An Arg-307 to Gln Polymorphism within the ATP-binding Site

1

An Arg-307 to Gln Polymorphism within the ATP-binding Site Causes Loss-of-function of the Human P2X7 Receptor

Ben J. Gu‡, Ronald Sluyter‡, Kristen K. Skarratt‡, Anne N. Shemon‡, Lan-

Phuong Dao-Ung‡, Stephen J. Fuller‡, Julian A. Barden║, Alison L. Clarke¶,

Steven Petrou¶ and James S. Wiley‡§,

From the ‡Department of Medicine, University of Sydney at Nepean Hospital,

Penrith, New South Wales 2750, the ║Department of Anatomy and Histology,

University of Sydney, Sydney, New South Wales, 2006, and the ¶Department

of Physiology, University of Melbourne, Parkville, Victoria 3050, Australia.

Running title: A polymorphism within the ATP-binding site of P2X7

§To whom correspondence should be addressed: Level 5, South Block,

Nepean Hospital, Penrith, NSW 2750, Australia. Tel.: 61-2-4734 3277; Fax:

61-2-4734 3432; E-mail: [email protected]

*This work was supported by the National Health and Medical Research

Council, the Cure Cancer Australia Foundation, the Leukemia Foundation of

Australia and a Sesqui Fellowship from the University of Sydney (BJ Gu).

Manuscript includes 2 tables and 11 figures

by guest on February 19, 2018http://w

ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

2

ABSTRACT

The P2X7 receptor is a ligand-gated channel which is highly expressed on

mononuclear cells of the immune system and which mediates ATP-induced

apoptosis. Wide variations in the function of the P2X7 receptor have been

observed, explained in part by loss-of-function polymorphisms which change

Glu-496 to Ala (E496A) and Ile-568 to Asn (I568N). In this study, a third

polymorphism which substitutes an uncharged glutamine for the highly

positively charged arginine-307 (R307Q) has been found in heterozygous

dosage in 12 of 420 subjects studied. P2X7 function was measured by ATP-

induced fluxes of Rb+, Ba2+ and ethidium+ into peripheral blood monocytes or

various lymphocyte subsets and was either absent or markedly decreased.

Transfection experiments showed that P2X7 carrying the R307Q mutation

lacked either channel or pore function despite robust protein synthesis and

surface expression of the receptor. The monoclonal antibody (clone L4) which

binds to the extracellular domain of wild type P2X7 and blocks P2X7 function

failed to bind to the R307Q mutant receptor. Differentiation of monocytes to

macrophages upregulated P2X7 function in cells heterozygous for the R307Q

to a value 10-40% of that for wild type macrophages. However, macrophages

from a subject who was double heterozygous for R307Q/I568N remained

totally non-functional for P2X7, and lymphocytes from the same subject also

lacked ATP-stimulated phospholipase D activity. These data identify a third

loss-of-function polymorphism affecting the human P2X7 receptor and since

the affected arginine-307 is homologous to those essential for ATP binding to

P2X1 and P2X2, it is likely that this polymorphism abolishes the binding of ATP

to the extracellular domain of P2X7.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

3

Key Words: P2X7, loss-of-function polymorphism, ATP-binding site,

purinergic receptor, lymphocyte, monocyte/macrophage

The abbreviations used are CLL, chronic lymphocytic leukemia; BSA, bovine serum

albumin; FITC, fluorescein isothiocyanate; PE, phycoerythrin; mAb, monoclonal

antibody; HEK, human embryonic kidney; hP2X7, human P2X7; PCR, polymerase

chain reaction; PBS, phosphate-buffered saline; PLD, phospholipase D; PBut,

phosphatidylbutanol; BzATP, 2’,3’-O-(4-benzoyl)benzoyl ATP


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

4

INTRODUCTION

In cells of the hemopoietic and immune systems, extracellular ATP can induce

cytolysis of lymphocytes (1), monocytes/macrophages (2) and dendritic cells

(3). It is generally accepted that these cytolytic effects of ATP are mediated

by the P2X7 receptor which is a ligand-gated cation channel activated by

extracellular ATP and highly expressed on these cell types (4,5). The P2X7

ionic channel opened by extracellular ATP shows strong selectivity for the

divalent cations Ca2+ and Ba2+ over monovalent cations (6,7). After immediate

(< 1s) channel opening, in the presence of agonist, a second permeability

state develops which allows larger organic cations to pass, a process termed

“pore” formation (8-10) . This larger permeability state allows permeation by

the ethidium+ cation (314 Da) or Yo-Pro-12+ (375 Da) but excludes passage of

propidium2+ (414 Da) into lymphocytes (11) and monocyte-derived dendritic

cells (12). Studies of P2X7 of monocyte-macrophages as well as human

embryonic kidney (HEK)-293 cells expressing the cDNA for P2X7 have shown

this molecule forms part of a membrane complex (13) which activates the

caspase signalling cascade (2,14,15) as well as intracellular phospholipase D

(PLD) (16,17) and various proteinases such as membrane metalloproteases

which shed surface L-selectin and CD23 (18,19).

P2X receptors have an oligomeric structure in the plasma membrane based

on trimeric or larger complexes of identical subunits(20,21). Moreover the

values of Hill coefficients derived from the sigmoid ATP dose–response

curves of the P2X7(P2Z) receptor are consistent with multiple ATP binding

sites in each P2X7 trimer(8,22,23). All seven members of the P2X receptor

family have two transmembrane domains with intracellular amino and


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

5

carboxyl termini. Little is known of the conformation of the extracellular

domain containing the ATP binding site/s. An analysis of the P2X subtype

sequence homology has shown that the two transmembrane domains M1 and

M2 are separated by an extracellular sequence containing a cysteine-rich

region (residues 110-170) followed by a segment from Phe188-Val321 that

may form six antiparallel beta-pleated sheets homologous with members of

the class II aminoacyl-tRNA synthetases (24). The ATP-binding site is very

likely to lie in this beta sheet region since two positively charged residues,

Lys193 and Lys311 have been identified as being associated with the ATP

binding site (25).

Our previous studies have shown that genetic factors play a role in the

functional phenotype of the P2X7 receptor. In around 20% of the population,

a Glu-496 to Ala polymorphism (1513A→C) which is located in an ankyrin

repeat motif of the C-terminus of P2X7 receptor (26) leads to loss-of-function

in homozygous individuals and approximately 50% reduction in heterozygous

individuals (27). A second polymorphism, Ile-568 to Asn (1729T→A), lies in a

trafficking motif of the carboxyl terminus (28) and prevents normal trafficking

and surface expression of this receptor (29). In this study, we report a third

polymorphism within exon 9 of the human P2RX7 gene, which changes

arginine-307 to an uncharged glutamine at the homologous position to Arg305

in P2X1 and Arg304 in P2X2, both of which are essential for the binding of

ATP and activation of these receptors (30,31). Cells carrying the Arg-307 to

Gln polymorphism have reduced or absent P2X7 function due to the failure of

ATP binding to the extracellular domain of P2X7.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

6

EXPERIMENTAL PROCEDURES

Materials―ATP, 2’,3’-O-(4-benzoyl)benzoyl ATP (BzATP), ethidium

bromide, barium chloride, digitonin, D-glucose, bovine serum albumin (BSA),

RPMI-1640 medium, gentamicin, collagen (Type X), glycerol gelatin mounting

medium, 7-aminoactinomycin D, 6-aminocaproic acid, bistris, ε-amino-n-

caproic acid (6-aminocaproic acid), n-dodecyl β-D-maltoside(laurylmaltoside)

were purchased from Sigma. Interferon-γ was from Roche Diagnostics

(Mannheim, Germany). HEPES, fetal calf serum, normal horse serum,

LipofectamineTM2000 reagent, Opti-MEM I medium, Taq DNA polymerase and

pcDNA3 plasmid vector were from Invitrogen. Ficoll-PaqueTM PLUS and a

GFXTMPCR DNA and Gel Band Purification Kit were from Amersham

Biosciences. A Wizard Genomic DNA Purification Kit and pCI plasmid vector

were bought from Promega. A QuickChangeTM Site-Directed Mutagenesis Kit

was purchased from Stratagene. NotI, BsrGI, XhoI were from New England

Biolabs (Beverly, MA), 86RbCl (1.5 mCi/ml; specific radioactivity 3 Ci/mmol)

was purchased from Amersham International (Little Chalfont,

Buckinghamshire, UK) and Perkin Elmer Life Science (Boston, MA). di-n-

butyl phthalate and di-isooctyl phthalate (BDH Chemicals, Poole, England)

were blended 80:20 (v/v) to give a mixture of density 1.030 g/ml. Fura RedTM,

AM was from Molecular Probes. Fluorescein (FITC), phycoerythrin (PE) and

PE-Cy5-conjugated anti-CD monoclonal antibodies (mAb) and horseradish

peroxidase (HRP)-conjugated rabbit anti-sheep and anti-rabbit

immunoglobulin antibody were from Dako. PE-conjugated sheep anti-mouse

immunoglobulin antibody was from Chemicon (Temecula, CA). Cy3-

conjugated donkey anti-sheep IgG antibody and Cy2-conjugated donkey anti-


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

7

rabbit IgG antibody were from Jackson ImmunoResearch (West Grove, PA).

Murine anti-human P2X7 receptor mAb (kindly provided by Drs. Gary Buell

and Ian Chessell) (32) was purified from clone L4 and B2 hybridoma

supernatants by chromatography on Protein A Sepharose Fast Flow and

conjugated to FITC as described previously (33). Sheep anti-human P2X7

polyclonal antibody against a non-homologous extracellular epitope of the

human P2X7 receptor has been described (29). Rabbit anti-rat P2X7

polyclonal antibody cross-reacting with human P2X7 has also been described

previously (34). The Mini-complete Protease Inhibitor cocktail and

phenylmethylsulfonyl fluoride (PMSF) plus were from Roche Applied Science

(Mannheim, Germany). The SuperSignal West Pico Chemiluminescent

Substrate kit was from Pierce Endogen (Rockford, IL).

Source of Human Leukocytes―Peripheral blood was collected and

diluted with an equal volume of RPMI-1640 medium. Mononuclear cells were

separated by density gradient centrifugation over Ficoll-Hypaque and washed

once in RPMI-1640 medium and resuspended in HEPES-buffered NaCl

medium (145 mM NaCl, 5 mM KCl, 10 mM HEPES, 5 mM D-glucose and 1

mg/mL BSA, pH 7.5) containing 1 mM CaCl2 or RPMI-1640 medium

containing 10% fetal calf serum and 5 µg/mL gentamycin (complete RPMI-

1640 medium). For the generation of macrophages, the mononuclear cell

preparation in complete RPMI-1640 medium was incubated for 2 h in plastic

flasks then gently washed to remove non-adherent cells. The plastic-

adherent monocytes were differentiated into macrophages by culturing for 7

days in complete RPMI-1640 medium. Macrophages were activated by


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

8

adding 100 U/mL interferon-γ in the final 24 h of culture, before harvesting by

mechanical scraping for flow cytometric analysis.

86Rb+ Efflux Measurements―Lymphocytes (2.5 X 107/ml) were loaded

with 86RbCl (5 µCi/ml) for 2 h at 37°C in HEPES-buffered NaCl medium

containing 10 µM CaCl2. The cells were then washed three times with ice

cold, isotope-free NaCl medium. Cells were resuspended at 6 X 106/ml in

HEPES-buffered KCl medium (150 mM KCl, 10 mM HEPES, 5 mM D-glucose,

0.1% BSA, pH 7.5); 1 ml was lysed with 20 µl of Triton X-100 and used to

determine the total amount of cellular 86Rb+. 86Rb+ loaded cells (4.5 ml) were

incubated for 5 min at 37°C, before the addition of 1.0 mM ATP for 4 min.

Samples (1.0 ml) were removed at 1 min intervals, overlaid onto 0.3 ml of

phthalate oil mixture and centrifuged at 8000 g for 40 s. The upper layer (0.7

ml) from each tube was removed, as well as 0.7 ml from totals was removed

and the amount of radioactivity detected by Cerenkov counting.

Ba2+ Influx Measurements ― Mononuclear cells (4 X 106) were

incubated with Fura-Red (1 µg/mL) for 30 min at 37°C in HEPES-buffered

NaCl medium. Cells were then washed once and labeled with appropriate

FITC-conjugated anti-CD mAbs for 15 min. Cells were washed once and

resuspended in 1.0 ml HEPES-buffered KCl medium at 37°C. All samples

were stirred and temperature controlled at 37oC using a Time Zero module

(Cytek, Fremont, CA). BaCl2 (1.0 mM) was added, followed 40 s later by

addition of 1.0 mM ATP. Cells were analyzed at 2000 events/s on a

FACSCalibur flow cytometer (Becton Dickinson, San Jose, CA) and were

gated by forward and side scatter and by cell type specific antibodies. The

linear mean channel of fluorescence intensity (0-1023 channel) for each gated


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

9

subpopulation over successive 2-s intervals was analyzed by WinMDI

software (Joseph Trotter, version 2.7) and plotted against time.

Ethidium+ Influx Measurement ― Cells (2 X 106) prelabeled with FITC-

conjugated anti-CD mAb were washed once and resuspended in 1.0 ml

HEPES-buffered KCl medium at 370C. All samples were stirred and

temperature controlled at 37oC using a Time Zero module. Ethidium+ (25 µM)

was added, followed 40 s later by addition of 1.0 mM ATP. Cells were

analyzed at 1000 events/s on a FACSCalibur flow cytometer and were gated

by forward and side scatter and by cell type specific antibodies. The linear

mean channel of fluorescence intensity (0-255 channel) for each gated

subpopulation over successive 5-s intervals was analyzed by WinMDI

software and plotted against time. Due to the increased P2X7 function on

macrophages, ethidium+ uptake in these cells (Fig. 11) was acquired at a

reduced voltage setting for FL-2 (ethidium+ fluorescence) as described

previously (29).

Phospholipase D (PLD) assay ― B lymphocytes (1 x 107 cells/ml) were

cultured at 37°C, 5% CO2 overnight in supplemented RPMI-1640 containing

[3H] Oleic acid (2-5 µCi/ml). Labelled cells were resuspended in KCl medium

and pre-incubated for 5 min in the presence of the primary alcohol, 1-butanol

(30 mM) which yields a stable phophatidylalcohol end product following PLD

stimulation. The cells were then incubated in the presence of ATP (0.5 mM) or

PMA (0.1 µM) for 15 min at 37°C. Membrane lipids were extracted and the

level of phosphatidylbutanol (PBut) was determined as described (17).


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

10

DNA Extraction ― Genomic DNA was extracted from peripheral blood

using the Wizard Genomic DNA Purification Kit according to the

manufacturer’s instructions.

Polymerase Chain Reaction (PCR) and DNA Sequencing of PCR

Products― Twelve primer pairs were designed to amplify the 13 exons of

human P2RX7 gene from genomic DNA (Accession NT_009775.8) (Table I).

These oligonucleotides were designed by using Primer3 (http://www-

genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi) and synthesized by

PROLIGO (Sydney, Australia). PCR amplifications (39 cycles of

denaturation at 94oC for 45 s, annealing at 58 or 55oC for 20 or 30 s and

extension at 72oC for 15 s ) produced 12 fragments of the expected size.

PCR products were separated in 2% agarose gel and visualised by ethidium

bromide staining. Amplified PCR products were purified using the GFXTMPCR

DNA and Gel Band Purification Kit. Using the AmpliTaq FS Dye Terminator

Cycle Sequencing Kit (PerkinElmer Applied Biosystems), fluorescence-based

cycle sequencing reaction was performed to sequence the PCR products of

P2X7 directly from both ends using specific primers. Sequencing

electrophoresis was carried out on the ABI PRISM 377 DNA Sequencer and

analyzed using ABI PRISM Sequencing Analysis Software (version 3.0) at the

SUPAMAC Facility, Royal Prince Alfred Hospital (Sydney, Australia).

Site Directed Mutagenesis ― The full-length clone of human P2X7

(GenBank accession number Y09561) was used in these studies. hP2X7

cDNA was kindly provided by Dr. Gary Buell as a NotI-NotI insert in pcDNA3.

hP2X7 was removed from pcDNA3 using a NotI-NotI digest and ligated into

pCI, which is a cytomegalovirus driven mammalian expression vector.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

11

Mutated 946G→A was introduced using overlap PCR (Quick ChangeTM Site-

Directed Mutagenesis Kit) and the expression vector pCI-hP2X7 as a template.

The P2RX7 point mutation was constructed using a pair of complementary

mutagenic primers described below, consisting of the mutagenic codon

flanked by sequences homologous to the wild type strand of the template.

After digestion of the parental DNA with DpnI, intact mutation–containing

synthesized DNA was transformed into competent Blue XL cells. All mutations

were confirmed by sequencing. The base change is in bold and underlined.

G946A forward: C AAT GTT GAG AAA CAG ACT CTG ATA AAA GTC TTC

GGG;

G946A reverse: CCC GAA GAC TTT TAT CAG AGT CTG TTT CTC AAC

ATT G.

Transfection of HEK-293 Cells ― HEK-293 cells were cultured in

complete RPMI-1640 medium. The culture was negative for Mycoplasma as

monitored by PCR every 2 to 3 months of culture. Full length (30 µg) P2X7 or

mutated P2X7 cDNA in pCI vector was incubated in serum-free Opti-MEM I

medium for 5 min followed by incubation with LipofectamineTM2000 Reagent

(30 µL, diluted with Opti-MEM I medium) for 20 min at room temperature. The

solution was transfected into nearly confluent monolayer of HEK-293 cells (~5

X 106 in 9 mL complete RPMI-1640 medium without antibiotics). After 40-44

h, cells were collected by mechanical scraping in complete RPMI-1640

medium.

Immunofluorescent Staining and Flow Cytometry―Mononuclear cell

preparations (1 X 107/mL) from healthy or chronic lymphocytic leukemia (CLL)

subjects, or HEK-293 cells were incubated for 20 min at 20oC with FITC-


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

12

conjugated P2X7 mAb (clone L4) plus PE-conjugated CD3 and PE-Cy5-

conjugated CD19 mAb in HEPES-buffered saline containing 10% group AB

human serum. Cells were washed once and analyzed for P2X7 expression on

lymphocyte subpopulations gated for B-lymphocytes (CD19+) or T-

lymphocytes (CD3+) or on HEK-293 gated by forward and side scatter. Dead

cells were excluded by 7-aminoactinomycin D staining. For intracellular

staining, HEK-293 cells were fixed with 1% paraformaldehyde for 15 min at

4°C and labeled with FITC-P2X7 mAb for 15 min in the presence of 0.1%

saponin and 10% group AB human serum. Isotype control values for

lymphocytes ranged from 2±1 mean channels of fluorescence intensity and

were subtracted from the values for each type.

Immunofluorescent Staining and Confocal Microscopy ― Non-

transfected, mock transfected and transfected HEK-293 cells were harvested

and cultured on collagen-coated (50 µg/mL) glass coverslips in 48-well plates

at 2.5 x 105 cells/well for 120 min. Cells were fixed with 2%

paraformaldehyde in phosphate-buffered saline (PBS) for 15 min and washed

three times with PBS. Cells were blocked with 20% normal horse serum in

PBS for 20 min, before incubation with sheep anti-human or rabbit anti-rat

P2X7 polyclonal antibodies or pre-immune serum diluted in PBS for 120 min.

Cells were washed and incubated with Cy3-conjugated donkey anti-sheep or

Cy2-conjugated donkey anti-rabbit IgG antibody diluted in PBS for 60 min.

Washed cells were mounted on glass slides in glycerol gelatin mounting

media and visualized with a Leica TCS NT UV laser confocal microscope

system.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

13

Western Blotting ― HEK-293 cells (5 x 106) transfected with wild type

or R307Q mutant human P2RX7 cDNA were resuspended in digestion buffer

containing mini complete protease inhibitor cocktail, 1 mM PMSF, 750 mM ε-

amino-n-caproic acid and 50 mM bistris (pH 7.0). Cells were lysed with 1% n-

dodecyl β-D-maltoside at 4oC followed by centrifugation at 20,000g for 15 min.

The supernatants were collected and separated by 8~16% SDS-PAGE under

reducing conditions. Proteins were transferred to nitrocellulose membrane

and blocked overnight in TTBS buffer (20 mM Tris, 500 mM NaCl, 0.05%

Tween 20, pH 7.5) containing 5% skim milk powder. The membrane was

washed and incubated with a sheep anti-human or a rabbit anti-rat P2X7

receptor polyclonal antibody (1:1,000) in TTBS buffer for 2 hours. The

membrane was washed and incubated with HRP-conjugated rabbit anti-sheep

or swine anti-rabbit immunoglobulin antibody (1:5,000) for another 1 hour.

The HRP was then detected with SuperSignal kit.

Electrophysiology ― Oocytes from adult female Xenopus laevis were

surgically removed and prepared as outlined previously (28). Stage 5 or

6 oocytes were injected with 50 nl of cRNA-encoding wild type P2RX7 or

mutant P2RX7 R307Q receptors (~1 µg/µl) and were stored at 18oC for 2 days

prior to experimentation. For two electrode voltage clamp recordings, oocytes

were impaled with two glass electrodes containing 3 M KCl and held at a

membrane potential of -70mV with an Axoclamp 2B amplifier (Axon

Instruments, Union City, CA). Oocytes were continually perfused with a ND96

solution (NaCl 96 mM, KCl 2 mM, CaCl2 0.1 mM, HEPES 5 mM, pH 7.5) using

a pump perfusion system. 100 µM ATP dissolved in bath solution was applied

to the oocyte at 18oC until the response reached a plateau or alternatively, if


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

14

no response was observed, for ~1 min. Following ATP application, the oocyte

was again perfused with bath solution and the inward current trace was

monitored until full recovery was observed.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

15

RESULTS

A Single Nucleotide Polymorphism at Position 946 of the P2RX7

Gene ― Both loss-of-function polymorphisms identified to date in the human

P2RX7 gene result from single base substitutions in exon 13. A search was

made for other single nucleotide polymorphisms by sequencing the other 12

exons of P2RX7 gene from genomic DNA of healthy and leukemic subjects.

In two of 110 CLL patients and ten of 310 healthy subjects, a heterozygous

nucleotide substitution (946G→A) was found in exon 9 but no homozygous

substitutions were observed (Table 2). This substitution predicts a change of

arginine-307 to glutamine (R307Q) in the extracellular domain of P2X7

receptor. The overall allele frequency of this single nucleotide polymorphism

was 0.014 in the Caucasian population when healthy subjects and CLL

patients were considered as a single group (n=420). Thus this mutant allele

falls within the definition of a single nucleotide polymorphism (SNP) since its

prevalence is greater than 0.01 (1%) in the population. Of the total 12 subjects

who were heterozygous for 946G→A, three were also heterozygous for other

loss-of-function polymorphisms; one for 1513A→C and two for 1729T→A

(Table 2).

P2X7 Expression and Function in Monocytes and Lymphocytes―

Mononuclear preparations from healthy and CLL subjects with known

residues at position 307, 496 and 568 were pre-incubated with appropriate

FITC-labeled mAbs and ATP-induced uptake of ethidium into gated

lymphocyte and monocyte subpopulations was measured as previously

described (27,33). Absent or very reduced P2X7 function was found in all six

R307Q heterozygous subjects who were tested. In contrast, mononuclear


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

16

cells from subjects who were wild type at all three polymorphic positions

showed robust P2X7 function (Table 2 and Fig. 1). When the anti-human P2X7

mAb (clone L4) was used in this study as previously described (33), the

R307Q heterozygotes also showed decreased binding of this antibody (Table

2).

ATP-induced 86Rb Efflux from Lymphocytes ― The function of the

P2X7 channel/pore was measured by the ATP-induced efflux of isotopic Rb+

from lymphocytes (> 98% purity) isolated from peripheral blood of the two

subjects with CLL. In wild type lymphocytes the loss of 86Rb+ from the cells

over 4 min followed first-order kinetics with a rate constant of 0.03 ± 0.01 min-1

(range 0.01-0.05) in the absence of ATP and 0.34 ± 0.04 min-1 (range 0.24-

0.50) in the presence of ATP (Fig. 2). In subject C1 who was heterozygous

for both R307Q and I568N, ATP-induced Rb+ efflux was absent while in

subject C2, who was heterozygous for R307Q but wild type for E496A and

I568N, the rate constant was reduced to 0.26 min-1. Attempts to measure Rb+

efflux from lymphocytes of healthy subjects were complicated by a 5-10%

monocyte admixture in the preparation and a flow cytometric approach was

adopted to further study P2X7 channel fluxes.

ATP-induced Ba2+ Influx into Lymphocyte Subsets―The permeability

of the P2X7 channel/pore was also studied by two-color flow cytometry in

which the influx of Ba2+ was measured into T lymphocytes identified by

appropriate FITC-conjugated mAb. Fig. 3 shows the ATP-induced uptake of

Ba2+ into T lymphocytes loaded with Fura-Red whose fluorescence emission

measured by flow cytometry decreases on chelating this divalent cation as it

enters the cell. The rate of Ba2+ uptake into lymphocytes from subject N1 who


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

17

was heterozygous for R307Q was markedly decreased compared with a wild

type subject (Fig. 3). Absence of ATP-induced Ba2+ uptake was found in T-

lymphocytes from subject C1 who was double heterozygous for R307Q and

I568N (Fig. 3). Similar results were obtained fort T-lymphocytes, as well as

NK cells and B cells from other heterozygous subjects (data not shown).

ATP-stimulated Phospholipase D (PLD) Activity was Impaired in

Subject Double Heterozygous for R307Q/I568N Polymorphism ― A major

downstream effect of P2X7 receptor activation is stimulation of PLD activity

demonstrated both in macrophages (16) and CLL lymphocytes (17).

Lymphocytes from a CLL patient (>98% purity) were incubated with/without

ATP and the PLD activity was measured by the transphosphatidylation

reaction (17). Fig. 4 shows that lymphocytes from three CLL patients who

were wild type for R307/E496/I568 demonstrated strong ATP-stimulated PLD

activity while lymphocytes from subject C1 who was double heterozygous for

R307Q/I568N failed to show ATP-stimulated PLD activity despite the similar

level of total PLD activity stimulated by PMA.

Expression and Function of Arg-307 to Gln (R307Q) Mutated P2X7 in

HEK-293 cells ― cDNA for wild type P2RX7 or P2RX7 carrying the 946G→A

mutation was transfected into HEK-293 cells and the expression and function

of the receptor was measured. At 44 hours after transfection, an aliquot of the

cells was lysed and proteins separated by SDS-PAGE. Western blotting

using a sheep anti-human P2X7 revealed large amount P2X7 protein

migrating at the predicted 72 kD region for both wild type and R307Q mutant

P2X7 (Fig. 5). Confocal microscopy image of cells stained with the same

polyclonal antibody showed strong expression of R307Q mutated P2X7 on the


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

18

cell surface of the transfected HEK-293 cells while no surface expression was

found in I568N mutant P2X7 or in mock transfected HEK-293 cells (Fig. 6).

Similar results were found for Western blotting and confocal microscopy using

a rabbit anti-rat P2X7 polyclonal antibody (data not shown). Despite strong

P2X7 protein expression on the cell surface, the potent agonist BzATP, at

concentrations up to 1 mM, failed to induce ethidium uptake into HEK-293

cells transfected with R307Q mutant P2X7 (Fig. 7). In contrast, BzATP

induced ethidium uptake into HEK-293 cells transfected with wild type P2X7

with an EC50 of only 2~4 µM and of n value of 2.5 using Hill plot analysis (Fig.

7).

Absent Function of Arg-307 to Gln (R307Q) Mutated P2X7 in Oocytes

― cRNA for wild type P2RX7 or P2RX7 carrying the 946G→A mutation was

injected into oocytes and the channel function of the receptor was measured.

Five oocytes with wild type P2X7 and four oocytes with R307Q mutant P2X7

were tested for responses to ATP. In all oocytes with wild type P2X7

receptors, a clear increase in inward current was observed. In contrast,

oocytes injected with the R307Q mutant receptor P2X7 showed no response

to the application of ATP (Fig. 8)

Failure of L4 Monoclonal Antibody to Bind Arg-307 to Gln (R307Q)-

mutated P2X7― The study of P2X7 has been greatly assisted through the

development of an anti-P2X7 mAb (clone L4) which binds to the extracellular

domain of P2X7 and blocks receptor function (32,33). Moreover, this mAb

binds not only to cell surface P2X7 but also to the far larger intracellular pool

of this receptor when cells are permeabilized to allow access of the antibody


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

19

(33). However, at 44 h after transfection of R307Q mutated P2X7 into HEK-

293 cells, anti-human P2X7 mAb (clone L4) failed to bind either to cell surface

P2X7 or to intracellular P2X7 (Fig. 9). A different anti-P2X7 mAb (clone B2),

which also binds to the extracellular domain of P2X7 but without affecting its

function (27), was chosen to examine the surface expression level. This B2

mAb bound avidly to wild type P2X7 expressed on the surface of transfected

HEK-293 cells and binding of this mAb saturated between 1~10 µg/ml (Fig.

10). The B2 mAb also showed binding to R307Q mutant P2X7 receptor

expressed on the surface of transfected HEK-293, but the binding was of

lower affinity compared with binding to wild type P2X7. Mock transfected cells

failed to bind the B2 mAb.

Absent Macrophage P2X7 Function in Double Heterozygotes ―

Differentiation of monocytes into macrophages increases the expression and

function of P2X7 by many-fold (35). Peripheral blood monocytes were

cultured for 7 days with interferon-γ added for the final 24 h and the P2X7

function was measured by ATP-induced ethidium+ uptake into the CD14+

macrophage population. Macrophages isolated from healthy subjects who

were wild type for R307, E496 and I568 showed at least 10-fold increases of

surface expression and function of P2X7 over values for monocytes (12,27,29).

Although subjects heterozygous for R307Q showed near absent P2X7

function in monocytes, their P2X7 function was partially restored in

macrophages to values 10-40% of wild type (Fig. 11). However, macrophages

from subject N1 who was also heterozygous for R307Q failed to show any

P2X7 function, possibly because of a second unidentified genetic defect (Fig.

11). Three subjects were double heterozygous for loss-of-function


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

20

polymorphisms, two with R307Q combined with the trafficking-defective I568N

allele (subjects N2 and C1), while the third subject (N3) combined R307Q with

the E496A polymorphism. Monocytes and lymphocytes (both T- and B-cell)

from all three subjects showed total absence of P2X7 function in all 3 freshly

isolated cell types (Table 2). Macrophages grown for 7 days from one of

these double heterozygous subjects also showed a total absence of P2X7

function when assayed multiple times (subject C1 in Fig. 11).


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

21

DISCUSSION

The main finding in this study is that the single nucleotide polymorphism

altering the positively charged Arg307 to uncharged Gln in the extracellular

domain of the P2X7 receptor results in a complete loss-of-function. Positively

charged and conserved amino acid residues such as arginine and lysine in

the extracellular domain of P2X receptors usually contribute to the binding of

the negatively charged phosphate groups of ATP (25,30,31). Therefore,

substitution of these residues to less positively charged, uncharged, or

negatively charged residues effectively abolish the binding of agonists.

Arginine in the homologous position of the extracellular domain is conserved

in all members of the P2X receptor family. Evidence from the study of the

residue homologous to Arg307 in both P2X1 (Arg305) and P2X2 (Arg304)

strongly suggest that this conserved residue is critical for activation by ATP

(30,31). Mutation of Arg-305 in human P2X1 to the less positively charged

lysine reduced the ATP evoked channel peak current to one quarter that of

wild type while mutating Arg305 to the mildly hydrophobic alanine completely

abolished the ATP-evoked current (30). In the rat P2X2 receptor, Arg304

substitution to lysine or alanine reduced the ATP sensitivity by about 10-fold

and 1000-fold respectively (31). These data suggest that Arg307 forms part of

an ATP binding pocket which probably also includes Lys311, since mutation

of the latter residue to alanine also abolishes P2X7 function (25). This binding

site may also include contributions from other positive residues since mutation

of the conserved Lys309 and Arg292 in the P2X1 receptor either abolished

function or reduced the potency of ATP binding (30). However, perhaps due

to the fact that ATP binding to P2X7 is two orders of magnitude weaker than to


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

22

P2X1, modification of any of the critical residues of P2X7 causes total loss of

nucleotide binding (25). Further insight into the ATP binding site of P2X7 is

suggested by secondary structure predictions based on homology with the

known structure of class II aminoacyl-tRNA synthetases (24,36). This

indicates a conserved structure of six beta-pleated sheets between Phe188

and Val321 and further modelling reveals that Lys193 and the cluster of

charged groups including Arg307 and Lys311 are located within this sub-

domain of the extracellular loop. Whether the ATP binding site is formed at

the interface between adjacent monomers in the assembled channel/pore or

lies entirely within each monomer remains uncertain.

Two other polymorphisms, E496A and I568N, have been characterized in

healthy and leukemic human subjects and shown to cause loss-of-function of

the P2X7 receptor. Homozygosity for E496A produces the same amount of

P2X7 protein with markedly reduced pore function while the heterozygous

state gives cells with half the pore function of cells with wild type P2X7 protein

(27). Recent studies have found that the E496A polymorphism does not affect

the electrophysiological phenotype of the P2X7 channel in transfected oocytes

and HEK-293 cells (37) and we have confirmed these findings1. However, the

E496A functional defect can be overcome partially when the density of these

receptors on the cell surface is massively increased following differentiation of

monocytes to macrophages (27). A second loss-of-function polymorphism,

I568N, has been described within a trafficking motif in the C-terminus of P2X7

receptor (28) which blocks receptor function by preventing the receptor

trafficking to the cell surface (29). Large amounts of I568N mutated P2X7

protein is found in the intracellular location but none on the cell surface of


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

23

transfected HEK-293. Monocytes from subjects heterozygous for I568N have

near-to-absent P2X7 function, while macrophages from these same subjects

show partial P2X7 function presumably due to P2X7 upregulation from the

normal I568 allele. However, not all individuals with low P2X7 function can be

explained by these two polymorphisms both of which lie in exon 13.

Therefore, an extensive search of the other 12 exons of the P2RX7 gene was

conducted to find other loss-of-function polymorphisms. The mutation

reported in this study, R307Q, has not been reported in any public

polymorphism database, and is the third polymorphism found to cause loss-

of-function of the human P2X7 receptor with an allele frequency 0.014 in the

Caucasian population. Our study shows that subjects who are double

heterozygotes (compound heterozygotes) show the most profound loss of

P2X7 function. Thus subject C1, who was double heterozygous for

R307Q/I568N, failed to show any functional P2X7 in all our functional assays

of all mononuclear cell types including macrophages (Fig. 1, 2, 3, 4 & 11).

Fig. 9 shows that the R307Q mutant P2X7 receptor expressed in HEK-293

cells fails to bind the anti-human mAb (clone L4). Buell and colleagues, and

our laboratory have shown that the L4 mAb binds to an unknown extracellular

epitope and blocks ATP activation of this receptor by acting as a functional

antagonist (32,33). Western blotting showed robust synthesis of the mutant

receptor (Fig. 5) while our confocal images showed that the mutant P2X7

receptor is strongly expressed on the cell surface (Fig. 6). Moreover a second

monoclonal antibody (clone B2) to the extracellular domain of P2X7 was able

to bind to the R307Q mutant receptor, confirming expression of the mutant

receptor on the cell surface (Fig. 10). This failure of L4 mAb binding to the


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

24

R307Q mutant receptor indicates that the arginine-307 is absolutely required

for antibody binding by forming part of the recognition epitope which in turn

suggests that L4 mAb blocks P2X7 function by steric hindrance at the ATP

binding pocket. In contrast, arginine-307 is important but not essential for

binding of the B2 mAb, and this mAb does not block P2X7 function (27),

Dilatation of the P2X7 channel to form a pore under physiological conditions is

recognized as a unique feature of the P2X7 receptor. However, opening of the

ionic channel and formation of the pore are two distinct processes (28,38)

since the C-terminal truncated P2X7 receptor retains channel activity but lacks

pore formation. In this study, monocytes and macrophages from subjects who

were heterozygous R307Q showed variable reduction of ATP-induced

ethidium uptake to values of 0 to 50% of wild type (Fig 1 & 11). The ATP-

induced Ba2+ influx into lymphocytes was also greatly reduced when subsets

were identified using 2-colour flow cytometry (Fig 3). However, the

fluorometric methods used in this study are not sensitive enough to

distinguish the channel and pore function of the P2X7 receptor. Nevertheless,

our electrophysiological study (Fig. 8) clearly shows that the R307Q

polymorphism abolishes P2X7 channel function as expected by the loss of

ATP binding.

Our data is consistent with a role for the P2X7 receptor in the innate immune

response against obligate intracellular pathogens. There is evidence that

activation of the P2X7 receptor is required for fusion of lysosomes with the

phagosomes of the macrophage which contains engulfed mycobacteria or

chlamydiae. The formation of a phagolysosome results in the subsequent


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

25

killing of these pathogens by a process which is dependent on PLD

stimulation (39-42). Thus the results in Fig. 4 are significant since subject C1

who was double heterozygous for R307Q/I568N showed no ATP-stimulated

PLD activity, while the same subject (Fig. 11) showed total absence of P2X7

function in macrophages. Moreover, we have recently shown that ATP-

induced killing of intracellular mycobacteria is impaired in macrophages from

subjects with low P2X7 function due to homozygosity for the E496A

polymorphism (43). Our data raise the possibility that low or absent P2X7

receptor function due to inherited polymorphisms of this receptor may be a

genetic susceptibility factor in a range of infections as diverse as tuberculosis,

toxoplasma or chlamidia. Individuals who carry two loss-of-function

polymorphisms (compound heterozygotes) in P2X7 may have the highest

susceptibility to these infections by intracellular pathogens because of the

central role of macrophages in innate immunity. It is likely that more

polymorphisms affecting function will be found within the coding and non-

coding regions of the P2RX7 gene and their clinical associations will be the

subject of further study.

Footnotes:

1. M.Smart & S.Petrou. Unpublished observation

Acknowledgment:

We thank Dr. Gary Buell for providing B2 mAb and Dr. Diana Williams for

blood collection.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

26

References:

1. Di Virgilio, F., Bronte, V., Collavo, D., and Zanovello, P. (1989) Journal of Immunology 143, 1955-1960

2. Humphreys, B. D., Rice, J., Kertesy, S. B., and Dubyak, G. R. (2000) Journal of Biological Chemistry 275, 26792-26798

3. Coutinho-Silva, R., Persechini, P. M., Bisaggio, R. D., Perfettini, J. L., Neto, A. C., Kanellopoulos, J. M., Motta-Ly, I., Dautry-Varsat, A., and Ojcius, D. M. (1999) American Journal of Physiology 276, C1139-1147

4. Di Virgilio, F., Chiozzi, P., Ferrari, D., Falzoni, S., Sanz, J. M., Morelli, A., Torboli, M., Bolognesi, G., and Baricordi, O. R. (2001) Blood 97, 587-600

5. North, R. A. (2002) Physiological Reviews 82, 1013-1067 6. Bretschneider, F., Klapperstuck, M., Lohn, M., and Markwardt, F. (1995)

Pflugers Archiv - European Journal of Physiology 429, 691-698 7. Naumov, A. P., Kaznacheyeva, E. V., Kiselyov, K. I., Kuryshev, Y. A.,

Mamin, A. G., and Mozhayeva, G. N. (1995) Journal of Physiology 486, 323-337

8. Tatham, P. E., and Lindau, M. (1990) Journal of General Physiology 95, 459-476

9. Wiley, J. S., Gargett, C. E., Zhang, W., Snook, M. B., and Jamieson, G. A. (1998) American Journal of Physiology - Cell Physiology 44, C1224-C1231

10. Nuttle, L. C., and Dubyak, G. R. (1994) Journal of Biological Chemistry 269, 13988-13996

11. Wiley, J. S., Chen, R., and Jamieson, G. P. (1993) Archives of Biochemistry & Biophysics 305, 54-60

12. Sluyter, R., and Wiley, J. S. (2002) International Immunology 14, 1415-1421

13. Kim, M., Jiang, L. H., Wilson, H. L., North, R. A., and Surprenant, A. (2001) EMBO Journal 20, 6347-6358

14. Ferrari, D., Los, M., Bauer, M. K., Vandenabeele, P., Wesselborg, S., and Schulze-Osthoff, K. (1999) FEBS Letters 447, 71-75

15. Wen, L. T., Caldwell, C. C., and Knowles, A. F. (2003) Molecular Pharmacology 63, 706-713

16. el-Moatassim, C., and Dubyak, G. R. (1992) Journal of Biological Chemistry 267, 23664-23673

17. Gargett, C. E., Cornish, E. J., and Wiley, J. S. (1996) Biochemical Journal 313, 529-535

18. Jamieson, G. P., Snook, M. B., Thurlow, P. J., and Wiley, J. S. (1996) Journal of Cellular Physiology 166, 637-642

19. Gu, B., Bendall, L. J., and Wiley, J. S. (1998) Blood 92, 946-951 20. Nicke, A., Baumert, H. G., Rettinger, J., Eichele, A., Lambrecht, G.,

Mutschler, E., and Schmalzing, G. (1998) EMBO Journal 17, 3016-3028

21. Kim, M., Spelta, V., Sim, J., North, R. A., and Surprenant, A. (2001) Journal of Biological Chemistry 276, 23262-23267

22. Wiley, J. S., Chen, R., Wiley, M. J., and Jamieson, G. P. (1992) Archives of Biochemistry & Biophysics 292, 411-418


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

27

23. Klapperstuck, M., Buttner, C., Schmalzing, G., and Markwardt, F. (2001) Journal of Physiology 534, 25-35

24. Freist, W., Verhey, J. F., Stuhmer, W., and Gauss, D. H. (1998) FEBS Letters 434, 61-65

25. Worthington, R. A., Smart, M. L., Gu, B. J., Williams, D. A., Petrou, S., Wiley, J. S., and Barden, J. A. (2002) FEBS Letters 512, 43-46

26. Denlinger, L. C., Fisette, P. L., Sommer, J. A., Watters, J. J., Prabhu, U., Dubyak, G. R., Proctor, R. A., and Bertics, P. J. (2001) Journal of Immunology 167, 1871-1876

27. Gu, B. J., Zhang, W., Worthington, R. A., Sluyter, R., Dao-Ung, P., Petrou, S., Barden, J. A., and Wiley, J. S. (2001) Journal of Biological Chemistry 276, 11135-11142

28. Smart, M. L., Gu, B., Panchal, R. G., Wiley, J., Cromer, B., Williams, D. A., and Petrou, S. (2003) J Biol Chem 278, 8853-8860

29. Wiley, J. S., Dao-Ung, L.-P., Li, C., Shemon, A. N., Gu, B. J., Smart, M. L., Fuller, S. J., Barden, J. A., Petrou, S., and Sluyter, R. (2003) J. Biol. Chem. 278, 17108-17113

30. Ennion, S., Hagan, S., and Evans, R. J. (2000) Journal of Biological Chemistry 275, 29361-29367

31. Jiang, L. H., Rassendren, F., Surprenant, A., and North, R. A. (2000) Journal of Biological Chemistry 275, 34190-34196

32. Buell, G., Chessell, I. P., Michel, A. D., Collo, G., Salazzo, M., Herren, S., Gretener, D., Grahames, C., Kaur, R., Kosco-Vilbois, M. H., and Humphrey, P. P. (1998) Blood 92, 3521-3528

33. Gu, B. J., Zhang, W. Y., Bendall, L. J., Chessell, I. P., Buell, G. N., and Wiley, J. S. (2000) American Journal of Physiology - Cell Physiology 279, C1189-1197

34. Sluyter, R., Barden, J. A., and Wiley, J. S. (2001) Cell & Tissue Research 304, 231-236

35. Hickman, S. E., el Khoury, J., Greenberg, S., Schieren, I., and Silverstein, S. C. (1994) Blood 84, 2452-2456

36. Hansen, M. A., Barden, J. A., Balcar, V. J., Keay, K. A., and Bennett, M. R. (1997) Biochemical & Biophysical Research Communications 236, 670-675

37. Boldt, W., Klapperstuck, M., Buttner, C., Sadtler, S., Schmalzing, G., and Markwardt, F. (2003) Am J Physiol Cell Physiol 284, C749-756

38. Surprenant, A., Rassendren, F., Kawashima, E., North, R. A., and Buell, G. (1996) Science 272, 735-738

39. Molloy, A., Laochumroonvorapong, P., and Kaplan, G. (1994) Journal of Experimental Medicine 180, 1499-1509

40. Fairbairn, I. P., Stober, C. B., Kumararatne, D. S., and Lammas, D. A. (2001) Journal of Immunology 167, 3300-3307

41. Kusner, D. J., and Barton, J. A. (2001) Journal of Immunology 167, 3308-3315

42. Coutinho-Silva, R., Stahl, L., Raymond, M. N., Jungas, T., Verbeke, P., Burnstock, G., Darville, T., and Ojcius, D. M. (2003) Immunity 19, 403-412;

43. Saunders, B. M., Fernando, S. L., Sluyter, R., Britton, W. J., and Wiley, J. S. (2003) J Immunol 171, 5442-5446


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

28

Figure Legends: Fig. 1 ATP-induced ethidium uptake curve in mononuclear cell subsets

from healthy wild type and R307Q heterozygous subjects. 2 x 106 cells

pre-labeled with appropriate FITC-conjugated cell-specific mAb were

incubated in 1 ml KCl medium at 37oC. Ethidium bromide (25 µM) was added

followed 40 s later by 1 mM ATP. Mean channel of cell-associated

fluorescence intensity was measured at 5 s intervals for B-lymphocytes (gated

CD19+), T-lymphocytes (gated CD3+), NK cells (gated CD16+) and monocytes

(gated CD14+).

Fig. 2. ATP-induced Rb+ efflux from lymphocytes from either wild type

or R307Q heterozygous CLL subjects. Lymphocytes were loaded for 2 h

with 86Rb+. Cells were washed, resuspended in KCl medium and incubated

for 5 min at 37°C before incubation in the presence or absence of 1.0 mM

ATP for 4 min. Samples (1 mL) were collected at 1 min intervals. 86Rb+ efflux

is expressed as (1-Nt/No) where Nt was the level of cell-associated

radioactivity at time t and No the amount of cell-associated radioactivity at time

zero. The data have been analysed after log transformation to permit

calculation of efflux rate constants (k). Data from wild type subjects is from 5

experiments; data from mutant subjects is representative two separate

experiments.

Fig. 3. ATP-induced Ba2+ influx into T lymphocytes and NK cells from

healthy wild type subjects or R307Q heterozygotes. Mononuclear cells

were incubated with 1 µg/mL Fura-Red for 30 min and washed once. Cells


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

29

were labeled with FITC-conjugated anti-CD3 mAb and resuspended in KCl

medium at 37°C. Ba2+ (1 mM) was added followed 40 s later by 1 mM ATP.

The mean channel of cell-associated fluorescence intensity was measured at

2-s intervals for gated CD3+ T-lymphocytes.

Fig. 4. ATP-induced phospholipase D activity - B lymphocytes (1 x 107

cells/ml) from 3 CLL subjects with wild type (WT) and 1 CLL subject double

heterozygous for R307Q/I568N (C1) were labelled with [3H] Oleic acid (2-5

µCi/ml) followed and pre-incubated for 5 min in KCl medium with the

presence of the primary alcohol, 1-butanol (30 mM) which yields a stable

phophatidylalcohol end product following PLD stimulation. The cells were then

incubated with/without ATP (0.5 mM) or PMA (0.1 µM) for 15 min at 37°C.

Membrane lipids were extracted and the level of phosphatidylbutanol (PBut)

was determined.

Fig. 5. P2X7 protein synthesis in transfected HEK-293 cells. HEK-293

cells transiently transfected with wild type and R307Q mutant P2X7 were

lysed and proteins were separated by SDS-PAGE under reducing conditions,

followed by a 4-hour transfer to nitrocellulose membrane. The membrane

was blocked and probed using sheep anti-human P2X7 antibody. The

presence of a protein band (~70 KD) corresponding to the P2X7 receptor.

Untransfected HEK-293 cells were used as control. Similar results were

obtained by using the rabbit anti-rat P2X7 antibody (data not shown).


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

30

Fig. 6. Confocal microscope images of P2X7 expression in HEK-293 cells.

HEK-293 cells were transiently transfected with pCI Vector (Mock), wild-type,

R307Q or I568N mutant P2X7 cDNA as indicated. Cells were fixed and

incubated with pre-immune serum or sheep anti-human P2X7 antibody, and

subsequently with Cy3-conjugated anti-sheep IgG antibody before analysis by

confocal microscopy. Similar results were observed using the rabbit anti-rat

P2X7 antibody (data not shown). Pre-immune serum showed no binding.

Fig. 7. BzATP-induced ethidium+ uptake into transfected HEK-293 cells

Cells transiently transfected with pCI vector (Mock), wild-type or R307Q

mutated P2X7 cDNA as indicated. Cells were washed and resuspended in 1

mL of NaCl medium. Ethidium+ (25 µM) was added followed 40 s later by

BzATP. The mean channel of cell-associated fluorescence intensity was

measured at 5-s intervals for gated HEK-293 cells. The area under ethidium

uptake curve in 150 s after addition of BzATP was calculated and normalized.

Results were presented as mean ± S.D. (n=3).

Fig. 8 ATP-invoked current in oocytes. Oocytes from adult female

Xenopus laevis were injected with 50 nl of cRNA-encoding wild type P2RX7

(A) or mutant P2RX7 R307Q receptors (B) (~1 µg/µl) and were stored at 18oC

for 2 days prior to experimentation. For two electrode voltage clamp

recordings, oocytes were impaled with two glass electrodes containing 3 M

KCl and held at 18oC at a membrane potential of 70mV. 100 µM ATP

dissolved in bath solution was applied to the oocyte as indicated. One

representative experiment of four or five.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

31

Fig. 9. Flow cytometric histograms of P2X7 expression in HEK-293 cells

using clone L4 mAb. HEK-293 cells were transiently transfected with wild

type (top panels) or R307Q mutated (bottom panels) P2X7 cDNA. Non-

permeabilized cells (left panels, surface P2X7 expression), and fixed and

permeabilized cells (right panels; intracellular P2X7 expression) were labeled

with FITC-conjugated anti-P2X7 mAb (clone L4) (solid line) or isotype control

mAb (shaded line) and the level of P2X7 expression determined by flow

cytometry. One representative experiment of four.

Fig. 10 Saturation curve of clone B2 mAb. HEK-293 cells were transiently

transfected with pCI Vector (Mock), wild type or R307Q mutated P2X7 cDNA

as indicated. Cells were labeled with mouse anti-human P2X7 mAb (clone B2)

for 20 min at R.T. and washed twice before incubated with PE-conjugated

sheep anti-mouse immunoglobulin antibody. Cells were washed once and

mean channel of cell-associated fluorescence was measured by flow

cytometry. One representative experiment of two.

Fig.11. ATP-induced ethidium+ uptake in monocyte-derived

macrophages. Monocyte-derived macrophages (activated with interferon-γ)

from wild-type subject or R307Q heterozygotes (see table 2) were labeled

with FITC-conjugated anti-CD14 mAb and suspended in KCl medium at 37oC.

Ethidium+ (25 µM) was added, followed 40 s later by the addition of 1 mM

ATP (arrow). Mean channel of cell-associated fluorescence was measured by

time-resolved flow cytometry. The voltage setting for ethidium is reduced in


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

32

order to gain full scale of uptake increasing. Basal ethidium+ uptake measured

in the absence of ATP is shown.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

33

Table 1. Primers used to screen the P2RX7 gene (accession NT_009775.8)

Region Forward Primer (5’→3’)

Reverse Primer (5’→3’)

Product Size (bp)

Exon 1 tcagaatgtgcacctgaagc ccagtacgtttcattttgcag 315

Exon 2 ggctgtagatcctaggggaag agtcacacggaagcaagtca 379

Exon 3 gtccgcatttctgcttcttc cccagcaagctggattatta 230

Exon 4 tgacctgggcatcacaaat gtgtgcacattctggtggat 241

Exon 5 taggacccaggactttgcag cgggttgagttaatgatgtcc 299

Exon 6 ttcaggcttctgaggtttgg agaagcctctggtcccactg 239

Exon 7 gcctcttggctgtttgacat tggaacctctccaccacact 300

Exon 8 gttgccttggaaaccaaaat ctatgcagggagatgtctgg 300

Exon 9 gccccacagcagtaattagg gctgcagtgagtggtaatcct 279

Exon 10&11 tagaacccagcgacgtatcc ccaacaattgcacgttgaag 499

Exon 12 ggggcataaaagggactcct tgagccagcttgttcaatagtc 399

Exon 13 cagacgtgagccacggtgc gaacctagaacctgagggct 579


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

34

Table 2. P2X7 Expression and Function in Leukocytes with R307Q (946G→A) Polymorphism

Genotype

P2X7 expression (mean channels of fluorescence

intensity)

P2X7 function (arbitrary units of area under ATP-induced

ethidium+ uptake at 5 min)

946 1513 1729 B-lymphocyte T-lymphocyte B-lymphocyte T-lymphocyte Monocyte

Healthy Subjects N1 G/A A/A T/T 6.1 4.3 615 0 319 N2 G/A A/A T/A 2.1 1.5 194 219 149 N3 G/A A/C T/T 2.5 3.8 212 0 58 N4 G/A A/A T/T 1.0 1.8 465 61 913 N5 G/A A/A T/T 3.0 4.8 1075 97 844

B-CLL Subjects

C1 G/A A/A T/A 2.1 1.7 70 68 0 C2

G/A A/A T/T 3.6 5.1 521 129 0

Healthy wild type Subjects (Mean ± S.D.)

(n = 18-20)

G/G

A/A

T/T

10.0±5.0

7.1±3.5

4013±2010

2951±2311

22705±7696

Mononuclear cell preparations (1 x 107/ml) from healthy or CLL subjects were incubated for 20 min at 20oC with FITC-conjugated P2X7 mAb

(clone L4) plus PE-labeled CD3 and PE-Cy5-labeled CD19 surface marker antibody in HEPES buffered saline containing 10% group AB serum.

Cells were washed once and analyzed for P2X7 expression on subpopulations gated for B-lymphocytes (CD19+, CD3-), T-lymphocytes (CD3+,

CD19-). Isotype control values ranged from 2±1 mean channels of fluorescence intensity and were subtracted from the values for each type.

Function of P2X7 was measured by the area under the ATP-induced ethidium uptake curve on gated subpopulations gated by appropriate surface

markers. Uptake of ethidium was negligible in the absence of ATP.

by guest on February 19, 2018 http://www.jbc.org/ Downloaded from

http://www.jbc.org/

B Lymphocytes

-1 0 1 2 3 4 5

Ethi

dium

Upt

ake

(Lin

ear M

ean

Cha

nnel

/ C

ell)

0

10

20

30

40

50

60 BasalWild TypeN1C2C1

T Lymphocytes

-1 0 1 2 3 4 50

10

20

30

40

50


NK Cells

-1 0 1 2 3 4 50

20

40

60

80

BasalWild TypeN1C2

Monocytes

-1 0 1 2 3 4 50

50

100

150


Time (min)

ATP

ATPATP

ATP

Fig. 1


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Time (min)0 1 2 3 4

86R

b+ e

fflux

[Log

(1- N

t/Nto

tal)]

0.1

1

BasalWild TypeC1C2

Fig. 2


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

T Lymphocytes

Time (min)-1 0 1 2 3

Fura

-Red

Inte

nsity

(Lin

ear M

ean

Cha

nnel

/ C

ell)

0250

300

350

400

450

500

550

600

650

700

BasalWild TypeN1C1

Fig. 3

ATP


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Control ATP PMA

%PB

ut a

ccum

ulat

ion

ofto

tal l

ipid

s (m

eanS

.D.)

0.0

0.2

0.4

0.6

0.8

1.0

1.2

1.4

1.6

1.8

2.0

0.82%

1.82%

C1WT

Fig. 4


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Control R307Q WT

97kDa

66kDa

Fig. 5


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

WT WT

R307Q R307Q

I568N Mock

Fig. 6


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

BzATP Concentration (µM)

0.1 1 10 100 1000

% o

f Max

imum

Res

pons

e

-20

0

20

40

60

80

100

120

MockR307QWild Type

Fig. 7


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

20 s

10 nA

100 M ATPµ

20 nA20 s

100 M ATPµ

Wild TypeA. B. R307Q Mutant

Fig. 8


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Cel

l Cou

nt

Fig. 9

Wild Type

R307Q

IntracellularSurface

FITC-anti-hP2X7 mAb (L4) Fluorescent Intensity


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Concentration of B2 mAb

0 0.1 1 10 100 1000

Fluo

resc

ence

Inte

nsity

(Log

mea

n C

hann

el)

0

50

100

150

200

250 MockR307QWild Type

Fig. 10


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Fig. 11

Time (min)-1 0 1 2 3 4 5

Ethi

dium

Upt

ake

(Lin

ear M

ean

Cha

nnel

/ C

ell)

0

50

100

150

200BasalC1N1N5C2Wild Type

ATP


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

James S. WileyDao-Ung, Stephen J. Fuller, Julian A. Barden, Alison L. Clarke, Steven Petrou and

Ben J. Gu, Ronald Sluyter, Kristen K. Skarratt, Anne N. Shemon, Lan-PhuongLoss-of-function of the human P2X7 receptor

An Arg-307 to Gln polymorphism within the ATP-binding site causes

published online April 27, 2004J. Biol. Chem.

10.1074/jbc.M313902200Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M313902200

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;M313902200v1&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2004/04/27/jbc.M313902200.citation

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=early/2004/04/27/jbc&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2004/04/27/jbc.M313902200.citation

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/

Documents

An Arg-307 to Gln Polymorphism within the ATP-binding Site