Reactionswere carried out in the presence of 0.5 �l [�-32P]dATP (10 mCi/ml,3000 Ci/mmol; Amersham Biosciences), and samples were electro-phoresed in parallel with reverse-transcribed RNA digests.

Synthesis of Mutant COL2A1 Mini-genes—A series of mutant mini-genes was synthesized devoid of large regions (300–500 bp) of intronicsequence. PCRwas carried out to amplify two separate fragments of themini-gene using specific primers containing ClaI restriction sites. Theresulting fragments were gel-purified and ligated and a third PCR wasdone to amplify the ligated fragment devoid of the intronic sequence ofinterest. We named the mutant mini-gene with a 370-nucleotide dele-tion in intron 2 (adjacent to the 5� splice site of exon 2) deletion mutant1 (Del 1). Primers used to synthesize Del 1 were PCR 1 (forward primer�2542 BamHI, 5�-CTAGGGGATCCGGTTACGGC-3�, and reverseprimer, �4406 ClaI, 5�-CCATCGATAATTACAACCAC-3�), PCR 2(�4778 ClaI, 5�-CCATCGATCGATACCTTGTCTTA-3�, and reverseprimer, �5140 EcoRV, 5�-GATAGGATATCTTGTATTGAATGCT-GGGGAAG-3�), and PCR 3 (forward primer�2542 BamHI and reverseprimer �5140 EcoRV). The deletion mutant cDNA fragment was con-firmed by DNA sequencing and ligated into the COL2A1 mini-geneconstruct using BamHI and EcoRV restriction sites to replace the wild-type 2.6-kb fragment.

TABLE TWO

Primers pairs for amplification of aggrecan and type I collagen mRNAEach forward (F) and reverse (R) primer pair was used to amplify aggrecan or type I collagen from human (HEK-293, T/C28I2), mouse (C3H10T1/2,MC615), orrat (RCS) cells by RT-PCR. PCR cycle numbers were in the linear range as determined for each primer pair. cDNAwas analyzed by PhosphorImager analysis andexpressed relative to �-actin. The sequence of each primer is shown in the 5�-3� direction.

mRNA Primer pairs

Human aggrecan F, AGTGTCCATTCCCTCAGCCAGCCAR, GTCGATGAAATAGCAGGGGAT

Mouse aggrecan F, AGGAATCCCTAGCTGCTTCGCAGGGATR, ACACCTTGTCTTGGTAGATGCTGTTGA

Rat aggrecan F, ATCGCTGCAGTGATCTCAGAAR, CTCAATGCCATGCATCACTTCA

Human type I collagen F, AAGAGTCTACATGTCTAGGGTCTAR, TCCAGGCTGTCCAGGGATGCCAT

Mouse type I collagen F, AGCACCACGGCAGCAGGAGGTTTR, CATTGGTCCAGGGCCAAGTCCAACA

Rat type I collagen F, CAGATGTCCTATGGCTATGATGAR, ACCTCTCTCACCAGGCAGACCT




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Other mutant mini-gene constructs were synthesized by either sub-stituting or deleting nucleotides near or within the apparent stem-loopsequence in intron 2. TABLE THREE lists all of the COL2A1 mutantmini-genes analyzed in the present study. Mutations were introducedusing the QuikChangeTM site-directed mutagenesis kit (Stratagene).Briefly, a complementary primer pair (purified by SDS-PAGE; Invitro-gen) containing the desired nucleotide substitution or devoid of thenucleotide sequence of interest was added to �20 ng of substrate DNA.Substrate DNA was prepared by sub-cloning the wild-type 2.6-kb frag-ment of the COL2A1 mini-gene into pSP73 vector (Promega) usingBamHI and EcoRV restriction sites. This 2.6-kb fragment contains thespecific region of intron 2 that was to be mutated. By doing this, theconstruct size was reduced from �11.3 kb (size of COL2A1 mini-genein pcDNA3) to � 5 kb (the COL2A1 mini-gene 2.6-kb fragment inpSP73) to increase the efficiency of the in vitro mutagenesis procedure.PCRmutagenesis was carried out over 18 cycles (95 °C for 30 s; 55 °C for1min; 68 °C for 5.30min), and the resulting PCRproductswere digestedwith DpnI (1�l) for 1 h at 37 °C to digest parental, methylated DNA. Analiquot (1 �l) of digested DNA was transformed into XL-1 Blue Super-competent Cells (Stratagene), and resulting colonies were screened forthe presence of the correct mutation. Mutant colonies were selected,and the 2.6-kb fragment was re-ligated back into the COL2A1-pcDNA3construct to create the mutant COL2A1 mini-gene. Transfections ofthese mutant mini-genes were done as described previously.

RESULTS

Alternative Splicing of the Human COL2A1 Mini-gene inDifferent Cell Types

Fig. 1 shows the human COL2A1 mini-gene containing exon 1, theregulated cassette exon (exon 2), exon 3, and full-length interveningintron 1 and intron 2. This genomic DNA fragment (�5.9 kb) wascloned into pcDNA3 vector between T7 and sp6 RNA polymerase tran-scription initiation sites. Cloning of the mini-gene into pcDNA3 wasdone using the restriction enzyme sites shown. This human mini-genecontains the necessary bona fide sequences to ensure splicing (i.e.removal of introns 1 and 2) in vivo by any cell type. Transfection of thismini-gene construct and subsequent pre-mRNA splicing by cells used inthe present study resulted in production of IIA and/or IIBmRNA isoformsthat were distinguished by size difference based on the inclusion (IIA) orexclusion (IIB) of exon 2. RT-PCRusing the specific primer pair (P1 andP2in Fig. 1)-amplified cDNA fragments of �390 and 180 bp that corre-sponded to the IIA and IIB mRNA spliced isoforms, respectively.Five different cell lines were selected to analyze splicing of the

COL2A1 mini-gene. Human embryonic kidney (HEK-293) cells werechosen as a source of non-chondrocytes. C3H 10T1/2 cells wereincluded as a source of chondroprogenitors as these cells can be inducedto undergo differentiation in the correct culture environment (48, 49).MC615 and T/C28I2 cells are transformed chondrocytes isolated frommouse vertebrae and human costal cartilage, respectively; these cellswere expected to be in a de-differentiated state in the culture conditionsused in the present study. Finally, rat chondrosarcoma (RCS) cells werechosen as a source of differentiated chondrocytes (42). To confirm thedifferentiation status of these cells, RT-PCR was carried out on RNAisolated from each of the cell lines to analyze the levels of aggrecan andtype I collagenmRNA. Aggrecan is a chondrocytemarker, whereas typeI collagen is a marker of de-differentiated cells in culture. Fig. 2 showsthe levels of aggrecan and type I collagen mRNA relative to �-actin

FIGURE 1. Construction and alternative splicing of the human wild-type COL2A1mini-gene. The top panel shows the COL2A1 mini-gene containing exons (E) 1–3 withfull-length intervening introns (In). Three separate fragments of the mini-gene wereamplified from human genomic DNA and ligated into pcDNA3 vector using the restric-tion enzyme sites shown. The middle panel shows the two alternative pre-mRNA splicingmechanisms to remove either introns 1 and 2 (resulting in IIA mRNA) or introns 1 and 2and exon 2 (resulting in IIB mRNA). Numbers represent the nucleotide size of each exonand intron in the mini-gene. The bottom panel shows the IIA and IIB mature mRNA tran-scripts and the approximate nucleotide sizes of each after PCR amplification using thespecific primers, P1 and P2. P1 � pcDNA3-COL2A1-Exon1 primer (see “Materials andMethods”), and P2 � SP6 primer.

TABLE THREE

COL2A1 mutant mini-genesA range of nucleotide deletions and substitutions were introduced into the wild-type COL2A1mini-gene to produce the series of mutant mini-genes analyzed inthe present study. For each mutant mini-gene, the mutation type and nucleotide change are shown where applicable. Numbers in parentheses refer to the intron2 nucleotide numbers deleted from or substituted in the mini-gene.

Mutant mini-gene Type and site of mutation

Del 1 Deletion in intron 2 (�11 to �380)�5�SS Nucleotide substitutions, TGTA3AAGT (�3 to �6)SL-Del-1 Deletion of stem loop (�7 to �43)�5�SS/SL-Del-1 Combination of nucleotide substitution and stem loop deletionSL-Del 2 Partial deletion of stem loop (�7 to �18)SL-Del 3 Partial deletion of stem loop (�29 to �41)CCC-1 Nucleotide substitutions, TTT3CCC (� 8 to �10)CCC-2 Nucleotide substitutions, TTT3CCC (�8 to �10) and TTT3CCC (�12 to �14)CCC-3 Nucleotide substitutions: TTT3CCC (�8 to �10), TTT3CCC (�12 to �14), and TTT3CCC (�16 to �18)GGG-1 Nucleotide substitutions, AAA3GGG (�35 to �37)GGG-2 Nucleotide substitutions, AAA3GGG (�35 to �37) and AAA3GGG (�31 to �33)CCC-1/GGG-1 Nucleotide substitutions, TTT3CCC (�8 to �10) and AAA3GGG (�35 to �37)




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

mRNA for each cell line, and the ratio of aggrecan/type I collagenexpression is also shown. As expected, RCS cells expressed the highestratio of aggrecan/type I collagen, although undifferentiated C3H10T1/2 andMC615 cells expressed the lowest ratios. The aggrecan/typeI collagen ratio value shown for T/C28I2 cells suggests that these cellsare in an intermediate stage of differentiation. Therefore, based on thisknowledge, we would expect to see different patterns of COL2A1mini-gene splicing where levels of the type IIA mRNA isoform derived fromthe mini-gene would exceed those of the type IIB mRNA isoform inchondroprogenitor cells and vice versa in chondrocytes. Fig. 3 showsthat the mini-gene spliced products amplified by RT-PCR are con-sistent with the differentiation status of these cells. The C3H 10T1/2and MC615 cells contained the highest ratio of IIA/IIB mRNA iso-forms; T/C28I2 cells contained a lower IIA/IIB ratio in comparison,whereas the RCS cells spliced the mini-gene to produce more of theIIB mRNA isoform. To confirm the efficacy of using this COL2A1mini-gene as a model system to study regulation of exon 2 alternativesplicing, the ratio of endogenous type IIA and type IIB collagen iso-forms in C3H 10T1/2, MC615, T/C28, and RCS cells was found to besimilar to that derived from the COL2A1 mini-gene (results notshown). The non-chondrocyte HEK-293 cells spliced the mini-geneto produce �2-fold more of the type IIA mRNA isoform than thetype IIB mRNA isoform; levels of endogenous type II collagen wereundetectable in these cells.

Conservation of COL2A1 Sequence

Fig. 4 shows a sequence alignment comparison of a region ofCOL2A1genomic sequence between human, chimp, mouse, rat, dog, zebrafish,and fugu (puffer fish). The alignment shows intronic sequence spanningthe 3� and 5� splice sites of exon 2 as well as the first and last 20 nucle-otides of exon 2. In all species, the 3� splice site is shown to conform tothe classical consensus sequence, (�4N(T/C)AG2(G/A)N�2), wherethe arrow denotes the exon-intron junction, and highly conservednucleotides are shown in underlined bold font. Upstreamof the 3� splicesite is a long polypyrimidine tract sequence which may be an importantfeature in the regulation of exon 2 splicing. The 5� splice site sequence ofthe COL2A1 gene (e.g. �2TG2GTTGTA�6 in the human sequence)does not conform to the classical consensus sequence (�2AG2GU(G/A)AGU�6) and is, thus, referred to as a “weak” 5� splice site. This is thefirst report showing that a weak 5� splice site is present adjacent to thealternatively spliced exon in the type II procollagen gene from a numberof different species. It was previously reported that a region directlydownstream of the 5� splice site may contain RNA secondary structure

in the form of a stem-loop (29). The nucleotides predicted to form thedouble-stranded RNA of the stem-loop are 100% conserved between allspecies analyzed (Fig. 4). Therefore, there is a high likelihood that thisregion of intron 2 contains regulatory cis elements involved inpre-mRNA splicing regulation due to 1) the location, adjacent to analternatively spliced exon, 2) the conservation between species, and 3)the potential of secondary structure formation.

Altered Splicing of a COL2A1 Mini-gene Devoid of Intron 2 Sequence

To test for the presence of functional intronic splicing cis elements, aseries of mutant COL2A1 mini-genes was synthesized devoid of largeregions of introns 1 or 2. One of these deletion mutants, named Del 1,showed a marked difference in alternative splicing patterns comparedwith splicing of the wild-type mini-gene. Fig. 5 shows that the region ofintron 2 deleted from the Del 1 mini-gene is a 370-bp fragment fromintron 2 nucleotide numbers �11 to �380 directly adjacent to the 5�

FIGURE 3. Alternative splicing of COL2A1 mini-gene in different cell types. A, phos-phorimage analysis of IIA and IIB alternatively spliced mRNA isoforms in HEK-293 (293),C3H 10T1/2 (C3H), MC615, T/C28, and RCS cells. pBR322 DNA digested with MsbI wasused as a DNA base pair marker. DNA sequencing confirmed that these quantified bandsrepresent the IIA and IIB isoforms. Total RNA was extracted from cells transfected withthe wild-type COL2A1 mini-gene and then subjected to RT-PCR using primers specific foramplifying mRNA derived from the exogenous mini-gene only (Fig. 1). NC, non-chondro-cytes; PC, precursor chondrocytes; DC, de-differentiated chondrocytes; C, mature chon-drocytes. B, bar graph showing the ratio of IIA:IIB mRNA transcripts in each cell type.Values are an average of at least three separate transfection experiments.

FIGURE 2. Levels of aggrecan and type I colla-gen mRNA in different cell types. The top panelbar graphs show levels of aggrecan and type I col-lagen mRNA (expressed relative to �-actin) in eachof the five cell lines used in the present study: HEK-293, C3H 10T1/2, MC615, T/C28I2, and RCS. Ampli-fication of each mRNA was done in the linear rangeas determined for each cell type. The bottom paneltable shows the ratio of aggrecan/type I collagenfor each cell type.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

splice site of exon 2. In the Del 1 mutant, the intronic 5� splice sitenucleotides were not deleted, so that splicing to either include orexclude exon 2 could still potentially occur. The phosphorimage in Fig.5 shows that all cell types processed the Del 1 mutant in a similar way,producing only the type IIB isoform. This suggests that the weak 5�splice site alone is not sufficient to promote exon 2 splicing (inclusion).In addition, the deleted region of intron 2 may also contain essentialregulatory elements that modulate the distinct splicing patterns of exon2 in cells at various stages of chondrocyte differentiation.

Analysis of RNA Secondary Structure in Intron 2 Adjacent to the5� Splice Site

Using theZukerMfold program to predict secondary structure, it wasfound that the region in intron 2 directly adjacent to the 5� splice site ofexon 2 (intron 2 nucleotide number�4 to�41) is likely to contain RNAsecondary structure in the formof a stem-loop. Fig. 6 shows the locationof this stem-loop and the predictedMfold structure and�G (�7.7 kcal).To experimentally determine the presence of an RNA stem-loop struc-ture in intron 2, we performed RNase mapping analysis. RNase T1digests single-stranded sites, preferentially adjacent to guanine residues,and S1 nuclease digests single-stranded RNA with no particular speci-ficity, whereas RNase V1 digests sites of double-stranded RNA. The

region of the COL2A1mini-gene that was probed was a 145-nucleotidefragment containing the last 87 nucleotides of exon 2 and the first 58nucleotides of intron 2. The phosphorimage of the polyacrylamide

FIGURE 5. Alternative splicing of Del 1 COL2A1 mutant mini-gene. The top panelshows the 370-bp region of intron 2 (nucleotide numbers �11 to �380) that was deletedfrom the COL2A1 mini-gene to form the Del 1 mutant. The bottom panel shows thePhosphorimage of IIA- and IIB-spliced isoforms derived from wild-type (WT) and Del 1mutant mini-gene in each cell type. Mutant mini-gene transfections were done in tripli-cate in each cell line.

FIGURE 4. Conservation analysis of COL2A1genomic sequence. The top panel shows theregion of COL2A1 genomic sequence in the con-servation line-up. 98 nucleotides (ntds) of intron 1,the first 20 ntds and the last 20 ntds of exon 2, andthe first 58 ntds of intron 2 are shown for eachspecies. The May 2004 genomic assembly of thehuman COL2A1 gene (chr12: 46, 679, 680, 700 –746, 778) was accessed on the UCSC GenomeBrowser (genome.ucsc.edu). The species conser-vation tracks showing the pairwise alignmentswere obtained through the conservation link.Twelve pairwise-aligned sequence blocks derivedfrom Blastz alignments (43) were scored by phast-Cons (44). The resulting annotation alignmentusing Multiz (45) was done using the followingassemblies: human (May 2004), chimp (Nov 2003),mouse (May 2004), rat (June 2003), dog (July 2004),zebrafish (Nov 2003), and fugu (Aug 2002).Genomic sequences taken from blocks 3–9 werereverse-complemented to generate the finalalignment sequence. Uppercase letters, exonnucleotides; lowercase letters, intron nucleotides.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

sequencing gel in Fig. 6 shows results of the various RNase treatments.Localization of the digested sites was determined by referring to thesequencing reaction results shown on the left side of the phosphorim-age. Specifically, RNase T1 or S1 nuclease digestion sites indicated thata single-stranded loop is present. Digestion sites corresponding to theregions of double-stranded RNA were seen in the lanes correspondingto RNase V1 digestions only. This is indicative of the stem region andconfirms that RNA stem-loop secondary structure is present in intron 2of human COL2A1, directly adjacent to the 5� splice site.

Effect of a Weak 5� Splice Site on Alternative Splicing of COL2A1Exon 2

The COL2A1 genomic sequence alignment in Fig. 4 shows conserva-tion of a potentially weak 5� splice site in all species. To determine theeffect of the 5� splice site sequence on alternative splicing of exon 2, wesynthesized a mutant mini-gene (named �5� SS) with a four nucleotidesubstitution in intron 2 (�3TGTA�63�3AAGT�6) to create a strongsplice site that conforms to the classical consensus sequence. The �5�SS COL2A1 mini-gene was spliced similarly by all cell types to produceonly the type IIA mRNA isoform (Fig. 7, second lane of each gel panel).This suggests that the presence of a weak 5� splice site is important toconfer the differential cell type-specific splicing patterns of COL2A1shown in the present study.

Effect of Intron 2 (stem-loop) Deletions on Alternative Splicing ofCOL2A1 Exon 2

To determine whether the stem-loop sequence (Fig. 6), locateddirectly adjacent to the weak 5� splice site, contains regulatory elementsthat modulate exon 2 splicing, a series of deletion mutant COL2A1mini-genes were synthesized (TABLE THREE). Stem-loop deletion 1mutant mini-gene (SL-Del 1) was produced by deleting most of thestem-loop region (intron 2 nucleotides �7 to �43; Fig. 7) except thefirst three nucleotides (�4 to�6) that are part of the bona fide splice sitesequence. Because the double-stranded stem sequence of the stem-loopshowed 100% sequence similarity between species, we also produced

deletion mutant mini-genes devoid of the uridine-rich region of thestem (SL-Del 2) or the opposite, adenine-rich region of the stem (SL-Del3). Thesemutants are shown diagrammatically in the top panel of Fig. 7.In all of these deletion mutant mini-genes, the 5� splice site intronicsequence (�1 to �6) that binds to U1 snRNA (8) was intact. The Phos-phorImager gel pictures in Fig. 7 show that, compared with wild-typemini-gene splicing, deletion of the stem-loop sequence resulted in amarked inhibition of exon 2 splicing (inclusion), favoring type IIBmRNA production (SL-Del 1; third lane of each gel panel). This splicingpattern was displayed by all cells regardless of the cell type or differen-tiation status, again suggesting that the weak 5� splice site alone is notsufficient to induce exon 2 splicing and that a cis enhancer element-promoting spliceosome assembly at the 5� splice site of exon 2 wasremoved. A mutant mini-gene combining both the strong 5� splice sitesequence together with deletion of most of the stem-loop region(�5�SS/SL-Del-1; Fig. 7, fourth lane of each gel panel) showed exclu-sively exon 2 inclusion to produce only the IIA mRNA isoform. Thissplicing pattern was shown by all cell types and confirms that the strongsplice site sequence compensated for the deleted stem-loop region topromote exon 2 splicing. This suggests that 1) the stem-loop sequencedoes not contain bona fide nucleotides necessary for constitutive splic-ing (inclusion) of exon 2 and 2) the cell type-specific COL2A1 splicingpatterns shown in the present study are dependent on the presence ofboth a weak 5� splice site and the adjacent stem-loop sequence.Removal of the left side of the stem loop containing the uridine

stretch sequence (AUUUAUUUAUUU; SL-Del 2), resulted in an appar-ent decrease in the ratio of IIA:IIB mRNA transcripts compared withsplicing of the wild-typemini-gene in all cell types except RCS cells (Fig.7, fifth lane of each gel panel). This suggests that an enhancer site islocated within this uridine stretch that is not functional in RCS cells.However, by deleting the adenine-rich region of the stem(AUAAAUAAAU; SL-Del 3) the opposite effect was found whereby allcell types, including the differentiated chondrocyte RCS cells, splicedthe mutant mini-gene to produce predominantly type IIA mRNA (Fig.7, sixth lane of each gel panel). This suggests removal of a splicing

FIGURE 6. Analysis of RNA secondary structurein human COL2A1 intron 2 adjacent to the 5�splice site of exon 2. The top panel shows theposition of the predicted stem loop structure inthe human COL2A1 pre-mRNA spanning nucleo-tides 4401– 4438 (numbering is based on a pub-lished sequence, accession number L10347). P1indicates the position of the primer used for in vitrotranscription to produce a radiolabeled RNA frag-ment encoding the last 87 nucleotides of exon 2and the first 58 nucleotides of intron 2. Bottompanel, left, shows the stem-loop structure as pre-dicted by Mfold with a �G of �7.7 kcal. Bottompanel, right, is a Phosphorimage scan of a sequenc-ing polyacrylamide gel showing sites of enzymaticcleavage of the in vitro transcribed RNA probe.Bands corresponding to the single-stranded loopregion were seen after digestion with RNase T1(0.4 or 4 units/�l) and S1 nuclease (2 or 20 units/�l). Bands at the predicted double-stranded stemregion were only seen after RNase V1 digestion(0.002 or 0.02 units/�l). A sequencing reaction wasdone in parallel with the same primer (P1) to deter-mine the RNase cleavage sites. The orientation ofnucleotides within the stem loop region (�4, �16,�29, and �41) are also shown, each one repre-sented by an asterisk (*) in the sequencing gel.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

silencer element. Analysis of the intronic sequence after deletion of the10 nucleotides comprising the adenine-rich side of the stem-loopshowed that we had not created an alternative, stronger 5� splice site.This was confirmed by DNA sequencing of the amplified cDNA corre-sponding to the IIA mRNA isoform derived from SL-Del 3 mutantmini-gene (data not shown).

Effect of Stem-loop Nucleotide Substitutions on COL2A1 Exon 2Alternative Splicing

Mutation of the Uridine-rich Stretch—To specifically localize regula-tory cis elements within the RNA stem-loop, nucleotide substitutionswere introduced on either side of the conserved double-stranded stem.Because of reports of splicing factor proteins that bind to intronic uri-dine-rich regions in pre-mRNAs to regulate alternative splicing, we firstsynthesized three mutant mini-genes named CCC-1, CCC-2, andCCC-3 that contained cytosines in place of the first, second, and thirdtriplet set of uridine nucleotides within the double-stranded stem,respectively (TABLE THREE; Fig. 8). Analysis of the spliced mRNAproducts derived from theCCC-1mutantmini-gene suggested that this

mutation had either a minor effect or no effect in inhibiting exon 2splicing (i.e. exon 2 skipping) in HEK-293, MC615, T/C28I2, and C3H10T1/2 cells when compared with splicing of the wild-type mini-gene(Fig. 8). However, splicing of CCC-2 and CCC-3 mini-genes by thesecell types showed a trend toward type IIB mRNA production, concom-itantwith an increasing number of uridine substitutions. This result is inagreement with that from splicing of the uridine-stretch deletionmutant (SL-Del2; Fig. 7) in these cell types, confirming the presence of afunctional enhancer cis element, particularly within the second andthird uridine triplets.Interestingly, in RCS cells, splicing of the CCC-1 mutant mini-gene

produced a significantly higher ratio of IIA:IIB mRNAs compared withsplicing of the wild-type mini-gene. This splicing ratio was also higherthan that achieved by splicing of the CCC-1mini-gene in the other fourcell types. In addition, the IIA:IIB mRNA splicing ratio decreased bymutating the second (CCC-2) and third (CCC-3) set of uridines. How-ever, levels of IIA:IIB mRNA derived from these mini-genes did not fallbelow that derived from the wild-type mini-gene, suggesting that theuridine-rich region is not an enhancer site but, rather, a silencer element

FIGURE 7. Alternative splicing of mutantCOL2A1 mini-genes with nucleotide substitu-tions or deletions in the stem-loop of intron 2.The top panel shows the location of mutations inthe COL2A1 mutant mini-genes: �5�SS, SL-Del 1,SL-Del 2, and SL-Del 3. �5�SS mini-gene contains a4-nucleotide change (underlined in bold) at the 5�splice site of exon 2, resulting in a strong splice sitesequence. Arrows and intron 2 nucleotide num-bers show the omitted regions resulting in stem-loop deletion mutants mini-genes 1, 2, or 3 (SL-Del1, 2, or 3). For each cell line, type IIA and IIB mRNAsplicing patterns derived from each mutant mini-gene are shown in the Phosphorimages. Thefourth column of each gel image shows IIA:IIBsplicing patterns for the mutant mini-gene com-bining the �5� SS mutation with deletion of thewhole stem-loop (�5� SS/SL-Del1). Splicing pat-terns shown from each mutant mini-gene repre-sent one of at least four replicate experiments foreach cell line. WT, wild type.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

in differentiated chondrocytes. The observation that theCCC-3 splicingresult was similar to that of the uridine-stretch deletion mutant (SLDel-2; Fig. 7) in RCS cells also supports the latter statement. In the caseof CCC-1 mutant mini-gene splicing, it is possible that this mutationC(�8 to �10) may have created a new enhancer site that may only befunctional in RCS cells. An alternative or stronger 5� splice site was notcreated by this mutation, as confirmed by DNA sequencing of thereverse-transcribed IIAmRNAderived from the CCC-1mini-gene. It isdifficult to predict if this potentially novel enhancer site is also func-tional inMC615 and C3H 10T1/2 cells since wild-type mini-gene splic-ing patterns in these cells are similar to CCC-1 splicing patterns in RCScells. However, a lower IIA:IIB mRNA ratio by splicing of the CCC-1mini-gene compared with wild type in HEK-293 and T/C28 cells is inkeeping with disruption of a natural enhancer cis element.

Mutation of the Adenine-rich Stretch—To analyze potential regula-tory elements on the opposite side of the stem, two mutant mini-geneswere made, named GGG-1 and GGG-2, which contained guanines inplace of one or both sets of adenine triplet nucleotides, respectively(TABLE THREE; Fig. 9). Splicing of these mini-genes by all cell typesresulted in a higher IIA:IIB mRNA splicing ratio when compared withthe corresponding wild-type mini-gene splicing pattern. The level ofexon 2 inclusion was also slightly higher from themini-gene-containingmutations in both sets of adenine triplets (GGG-2) compared withmutation of one adenine triplet (GGG-1) in all cell types. These splicingpatterns are similar to those from the mutant mini-gene devoid of theadenine-rich region (SL-Del 3; Fig. 7), which suggests the presence of afunctional silencer element within this region of the stem-loop. The IIAmRNA derived from the GGG-1 and GGG-2 mutant mini-genes was

also reverse-transcribed and sequenced to confirm that an alternative 5�splice site was not created by these mutations.

Effect of Compensatory Mutations to Restore Secondary Structure—Another mutant mini-gene was synthesized (CCC-1/GGG-1; TABLETHREE and Fig. 9) that combined the CCC-1 and GGG-1 mutations torestore secondary structure to the stem-loop that would have been dis-rupted in the CCC-1 mutant mini-gene. The formation of a stem-loopby introducing the CCC andGGGmutations was verified by RNAmap-ping (results not shown), and Mfold analysis showed that the mutatedCCC-1/GGG-1 stem loop was more stable (�G � �13.6 kcal) than thewild-type stem-loop (�G � �7.7 kcal). Individually, the CCC-1 andGGG-1 mutations resulted in a splicing pattern that favored exon 2splicing (inclusion) in all cell types, and in most cases, splicing of thesemutantmini-genes differed from the splicing pattern of the correspond-ing wild-type mini-gene. However, the presence of both mutations inthe samemini-gene resulted in a significant change in COL2A1 isoformsynthesis that favored exon 2 exclusion. This suggests that in addition tothe presence of secondary structure, the specific nucleotides that formthe stem-loop are also important in regulating exon 2 splicing. As shownin this study, the adjacent positioning of the U (�8 to�10) and A (�35 to�37) triplets within the double-stranded stem apparently functions as asplicing enhancer site. This enhancer function was also supported by thefact that the splicing pattern of CCC-1/GGG-1 was similar to that of theSL-Del 1mini-gene (Fig. 7) in which the stem-loop, including theU (�8 to�10)/A(�35 to�37) triplet,was removed.This suggests that another levelof complexity existswithin the stem-loop to regulateCOL2A1exon2alter-native splicing, where functional cis elementsmay exist as individual linearsites as well as within the context of secondary structure.

FIGURE 8. Effect of alternative splicing of COL2A1 exon 2 by mutations in the uri-dine-rich site of the stem-loop. The top panel shows the location of cytosine nucleo-tides in CCC-1, CCC-2, and CCC-3 mutant mini-genes that replaced the first, second, andthird set of uridine triplets in the stem-loop, respectively. Phosphorimage gels showreverse-transcribed IIA and IIB mRNA transcripts from splicing of wild-type (WT) and CCCmutant mini-genes in each cell type used in the present study. Splicing patterns shownfrom each mutant mini-gene represent one of at least four replicate experiments foreach cell line.

FIGURE 9. Effect of adenine mutations and secondary structure compensatorymutations on the alternative splicing of COL2A1 exon 2. The top panel shows thelocation of guanine nucleotides in GGG-1 and GGG-2 mutant mini-genes that alteredeither one or both adenine triplets in the stem-loop, respectively. Another mutant mini-gene was also created (CCC-1/GGG-1) to study the effect of secondary structure on exon2 splicing. Phosphorimage gels show reverse-transcribed IIA and IIB mRNA transcriptsfrom splicing of wild-type (WT) and mutant mini-genes in each cell type used in thepresent study. Splicing patterns shown from each mutant mini-gene represent one of atleast four replicate experiments for each cell line.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

DISCUSSION

To identify key cis regulatory elements that modulate alternativesplicing of exon 2 during chondrogenesis, we used a human COL2A1mini-gene as amodel system (Fig. 1). A recent report described amurineCol2a1 mini-gene that was successfully spliced by ATDC-5 cells duringa 21-day chondrocyte differentiation assay system (40). However, it wasnot specified if the mini-gene was stably transfected to detect splicedproducts after 3 weeks in culture. Splicing of our humanCOL2A1mini-gene was analyzed at one time point in cells at various stages of differ-entiation; C3H 10T1/2 cells were used as a source of chondroprogeni-tors, MC615 and T/C28I2 cells were a source of de-differentiatedchondrocytes, and RCS cells were a source of differentiated chondro-cytes. Variations in IIA- and IIB-spliced mRNA isoforms derived fromthe mini-gene correctly reflected the differentiation status of the cells.This indicated that the COL2A1 mini-gene contained the necessary ciselements required for correct splicing of exon 2 within different cellularcontexts. The fact that the HEK-293 cells spliced the mini-gene to pro-duce more of the type IIA isoform suggests that similar cis- and/ortrans-acting factors are functional in non-chondrocyte cells as they arein chondroprogenitor and de-differentiated chondrocytes.In the present studywe show that splicing of amutantmini-gene (Del

1; Fig. 5) devoid of 370 bp of intron 2 adjacent to the 5� splice siteresulted in exon 2 exclusion in all cell types. The importance of intron 2sequences in regulating exon 2 splicing was also reported by Nishiyamaet al. (41), who found that processing of a murine Col2a1 deletionmini-gene devoid of�92% of intron 2 byATDC-5 cells resulted in IIA and IIBmRNA transcripts in addition to an abnormal increase in splicing inter-mediates. This mini-gene contained nucleotides downstream of the 5�splice site that were not present in the Del 1 mutant reported here.Therefore, the absence of exon 2 splicing (inclusion) in theDel 1mutantmini-gene indicated that key, non-consensus splicing enhancer cis ele-ments are present in intron 2 adjacent to the 5� splice site. A previousreport predicted that a stretch of nucleotides in this regionmay containsecondary structure in the form of a stem-loop (29). By a series of RNasedigestions, we showed that this region of intron 2 (nucleotide numbers�4 to �41) does indeed form a stem-loop. Because of location,sequence similarity between species, and secondary structure confor-mation, we hypothesized that the stem-loop is important in the regula-tion of exon 2 alternative splicing. Furthermore, nucleotides �4 to �6of the stem-loop, which are part of the intronic sequence that interactswith U1 snRNA (8), does not conform to the classical 5� splice siteconsensus sequence. We identified this weak 5� splice site as anotherregion of the type II procollagen gene that is conserved between species.Weak 5� and/or 3� splice sites are a common feature of many alterna-tively spliced exons. Similar to COL2A1, reports have been published ofother genes containing regulated exons with weak splice sites that aredifferentially spliced during development, including fibronectin (27),cardiac troponin T (50), myosin phosphatase-targeting subunit-1(MYPT-1) (51, 52), and protein 4.1R (5). We showed that the presenceof a weak 5� splice site is necessary for the cell type-specific splicingpatterns of COL2A1 since conversion to a strong splice site resultedexclusively in exon 2 splicing (type IIAmRNA) regardless of the cell typeand state of differentiation.The functional significance of the stem-loop sequence in regulating

exon 2 splicing was demonstrated by constructing a series of mutantmini-genes that contained either deletions or substitutions in thisregion. Deletion of the entire stem-loop, except nucleotides �4 to �6that make up the intronic splice site sequence, resulted in a markedinhibition of exon 2 splicing in all cells (SL-Del 1; Fig. 7). Therefore, theweak 5� splice site alone is not sufficient to yield exon 2 splicing and,thus, requires additional cis elements present in the stem-loop. The

stem-loop does not contain constitutive splicing elements since dele-tion of this region in combination with a strong splice site adjacent toexon 2 resulted exclusively in exon 2 splicing(�5�ss/SL-Del 1; Fig. 7).Thus, the cis regulatory elements in the stem-loop are functional only inthe context of a weak 5� splice site. The importance of non-consensusintronic splicing sequences downstream of the weak 5� splice site of aregulated exon has been reported in other genes. For example, pyrimi-dine-rich regions are required for inclusion of the alternatively splicedK-SAM exon in the FGFR-2 gene (53) or exon 6A in the �-tropomyosingene (54). Similar to COL2A1 exon 2 splicing, these regulatorysequences are not functional when the 5� splice site sequence isoptimized.Studies of yeast splicing commitment complexes have identified a

number of proteins that bind to non-consensus intronic regions down-stream of 5� splice sites; the functional significance of these interactionsin stabilizing the U1 small nuclear ribonucleoprotein-pre-mRNA com-plex to enhance splicing of an exon was also suggested by the authors(55, 56). Therefore, we hypothesized that enhancer cis elements arepresent in the stem-loop to promote splicing of exon 2 and that thesesites would bemore functional in cells that naturally expressmore of thetype IIA isoform. Mutations within the conserved double-strandedregion of the stem-loop revealed that the uridine (U)-rich site of thestem-loop is a functional enhancer element in all cell types tested exceptthe differentiated chondrocytes (Fig. 7, SL-Del2; Fig. 8). A U-richenhancer element was identified downstream of the central regulatedexon in the MYPT-1 gene which, like COL2A1 exon 2, contains a weak5� splice site and is spliced in a developmentally regulated manner (57).Further studies showed that the splicing factor protein TIA-1 interactswith thisMYPT-1U-rich enhancer (58). By binding to U-rich elements,TIA-1 stabilizes the U1 small nuclear ribonucleoprotein complex asso-ciation at the 5� splice site, thereby promoting splicing of the regulatedexon (18, 59). Furthermore, Shukla and co-workers (58) also reportedthat decreased in vivo expression levels of TIA-1 was concomitant withthe alternative splicing switch (exclusion) of the regulated MYPT-1exon. Therefore, TIA-1 is a potential candidate protein that may inter-act with the U-rich region of the stem-loop downstream of COL2A1exon 2. A sequence corresponding to part of the COL2A1 U-rich ele-ment (AUUUAUUU) is also present within a larger splicing enhancerelement identified downstream of the MYPT-1 alternative exon (57).This U-rich stretch is not in the context of secondary structure in theMYPT-1 gene, therefore suggesting the possibility that this element canfunction as a linear sequence in different cell types. Interestingly, thisU-rich element apparently contains some silencing activity in the dif-ferentiated chondrocytes used in the present study. This points to thelikelihood that different trans-acting splicing factors can bind to thesame regulatory cis element and that the expression or regulation ofspecific splicing factor proteins changes during chondrocyte differenti-ation. This statement is also supported by splicing of the CCC-1mutantmini-gene (Fig. 8) in differentiated chondrocytes compared with theother cell types. This mutation did not create an improved intron bind-ing site for U6 snRNA, which displaces U1 snRNA during the constitu-tive splicing process (8). Here, we predict that this mutation created anovel enhancer site that was recognized by a trans-acting factor presentor functional in the RCS cells only.Mutations in the opposite, adenine (A)-rich region of the double-

stranded stem suggested disruption of a functional silencer element inall cell types tested (Fig. 7, SL-Del 3; Fig. 9). The presence of both positiveand negative splicing cis elements situated in close proximity withineither a regulated exon or an intron has been identified in pre-mRNAencoding a number of proteins including fibronectin,MYPT-1, and tau,for example (57, 60–62). Some of these regulatory sites can function as




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

linear, independent elements, whereas others are functional only in thepresence of the adjacent, antagonistic cis element (22, 62). We cannotconclude from the present study that the U-rich and A-rich regionspresent in the stem-loop can function independently of each other in alinear context to regulate exon 2 splicing. For example, deletion ornucleotide substitution of the A-rich element that resulted in increasedexon 2 splicing in all cell types may be due to 1) loss of the silenceractivity functional in this region, independent of the U-rich site, 2) dis-ruption of stem-loop secondary structure, thereby allowing the U-richelement to function better as a linear enhancer site, or 3) a combinationof the above two scenarios.The importance of stem-loop secondary structure in regulating

COL2A1 exon 2 splicing is supported by the results obtained from themutant mini-gene CCC-1/GGG-1 (Fig. 9). This mini-gene was con-structed to restore secondary structure to the CCC-1 mutant mini-gene, thereby creating a more stable stem-loop structure (�G � �13.6kcal; wild-type stem-loop �G � �7.7 kcal). An altered splicing patternderived from the CCC-1/GGG-1 mini-gene was noted in all cell typeswhereby exon 2 splicing was inhibited. This suggests the involvement ofanother enhancer protein or protein complex that binds specifically todouble-stranded RNA in the stem-loop-containing adjacent U-A resi-dues. Numerous reports have described the effects of RNA secondarystructure on the regulation of splicing (63, 64). In general, with respectto alternative exon splicing, the presence of stem-loop structures nega-tively regulates splicing by masking the splice site sequence, therebypreventing spliceosome formation at the exon-intron junction. Forexample, secondary structure was shown to sequester the alternativeexon 6B in the chicken �-tropomyosin pre-mRNA, resulting in itsexclusion from the final mRNA (65–67). A stem-loop situated down-stream of the alternative exon in the human growth hormone geneinfluenced its splicing since mutations that stabilized the stem-loopresulted in use of an alternative splice site (68). To our knowledge, thereare only two reports postulating the presence of stem-loop secondarystructure overlapping a weak 5� splice site of an alternatively splicedexon (58, 69). In both cases it was suggested that the hypothesizedstem-loop functioned in masking the weak 5� splice site of the alterna-tive exon. Importantly, the present study is the first to experimentallyshow the existence of a stem-loop at the weak 5� splice site of an alter-native exon that is regulated in a tissue-specific manner during devel-opment. We are in agreement with the generally accepted function ofthe stem-loop in inhibiting splicing by masking the 5� splice site. Asdescribed above, the CCC-1/GGG-1mutation in the stem-loop createda more stable secondary structure that inhibited exon 2 splicing. Wehypothesize that this mutation altered an enhancer binding site withinthe double-stranded region of the stem-loop that potentially serves tounwind ormelt the RNA secondary structure, thereby unmasking the 5�splice site. Subsequently, other splicing factor proteins may then inter-act with the appropriate regulatory elements (e.g. the U-rich or A-richsite), resulting in either exon 2 splicing or skipping. Potential candidatesthat may function to unwind the stem-loop include the family of RNAhelicases (70), which have been implicated in altering RNA-RNA inter-actions and remodeling RNA-protein interaction. For example, twohelicases, hPrp28p and p68, have been shown to unwind the RNAduplex formed between U1 snRNA and intronic nucleotides of the 5�splice site (71, 72). Whether these or other proteins with similar func-tion play a role in destabilizing the COL2A1 stem-loop remains to bedetermined.The positive and negative cis elements identified in the present study

that potentially serve as binding sites for specific splicing factor pro-teins/protein complexes are shown diagrammatically in Fig. 10. Wehypothesize that cis elements present in the stem-loop are the major

regulatory sites occupied by trans-acting splicing factors duringCOL2A1 splicing. In addition, the less conserved single-stranded loopregion was not specifically analyzed for the presence of functional ciselements, and so we cannot rule out this possibility. It is now generallyaccepted that alternative splicing of a number of regulated exonsinvolves a complex interplay between positive andnegative-acting splic-ing factor proteins, some of which compete for the same cis elements(73–77). In addition, a further level of complexity exists from theincreasing evidence that transcription and pre-mRNA splicing is co-regulated (78). Interestingly, it was recently found that the SOX tran-scription factors important in chondrogenesis, SOX6 and SOX9, canregulate splicing (79) and may also influence what splicing factor pro-teins are recruited to the site of pre-mRNA splicing in the nucleus.We predict that chondroprogenitor cells express a different subset of

splicing factor proteins compared with differentiated chondrocytes.Subsequently, these splicing factor proteins may act cooperatively orantagonistically at enhancer or silencer sites within the stem-loop toultimately determine whether the type IIA or type IIB isoform isexpressed during cartilage development. We plan to explore this infuture studies.

Acknowledgment—We thank Dr Eric Wagner for critical reading of thismanuscript.

REFERENCES1. Black, D. L. (2003) Annu. Rev. Biochem. 72, 291–3362. Roesser, J. R., Liittschwager, K., and Leff, S. E. (1993) J. Biol. Chem. 268, 8366–83753. Cooper, T. A., and Ordahl, C. P. (1985) J. Biol. Chem. 260, 11140–111484. Fujita, H., Ohta, M., Kawasaki, T., and Itoh, N. (1991) Biochem. Biophys. Res. Com-

mun. 174, 946–9515. Hou, V. C., and Conboy, J. G. (2001) Curr. Opin. Hematol. 8, 74–796. Gooding, C., Roberts, G. C., Moreau, G., Nadal-Ginard, B., and Smith, C. W. (1994)

EMBO J. 13, 3861–38727. Gallego,M. E., Sirand-Pugnet, P., Durosay, P., Clouet d’Orval, B., d’Aubenton-Carafa,

Y., Brody, E., Expert-Bezancon, A., andMarie, J. (1996)Biochimie (Paris) 78, 457–4658. Burge, C. B., Tuschl, T., and Sharp, P. A. (1999) in The RNA World (Gesteland, R.,

Cech, T., and Atkins, J., eds) 2nd Ed., pp. 525–560, Cold Spring Harbor Laboratory

FIGURE 10. Model for COL2A1 exon 2 splicing regulation involving intron 2 regula-tory cis elements in the stem-loop. Enhancer (�) or silencer (�) splicing factor proteinsor protein complexes (named I, II, III, and IV) that may bind to the cis elements identifiedin the present study are shown. Protein(s) binding to the double-stranded stem region(Complex I) may serve to unwind the RNA to disrupt secondary structure and unmask the5� splice site. Subsequently, protein(s) binding to the uridine-rich region (Complex II) willresult in splicing enhancing activity in all cell types except differentiated chondrocytes. Adifferent protein interacting with the adenine-rich region (Complex III) may competewith the enhancer proteins to favor exon 2 exclusion. We predict that other potentialenhancer regions exist further downstream of the stem-loop (Complex IV) due to thelack of exon 2 splicing in the Del1 mutant (Fig. 5) compared with very low levels of exon2 splicing in the SL-Del 1 mutant mini-gene (Fig. 7). Regulatory cis elements in the single-stranded loop region was not determined in the present study. A fine balance of positiveand negative-acting proteins likely regulates the COL2A1 splicing pattern, and concen-trations of these factors will undoubtedly change in accordance with the differentiationstatus of the cells during chondrogenesis.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Press, Cold Spring Harbor, NY9. Staley, J. P., and Guthrie, C. (1998) Cell 92, 315–32610. Goldstrohm, A. C., Greenleaf, A. L., and Garcia-Blanco, M. A. (2001) Gene (Amst.)

277, 31–4711. Hertel, K. J., Lynch, K. W., and Maniatis, T. (1997) Curr. Opin. Cell Biol. 9, 350–35712. Schaal, T. D., and Maniatis, T. (1999)Mol. Cell. Biol. 19, 261–27313. Blencowe, B. J. (2000) Trends Biochem. Sci. 25, 106–11014. Fairbrother, W. G., Yeh, R. F., Sharp, P. A., and Burge, C. B. (2002) Science 297,

1007–101315. Smith, C. W., and Valcarcel, J. (2000) Trends Biochem. Sci. 25, 381–38816. Valcarcel, J., and Green, M. R. (1996) Trends Biochem. Sci. 21, 296–30117. Graveley, B. R. (2000) RNA 6, 1197–121118. Del Gatto-Konczak, F., Bourgeois, C. F., Le Guiner, C., Kister, L., Gesnel, M. C.,

Stevenin, J., and Breathnach, R. (2000)Mol. Cell. Biol. 20, 6287–629919. Carstens, R. P., Wagner, E. J., and Garcia-Blanco, M. A. (2000) Mol. Cell. Biol. 20,

7388–740020. Tange, T.O., Damgaard, C. K., Guth, S., Valcarcel, J., andKjems, J. (2001)EMBO J. 20,

5748–575821. Coleman, T. P., and Roesser, J. R. (1998) Biochemistry 37, 15941–1595022. Muro, A. F., Caputi, M., Pariyarath, R., Pagani, F., Buratti, E., and Baralle, F. E. (1999)

Mol. Cell. Biol. 19, 2657–267123. Del Gatto, F., Plet, A., Gesnel, M. C., Fort, C., and Breathnach, R. (1997) Mol. Cell.

Biol. 18, 2205–221724. McAlinden, A., Havlioglu, N., and Sandell, L. J. (2004) Birth Defects Res. C Embryo

Today 72, 51–6825. Ryan, M. C., and Sandell, L. J. (1990) J. Biol. Chem. 265, 10334–1033926. Chen, Y., Sumiyoshi, H., Oxford, J. T., Yoshioka, H., Ramirez, F., and Morris, N. P.

(2001)Matrix Biol. 20, 589–59927. Uporova, T. M., Norton, P. A., Tuan, R. S., and Bennett, V. D. (1999) J. Cell. Biochem.

76, 341–35128. Mackie, E. J., and Murphy, L. I. (1998)Microsc. Res. Tech. 43, 102–11029. Ala-Kokko, L., Kvist, A. P., Metsaranta, M., Kivirikko, K. I., de Crombrugghe, B.,

Prockop, D. J., and Vuorio, E. (1995) Biochem. J. 308, 923–92930. Sandell, L. J., Nalin, A. M., and Reife, R. A. (1994) Dev. Dyn. 199, 129–14031. Lui, V. C., Ng, L. J., Nicholls, J., Tam, P. P., and Cheah, K. S. (1995) Dev. Dyn. 203,

198–21132. Ng, L. J., Tam, P. P., and Cheah, K. S. (1993) Dev. Biol. 159, 403–41733. Oganesian, A., Zhu, Y., and Sandell, L. J. (1997) J. Histochem. Cytochem. 45,

1469–148034. Garcia Abreu, J., Coffinier, C., Larrain, J., Oelgeschlager, M., and De Robertis, E. M.

(2002) Gene (Amst.) 287, 39–4735. Larrain, J., Bachiller, D., Lu, B., Agius, E., Piccolo, S., and De Robertis, E. M. (2000)

Development 127, 821–83036. Zhu, Y., Oganesian, A., Keene, D. R., and Sandell, L. J. (1999) J. Cell Biol. 144,

1069–108037. Reardon, A., Sandell, L., Jones, C. J.,McLeod, D., and Bishop, P. N. (2000)Matrix Biol.

19, 169–17338. Ihanamaki, T., Salminen, H., Saamanen, A. M., Sandberg-Lall, M., Vuorio, E., and

Pelliniemi, L. J. (2002) Curr. Eye Res. 24, 439–45039. Aigner, T., Zhu, Y., Chansky, H. H.,Matsen, F. A., III,Maloney,W. J., and Sandell, L. J.

(1999) Arthritis Rheum. 42, 1443–145040. Hatano, H., Sarkar, G., and Bolander, M. E. (2002) J. Orthop. Res. 20, 516–51941. Nishiyama, T., Hatano, H., Kurosaka, M., Bolander, M., and Sarkar, G. (2003) J. Bone

Miner. Res. 18, 1716–172242. Fernandes, R. J., Schmid, T. M., Harkey, M. A., and Eyre, D. R. (1997) Eur. J. Biochem.

247, 620–62443. Schwartz, S., Kent, W. J., Smit, A., Zhang, Z., Baertsch, R., Hardison, R. C., Haussler,

D., and Miller, W. (2003) Genome Res. 13, 103–10744. Siepel, A., and Haussler, D. (2004) J. Comput. Biol. 11, 413–428

45. Blanchette,M., Kent,W. J., Riemer, C., Elnitski, L., Smit, A. F., Roskin, K.M., Baertsch,R., Rosenbloom, K., Clawson, H., Green, E. D., Haussler, D., and Miller, W. (2004)Genome Res. 14, 708–715

46. Zuker, M. (2003) Nucleic Acids Res. 31, 3406–341547. Mathews, D. H., Sabina, J., Zuker, M., and Turner, D. H. (1999) J. Mol. Biol. 288,

911–94048. Denker, A. E., Haas, A. R., Nicoll, S. B., and Tuan, R. S. (1999) Differentiation 64,

67–7649. Atkinson, B. L., Fantle, K. S., Benedict, J. J., Huffer,W. E., andGutierrez-Hartmann, A.

(1997) J. Cell. Biochem. 65, 325–33950. Cooper, T. A. (2001) Science’s STKE http://stke.sciencemag.org/cgi/content/full/

OC_sigtrans;2001/105/pe3551. Khatri, J. J., Joyce, K. M., Brozovich, F. V., and Fisher, S. A. (2001) J. Biol. Chem. 276,

37250–3725752. Dirksen, W. P., Vladic, F., and Fisher, S. A. (2000) Am. J. Physiol. Cell Physiol. 278,

589–60053. Del Gatto, F., and Breathnach, R. (1995)Mol. Cell. Biol. 15, 4825–483454. Balvay, L., Libri, D., Gallego, M., and Fiszman, M. Y. (1992) Nucleic Acids Res. 20,

3987–399255. Zhang, D., and Rosbash, M. (1999) Genes Dev. 13, 581–59256. Puig, O., Gottschalk, A., Fabrizio, P., and Seraphin, B. (1999)Genes Dev. 13, 569–58057. Dirksen, W. P., Mohamed, S. A., and Fisher, S. A. (2003) J. Biol. Chem. 278,

9722–973258. Shukla, S., Dirksen,W. P., Joyce, K. M., Le Guiner-Blanvillain, C., Breathnach, R., and

Fisher, S. A. (2004) J. Biol. Chem. 279, 13668–1367659. Forch, P., Puig, O, Martinez, C., Seraphin, B., and Valcarcel, J. (2002) EMBO J. 21,

6882–689260. Lavigueur, A., La Branche, H., Kornblihtt, A. R., and Chabot, B. (1993) Genes Dev. 7,

2405–241761. Caputi, M., Casari, G., Guenzi, S., Tagliabue, R., Sidoli, A., Melo, C. A., and Baralle,

F. E. (1994) Nucleic Acids Res. 22, 1018–102262. D’Souza, I., and Schellenberg, G. D. (2002) J. Biol. Chem. 277, 26587–2659963. Solnick, D. (1985) Cell 43, 667–67664. Balvay, L., Libri, D., and Fiszman, M. Y. (1993) BioEssays 15, 165–16965. Clouet d’Orval, B., d’Aubenton carafa, Y., Sirand-Pugnet, P., Gallego, M., Brody, E.,

and Marie, J. (1991) Science 252, 1823–182866. Libri, D., Goux-Pelletan, M., Brody, E., and Fiszman, M. Y. (1990)Mol. Cell. Biol. 10,

5036–504667. Fiszman, M. Y., Libri, D., and Balvay, L. (1992) Symp. Soc. Exp. Biol. 46, 355–36268. Estes, P. A., Cooke, N. E., and Liebhaber, S. A. (1992) J. Biol. Chem. 267, 14902–1490869. Grover, A., Houlden, H., Baker, M., Adamson, J., Lewis, J., Prihar, G., Pickering-

Brown, S., Duff, K., and Hutton, M. (1999) J. Biol. Chem. 274, 15134–1514370. Delagoutte, E., and von Hippel, P. H. (2003) Q. Rev. Biophys. 36, 1–6971. Ismaili, N., Sha, M., Gustafson, E. H., and Konarska, M. M. (2001) RNA 7, 182–19372. Liu, Z. R. (2002)Mol. Cell. Biol. 22, 5443–545073. Charlet, B. N., Logan, P., Singh, G., and Cooper, T. A. (2002)Mol. Cell 9, 649–65874. Gallego, M. E., Gattoni, R., Stevenin, J., Marie, J., and Expert-Bezancon, A. (1997)

EMBO J. 16, 1772–178475. Expert-Bezancon, A., Sureau, A., Durosay, P., Salesse, R., Groeneveld, H., Lecaer, J. P.,

and Marie, J. (2004) J. Biol. Chem. 279, 38249–3825976. Guil, S., Gattoni, R., Carrascal, M., Abian, J., Stevenin, J., and Bach-Elias, M. (2003)

Mol. Cell. Biol. 23, 2927–294177. Zahler, A. M., Damgaard, C. K., Kjems, J., and Caputi, M. (2004) J. Biol. Chem. 279,

10077–1008478. Kornblihtt, A. R., de la Mata, M., Fededa, J. P., Munoz, M. J., and Nogues, G. (2004)

RNA 10, 1489–149879. Ohe, K., Lalli, E., and Sassone-Corsi, P. (2002) Proc. Natl. Acad. Sci. U. S. A. 99,

1146–1151




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Audrey McAlinden, Necat Havlioglu, Li Liang, Sherri R. Davies and Linda J. SandellElement

Splice Site and an Adjacent Intronic Stem-loop Cis′Combination of a Weak 5Alternative Splicing of Type II Procollagen Exon 2 Is Regulated by the

doi: 10.1074/jbc.M505940200 originally published online August 2, 20052005, 280:32700-32711.J. Biol. Chem.

10.1074/jbc.M505940200Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here

http://www.jbc.org/content/280/38/32700.full.html#ref-list-1

This article cites 77 references, 35 of which can be accessed free at


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M505940200

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;280/38/32700&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/280/38/32700

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=280/38/32700&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/280/38/32700

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/content/280/38/32700.full.html#ref-list-1

http://www.jbc.org/

Documents

AlternativeSplicingofTypeIIProcollagenExon2Is ... · construct was sequenced to confirm correct orientation and the absence of mutations. Transient Transfections of the COL2A1 Mini-gene—The