Amelioration of Diabetes Mellitus by Protein S · 07/04/2016 · 1 Amelioration of Diabetes Mellitus by Protein S Taro Yasuma,1 Yutaka Yano,1 Corina N. D' Alessandro-Gabazza,3 Masaaki

1

Amelioration of Diabetes Mellitus by Protein S

Taro Yasuma,1

Yutaka Yano,1

Corina N. D' Alessandro-Gabazza,3

Masaaki Toda,3 Paloma

Gil-Bernabe,3 Tetsu Kobayashi,

4 Kota Nishihama,

1 Josephine A Hinneh,

3 Rumi

Mifuji-Moroka,2

Ziaurahman Roeen,3

John Morser,5

Isaac Cann,6 Iwasa Motoh,

32 Yoshiyuki

Takei,1,2,4

and Esteban C Gabazza.3

Affiliation

1Department of Diabetes, Metabolism and Endocrinology,

2Department of

Gastroenterology and Hepatology, 3Department of Immunology,

4Department of

Pulmonary and Critical Care Medicine, Mie University Graduate School of Medicine,

Edobashi 2-174, Tsu, Mie 514-8507, Japan. 5Division of Hematology, Stanford School of

Medicine, 269 Campus Drive, CCSR 1155, Stanford, CA 94305-5156. 6Carl R. Woese

Institute for Genomic Biology Institute for Genomic Biology, and Departments of Animal

Sciences, Microbiology, University of Illinois at Urbana-Champaign, Urbana, IL 61801

Running title

Protein S in diabetes mellitus

Corresponding author

Page 1 of 56 Diabetes

Diabetes Publish Ahead of Print, published online May 9, 2016

2

Esteban C Gabazza, MD, PhD, Department of Immunology, Mie University School of

Medicine, Edobashi 2-174, Tsu-city, Mie, Japan. Postal Code 514-8507; Phone: +81 59 231

5037; Fax: +81 59 231 5225.

Word count

4417

Number of figures

6

Number of table

1

Page 2 of 56Diabetes

3

Abstract

Protein S is an anticoagulant factor that also regulates inflammation and cell apoptosis. The

effect of protein S on diabetes mellitus and its complications is unknown. This study

compared the development of diabetes mellitus between wild type and transgenic mice

overexpressing human protein S, and the development of diabetic glomerulosclerosis

between mice treated with and without human protein S and between wild type and protein

S transgenic mice. Mice overexpressing protein S showed significant improvements in

blood glucose level, glucose tolerance, insulin sensitivity and insulin secretion compared to

wild type counterparts. Exogenous protein S improved insulin sensitivity in db/db mice, in

adipocytes, skeletal muscle and liver cell lines compared to controls. Significant inhibition

of apoptosis with increased expression of BIRC3, BcL-2 and enhanced activation of

Akt/PKB was induced by protein S in islet β cells compared to controls. Diabetic wild type

mice treated with protein S and diabetic protein S transgenic mice developed significantly

less severe diabetic glomerulosclerosis than control group. Type 2 diabetic patients had

significantly lower circulating free protein S than healthy controls. This study shows that

protein S attenuates diabetes mellitus by inhibiting apoptosis of β-cells and the

development of diabetic nephropathy.


4

Diabetes mellitus (DM) is a fast growing global public health problem that is associated

with increased morbidity and mortality (1). The prevalence of DM continues to increase, as

it is estimated that the DM population worldwide will increase from 285 million in 2010 to

more than 400 million by 2030 (2). DM is the fourth-leading cause of death; the risk of

death for people with DM is twice compared to non-diabetic subjects and life expectancy is

5-10 years shorter among middle-aged DM patients (2). Of the two major forms of DM,

type 1 DM may be caused by genetic, environmental or autoimmune factors leading to

selective apoptosis or destruction of insulin-producing pancreatic islet β cells (3; 4). Type 2

DM is associated with insulin resistance and abnormal insulin secretion with evidence

suggesting that reduced β-cell mass is linked to dysfunctional insulin secretion (3; 5).

Apoptosis of β-cells caused by glucotoxicity, lipotoxicity, advanced glycation end-products,

inflammatory cytokines and intracellular deposition of islet amyloid polypeptide are

believed to be the cause of the reduced number of islet β cells in type 2 DM (5). Therefore,

apoptosis of β-cells is a mechanistic pathway common to both type 1 and type 2 DM.

Protein S (PS) is a vitamin K-dependent glycoprotein that acts as an anticoagulant factor by

enhancing the inhibitory activity of activated protein C on blood coagulation (6). PS may

also directly stimulate the inhibition of the tissue factor pathway (7). In addition, PS


5

regulates the inflammatory response and apoptosis pathways through Tyro3, Axl and Mer

(TAM) tyrosine kinase receptors (8). PS inhibits the expression of inflammatory cytokines

from a variety of cells and is protective against lipopolysaccharide-induced acute lung

injury (9). PS also supports the neuroprotective action of APC (10). PS circulates in plasma

as both free and in complex with C4b-binding protein (C4BP), which is an inhibitor of the

classic complement pathway (11). Localization of C4BP to cell membrane by PS may

inhibit inflammation induced by complement activation (11). In addition, PS can suppress

inflammatory and immune responses by enhancing the clearance of apoptotic cells by

macrophages via binding to negatively charged phospholipids exposed on apoptotic cells

(12). Furthermore, PS can directly inhibit cell apoptosis by activating the Akt signaling

pathway (13).

Based on the anti-apoptotic activity of PS, we hypothesized that PS would protect against

DM by inhibiting apoptosis of pancreatic β cells and the development of diabetic

nephropathy.

Research Design and Methods

Subjects

Blood samples were obtained from 32 patients with type 1 (n=6) and type 2 (n=26) DM


6

with controlled glycaemia and 37 healthy volunteers for determination of PS and C4BP

levels (Table 1). None of the patients had diabetic nephropathy or neuropathy. All patients

and subjects provided informed consent, and the protocol was approved by the Ethics

Committee for Clinical Investigation of Mie University (approval No 2194).

Experimental animals

Homozygous human PS (hPS) transgenic (TG) mice on a C57BL/6 background have been

previously characterized (14). Briefly, the full-length hPS cDNA was cloned into a pCAG

plasmid containing the CAG-promoter (cytomegalovirus enhancer+chicken+β-actin

promoter) and rabbit β-globin polyadenylation sites. The plasmid was digested, purified

and microinjected into fertilized eggs from C57BL/6J mice and transgenic founders were

screened by Southern blotting. Most hPS TG organs express hPS and its mean plasma

concentration is 85 ± 3 µg/ml (14). Wild type (WT) littermates were used as controls.

Pancreatic islet mass is not different between WT and hPS mice. Male wild type mice (8-10

weeks old) weighing 19-22g and db/db male mice (6-week, weight 31-33g) were from

Nihon SLC (Hamamatsu, Japan). All animals were maintained in a specific pathogen-free

environment and subjected to a 12h light:dark cycle in the animal house of Mie University.

The research followed the ARRIVE Guidelines for animal investigation. The Committee on


7

Animal Investigation of Mie University approved the protocols (Approval No:24-50) and

animal procedures were performed in accordance with the institutional guidelines of Mie

University. Mice were randomized and researchers that measured parameters were blinded

to treatment groups.

Diabetes induction

To evaluate susceptibility to diabetes induction, 200 µL (40 mg/kg body weight)

streptozotocin (STZ; Sigma, St. Louis, MO) was intraperitoneally administered for 5

consecutive days to hPS TG (hPS TG/STZ) and WT littermates (WT/STZ); control mice

received 200 µL of saline solution (hPS/SAL, WT/SAL) intraperitoneally for 5 consecutive

days.

Diabetic status evaluation

Fasting blood glucose levels were measured after STZ (hPS TG/STZ, WT/STZ) or saline

(hPS/SAL, WT/SAL) injection once a week during 4-weeks. On the 3rd

week after STZ or

saline injection, intraperitoneal glucose tolerance (IPGT) test was performed after 16h of

fasting by intraperitoneal injection of glucose (1g/kg mouse body weight) and tail vein

blood was sampled on days 0, 7, 14, 21 and 28 for glycemia measurement. Insulin

sensitivity test was performed in non-fasting mice by intraperitoneal injection of insulin


8

(1U/kg mouse body weight) and insulin secretion test was carried out after 16h fasting by

intraperitoneal injection of 3g/kg mouse body weight of glucose. Tail vein blood was

sampled for measuring glucose or insulin level. All groups were sacrificed 4 weeks after

STZ or saline injection and pancreatic tissues were excised for histochemistry.

Diabetic nephropathy induction

hPS transgenic (hPS-TG) mice and WT littermates underwent unilateral nephrectomy and

after 4 weeks of recovery, WT (WT/STZ) and hPS TG (hPS TG/STZ) mice received 5

injections of STZ on consecutive days mice and then additional injections (average: 5

additional injections) of STZ were given to hPS TG mice to induce diabetes of equal

severity to that in WT mice (15). Control (hPS TG/SAL, WT/SAL) mice received

intraperitoneally similar amounts of saline. Mice were sacrificed 8 weeks after the last STZ

or saline injection. In separate experiments, WT mice underwent unilateral nephrectomy,

received intraperitoneally STZ or saline for 5 consecutive days after 4 weeks of recovery,

and then treated with either hPS or saline subcutaneously through osmotic mini-pumps for

4-weeks before sacrifice (15).

Tissue preparation and staining

After euthanasia by pentobarbital overdose, pancreas and kidneys were dissected,


9

dehydrated, embedded in paraffin, cut into 3-µm thick sections and the pancreas was

prepared for hematoxilin/eosin (H&E) stain and immunostaining, and the kidneys for

periodic acid-Schiff (PAS) and Masson's trichrome staining. An investigator blinded to the

treatment group calculated the areas of pancreatic islets stained with H&E and glomeruli

(>30 per mouse) stained positive for PAS or trichrome using an Olympus BX50 microscope

with a plan objective, combined with an Olympus DP70 digital camera (Tokyo, Japan) and

WinROOF image processing software (Mitani Corp., Fukui, Japan).

Immunohistochemistry

Immunostaining of insulin, glucagon and F4/80 was performed at Biopathology Institute

Corporation using specific antibodies from DAKO Corporation (Carpinteria, CA) and

Novus Biologicals (Littleton, CO) following standard methods. An investigator blinded to

the experimental group measured the area of immunoreactivity for insulin or glucagon in

all visible islets from four pancreatic sections (40-50 fields per mouse) as described above.

Biochemical analysis

Glucose in blood was measured by glucose-oxidase method and insulin using a kit from

ALPCO Diagnostics (Salem, NH). Thrombin-antithrombin complex (TAT; Cedarlane

Laboratories, Ontario, Canada), total plasminogen activator inhibitor-1 (PAI-1; E1/PAI-1,


10

R&D, Minneapolis, MN) were measured using EIA kits and total collagen and

hydroxyproline as described (15). Complement C4BP was assayed with an EIA kit from

Assaypro (St. Charles, MO), and total hPS as described (14). To assess free hPS, a 96-well

microplate was coated with C4BP (ATGen Corp., Sampyeong-dong, Korea), and after

appropriate washing and blocking, biotin-labelled polyclonal rabbit anti-hPS antibody

(DakoCytomation, Glostrup, Denmark) was added. Urinary liver-type fatty acid binding

protein (L-FABP), a marker of diabetic nephropathy severity (16), was measured using a

EIA kit (R&D), tissue factor by EIA using primary and biotinylated antibodies (Santa Cruz

Biotechnology, Santa Cruz, CA) and tissue plasminogen activator activity (t-PA;

Carbiochem, Nottingham, UK) using a chromogenic substrate (S-2288). Homeostasis

model assessment for insulin resistance (HOMA-IR) was determined as follows:

HOMA-IR = [fasting insulin (µU/mL) × fasting glucose (mmol/L)]/22.5 (17).

Cell culture

The mouse pancreatic β cell line MIN6, provided by Jun-ichi Miyazaki, Osaka University,

L6 rat skeletal myoblasts, provided by Hitoshi Ashida, Kobe University, and HepG2 cells

(RIKEN Cell Bank, Ibaraki, Japan), murine 3T3-L1 and rat RAW264 cells (ATCC) were

cultured in Dulbecco's modified Eagle's medium (DMEM; Sigma-Aldrich) containing


11

10%(v/v) heat-inactivated fetal calf serum (FCS). Differentiation to adipocytes was induced

by treating with 0.5 mmol/l 3-isobutyl-1-methylxanthine, 4 mg/ml dexamethasone, 1 mg/ml

insulin and 10% FCS.

Glucose uptake/release assay

Cells were incubated in DMEM (low glucose)+1% BSA for 6h and placed in DMEM with

high glucose (1g/L) before adding plasma-derived hPS (20 µg/ml; Enzyme Research

Laboratories, South Bend, IN; purity > 95%), and 30min after hPS treatment, insulin (200

nM) was added, and cultured for 4h. Glucose content of culture supernatant was measured

using Glucose Colorimetric Assay Kit (BioVision).

Primary mouse islet cell isolation

Pancreatic tissues were excised from euthanized WT and hPS-TG mice after 4 weeks of

intraperitoneal STZ or saline cut into 1–2 mm pieces, incubated for 30min at 37ºC in a

1mg/ml collagenase. After centrifugation and resuspension, the cells were placed on a

discontinuous Percoll gradient, centrifuged and the islet cell layer was collected, washed

and then dispersed with trypsin/EDTA solution before using in assays (18).

Apoptosis evaluation

Apoptosis in histological samples of pancreas islets was assayed by the terminal


12

deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) method, using a

commercially available kit (Chemicon International, Temecula, CA). The number of

TUNEL-positive cells within the islets was counted in 6 pancreatic sections (40-50 fields)

per mouse by an investigator in a blinded fashion as described above.

Apoptosis of primary islet β-cells and MIN6 β-cell lines was analyzed by flow cytometry

(BD Biosciences, Oxford, UK) after staining with FITC-annexin V (BD Pharmingen) and

propidium iodide. Apoptosis of MIN6 β-cell lines was also assessed by

immunofluorescence microscopy after similar staining. The mRNA expression of inhibitor

of baculoviral inhibitor of apoptosis repeat-containing (BIRC) 3/inhibitor of apoptosis

(IAP), B-cell lymphoma 2 (Bcl-2) family of regulator proteins and apoptotic protease

activating factor 1 (APAF1) were also measured.

Evaluation of insulin sensitivity and β-cell apoptosis in vivo

The effect of exogenous hPS on insulin sensitivity was evaluated in db/db mice. Fasting

db/db mice received subcutaneous hPS (2mg/kg; n=5) or saline (n=5) and insulin

sensitivity test and HOMA-IR measurement were performed at 0, 1, 2, 4 and 6h. To study

the in vivo effects of hPS on STZ-induced β-cell apoptosis, exogenous hPS (2mg/kg; n=6))

or saline (n=6) was subcutaneously administered for five days to WT mice 1h before STZ


13

injection and 9 days after the last STZ injection before euthanasia. Islets were isolated,

incubated with trypsin-EDTA solution at 37°C, gently dispersed, and apoptosis was

assessed by flow cytometry.

Macrophage phenotype evaluation

RAW264.7 cells were pretreated with or without hPS (20 µg/ml) for 30min and then treated

with or without high glucose for 24h. Expression of the M1 marker inducible nitric oxide

synthase and the M2 marker Arginase1 were analyzed by RT-PCR.

Evaluation of TAM receptor mediation

MIN6 cells were pretreated with anti-Tyro3, anti-Axl, anti-Mer or isotype IgG for 30min

before adding 20µg/ml hPS, and 2mM STZ, cultured for 24h and apoptosis was evaluated.

All antibodies were goat IgGs from R&D (Minneapolis, MN).

Effect of BIRC3 knockdown

Min6 cells were transfected with 33nmol of BIRC3 siRNA or scrambled siRNA, cultured

in presence or absence of hPS for 30min and then treated with or without 3mM STZ for

24h. Apoptotic cells were assessed by flow cytometry.

Akt/PKB and NFκκκκB activation

Activation of Akt/PKB and NFκB in MIN6 cells and was evaluated by Western blot


14

following standard methods using antibodies against p-Akt/PKB, Akt/PKB, p-IκB, cleaved

form of caspase-3 and β-actin from Cell Signaling (Danvers, MA), and antibody against

human/mouse cIAP-2/HIAP-1 from R& (Minneapolis, MN). Activation of Akt/PKB and

NFκB in primary islet β cells by hPS was assessed by flow cytometry in the presence or

absence of anti-hPS.

Gene expression analysis

Total RNA was extracted from pancreas tissues by Trizol Reagent (Invitrogen, Carlsbad,

CA) before reverse-transcription using oligo-dT primers and DNA amplification by PCR

using the Superscript Preamplification system kit (Invitrogen). The Applied Biosystem Step

One Real-Time PCR System, Taqman master mix and SYBR green were used for

quantitative amplification. Supplemental Table 1 describes primer sequences. The data

were analyzed using the 7500 software from Applied Bio systems and gene expression was

normalized by the GAPDH transcription level.

Statistical analysis

Data are expressed as the mean ± standard error (S.E.M.) unless otherwise specified. The

statistical difference between several variables was calculated by ANOVA with post hoc

analysis using the Turkey test and between two variables by the Mann-Whitney U test.


15

Statistical analyses were done using the StatView 4.1 package software for Macintosh

(Abacus Concepts, Berkeley, CA). Statistical significance was considered as p<0.05.

Results

DM patients have less circulating hPS

There was no difference in BMI or age between type 2 DM patients and healthy subjects

(Table 1). The plasma concentration of free hPS was significantly decreased in both type 1

and type 2 DM patients and that of C4BP was significantly increased in type 2 DM patients

compared to controls (Table 1). There was no significant difference by gender. A

significant inverse correlation between free PS and hemoglobinA1c (HbA1c) and a

significant proportional correlation between C4BP and HbA1c were observed in type 2 DM

patients (Supplemental Table 2). Age was significantly correlated with free PS and C4BP

in type 2 DM patients. No significant correlation was found between parameters in type 1

DM patients (Supplemental Table 3).

hPS TG are less prone to STZ-induced DM

DM was induced with STZ in hPS TG and WT mice and DM severity was compared. The

non-fasting blood glucose level was significantly decreased in the hPS/STZ group

compared to WT/STZ group on days 14, 21 and 28 after the first STZ injection (Figure 1A).


16

The blood glucose level in WT/STZ mice was significantly increased from day 7 after STZ

injection compared to WT/SAL, while the significant increase occurred from day 21 after

STZ injection in the hPS/STZ group compared to hPS/SAL mice. The IPGT test disclosed

significantly lower levels of glycaemia in the hPS/STZ group than in the WT/STZ group at

all different time points after glucose injection; the levels of glycemia were significantly

higher in both hPS/STZ and WT/STZ groups than in the saline groups (Figure 1B). The

blood glucose levels were also significantly increased in the WT/STZ group compared to

the hPS/STZ group during the insulin sensitivity test at all different time points after

glucose administration (Figure 1C), and the plasma insulin was significantly higher in the

hPS/STZ group than in the WT/STZ after 30 min of glucose i.p. injection (Figure 1D).

Exogenous hPS improves insulin sensitivity

Insulin sensitivity was significantly improved in db/db mice treated with exogenous hPS

15min after insulin injection and remained better over time compared to control mice.

HOMA-IR was improved in hPS-treated db/db compared to controls though it was not at

significant level (Supplemental Figure 1A,B) .

Treatment of rat L6 skeletal muscle cells, HepG2 human liver cells and 3T3-L1 mouse

adipocytes with hPS increases their insulin sensitivity (Figure 2A). This effect was specific


17

to hPS as it could be inhibited by anti-hPS antibody (Figure 2B).

hPS-TG mice have less inflammation and pancreatic islet ββββ cell apoptosis

Compared to the WT/SAL, hPS/SAL and hPS/STZ groups, the total area of pancreatic

islets (Supplemental Figure 2A,B) and the area stained positive for insulin were

significantly reduced, while the area with apoptotic cells was significantly increased in the

WT/STZ group at the time of sacrifice on day 28 after STZ injection (Figure 3A,B). As the

insulin stained area decreased, the area of glucagon staining was significantly increased in

the WT/STZ group when compared with the WT/SAL group but remained unchanged in

the hPS TG/STZ compared to saline-treated group (Figure 3A).

Infiltration of macrophages was significantly decreased in pancreatic islets from hPS/STZ

mice compared to WT/STZ and WT/SAL mice; there was no difference between hPS/SAL

and hPS/STZ groups (Supplemental Figure 3A,B). In vitro, hPS promotes differentiation

of M2 type macrophages (Supplemental Figure 3C).

Exogenous hPS inhibits apoptosis of islet ββββ cells in vivo

C57BL/6 WT mice were treated subcutaneously with exogenous hPS or saline during and

after STZ injection and islet β cell apoptosis was assessed. Mice treated with hPS had

significantly lower β cell apoptosis than saline-treated controls (Supplemental Figure


18

4A,B,C).

hPS inhibits apoptosis and activates Akt/PKB and NFκκκκB in islet ββββ cells

Apoptosis of MIN6 cells induced by STZ was significantly suppressed when the cells were

pre-treated with hPS compared to control cells, and cleavage of caspase 3 was significantly

inhibited by hPS (Figure 4A). There was increased phosphorylation of Akt/PKB and IκB in

MIN6 cells and primary treated with hPS compared to vehicle-treated cells (Figure 4B).

Akt/PKB and IκB were also significantly phosphorylated by hPS in primary β cells

(Supplemental Figure 5A,B). MIN6 cells express all three TAM PS receptors

(Supplemental Figure 6) but only Mer mediates the inhibitory activity of hPS on apoptosis

(Supplemental Figure 7A,B).

hPS regulates IAP and Bcl-2 proteins

We determined changes in the expression of all members of the mouse BIRC (IAP) family

in MIN6 cells treated with either STZ or hPS or both reagents. The expression of BIRC1b

and BIRC3 mRNA were significantly increased in cells pretreated with hPS (hPS/SAL)

compared to cells pretreated with saline (SAL/SAL) before additional saline. BIRC3

expression was significantly increased and BIRC1b tended to be high (p=0.05) in cells

pretreated with hPS (hPS/STZ) compared to cells pretreated with saline (SAL/STZ) before


19

addition of STZ (Supplemental Figure 8). The significant increased expression of BIRC3

mRNA in hPS-treated MIN6 cells (hPS/SAL, hPS/STZ) compared to controls was

confirmed by Western blot (Figure 4C). Knockdown of BIRC3 with specific siRNA

abolished the hPS-mediated inhibition of MIN6 cell apoptosis (Supplemental Figure

9A,B,C). BIRC3 mRNA expression was also significantly increased in primary islet β cells

from hPS-TG/STZ mice compared to cells isolated from WT/STZ mice (Figure 4D). hPS

increases the expression of anti-apoptotic Bcl-2 but blocks the expression of pro-apoptotic

Bax in MIN6 cells (Supplemental Figure 10).

hPS ameliorates diabetic glomerulosclerosis

We assessed if hPS can improve diabetic nephropathy independently of its protective

activity on β cell apoptosis. WT C57BL/6 mice were unilaterally nephrectomized and after

complete recovery from surgery were made diabetic with STZ or kept as controls with

saline. After 4 weeks, mice from the STZ/p-hPS and STZ/p-SAL groups, both with equal

DM severity, and mice from the SAL/p-hPS and SAL/p-SAL groups, with no DM, were

treated with hPS or saline through subcutaneous osmotic mini-pumps for a second 4-week

period (Figure 5A). Both STZ/SAL and STZ/hPS mice became diabetic with significant

weight loss and increased blood glucose levels compared to the saline-treated groups. There


20

was a significant difference in body weight but not in blood glucose between STZ/SAL and

STZ/hPS groups (Figure 5B). The renal tissue content of collagen and hydroxyproline,

plasma creatinine, L-FABP, and the renal areas positive for PAS staining and for apoptotic

cells were increased in the STZ/SAL group compared to control and STZ/hPS groups

(Figure 5C,D,E). TGF-β1 mRNA expression was significantly elevated while that of

podocin was significantly reduced in the STZ/SAL group compared to control and

STZ/hPS groups (Figure 5F). There were no differences in the level of TAT, a marker of

coagulation activation (Supplemental Figure 11).

In a separate experiment, unilaterally nephrectomized hPS TG and WT mice were made

diabetic using a higher dose of STZ in hPS TG mice than that used in WT mice so that both

WT and hPS have similar blood glucose levels during the entire duration of DM (Figure

6A). As planned, the blood glucose levels were not significantly different between the

WT/STZ and hPS/STZ groups (Figure 6B). In contrast, despite the similar levels of

hyperglycemia, plasma creatinine, L-FABP and renal hydroxyproline content, the

glomerular mesangial expansion and collagen deposition were significantly decreased in

hPS/STZ mice compared with WT/STZ mice (Figure 6B, C). There was no significant

difference in signal for F4/80+ macrophages in the kidneys among groups (data not shown).


21

There were no differences in markers of coagulation (TF) and fibrinolysis (PAI-1, t-PA)

(Supplemental Figure 12).

Discussion

This study showed that hPS attenuates experimental DM by inhibiting apoptosis of

pancreatic islet β-cell and the development of diabetic nephropathy.

hPS attenuates DM by inhibiting apoptosis

hPS is a 69 kDa glycoprotein with anticoagulant, anti-inflammatory and anti-apoptotic

properties that is expressed by a variety of cells (8). hPS inhibits inflammation by

decreasing leukocyte infiltration, release of cytokines (e.g., IL-6, TNF-α) and chemokines

(MCP-1), by stimulating apoptotic cell clearance via macrophage-mediated phagocytosis or

by blocking cell apoptosis through TAM receptors and Akt/PKB pathway (9; 11-13). PS

suppression of apoptosis may prevent autoimmune responses, but it may also be deleterious

in some conditions such as cancer or hepatitis (14; 19). In agreement with its anti-apoptotic

property, here we showed that hPS protects pancreatic islet β cells from apoptosis and

attenuates STZ-induced DM. hPS TG mice have significantly less hyperglycemia, more

insulinemia and required high doses of STZ to develop DM severity similar to their WT

counterpart. STZ induced significantly less apoptosis in hPS-pretreated MIN6 β cell lines,


22

in islet β cells from mice overexpressing hPS and from mice treated systemically with

exogenous hPS compared to controls as demonstrated by pathological, immunostaining or

flow cytometry studies. Overall, these findings show for the first time that hPS attenuates

DM induced by STZ-mediated apoptosis of pancreatic islet β cells.

Regulation of apoptotic pathways by hPS

Apoptosis of β-cells plays a critical role in the pathogenesis of type 1 DM, but its

significance in type 2 DM remains unclear (20). Insulin resistance, hyperinsulinemia and

β-cell hyperplasia are typical features of preclinical type 2 DM (21). However, DM

becomes clinically overt when there is a relative insulin deficiency, which is believed to

result from apoptosis-associated decreased β-cell mass (22). Islet β cell apoptosis can be

triggered by death receptor signaling, by imbalance between pro- and anti-apoptotic

proteins and/or by pro-apoptotic effectors activated during endoplasmic reticulum stress,

the three pathways converging to activate caspase-3 to execute apoptosis (23). Critical

pathways protecting β cells from apoptosis in DM are the Akt/PKB and NFκB pathways,

IAP proteins and some proteins from the Bcl-2 family (24-28). Previous studies have

demonstrated that hPS inhibits apoptosis by activating TAM receptor/Akt/PKB signaling,

but whether it affects expression of IAP or Bcl-2 proteins was unknown. Here we showed


23

that hPS inhibits caspase-3 activation, elicits increased phosphorylation of both Akt/PKB

and IκB, enhances the expression of the anti-apoptotic BIRC3 and Bcl-2 proteins, reduces

pro-apoptotic Bax in β cells, and that this anti-apoptotic activity of hPS is abolished by Mer

receptor antibody. These results are consistent with the concept that hPS ameliorates DM

by inhibiting β cell apoptosis via a TAM receptor-mediated mechanism leading to increased

activation of Akt/PKB and NFκB signaling and upregulation of IAP and Bcl-2 proteins

(25).

hPS attenuates insulin resistance

Type 2 DM is characterized are impaired insulin secretion and increased insulin resistance

leading to relative hypoinsulinemia, decreased uptake of blood glucose in muscles and

adipose tissue and enhanced glucose output from the liver (3). The Akt/PKB pathway is

critical for insulin sensitivity and for the maintenance of normal glucose homeostasis.

Apart from enhancing secretion of insulin from β cells, activation of the Akt/PKB pathway

promotes glucogen synthesis by inactivating glycogen synthase kinase-3, glucose uptake by

increasing the expression or translocation of glucose transporters, and glycolysis by

activating 6-phosphofructo-2-kinase (29-31). Through these mechanisms Akt/PKB can

improve insulin sensitivity in peripheral tissues. Here, we showed that systemic


24

administration of hPS improves sensitivity to insulin in db/db mice with reduced

HOMA-IR values, and that pre-treatment with hPS improves insulin sensitivity in

adipocytes, skeletal muscle and liver cell lines supporting the role of hPS in amelioration of

insulin resistance. Possibly hPS improves insulin sensitivity by activating the Akt/PKB

pathway (32).

hPS ameliorates diabetic glomerulosclerosis

Renal deposition of matrix protein with thickened glomerular basement membrane,

mesangial expansion and nodular sclerosis are characteristic findings of diabetic

nephropathy (33). Growth factors and chemokines including TGF-β1 stimulate matrix

protein release from myofibroblasts following apoptosis of renal cells of glomeruli (33). In

the present study, the protective effect of hPS was evaluated using two models of diabetic

nephropathy: in one WT mice were treated with exogenous hPS or saline after becoming

fully diabetic and, in a second model, DM of equal severity was induced in both WT and

hPS TG mice by administering higher STZ doses to hPS TG than to WT mice and then the

development of nephropathy was compared over the same time period. The results were

significantly less glomerulosclerosis, hydroxyproline content and TGF-β1 expression in the

kidneys, less plasma creatinine and L-FABP in diabetic WT mice treated with exogenous


25

hPS compared to those treated with saline, and in diabetic hPS TG mice compared to

diabetic WT mice with equal severity and duration of DM, suggesting that hPS attenuates

diabetic nephropathy independently of its protective effects on islet β cells. Although the

mechanism by which hPS attenuates diabetic nephropathy was not clearly defined by these

results, the observation of decreased number of apoptotic cells and improved podocin

expression in diabetic mice treated with exogenous hPS compared to controls suggests that

inhibition of glomerular cell apoptosis is the probable mechanism.

Clinical relevance

We found significantly reduced circulating level of free PS in both type 1 and type 2 DM

patients and significant inverse correlation of free PS with HbA1c in patients with type 2

DM. The significant inverse correlation between the circulating level of free PS and HbA1c

suggests that lower systemic availability of PS is clinically relevant in DM patients.

Conclusions

We believe that these novel findings combining observations of supplementing PS levels by

either administration of exogenous hPS or by overexpressing PS are consistent with our

original hypothesis that hPS ameliorates DM and its renal complication.

Acknowledgment


26

T.Y., K.N. and C.N.D-G' performed and prepared the DM mouse models. P.G-B., R.M-M.

and M. I. prepared the models of diabetic nephropathy. M.T., J.A.H. and Z.R. measured

several parameters in mouse model samples. E.C.G., Y.T. and Y.Y. conceived and designed

the experiments and analyzed the data. I.C., J.M. and T.K. contributed with critical revision

and interpretation of the data. T.Y., E.C.G., J.M. and I.C. contributed in manuscript

preparation. E.C.G. is the guarantor of this work and, as such, had full access to all the data

in the study and takes responsibility for the integrity of the data and the accuracy of the data

analysis. This research was supported in part by the Ministry of Education, Culture, Sports,

Science, and Technology of Japan. The funders had no role in study design, data analysis,

decision to publish, or preparation of the manuscript. None of the authors declared any

financial conflict of interest regarding this manuscript.

References

1. Forouhi NG, Wareham NJ: Epidemiology of diabetes. Medicine (Abingdon)

2014;42:698-702

2. Wild S, Roglic G, Green A, Sicree R, King H: Global prevalence of diabetes: estimates

for the year 2000 and projections for 2030. Diabetes care 2004;27:1047-1053

3. American Diabetes A: (2) Classification and diagnosis of diabetes. Diabetes care 2015;38

Suppl:S8-S16

4. van Belle TL, Coppieters KT, von Herrath MG: Type 1 diabetes: etiology, immunology,

and therapeutic strategies. Physiol Rev 2011;91:79-118

5. Donath MY, Ehses JA, Maedler K, Schumann DM, Ellingsgaard H, Eppler E, Reinecke


27

M: Mechanisms of beta-cell death in type 2 diabetes. Diabetes 2005;54 Suppl 2:S108-113

6. Griffin JH, Fernandez JA, Gale AJ, Mosnier LO: Activated protein C. J Thromb Haemost

2007;5 Suppl 1:73-80

7. Ahnstrom J, Andersson HM, Canis K, Norstrom E, Yu Y, Dahlback B, Panico M, Morris

HR, Crawley JT, Lane DA: Activated protein C cofactor function of protein S: a novel role

for a gamma-carboxyglutamic acid residue. Blood 2011;117:6685-6693

8. van der Meer JH, van der Poll T, van 't Veer C: TAM receptors, Gas6, and protein S:

roles in inflammation and hemostasis. Blood 2014;123:2460-2469

9. Takagi T, Taguchi O, Aoki S, Toda M, Yamaguchi A, Fujimoto H, Boveda-Ruiz D,

Gil-Bernabe P, Ramirez AY, Naito M, Yano Y, D'Alessandro-Gabazza CN, Fujiwara A,

Takei Y, Morser J, Gabazza EC: Direct effects of protein S in ameliorating acute lung injury.

J Thromb Haemost 2009;7:2053-2063

10. Liu D, Guo H, Griffin JH, Fernandez JA, Zlokovic BV: Protein S confers neuronal

protection during ischemic/hypoxic injury in mice. Circulation 2003;107:1791-1796

11. Bouwens EA, Stavenuiter F, Mosnier LO: Mechanisms of anticoagulant and

cytoprotective actions of the protein C pathway. J Thromb Haemost 2013;11 Suppl

1:242-253

12. Anderson HA, Maylock CA, Williams JA, Paweletz CP, Shu H, Shacter E:

Serum-derived protein S binds to phosphatidylserine and stimulates the phagocytosis of

apoptotic cells. Nat Immunol 2003;4:87-91

13. Zhong Z, Wang Y, Guo H, Sagare A, Fernandez JA, Bell RD, Barrett TM, Griffin JH,

Freeman RS, Zlokovic BV: Protein S protects neurons from excitotoxic injury by activating

the TAM receptor Tyro3-phosphatidylinositol 3-kinase-Akt pathway through its sex

hormone-binding globulin-like region. J Neurosci 2010;30:15521-15534

14. Chelakkot-Govindalayathil AL, Mifuji-Moroka R, D'Alessandro-Gabazza CN, Toda M,

Matsuda Y, Gil-Bernabe P, Roeen Z, Yasuma T, Yano Y, Gabazza EC, Iwasa M, Takei Y:

Protein S exacerbates alcoholic hepatitis by stimulating liver natural killer T cells. J

Thromb Haemost 2015;13:142-154

15. Gil-Bernabe P, D'Alessandro-Gabazza CN, Toda M, Boveda Ruiz D, Miyake Y, Suzuki

T, Onishi Y, Morser J, Gabazza EC, Takei Y, Yano Y: Exogenous activated protein C

inhibits the progression of diabetic nephropathy. J Thromb Haemost 2012;10:337-346

16. Kamijo-Ikemori A, Sugaya T, Yasuda T, Kawata T, Ota A, Tatsunami S, Kaise R,

Ishimitsu T, Tanaka Y, Kimura K: Clinical significance of urinary liver-type fatty


28

acid-binding protein in diabetic nephropathy of type 2 diabetic patients. Diabetes care

2011;34:691-696

17. Haffner SM, Miettinen H, Stern MP: The homeostasis model in the San Antonio Heart

Study. Diabetes care 1997;20:1087-1092

18. Li DS, Yuan YH, Tu HJ, Liang QL, Dai LJ: A protocol for islet isolation from mouse

pancreas. Nat Protoc 2009;4:1649-1652

19. Linger RM, Keating AK, Earp HS, Graham DK: TAM receptor tyrosine kinases:

biologic functions, signaling, and potential therapeutic targeting in human cancer. Adv

Cancer Res 2008;100:35-83

20. Weir GC, Bonner-Weir S: Islet beta cell mass in diabetes and how it relates to function,

birth, and death. Ann N Y Acad Sci 2013;1281:92-105

21. Kahn SE, Cooper ME, Del Prato S: Pathophysiology and treatment of type 2 diabetes:

perspectives on the past, present, and future. Lancet 2014;383:1068-1083

22. Butler AE, Janson J, Soeller WC, Butler PC: Increased beta-cell apoptosis prevents

adaptive increase in beta-cell mass in mouse model of type 2 diabetes: evidence for role of

islet amyloid formation rather than direct action of amyloid. Diabetes 2003;52:2304-2314

23. Choi D, Woo M: Executioners of apoptosis in pancreatic {beta}-cells: not just for cell

death. Am J Physiol Endocrinol Metab 2010;298:E735-741

24. Addison D, Aguilar D: Diabetes and cardiovascular disease: the potential benefit of

incretin-based therapies. Curr Atheroscler Rep 2011;13:115-122

25. de Almagro MC, Vucic D: The inhibitor of apoptosis (IAP) proteins are critical

regulators of signaling pathways and targets for anti-cancer therapy. Exp Oncol

2012;34:200-211

26. Emamaullee J, Liston P, Korneluk RG, Shapiro AM, Elliott JF: XIAP overexpression in

islet beta-cells enhances engraftment and minimizes hypoxia-reperfusion injury. Am J

Transplant 2005;5:1297-1305

27. Emamaullee JA, Rajotte RV, Liston P, Korneluk RG, Lakey JR, Shapiro AM, Elliott JF:

XIAP overexpression in human islets prevents early posttransplant apoptosis and reduces

the islet mass needed to treat diabetes. Diabetes 2005;54:2541-2548

28. Gurzov EN, Eizirik DL: Bcl-2 proteins in diabetes: mitochondrial pathways of beta-cell

death and dysfunction. Trends in cell biology 2011;21:424-431

29. Cheng KK, Lam KS, Wu D, Wang Y, Sweeney G, Hoo RL, Zhang J, Xu A: APPL1

potentiates insulin secretion in pancreatic beta cells by enhancing protein kinase


29

Akt-dependent expression of SNARE proteins in mice. Proc Natl Acad Sci U S A

2012;109:8919-8924

30. Lawlor MA, Alessi DR: PKB/Akt: a key mediator of cell proliferation, survival and

insulin responses? J Cell Sci 2001;114:2903-2910

31. Manning BD, Cantley LC: AKT/PKB signaling: navigating downstream. Cell

2007;129:1261-1274

32. Yang M, Ren Y, Lin Z, Tang C, Jia Y, Lai Y, Zhou T, Wu S, Liu H, Yang G, Li L:

Kruppel-like factor 14 increases insulin sensitivity through activation of PI3K/Akt signal

pathway. Cellular signalling 2015;27:2201-2208

33. Navarro-Gonzalez JF, Mora-Fernandez C, Muros de Fuentes M, Garcia-Perez J:

Inflammatory molecules and pathways in the pathogenesis of diabetic nephropathy. Nat

Rev Nephrol 2011;7:327-340

Figures legends

Figure 1. hPS-TG mice are resistant to diabetes induced by STZ. Mice received

intraperitoneal injections of STZ or saline for five consecutive days. In multiple cohorts of

mice, the blood glucose levels were measured over time after STZ administration or saline

(A; WT/SAL n=3; hPS/SAL n=4; WT/STZ n=7; hPS TG/STZ n= 6), during the

intraperitoneal glucose tolerance test (B; WT/SAL n=3; hPS/SAL n=3; WT/STZ n=7; hPS

TG/STZ n= 7) and insulin sensitivity test (C; WT/SAL n=3; hPS/SAL n=3; WT/STZ n=5;

hPS TG/STZ n=3) performed on the 3rd

week of STZ injection after 16h of food

deprivation. Plasma insulin level was measured after an intraperitoneal injection of glucose

and 16h of food deprivation (D; WT/SAL n=3; hPS/SAL n=4; WT/STZ n=7; hPS TG/STZ


30

n=5). Data are expressed as mean ± S.E.M. The figure shows representative result from one

of three independent experiments. WT, wild type; STZ, streptozotocin; hPS, human protein

S; SAL, saline. *p<0.005 vs hPS/STZ; ‡p<0.01 vs WT/SAL. Statistical analysis by

Mann-Whitney U test for two groups and ANOVA with post hoc analysis by Tukey’s test.

Figure 2. Exogenous hPS antigen increases insulin sensitivity in target cells. (A) L6

myoblasts, 3T3-L1 adipocytes and HepG2 were cultured in normal medium (low glucose)

or medium with high glucose (1g/L) in the presence of insulin alone (200 nM) or hPS alone

(20 µg/ml) or in the presence of both for 4h before measuring medium glucose levels. (B)

In separate experiments, anti-hPS antibody (20 µg/ml) was added to the cell culture before

stimulation with insulin and/or hPS. Data are expressed as mean ± S.D. The figure shows a

representative result from one of two independent experiments. N=3 per group. *p<0.005

vs insulin (-), hPS (-); **p<0.05 vs insulin (+), hPS (-); ‡p<0.02 vs insulin (-), hPS (-),

anti-hPS (-); ¶p<0.01 vs insulin (+), hPS (-), anti-hPS (-); §p<0.001 vs insulin (+), hPS (+),

anti-hPS (-). Statistical analysis was done using ANOVA with post hoc analysis by Tukey’s

test.

Figure 3. hPS-TG mice showed less apoptosis of islet ββββ cells. Mice were sacrificed on

day 28 after STZ or saline intraperitoneal injection. The pancreas was incised, removed and


31

prepared for immune-staining of insulin (green) and glucagon (red) (A; n=3 per group) or

apoptotic cells by TUNEL method (B; WT/SAL n=3; hPS/SAL n=3; WT/STZ n=6;

hPS/STZ n=6). The areas of positive cells for insulin and glucagon and apoptotic cells were

quantified using image software (WinROOF); the mean values of the WT/SAL group were

taken as 100% for comparison purposes. Data are expressed as mean ± S.E.M. The figure

shows a representative section from one of three independent experiments. Scale bars

indicate 20 µm. Arrowhead indicates apoptotic cells. WT, wild type; STZ, streptozotocin;

hPS, human protein S; SAL, saline. *p<0.05 vs WT/SAL and hPS/SAL groups; **p<0.05

vs WT/STZ group. Statistical analysis was done using ANOVA with post hoc analysis by

Tukey’s test.

Figure 4. hPS inhibits apoptosis of the pancreatic islet ββββ cells. (A) Apoptosis of the

murine β cell line MIN6 was induced with streptozotocin (STZ) in the presence of hPS (20

µg/ml) or saline, stained with Annexin-FITC and propidium iodide and assessed by flow

cytometry, fluorescence microscopy or by Western blot of cleaved caspase-3. (B)

Phosphorylation of Akt/PKB and IκB was assessed after treating MIN6 cells with hPS (20

µg/ml) for 30min and 60min by flow cytometry and Western blot. (C) Analysis of mBIRC3

expression in MIN6 cells by Western blot. (D) Primary islet cells from wild type (WT) and


32

hPS TG mice were isolated after DM induction as described under Materials and Methods

and the expression of mBIRC3 was assessed by quantitative RT-PCR. Data are expressed as

mean ± S.E.M. The figure shows a representative result from one of three independent

experiments. N=3 per group. STZ, streptozotocin; hPS, human protein S; SAL, saline.

SAL/SAL, cells treated with saline alone; hPS/SAL, cells pre-treated with hPS before

saline; SAL/STZ, cells pretreated with saline before STZ; hPS/STZ, cells pretreated with

hPS before STZ. *p<0.05 vs SAL/SAL and hPS/SAL groups; **p<0.05 vs SAL/STZ

group; ¶p<0.05 vs hPS (-). Statistical analysis was done using ANOVA with post hoc

analysis by Tukey’s test.

Figure 5. hPS attenuates the progression of diabetic nephropathy. (A) Mice received

intraperitoneal injections of STZ (40 mg/kg body weight) after recovery from unilateral

nephrectomy and treated with hPS by implanted s.c. pump from the 4th

week after STZ

injection. (B) Body weight and blood glucose were followed longitudinally for 4 weeks.

(C) The collagen and hydroxyproline content of the kidney and plasma creatinine were

measured by colorimetric assays. (D) Mesangial expansion was assessed by PAS stain

(upper panel), collagen deposition by Masson trichrome stain (middle panel), apoptosis by

TUNEL method (lower panel) and quantified using image software (WinROOF); the mean


33

values of the SAL/p-SAL group were taken as 100% for comparison purposes. (E) L-FABP

was measured by enzyme immunoassays. (F) Relative renal mRNA expression of TGFβ1

and podocin was measured by RT-PCR. Data are expressed as mean ± S.E.M. Scale bars

indicate 20 µm. The figure shows representative results from one of two independent

experiments. N=5 mice per group. WT, wild type; STZ, streptozotocin; p-hPS, human

protein S administered by pump; p-SAL, saline administered by pump. Statistical analysis

was done using ANOVA with post hoc analysis by Tukey’s test. *p<0.05 vs SAL/p-SAL

and SAL/p-hPS groups; **p<0.01 vs STZ/p-SAL group.

Figure 6. Overexpression of hPS protects against diabetic nephropathy. (A) WT mice

received 5 intraperitoneal injections of streptozotocin (STZ; 40 mg/kg body weight) for 1

week while hPS TG mice received (in average) 10 injections for 2 weeks. Both WT and

hPS TG mice were followed up for 8 weeks after the last STZ injection before sacrifice. (B)

Blood glucose was followed longitudinally for 7 weeks, (C) hydroxyproline content and

plasma creatinine were measured by colorimetric assays, and L-FABP by enzyme

immunoassays. (D) Mesangial expansion was assessed by PAS stain, collagen deposition

by Masson trichrome stain and quantified using image software (WinROOF); the mean

values of the WT/SAL group were taken as 100% for comparison purposes. Data are


34

expressed as mean ± S.E.M. Scale bars indicate 20 µm. The figure shows representative

result from one of two independent experiments. N=4 mice per group. WT, wild type; STZ,

streptozotocin; hPS, human protein S; SAL, saline. *p<0.05 vs WT/SAL and hPS/SAL

groups; **p<0.05 vs WT/STZ group; ‡p<0.05 vs STZ-treated groups. Statistical analysis

was done using ANOVA with post hoc analysis by Tukey’s test.


Table 1. Characteristics of the subjects.

Statistical analysis by Student’s t test. Levels of hemoglobin A1c were measured by high-perfomance liquid chromatography,

total cholesterol, triglycerides and high density lipoproteins by automated enzymatic methods at the clinical laboratory of Mie

University Hospital. Data expressed as the mean ± S.E.M. DM, diabetes mellitus.*p<0.05, ¶p<0.01 and §p=0.06, compared to

healthy subjects.

No of subjects

Age (year-old)

Gender (M/F)

Diabetes duration (years)

Body mass index

Fasting blood glucose (mg/dL)

Serum Hemoglobin A1c (%)

Serum T cholesterol (mg/dL)

Serum Triglycerides (mg/dL)

Serum high density lipoproteins (mg/dL)

Plasma total protein S (µg/ml)

Plasma Free protein S (µg/ml)

Plasma C4 binding protein (µg/ml)

Patients with type 1 DM Healthy subjects Variables

6

61.3 ± 1.9

2/4

15.3 ± 3.9

22.9 ± 2.6

152.2 ± 12.6

7.8 ± 0.4

200.0 ± 16.3

140.5 ± 34.2

53.3 ± 8.9

15.7 ± 2.1

5.9 ± 0.6

5.2 ± 0.5

37

54.2 ± 1.2

10/27

-

23.7 ± 0.6

96.5 ± 2.7

5.3 ± 0.1

216.7 ± 5.3

121.4 ± 10.6

59.5 ± 2.5

22.9 ± 1.8

9.6 ± 0.8

5.4 ± 0.2

Patients with type 2 DM

26

53.5 ± 2.1

14/12

14.5 ± 2.3

24.4 ± 0.7

176.4 ± 13.2

9.1 ± 0.4

193.1 ± 9.2

218.8 ± 44.1

41.8 ± 2.4

18.7 ± 1.8

6.8 ± 0.4

6.2 ± 0.2

∗

¶ ¶

¶ ¶

∗

∗ § §

∗ ∗

¶


Figure 1. hPS-TG mice are resistant to diabetes induced by STZ. Mice received intraperitoneal injections of STZ or saline for five consecutive days. In multiple cohorts of mice, the blood glucose levels were measured over time after STZ administration or saline (A; WT/SAL n=3; hPS/SAL n=4; WT/STZ n=7; hPS TG/STZ n=

6), during the intraperitoneal glucose tolerance test (B; WT/SAL n=3; hPS/SAL n=3; WT/STZ n=7; hPS TG/STZ n= 7) and insulin sensitivity test (C; WT/SAL n=3; hPS/SAL n=3; WT/STZ n=5; hPS TG/STZ n=3)

performed on the 3rd week of STZ injection after 16h of food deprivation. Plasma insulin level was measured after an intraperitoneal injection of glucose and 16h of food deprivation (D; WT/SAL n=3; hPS/SAL n=4; WT/STZ n=7; hPS TG/STZ n=5). Data are expressed as mean ± S.E.M. The figure shows representative

result from one of three independent experiments. WT, wild type; STZ, streptozotocin; hPS, human protein S; SAL, saline. *p<0.005 vs hPS/STZ; ‡p<0.01 vs WT/SAL. Statistical analysis by Mann-Whitney U test for

two groups and ANOVA with post hoc analysis by Tukey’s test. 161x249mm (300 x 300 DPI)



Figure 2. Exogenous hPS antigen increases insulin sensitivity in target cells. (A) L6 myoblasts, 3T3-L1 adipocytes and HepG2 were cultured in normal medium (low glucose) or medium with high glucose (1g/L) in the presence of insulin alone (200 nM) or hPS alone (20 µg/ml) or in the presence of both for 4h before

measuring medium glucose levels. (B) In separate experiments, anti-hPS antibody (20 µg/ml) was added to the cell culture before stimulation with insulin and/or hPS. Data are expressed as mean ± S.D. The figure shows a representative result from one of two independent experiments. N=3 per group. *p<0.005 vs

insulin (-), hPS (-); **p<0.05 vs insulin (+), hPS (-); ‡p<0.02 vs insulin (-), hPS (-), anti-hPS (-); ¶p<0.01 vs insulin (+), hPS (-), anti-hPS (-); §p<0.001 vs insulin (+), hPS (+), anti-hPS (-). Statistical analysis was

done using ANOVA with post hoc analysis by Tukey’s test. 190x179mm (300 x 300 DPI)


Figure 3. hPS-TG mice showed less apoptosis of islet β cells. Mice were sacrificed on day 28 after STZ or saline intraperitoneal injection. The pancreas was incised, removed and prepared for immune-staining of

insulin (green) and glucagon (red) (A; n=3 per group) or apoptotic cells by TUNEL method (B; WT/SAL n=3; hPS/SAL n=3; WT/STZ n=6; hPS/STZ n=6). The areas of positive cells for insulin and glucagon and

apoptotic cells were quantified using image software (WinROOF); the mean values of the WT/SAL group were taken as 100% for comparison purposes. Data are expressed as mean ± S.E.M. The figure shows a representative section from one of three independent experiments. Scale bars indicate 20µm. Arrowhead

indicates apoptotic cells. WT, wild type; STZ, streptozotocin; hPS, human protein S; SAL, saline. *p<0.05 vs

WT/SAL and hPS/SAL groups; **p<0.05 vs WT/STZ group. Statistical analysis was done using ANOVA with post hoc analysis by Tukey’s test.

231x194mm (300 x 300 DPI)


Figure 4. hPS inhibits apoptosis of the pancreatic islet β cells. (A) Apoptosis of the murine β cell line MIN6 was induced with streptozotocin (STZ) in the presence of hPS (20 µg/ml) or saline, stained with Annexin-FITC and propidium iodide and assessed by flow cytometry, fluorescence microscopy or by Western blot of

cleaved caspase-3. (B) Phosphorylation of Akt/PKB and IκB was assessed after treating MIN6 cells with hPS (20 µg/ml) for 30min and 60min by flow cytometry and Western blot. (C) Analysis of mBIRC3 expression in MIN6 cells by Western blot. (D) Primary islet cells from wild type (WT) and hPS TG mice were isolated after

DM induction as described under Materials and Methods and the expression of mBIRC3 was assessed by quantitative RT-PCR. Data are expressed as mean ± S.E.M. The figure shows a representative result from one of three independent experiments. N=3 per group. STZ, streptozotocin; hPS, human protein S; SAL,

saline. SAL/SAL, cells treated with saline alone; hPS/SAL, cells pre-treated with hPS before saline; SAL/STZ, cells pretreated with saline before STZ; hPS/STZ, cells pretreated with hPS before STZ. *p<0.05 vs SAL/SAL and hPS/SAL groups; **p<0.05 vs SAL/STZ group; ¶p<0.05 vs hPS (-). Statistical analysis was done using

ANOVA with post hoc analysis by Tukey’s test. 271x203mm (300 x 300 DPI)


Figure 5. hPS attenuates the progression of diabetic nephropathy. (A) Mice received intraperitoneal injections of STZ (40 mg/kg body weight) after recovery from unilateral nephrectomy and treated with hPS

by implanted s.c. pump from the 4th week after STZ injection. (B) Body weight and blood glucose were

followed longitudinally for 4 weeks. (C) The collagen and hydroxyproline content of the kidney and plasma creatinine were measured by colorimetric assays. (D) Mesangial expansion was assessed by PAS stain

(upper panel), collagen deposition by Masson trichrome stain (middle panel), apoptosis by TUNEL method (lower panel) and quantified using image software (WinROOF); the mean values of the SAL/p-SAL group were taken as 100% for comparison purposes. (E) L-FABP was measured by enzyme immunoassays. (F) Relative renal mRNA expression of TGFβ1 and podocin was measured by RT-PCR. Data are expressed as

mean ± S.E.M. Scale bars indicate 20 µm. The figure shows representative results from one of two independent experiments. N=5 mice per group. WT, wild type; STZ, streptozotocin; p-hPS, human protein S administered by pump; p-SAL, saline administered by pump. Statistical analysis was done using ANOVA with post hoc analysis by Tukey’s test. *p<0.05 vs SAL/p-SAL and SAL/p-hPS groups; **p<0.01 vs STZ/p-SAL

group.

283x204mm (300 x 300 DPI)


Figure 6. Overexpression of hPS protects against diabetic nephropathy. (A) WT mice received 5 intraperitoneal injections of streptozotocin (STZ; 40 mg/kg body weight) for 1 week while hPS TG mice received (in average) 10 injections for 2 weeks. Both WT and hPS TG mice were followed up for 8 weeks

after the last STZ injection before sacrifice. (B) Blood glucose was followed longitudinally for 7 weeks, (C) hydroxyproline content and plasma creatinine were measured by colorimetric assays, and L-FABP by enzyme

immunoassays. (D) Mesangial expansion was assessed by PAS stain, collagen deposition by Masson trichrome stain and quantified using image software (WinROOF); the mean values of the WT/SAL group

were taken as 100% for comparison purposes. Data are expressed as mean ± S.E.M. Scale bars indicate 20 µm. The figure shows representative result from one of two independent experiments. N=4 mice per group. WT, wild type; STZ, streptozotocin; hPS, human protein S; SAL, saline. *p<0.05 vs WT/SAL and hPS/SAL groups; **p<0.05 vs WT/STZ group; ‡p<0.05 vs STZ-treated groups. Statistical analysis was done using

ANOVA with post hoc analysis by Tukey’s test. 193x283mm (300 x 300 DPI)



Supplemental Table 1. Primers for RT-PCR

Sequence (5' -> 3') Tm Reference Location Product size

BIRC1a (NAIP1)

Sense TGCCCAGTATATCCAAGGCTAT 60.2 NM_008670 708-729 116 bp

Antisense AGACGCTGTCGTTGCAGTAAG 62.6 823-803

BIRC1b (NAIP2)

Sense AGCTTGGTGTCTGTTCTCTGT 61 NP_001119654 1204-1224 180 bp

Antisense GCGGAAAGTAGCTTTGGTGTAG 61.2 1383-1362

BIRC2 (c-IAP1)

Sense TGTGGCCTGATGTTGGATAAC 60 NM_007465 256-276 164 bp

Antisense GGTGACGAATGTGCAAATCTACT 60.9 419-397

BIRC3 (c-IAP2)

Sense ACGCAGCAATCGTGCATTTTG 62.9 NM_007464 1073-1093 181 bp

Antisense CCTATAACGAGGTCACTGACGG 61.6 1253-1232

BIRC4 (XIAP)

Sense CGAGCTGGGTTTCTTTATACCG 60.7 NM_009688 145-166 126 bp

Antisense GCAATTTGGGGATATTCTCCTGT 60.4 270-248

BIRC5 (Survivin)

Sense GAGGCTGGCTTCATCCACTG 62.6 NM_009689 118-137 250 bp

Antisense CTTTTTGCTTGTTGTTGGTCTCC 60.7 367-345

BIRC6 (Apollon)

Sense ACAGATTGTCTTACCTCTTGCCC 61.9 NM_007566 695-717 120 bp

Antisense GCCACGAAGTGAAGGTCTCC 62.5 814-795

BIRC7 (ml-IAP)

Sense AGCCTCCTTCTACGACTGG 60.1 NM_001163247 291-309 245 bp

Antisense GCAAAGGGGTGTAGGTCTGG 62.2 535-516

TGF-β1

Sense ACTCCACGTGGAAATCAACGG 68.1 NM_011577 693-713 414 bp

Antisense TAGTAGACGATGGGCAGTGG 62.7 1106-868

Podocin

Sense AAGCTGAGGCACAAAGACAGG 65.6 NM_130456 848-868 416 bp

Antisense CTATTTGGCAACCAAACAAGTG 63.0 1263-1242

GAPDH

Sense TGGCCTTCCGTGTTCCTAC 61.3 NM_008084 686-704 178 bp

Antisense GAGTTGCTGTTGAAGTCGCA 60.9 863-844 Bcl2

Sense AGCTGCACCTGACGCCCTT 69.6 NM_177410 344-362 192 bp

Antisense GTTCAGGTACTCAGTCATCCAC 60.1 535-516 Bax

Sense CGGCGAATTGGAGATGAACTG 68.7 NM_007527 190-210 161bp

Antisense GCAAAGTAGAAGAGGGCAACC 63.8 350-330 BclxL

Sense AGGTTCCTAAGCTTCGCAATTC 64.4 NM_001289739 128-149 248bp

Antisense TGTTTAGCGATTCTCTTCCAGG 64.2 375-354 Apaf1

Sense AAGGACAGTGCTGTGTGAA 59.4 NM_001042558 330-349 627bp

Antisense CCTTTGCATTCCTTTATAATAC 56.1 956-935 BIRC1a,1b, 2, 3, 4, 5, 6, or 7: baculoviral iap repeat-containing 1a, 1b, 2, 3, 4, 5, 6, or 7. NAIP1, or 2: neuronal apoptosis inhibitory protein1, or 2. c-IAP1, or 2: cellular inhibitor of apoptosis protein 1, or 2. x-IAP: x-linked inhibitor of apoptosis proten. ml-IAP: melanoma inhibitor of apoptosis. TGF-β1: transforming growth factor-β1. GAPDH: glyceraldehyde 3-phosphate dehydrogenase. Bcl2: B-cell

lymphoma 2. Bax: Bcl-2-associated X protein. BclxL: B-cell lymphoma-extra large. Apaf1: apoptotic protease

activating factor 1


Supplemental Table 2. Spearman correlation coefficients between clinical variables and

plasma levels of total and free protein S and C4BP in type 2 DM patients(n=26).

Age

Diabetes duration

Body mass index

Fasting blood glucose

Serum Hemoglobin A1c

Serum T cholesterol

Serum Triglycerides

Serum high density lipoproteins

Plasma total protein S Plasma free protein S Variables

0.2

-0.1

-0.1

0.1

-0.3

-0.1

0.1

-0.2

p values r values

Plasma C4BP

p values r values p values r values

0.3

0.6

0.7

0.8

0.1

0.5

0.6

0.4

0.4

0.0

-0.1

-0.1

-0.5

-0.2

-0.1

-0.3

0.04

0.9

0.8

0.7

0.02

0.4

0.6

0.1

-0.6

-0.3

0.3

0.1

0.4

0.3

0.1

0.1

0.003

0.07

0.2

0.7

0.04

0.1

0.7

0.4


Supplemental Table 3. Spearman correlation coefficients between clinical variables and

plasma levels of total and free protein S and C4BP in type 1 DM patients (n=6).

Age

Diabetes duration

Body mass index

Fasting blood glucose

Serum Hemoglobin A1c

Serum T cholesterol

Serum Triglycerides

Serum high density lipoproteins

Plasma total protein S Plasma free protein S Variables

0.3

0.6

-0.3

0.3

-0.5

-0.7

-0.1

0.2

p values r values

Plasma C4BP

p values r values p values r values

0.5

0.2

0.6

0.5

0.2

0.1

0.9

0.7

0.1

0.5

0.0

0.0

-0.4

-0.8

0.1

-0.1

0.8

0.3

0.9

0.9

0.4

0.06

0.8

0.9

0.5

0.1

-0.4

0.6

-0.0

0.1

-0.6

0.4

0.3

0.9

0.4

0.1

0.8

0.8

0.1

0.4


Supplemental Figure 1. Improvement of insulin sensitivity in db/db mice by hPS treatment. During fasting db/db mice were subcutaneously treated

with hPS (2 mg/kg; n=5) or saline (n=5) at 0, 1, 2, 4 and 6h and then insulin sensitivity test (A) was performed and homeostasis model assessment for

insulin resistance (HOMA-IR) was calculated (B). Means of two independent experiments are shown. Data are expressed as mean ± S.E.M. Statistical

significance was calculated by Mann-Whitney U test. *p<0.05 vs. db/db/hPS


Supplemental Figure 2. Increased area of pancreatic islets in hPS-TG mice. (A) Mice were sacrificed on day 28 after STZ or saline intraperitoneal injection.

The pancreas was incised, removed and prepared for staining with H&E (WT/SAL n=3; hPS/SAL n=5; WT/STZ n=6; hPS/STZ n=6). (B) Pancreatic islet area

was quantified using image software (WinROOF); the mean values of the WT/SAL group were defined as 100%. Data are expressed as mean ± S.E.M. The

figure shows a representative section from one of three independent experiments. Scale bars indicate 20 µm. Arrows indicate pancreas islets. WT, wild type;

STZ, streptozotocin; hPS, human protein S; SAL, saline. *p<0.05 vs WT/SAL and hPS/SAL groups; **p<0.05 vs WT/STZ group. Statistical analysis was done

using ANOVA with post hoc analysis by Tukey’s test.


Supplemental Figure 3. hPS decreases infiltration of macrophages and promotes M2 differentiation. (A) Mice were sacrificed on day 28 after streptozotocin (STZ) or saline

intraperitoneal injection. The pancreas was removed and immunostaining of F4/80 was performed (WT/SAL n=3; hPS/SAL n=5; WT/STZ n=6; hPS/STZ n=6). (B) Positively stained

area was quantified using image software (WinROOF). Data are expressed as mean ± S.E.M. The figure shows a representative section from one of three independent experiments.

Scale bars indicate 25 µm. Head arrows indicate positively stained macrophages. WT, wild type; hPS, human protein S; SAL, saline. *p<0.05 vs WT/SAL; **p<0.05 vs WT/STZ.

Statistical analysis was done using ANOVA with post hoc analysis by Tukey’s test. (C) RAW264.7 cells were cultured in 12-well microplates in the presence or absence of hPS (20

µg/ml) for 30 min and then high glucose concentration (final concentration, 25 mM) was added to medium the cells and the culture was continued for 24h. Expression of the M1

marker inducible nitric oxide synthase (iNOS) and the M2 marker arginase1 (Arg1) were analyzed by RT-PCR. The figure shows representative result from one of two independent

experiments. N=3 mice per group. *p<0.05vs hPS (-), high glucose group. Statistical analysis was done using ANOVA with post hoc analysis by Tukey’s test.


Supplemental Figure 4. hPS inhibits apoptosis of pancreatic islet ββββ cells in vivo. C57BL/6 WT mice received intraperitoneal injection of streptozotocin (STZ) for 5 days

and treated with exogenous hPS (2mg/kg) or saline subcutaneously 1h before each STZ injection and continued for 9 additional days after the last STZ injection. (A) Blood

glucose performed on day 7 after STZ and hPS treatment. (B) Mice of each group were then euthanized, islet β cells were isolated and apoptotic cells were assessed by flow

cytometry after staining with Annexin-fluorescein isothiocyanate and propidium iodide. (C) Percentage of apoptotic cells in each group. Data are expressed as mean ± S.D.

Statistical analysis was done using Mann Whitney U test. *p<0.05 vs STZ/SAL group.


Supplemental Figure 5. hPS increases phosphrylation of Akt/PKB and iκκκκB in primary islet ββββ cells. Primary pancreatic islets isolated as described in the

method section, and then treated with 20 µg/ml hPS in the presence or absence of 100 µg/ml anti-hPS antibody for 60 min. Islets were dissociated with

trypsin/EDTA into a single cell suspension and fixed with 4% paraformaldehyde. After permeabilization with 90 % ice-cold methanol, cells were stained with

anti-phospho-Akt (A; Ser473) or anti-phospho-IκBα (B), followed by FITC-conjugated goat anti-rabbit IgG. Black line histogram represents the isotype control

(normal rabbit IgG). N=3 mice per group. hPS, human protein S; hPS. *p<0.05 vs anti-hPS(-) hPS(-) group; **p<0.05 vs vs anti-hPS(-) hPS(+) group. Data are

expressed as mean ± S.D. Statistical analysis was done using ANOVA with post hoc analysis by Tukey’s test.


Supplemental Figure 6. MIN6 cells express the three TAM receptors. The murine pancreatic β cell line MIN6 was cultured and the surface

expression of Tyro3, Axl and Mer receptors was evaluated by flow cytometry using mouse-specific antibodies for the three receptors (red lines).

Isotype antibody in grey was used as control.


Supplemental Figure 7. hPS protects β-cells against streptozotocin–induced apoptosis via Mer receptor. (A) MIN6 cells were pretreated with 20

µg/ml of anti-Tyro3, anti-Axl, anti-Mer or isotype IgG for 30 min, before adding 20 µg/ml hPS. The cells were then treated with 2 mM streptozotocin

or saline, cultured for 24h and the number of apoptotic cells was evaluated by flow cytometry after Annexin V-FITC/propidium iodide (PI) double

staining. (B) The percentage of apoptotic cells was measured (STZ, solid red bars) or saline (SAL, open white bars). Each bar represents the mean ±

S.D. of three independent experiments. *p<0.05 vs. control (IgG+SAL).


Supplemental Figure 8. hPS increases the expression of some inhibitors of apoptosis (IAP). The murine pancreatic β cell line MIN6 was cultured and

stimulated as described in the Methods section, RNA isolated and quantitative RT-PCR was performed. Data are expressed as mean ± S.E.M. The figure shows

representative result from one of two independent experiments. N=3 mice per group. WT, wild type; STZ, streptozotocin; hPS, human protein S; hPS TG, hPS

transgenic mice; SAL, saline. *p<0.05vs SAL/SAL; **p<0.05 vs SAL/STZ. Statistical analysis was done using ANOVA with post hoc analysis by Tukey’s test.


Supplemental Figure 9. BIRC3 mediates the anti-apoptotic activity of hPS in Min6 ββββ-cell lines. Min6 cells were transfected with 33 nmol of Birc3 siRNA

or scrambled siRNA, cultured in the presence or absence of hPS for 30 min and then treated with or without streptozotocin for 24h. (A) Knock down of

mBIRC3 by specific siRNA. (B) Percent of apoptotic cells was assessed by flow cytometry. (C) The percentage of apoptotic cells was measured and compared

among groups. Each bar represents the mean ± S.D. of three independent experiments. *p<0.05 vs. scrambled siRNA. **p<0.05 vs hPS (-) /scrambled siRNA


Supplemental Figure 10. Effect of hPS on the expression of Bcl-2 family proteins and apoptotic protease activating factor 1 (APAF1). The murine

pancreatic β cell line MIN6 was cultured and stimulated as described in the method section and quantitative RT-PCR was performed. Data are expressed as

mean ± S.E.M. The figure shows representative results from one of two independent experiments. N=3 mice per group. WT, wild type; STZ, streptozotocin;

hPS, human protein S; hPS TG, hPS transgenic mice; SAL, saline. *p<0.05vs SAL/SAL; **p<0.05 vs SAL/STZ. Statistical analysis was done using ANOVA

with post hoc analysis by Tukey’s test.


Supplemental Figure 11. The coagulation system was not affected by exogenous hPS administration in mice with diabetes. Mice received intraperitoneal

injections of STZ (40 mg/kg body weight) after recovery from unilateral nephrectomy and treated with hPS by implanted s.c. pump from the 4th week after

STZ injection. Blood was sampled during sacrifice, plasma was separated and thrombin-antithrombin complex (TAT) was measured by enzyme immunoassays.

Data are expressed as mean ± S.E.M. The figure shows representative results from one of two independent experiments. N=5 mice per group. WT, wild type;

STZ, streptozotocin; p-hPS, human protein S administered by pump; p-SAL, saline administered by pump. Statistical analysis was done using ANOVA with

post hoc analysis by Tukey’s test.


Supplemental Figure 12. Circulating levels of tissue factor (TF), plasminogen activator inhibitor-1 (PAI-1) and tissue plasminogen activator (tPA) are

not significantly affected by hPS overexpression. Diabetes was induced in WT and hPS-TG mice by intraperitoneal injection of streptozotocin as described

under materials and methods and blood samples were drawn after euthanasia. Data are expressed as mean ± S.E.M. The figure shows representative results

from one of two independent experiments. N=4 mice per group. WT, wild type; STZ, streptozotocin; hPS, human protein S; SAL, saline. Statistical analysis

was done using ANOVA with post hoc analysis by Tukey’s test.


Documents

Amelioration of Diabetes Mellitus by Protein S · 07/04/2016 · 1 Amelioration of Diabetes Mellitus by Protein S Taro Yasuma,1 Yutaka Yano,1 Corina N. D' Alessandro-Gabazza,3 Masaaki